Broad-spectrum coronavirus entry inhibitors

Abstract

Disclosed herein are broad-spectrum Coronavirus entry inhibitor compounds and methods of use thereof. Methods disclosed herein include inhibiting Coronavirus infection, treating a Coronavirus infection, and treating a subject at risk of contracting a Coronavirus infection. The compounds described herein target entry of Coronaviruses downstream of binding of the viral receptor.

Description

BROAD-SPECTRUM CORONAVIRUS ENTRY INHIBITORSCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application Serial Nos. 63 / 582,255, filed on September 13, 2023, and 63 / 575,967, filed on April 8, 2024, which are incorporated in their entirety herein by reference.SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. Said XML copy, created on August 23, 2023, is named P-611747-USP_SL.xml and is 16,847 bytes in size.FIELD OF INVENTION

[0003] Disclosed here are therapeutic compounds that inhibit Coronavirus infection mediated by the S glycoprotein of SARS-CoV-2 and MERS-CoV viruses. Methods of use inhibiting broadspectrum Coronavirus infection are described as are methods of treating a subject infected with a Coronavirus.BACKGROUND

[0004] Coronaviruses (CoVs) have garnered global attention due to their potential for causing severe diseases in humans. The most notable among these are SARS-CoV, MERS-CoV, and SARS-CoV-2, each responsible for significant disease outbreaks. As zoonotic pathogens, CoVs continue to pose a constant threat to global health due to the potential for cross-species transmission, underscoring the need for broad-spectrum antiviral inhibitors.

[0005] The viral Spike (S) glycoprotein of CoVs mediates fusion of the viral envelope with the host cell membrane, which is essential for infection and delivery of the viral genetic material into host cells. This process is conserved across all coronaviruses, positioning the S glycoprotein as a promising target for broad-spectrum antiviral strategies. The S glycoprotein is a class I viral fusogens, comprised of two subunits: SI, involved in host cell recognition and binding, and S2, which mediates membrane fusion.

[0006] As used throughout, the term "CoV" refers to coronaviruses, including current and emerging variants.

[0007] Current therapies for CoV infection largely aim to disrupt the S 1 domain-mediated host recognition. However, these strategies face significant limitations, particularly with theemergence of SARS-CoV-2 variants carrying mutations in the SI domain that enhance receptor binding and facilitate immune evasion. Additionally, the variability in the cellular receptors recognized by different CoVs presents a challenge for achieving broad inhibition with SI domain- targeted strategies. For instance, SARS-CoV and SARS-CoV-2 recognize angiotensin-converting enzyme 2 (ACE2), while MERS-CoV interacts with dipeptidyl peptidase 4 (DPP4). Further, the identification of new SARS-CoV-2 receptors, such as TMEM106B16 highlights the adaptability of Co Vs in exploring alternative receptors.

[0008] Strategies to inhibit host proteases like Transmembrane protease serine 2 (TMPRSS2) and Cathepsins, which facilitate CoV entry by cleaving the S protein and activating the fusogenic activity of the S2 domain, have also been explored. Protease inhibitors like Nafamostat and Camostat have demonstrated some efficacy against multiple CoVs. However, their inhibition spectrum remains uncertain due to the adaptability of CoVs in exploring alternative proteases, and their evolution to include a polybasic furin cleavage site, thereby limiting the strategy of targeting a single protease for broad-spectrum inhibition.

[0009] In contrast, the S2 domain presents as a promising target for managing CoV infection. Cross-reactive neutralizing antibodies (nAbs) against the S2 domain have been identified in individuals who have not contracted SARS-CoV-2, as well as patients infected with various CoVs. This compelling evidence is reinforced by the essential role of the S2 domain in the universally conserved biophysical process of membrane fusion. Additionally, in comparison to the SI domain, the S2 domain has exhibited lower mutation rates in emerging SARS-CoV-2 variants, which is further supported by phylogenetic analyses showing a higher degree of sequence conservation in the S2 domains of diverse CoV clades. These characteristics of the S2 domain suggest its potential as a broad-spectrum therapeutic target. However, targeting the S2 domain is challenging because it cannot be expressed independently of the SI domain. Hence, current FDA-approved drugs for treating COVTD-19 patients, such as Remdesivir, Molnupiravir, and Nirmatrelvir, do not specifically target the S2 domain.

[0010] High throughput screening (HTS) has been used to identify antiviral leads for various viruses. With the emergence of SARS-CoV-2, several HTS assays were swiftly developed, predominately focusing on FDA-approved drugs, to reduce the development time by re-purposing existing drugs. Despite numerous efforts, few novel and efficient antivirals were identified. Furthermore, while numerous in silico and in vitro HTS approaches targeting viral entry or viral replication have been developed, efforts specifically dedicated to the identification of broad-spectrum CoV antivirals through HTS have been sparse.SUMMARY

[0011] Disclosed herein are broad-spectrum Coronavirus entry inhibitor compounds and uses thereof. In some aspects, disclosed herein is a compound represented by the structure of Formula XII, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinA and B rings are each independently a substituted or unsubstituted single or fused aromatic or heteroaromatic ring system, substituted or unsubstituted single or fused C3-C10 cycloalkyl, or substituted or unsubstituted single or fused heterocycloalkyl;L5 and Le are each independently selected from H, linear or branched alkyl, linear or branched alkoxy, linear or branched haloalkyl; single or fused cycloalkyl, single or fused heterocyclic ring, single or fused aryl, single or fused heteroaryl -(CH2)n-cycloalkyl, -(CH2)n-heterocyclic ring, -(CH2)n-aryl, and -(CH2)n-heteroaryl; or L5 and Le join together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring; n and m are each independently an integer between 0-10; wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted; and wherein said * indicates a chiral center.

[0012] In a related aspect, a compound represented by the structure of Formula XII is represented by the structure of Formula XII-A, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinC and D rings are each independently a single or fused aryl or heteroaryl;L5 and Le are each independently selected from H, linear or branched alkyl, linear or branched alkoxy, linear or branched haloalkyl; single or fused cycloalkyl, single or fused heterocyclic ring, single or fused aryl, single or fused heteroaryl -(CH2)n-cycloalkyl, - (CH2)n-heterocyclic ring, -(CH2)n-aryl, and -(CH2)n-heteroaryl; or L5 and Le join together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring; n is an integer between 0-10; wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted; and wherein * indicates a chiral center.

[0013] In a related aspect, a compound represented by the structure of Formula XII is represented by the structure of Compound 12, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:wherein * indicates a chiral center.

[0014] In a related aspect, a compound represented by the structure of Formula XII is represented by the structure of Compound 12a or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof,related aspect, a compound represented by the structure of Formula XII is represented by the structure of Compound 12b or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof,

[0015] In a related aspect, a derivative of Compound 12 is represented by the structure ofCompound 12-X or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof,wherein * indicates a chiral center.

[0016] In a further related aspect, the isomer of Compound 12-X is represented by the structure of Compound 12-Xa, or a pharmaceutical acceptable salt thereof, or any combinationthereof.

[0017] In another further related aspect, the isomer of Compound 12-X is represented by the structure of Compound 12-Xb, or a pharmaceutical acceptable salt thereof, or any combination thereof.

[0018] In one aspect, disclosed herein is a pharmaceutical composition comprising a compound represented by the structures of any one of Formulae XII, XII-A, 12a, 12b, 12-X, 12- Xa, or 12-Xb or an isomer thereof, a derivative thereof, or a pharmaceutical salt thereof.

[0019] In some aspects, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a compound represented by the structure of Formula XII, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinA and B rings are each independently a substituted or unsubstituted single or fused aromatic or heteroaromatic ring system, substituted or unsubstituted single or fused C3-C10 cycloalkyl, or substituted or unsubstituted single or fused heterocycloalkyl;L5 and Le are each independently selected from H, linear or branched alkyl, linear or branched alkoxy, linear or branched haloalkyl; single or fused cycloalkyl, single or fused heterocyclic ring, single or fused aryl, single or fused heteroaryl -(CH2)n-cycloalkyl, - (CH2)n-heterocyclic ring, -(CH2)n-aryl, and -(CH2)n-heteroaryl; or L5 and Le join together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring; n and m are each independently an integer between 0-10; wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted; and wherein said * indicates a chiral center; wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection.

[0020] In a related aspect of a method of inhibiting or reducing a Coronavirus infection, the compound is represented by the structure of Formula XII- A, or an isomer thereof, or a derivative thereof, a pharmaceutically acceptable salt thereof, or any combination thereof:whereinC and D rings are each independently a single or fused aryl or heteroaryl;L5 and Le are each independently selected from H, linear or branched alkyl, linear or branched alkoxy, linear or branched haloalkyl; single or fused cycloalkyl, single or fused heterocyclic ring, single or fused aryl, single or fused heteroaryl -(CH2)n-cycloalkyl, - (CH2)n-heterocyclic ring, -(CH2)n-aryl, and -(CH2)n-heteroaryl; or L5 and Le join together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring; n is an integer between 0-10; wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted; wherein * indicates a chiral center; and wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection.

[0021] In a further related aspect of a method of inhibiting or reducing a Coronavirus infection, the compound is represented by the structure of Compound 12, or an isomer thereof, or a derivative thereof, a pharmaceutically acceptable salt thereof, or any combination thereof:wherein * indicates a chiral center. In yet further related aspect of a method of inhibiting or reducing a Coronavirus infection, the isomer is represented by the structure of Compound 12a or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof,yet further related aspect of a method of inhibiting or reducing a Coronavirus infection, the isomer is represented by the structure ofCompound 12b or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof,

[0022] In another related aspect, a method of inhibiting or reducing a Coronavirus infection, a derivative of Compound 12 is represented by the structure of Compound 12-X or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof,wherein * indicates a chiral center.

[0023] In yet another further related aspect, a method of inhibiting or reducing a Coronavirus infection, the isomer of Compound 12-X is represented by the structure of Compound 12-Xa, or a pharmaceutical acceptable salt thereof, or any combination thereof.

[0024] In yet another further related aspect, a method of inhibiting or reducing a Coronavirus infection, the isomer of Compound 12-X is represented by the structure of Compound 12-Xb, or a pharmaceutical acceptable salt thereof, or any combination thereof.

[0025] In one aspect, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a compound represented by any one of the structures of Compounds 1-11, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection.

[0026] In some related aspects of a method of inhibiting or reducing a Coronavirus infection, the inhibition or reduction of the Coronavirus infection comprises inhibition of a primary infection or a secondary infection. In yet another related aspect of a method of inhibiting or reducing a Coronavirus infection, a Coronavirus comprises SARS-CoV, SARS-CoV-2, or MERS-CoV.

[0027] In one aspect, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering to a subject in need, a compound represented by the structure of Formula XII, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinA and B rings are each independently a substituted or unsubstituted single or fused aromatic or heteroaromatic ring system, substituted or unsubstituted single or fused C3-C10 cycloalkyl, or substituted or unsubstituted single or fused heterocycloalkyl;Ls and Le are each independently selected from H, linear or branched alkyl, linear or branched alkoxy, linear or branched haloalkyl; single or fused cycloalkyl, single or fused heterocyclic ring, single or fused aryl, single or fused heteroaryl -(CLEjn-cycloalkyl, - (CLEjn-heterocyclic ring, -(CEbjn-aryl, and -(CLLjn-heteroaryl; or L5 and Le join together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring;n and m are each independently an integer between 0-10; wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted; and wherein said * indicates a chiral center; wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing virus entry into cells.

[0028] In a related aspect of a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said compound is represented by the structure of Formula XII-A, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinC and D rings are each independently a single or fused aryl or heteroaryl;Ls and Le are each independently selected from H, linear or branched alkyl, linear or branched alkoxy, linear or branched haloalkyl; single or fused cycloalkyl, single or fused heterocyclic ring, single or fused aryl, single or fused heteroaryl -(CH2)n-cycloalkyl, - (CH2)n-heterocyclic ring, -(CH2)n-aryl, and -(CILjn-heteroaryl; or L5 and Le join together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring; n is an integer between 0-10; wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted; and wherein * indicates a chiral center.

[0029] In yet a further related aspect of a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, the compound is represented by the structure of Compound 12, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:wherein * indicates a chiral center.

[0030] In another further related aspect of a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, an isomer is represented by the structure of Compound 12a, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof,another further related aspect of a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting aCoronavirus infection, an isomer is represented by the structure of Compound 12b, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof,

[0031] In another related aspect of a method of treating a Coronavirus infection in a subj ect or treating a subject at risk of contracting a Coronavirus infection, a derivative of Compound 12 is represented by the structure of Compound 12-X or an isomer thereof, or a pharmaceuticallyacceptable salt thereof, or any combination thereof,wherein * indicates a chiral center.

[0032] In yet another further related aspect of a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, the isomer of Compound 12-X is represented by the structure of Compound 12-Xa, or a pharmaceutical acceptable salt thereof, or any combination thereof.

[0033] In yet another further related of a method of treating a Coronavirus infection in a subj ect or treating a subject at risk of contracting a Coronavirus infection, the isomer of Compound 12-X is represented by the structure of Compound 12-Xb, or a pharmaceutical acceptable salt thereof, or any combination thereof.

[0034] In some aspects, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering to a subject in need, a compound represented by any one of the structures of Compounds 1-11, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing virus entry into cells.

[0035] In some related aspects of methods of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, the Coronavirus comprises SARS- CoV, SARS-CoV-2, or MERS-CoV. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] The subject matter regarded as the small molecule compounds and uses thereof described herein to inhibit Coronavirus entry is particularly pointed out and distinctly claimed in the concluding portion of the specification. These small molecule compounds and uses thereof, however, both as to organization and method of operation, together with objects, features, and advantages thereof, may best be understood by reference to the following detailed description when read with the accompanying drawings in which:

[0037] FIGURES 1A-1G. Production of high titer VSVAG pseudoviruses and quantification of single infection events. (FIGURE 1A) A schematic representation of theVSVAG pseudoviruses production process. Viral glycoproteins (yellow) are expressed by plasmid transfection on cell surface. Transfected cells were subsequently infected with recombinant VSV in which the endogenous G glycoprotein (VSV-G; purple) gene was replaced with a fluorescent reporter (VSVAG) and complemented with VSV-G (VSVAG-G). 1 hour postinfection, the residual VSVAG-G is thoroughly washed, and the culture is replenished with medium. This results in the production of pseudovirus particles capable of a single round of infection, baring the desired glycoproteins into the VSVAG pseudovirus on their surface. Nevertheless, all downstream experiments are performed in the presence of a neutralizing anti- VSV-G antibody (a-G). (FIGURE IB) A widefield image of cells infected with VSVAG pseudoviruses expressing a fluorescent reporter (GFP; green). Infected cells become round after infection due to the virus-induced Cytopathic Effect (CPE). (FIGURE 1C) (left) A high magnification overlay image showing the infected GFP -positive cells (green) and total nuclei (blue). (Right) The respective segmentation showing infected cells (yellow) and nuclei (cyan). (FIGURES 1D-1F) Pseudoviral titers in infectious units / ml. To remove any residual infections from VSVAG-G, the neutralizing a-G antibody was added to all pseudoviruses, ensuring accurate titer calculation. The activity of a-G was tested using VSVAG-G in the presence and absence of a-G. Two-tailed unpaired t-tests were used to evaluate the statistical significance of a-G activity (p. **<o.oi, ****<0.0001. Nexperiments=3, nrepeats=9. (FIGRUE ID) Titer of VSVAG complemented with the Wuhan variant of the SARS-CoV-2 Spike (VSVAG-Sw; SEQ ID NO: 1) in different cell types showing infection improves upon over-expression of the innate receptor, ACE2 and host protease, TMPRSS2. (FIGURE IE) Titer of VSVAG-Sw in HEK-293T-ACE2- TMPRSS2 cells showing the effect of modifications to the cytosolic tail of Sw. (FIGURE IF) Titer of VSVAG-G, VSVAG-Sw, VSVAG-Sa (Alpha - SEQ ID NO: 2), VSVAG-Ss(Delta-SEQ ID NO: 3), VSVAG-So (Omicron-SEQ ID NO: 4), and VSVAG- SM (MERS-COV Spike-SEQ ID NO: 5) showing similar infection levels with and without DPP4. VSVAG-G Pseudoviruses infected all cell lines at similar levels (FIGURES ID and IF). (FIGURE 1G) Pseudoviral infectious units / ml of VSVAGRFP-G and VSVAGGFP-SW separately or simultaneously result in equivalent infection titer measurements. Error bars represent the SEM. (Right) An overlay image showing VSVAGRFP-G and VSVAGGFP-SW infected cells (White and green, respectively). As used throughout this application, VSVAG-Sw and VSVAG-SW, VSVAG-Saand VSVAG-Sa, VSVAG-Ss and VSVAG-S6, VSVAG-S0and VSVAG-So, and VSVAG-SM and VSVAG-SM are interchangeable pairs, with each pair having identical meanings and qualities.

[0038] FIGURES 2A-2B. Optimization of pseudovirus titer. (FIGURE 2 A) Infectious units / ml of VSVAG-Sw pseudoviruses present in the harvested supernatant at different times, indicating optimal titers at 30 hours post-infection with the helper virus. (FIGURE 2B) Infectious units / ml of samples subjected to centrifugation, indicating a two-fold increase in viral titer with centrifugation. Experiments were performed in the presence of an a-G neutralizing antibody to exclude any residual infection from VSVAG-G that was left over from the production. The statistical significance of conditions was also determined. P: ****<0.0001 (two-tailed unpaired t-tests).

[0039] FIGURES 3A-3C. The pseudovirus-based High Throughput Screen (HTS) platform demonstrates high reproducibility. (FIGURE 3A) Schematic of the high content screening pipeline: plating, imaging, and analysis. Compounds were pre-plated. Then, pseudoviruses, pre-incubated with a-G to neutralize any residual VSVAG-G infection, were added in individual wells. This was followed by introducing HEK-293T cells stably overexpressing SARS-CoV-2 receptor ACE2 and protease TMPRSS2. After 24 hours, the nuclei were stained, and the plates were imaged. Images were subsequently segmented and quantified. (FIGURE 3B) Overview image of a portion of a 384-well screening plate (orange box in FIGURE 3A) The neutral control (yellow wells) indicates 100% infection, and the positive control (magenta wells) signifies 0% infection or 100% inhibition. The green well depicts an example of a compound with -90% inhibition. (FIGURE 3C) Scatter plot showing % inhibition of 2489 compounds tested as single point, on two different days. Blue line shows the linear correlation for all 2489 compounds (R2=0.60). Black line represents the linear correlation for the compounds that showed >35% inhibition, which were reproducible with a high fit (R2=0.85). (FIGURE 3C Lower portion) Examples of two inhibitors showing similar inhibition values after normalization and despite having different total cell and infection counts.

[0040] FIGURE 4. Overview of a 384-well plate from the screen. Column 1, plated with pseudovirus and cells, serves as the neutral control and indicates 100% infection. Column 2, plated with only cells, acts as the positive control, signifying 0% infection or 100% inhibition. Columns 3-22 are spotted with compounds. All wells containing pseudovirus in Columns 1 and 3-22 are pre-incubated with the a-G neutralizing antibody to remove any residual VSVAG-G infection. To ascertain that the a-G antibody was active, VSVAG-G pseudovirus were plated in the presence and absence of a-G in Column 23 and 24 respectively. All columns contain 0.01% DMSO.

[0041] FIGURES 5A-5C. A three-tiered screen identifies putative entry inhibitors of CoVs. (FIGURE 5A) Schematic showing primary screening of -200,000 compounds against Wuhan SARS-CoV-2 Spike (VSVAG-Sw) yielded 733 putative Spike-specific and non-specific inhibitors. Sw specific inhibitors were identified by a secondary screen against VSV-G (VSVAG- G), yielding 65 putative inhibitors. The tertiary screen with MERS-CoV Spike (VSVAG-SM) and initial validation resulted in 5 compounds that were putatively broad-spectrum inhibitors. (FIGURES 5B) Plots showing HTS parameters to determine the robustness of the screen: Z prime (Z1) factor, signal-to-background, percentage of coefficient of variance for positive and negative for the primary screen. Red line denotes the cut off for a robust plate. Five plates that failed to meet the cut-off for Z prime were manually checked for data quality. (FIGURE 5C) The chemical structures of the four novel compounds and Nafamostat that were commercially resourced. (FIGURE 5D) Plot of the inhibition of the resourced compounds against the three viruses. All the compounds selectively inhibit SARS-CoV-2 and MERS-CoV Spikes without inhibiting VSV-G. Error bars represent the range. Values represent mean inhibitions ± standard deviations.

[0042] FIGURE 6. Table 2 presents a listing of the 733 compounds identified that were capable of inhibiting VSVAG-Sw infection. Each compound is presented with its IUPAC name, the percent inhibition (VSVAG-Sw), and the % cell viability. Note that molecule names were generated for this study and do not relate to specific compounds outside of this study.

[0043] FIGURE 7. Table 3 presents a listing of the 65 Spike-specific inhibitors identified that inhibited VSVAG-Sw infection. Each compound is presented with its IUPAC name, % Inhibition (VSVAG-Sw), SD (% Inhibition of VSVAG-Sw), % Inhibition (VSVAG-G), SD (% Inhibition of VSVAG-G), % Cell viability, and SD (% Cell counts). Note that molecule names were generated for this study and do not relate to specific libraries or compounds outside of this study.

[0044] FIGURE 8. Table 4 presents a listing of 22 putative S2-domain specific inhibitors that reduced VSV G-SM infection. Each compound is presented based on Structure and SMILE information. As well, the results showing % Inhibition (VSVAG-SM), SD (% Inhibition of VSVAG-SM), % Inhibition (VSVAG-G), SD (% Inhibition of VSVAG-G), % Inhibition (VSVAG-Sw), SD (% Inhibition of VSVAG-Sw), % Cell viability, and SD (% Cell counts) is included. Molecular Names were generated for this work and do not relate to specific compounds outside of this study. Compounds 1-11 are novel putative inhibitors for which no previousfunction had been defined. Compounds 13-23 present compounds previously reported in the literature for various functions.

[0045] FIGURE 9. Dose-response activity and cytotoxicity of compounds before HPLC. (Left) Dose-response plot of the hits against VSVAG-Sw, VSVAG-SM, or VSVAG-G and their cytotoxicity profile. (Right) Dose-response plots of hits against pseudoviruses with glycoproteins of SARS-CoV-2 variants (VSVAG-Sa, VSVAG-Sa, VSVAG-S0). Dose-response curves were fitted with a variable slope (four-parameter logistic model). Error bars represent the SEM. None statistically significant differences between VSVAG-SM and VSVAG-G data points are indicated (ns). For all other readings, the P<0.05 (two-tailed unpaired t-tests). PCM-0068389 represents Compound 1; PCM-0179622 represents Compound 5; PCM-0166392 represents Compound 6; PCM-0163855 represents Compound 11.

[0046] FIGURE 10. Dose-response activity and cytotoxicity of HPLC-purified compounds. (Left) Dose-response plot of the purified candidates against VSVAG-Sw, VSVAG- SM or VSVAG-G and their cytotoxicity profile. (Right) Dose-response plots of hits against pseudoviruses with glycoproteins of SARS-CoV-2 variants (VSVAG-Sa, VSVAG-Sa, VSVAG- So). Dose-response curves were fitted with a variable slope (four-parameter logistic model). Error bars represent the SEM. None statistically significant differences between VSVAG-SM and VSVAG-G data points are indicated (ns). For all other readings, the P<0.05 (two-tailed unpaired t-tests). PCM-0068389 represents Compound 1; PCM-0179622 represents Compound 5; PCM- 0166392 represents Compound 6; PCM-0163855 represents Compound 11.

[0047] FIGURES 11A and 11B. Validation ofPCM-0163855 against bona fide SARS-CoV- 2. Cytotoxicity profile of PCM-0163855 and dose-response plots comparing the inhibitory activity of PCM-0163855, and known inhibitors Nafamostat and Remdesivir on SARS-CoV-2 delta variant on viral replication in Vero E6 cells with (FIGURE 11A) and without (FIGURE 11B) TMPRSS2 over-expression. PCM-0163855 represents Compound 11.

[0048] FIGURE 12. General reaction scheme for synthesis of PCM-0163855 (Compound 11) and PCM-0282478 (Compound 12).

[0049] FIGURES 13A and 13B Validation of PCM-0163855 (Compound 11; resynthesized) and its sulfoxide derivative PCM-0282478 (Compound 12; Racemic mixture). (FIGURE 13A) (from left to right) Structures of PCM-0163855 and its sulfoxide derivative PCM-0282478, the corresponding dose-response plots comparing the inhibitory activity against VSVAG-Sa, VSVAG-S0, VSVAG-SM or VSVAG-G, showing that PCM-0282478 exhibits a broader selectivity for inhibition compared to PCM-0163855, and the corresponding cytotoxicity profiles and dose-response plots comparing the inhibitory activity against bona fide SARS-CoV-2 variants, Delta.Bl.617.2, XBB.1.5, or CH.1.1, viral replication in Vero E6 cells. (FIGURE 13B) (Left) Dose-response plots of the two enantiomers of PCM- 0282478 (Enantiomer 1 - Compound 12a; Enantiomer 2 - Compound 12b) comparing the inhibitory activity against VSVAG-Sa, VSVAG-S0, VSVAG-SM, or VSVAG-G, showing that only one enantiomer exhibits a broader selectivity for inhibition in pseudovirus based assay. (Right) The corresponding cytotoxicity profiles and dose-response plots comparing the inhibitory activity against bona fide SARS-CoV-2 variants. The active enantiomer, PCM-0296174 was also tested against Delta.Bl.617.2 in presence of the multi drug resistance protein 1 (MDR1) inhibitor, CP 100356. (FIGURES 13A-13B) Error bars represent the SEM. The statistical significance of the inhibitions was also determined. P: *<0.05, **<0.01, ***<0.001 ****<0.0001 (multiple unpaired t-tests comparing group means, accounting for individual variance in each concentration and pseudovirus) Nexperiments <2, n repeats <6.

[0050] FIGURES 14A and 14B. Activity of controls against bona fide SARS-CoV-2 variants. Cytotoxicity profile and dose-response plots comparing the inhibitory activity of Nafamostat (FIGURE 14A) and Remdesivir (FIGURE 14B) against bona fide SARS-CoV-2 variants, Delta.Bl.617.2, XBB.1.5 and CH.1.1, on viral replication in Vero E6 cells.

[0051] FIGURES 15A-15C. Plaque assay showing PCM-0296174 reduces infection of SARS-CoV-2 virus. (FIGURE 15A) Plaque assay performed in Vero E6 cells in presence of PCM-0296174 (active enantiomer; Compound 12a) or PCM-0296173 (Compound 12b). (FIGURE 15B) The active enantiomer results in 100 fold reduction in viral load. (FIGURE 15C) RTqPCR done in parallel on the same samples reproduce the results shown in FIGURE 13B

[0052] FIGURE 16. PCM-0296174 does not inhibit SARS-CoV-2 Spike binding to ACE2. The effect of PCM-0296174 (active enantiomer; Compound 12a), PCM-0296173 (inactive enantiomer; Compound 12b), Nafamostat (negative control), and soluble Spike (positive control) on SARS-CoV-2 Spike binding to ACE2 receptor was assessed. All the compounds did not inhibit the Spike-ACE2 interaction at the tested concentrations, while the positive control exhibited a dose-dependent inhibitory effect on the binding with IC50 of 0.03 pM.

[0053] FIGURES 17A and 17B. Structure-activity relationship (SAR) of PCM-0282478derivatives. (FIGURE 17A) Structure of PCM-0282478 and dose-response plots comparing the inhibitory activity against VSVAG-Ss, VSVAG-S0, VSVAG-SM, or VSVAG-G. (FIGURE 17B) Structure of PCM-0297098 (Compound 12-X) and dose-response plots. The IC50 values presented in FIGURE 18 show that PCM-0297098, shows higher inhibitory activity against VSVAG-Sa, VSVAG-So, VSVAG-SM, and selectivity as compared to PCM-0282478.Figure 18. Table 5. Racemic PCM-0297098 is more potent than the enantiomerically pure compound PCM-0296174 (Compound 12a). Table summarizing the IUPAC names and IC50 values of racemic derivatives of PCM-0282478 that were synthesized and tested against VS VAG- S5, VSVAG-So, VSVAG-SM, or VSVAG-G. The IC50 values indicate that PCM-0297098 is the most potent derivative, and is more selective against CoVs than PCM-0282478.DETAILED DESCRIPTION

[0054] In the following detailed description, numerous specific details are set forth in order to provide a thorough understanding of the compounds and uses thereof described herein to inhibit Coronavirus entry. However, it will be understood by those skilled in the art that the small molecule compounds and uses thereof may be practiced without these specific details. In other instances, well-known methods, procedures, and components have not been described in detail so as not to obscure the presentation of the small molecule compounds and uses thereof.

[0055] Disclosed herein are screening methods used to identify broad-spectrum Coronavirus entry inhibitors. As well, disclosed herein are the compounds identified, derivatives and isomers thereof, methods of using these compounds to inhibit Coronavirus infection, and methods of using these compounds to treat a Coronavirus infection or to treat a subject at risk of contracting a Coronavirus infection.

[0056] The compounds described herein target entry of these Coronavirus downstream of receptor binding. In some embodiments, the compounds described herein may target entry of Coronaviruses at the level of the S2 domain of the spike protein, which plays a role in the cell membrane fusion process and entry of the virus into a cell, but the findings described herein are not bound to these compounds targeting the S2 domain. Targeting S2 may be advantageous because it is independent of any specific receptor recognized by individual Coronaviruses.

[0057] In some embodiments, a compound disclosed herein as a broad-spectrum inhibitor of Coronaviruses, inhibiting entry of the virus into the host cell. In some embodiments, a compound disclosed herein is a broad-spectrum inhibitor of Coronaviruses, inhibiting entry into a target cellof Coronaviruses including SARS-CoV, SARS-CoV-2, and MERS-CoV. In some embodiments, a compound disclosed herein is a broad-spectrum inhibitor of Coronaviruses, inhibiting entry of variants of SARS-CoV, SARS-CoV-2, and MERS-CoV Coronaviruses into a target cell. In some embodiments, a compound disclosed herein is a broad-spectrum inhibitor of Coronaviruses, inhibiting entry of SARS-CoV-2 variants. In some embodiments, a broad-spectrum inhibitor of Coronaviruses is an isomer or a derivative, or a pharmaceutically acceptable salt, or any combination thereof of a compound disclosed herein.

[0058] In some embodiments, methods of inhibiting or reducing a Coronavirus infection described herein reduces a SARS-CoV, SARS-CoV-2, or MERS-CoV infection. In some embodiments, methods of inhibiting or reducing a Coronavirus infection described herein reduces the infection of a SARS-CoV-2 variant. In some embodiments, in the methods of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus described herein, the Coronavirus comprises a SARS-CoV, SARS-CoV-2, or MERS-CoV virus. In some embodiments, the subject has COVID-19 due to an infection by a SARS-CoV-2 variant or is at risk of developing CO VID-19. Subjects at risk of developing CO VID-19 include but are not limited to human adults over the age of 50 and or a subject suffering from a serious health problem.

[0059] In some embodiments, the Coronavirus comprises a SARS-CoV-2 variant. As documented by the World Health Organization (WHO), SARS-CoV-2 variants include variants of concern, variants of interest, and variants under monitoring. In some embodiments of the methods disclosed herein, SARS-CoV-2 variants comprise variants of concern, variants of interests, or variants under monitoring, or any combination thereof. SARS-CoV-2 variants include but are not limited to the Wuhan variant, the alpha variant, the delta variant, and the omicron variant. In some embodiments, SARS-CoV-2 variants comprise emerging variants.

[0060] As used throughout, the term "CoV" refers to coronaviruses, including current and emerging variants.Compounds

[0061] In some embodiments, a compound described herein is a broad-spectrum Coronavirus entry inhibitor. As used herein the terms “compound” and “broad-spectrum Coronavirus entry inhibitor compound” and the like may be used interchangeably having all the same qualities and meanings.

[0062] In certain embodiments, the compounds disclosed herein encompass inhibitors ofCoronavirus entry into a cell. In certain embodiments, the compounds disclosed herein encompass inhibitors of Coronavirus infection. In certain embodiments, the compounds disclosed herein encompass inhibitors of Coronavirus entry into a cell and Coronavirus infection. In some embodiments, use of the compounds disclosed herein, inhibits viral replication. In some embodiments, the Coronavirus infection comprises a primary infection or a secondary infection.

[0063] A skilled artisan would appreciate that the term “broad-spectrum Coronavirus entry inhibitor” encompasses a “broad-spectrum’ antiviral agent” that inhibits entry of a broad spectrum of Coronavirus into cells. In some embodiments, broad-spectrum Coronavirus entry inhibitors have efficacy against known highly pathogenic human coronaviruses SARS-CoV, SARS-CoV-2, and MERS-CoV. In some embodiments, the broad-spectrum Coronavirus entry inhibitors disclosed herein, have efficacy against additional novel Coronaviruses that may emerge in the future.

[0064] In some embodiments, the broad-spectrum Coronavirus entry inhibitors have efficacy against Coronavirus variants including SARS-CoV-2 variants. In some embodiments, the SARS- CoV-2 variant is a variant of concern. In some embodiments, the variant is a variant of interest. In some embodiments, the variant is a variant under investigation. In some embodiments, SARS- CoV-2 variants comprise an alpha (a), beta (P), gamma (y), delta (6), or omicron (o) variant. In some embodiments, the broad-spectrum Coronavirus entry inhibitors disclosed herein have efficacy against additional novel SARS-CoV-2 variants that may emerge in the future.

[0065] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula XII, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinA and B rings are each independently a substituted or unsubstituted single or fused aromatic or heteroaromatic ring system, substituted or unsubstituted single or fused C3-C10 cycloalkyl, or substituted or unsubstituted single or fused heterocycloalkyl;L5 and Le are each independently selected from H, linear or branched alkyl, linear or branched alkoxy, linear or branched haloalkyl; single or fused cycloalkyl, single or fused heterocyclic ring, single or fused aryl, single or fused heteroaryl, -(CH2)n-cycloalkyl, -(CH2)n- heterocyclic ring, -(CH2)n-aryl, and -(CH2)n-heteroaryl; or L5 and Le j oin together to form a 5 or 6 membered sub stituted or unsub stituted, aliphatic or aromatic, carbocyclic or heterocyclic ring; and n and m are each independently an integer between 0-10; wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted; and wherein said * indicates a chiral center.

[0066] In some embodiments, a broad-spectrum Coronavirus entry inhibitor compound is represented by the structure of Formula XII- A, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinC and D rings are each independently a single or fused aryl or heteroaryl;L5 and Le are each independently selected from H, linear or branched alkyl, linear or branched alkoxy, linear or branched haloalkyl, single or fused cycloalkyl, single or fused heterocyclic ring, single or fused aryl, single or fused heteroaryl, -(CH2)n-cycloalkyl, -(CH2)n- heterocyclic ring, -(CH2)n-aryl, and -(CH2)n-heteroaryl; or L5 and Le j oin together to form a 5 or 6 membered sub stituted or unsub stituted, aliphatic or aromatic, carbocyclic or heterocyclic ring; n is an integer between 0-10; wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, heteroaryl are each independently substituted or unsubstituted; and wherein * indicates a chiral center.

[0067] In some embodiments, a broad-spectrum Coronavirus entry inhibitor compound isrepresented by the structure of Formula XII-B, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:wherein Qio, Qu, Q12, Q13 are each independently H, halo, alkyl, alkylene, haloalkyl, CN, NO2, O(C=O)R, R-O-R, -(C=O)R, -(C=O)OR, -(C=O)NHR, amine, aryl, heteroaryl, cycloalkyl, heterocycloalkyl, SO3R;L5 and Le are each independently selected from H, linear or branched alkyl, linear or branched alkoxy, linear or branched haloalkyl, single or fused cycloalkyl, single or fused heterocyclic ring, single or fused aryl, single or fused heteroaryl, -(CH2)n-cycloalkyl, - (CH2)n-heterocyclic ring, -(CH2)n-aryl, and -(CH2)n-heteroaryl; orL5 and Le join together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring p is an integer between 1-4; q is an integer between 1 -4; and wherein * indicates a chiral center.

[0068] In some embodiments, a broad-spectrum Coronavirus entry inhibitor compound is represented by the structure of Compound 12, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:wherein * indicates a chiral center.

[0069] In some embodiments, a broad-spectrum Coronavirus entry inhibitor compound disclosed herein includes a stereogenic sulfur center, wherein the chiral sulfoxide is indicated byAs discussed throughout, a compound including a chiral sulfoxide, for example, but not limited to Compound 12, may have an (S) or (R) configuration, wherein each enantiomer comprises exactly the same connectivity but opposite three-dimensional shapes. Derivatives of a compound of Formula XII and / or XII-A, and / or XII-B, and of Compound 12 that maintain the chiral center similarly may have an (S) or (R) configuration, wherein each enantiomer comprises exactly the same connectivity but opposite three-dimensional shapes.

[0070] In some embodiments, a broad-spectrum Coronavirus entry inhibitor compound is represented by the structure of Compound 12a, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:

[0071] Compound 12a represents the (R) configuration enantiomer of Compound 12 (PCM- 0296174).

[0072] In some embodiments, a broad-spectrum Coronavirus entry inhibitor compound is represented by the structure of Compound 12b, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:

[0073] Compound 12b represents the (S) configuration enantiomer of Compound 12 (PCM- 0296173).

[0074] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula I, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereofwhereinRi and R2 are each independently H, linear or branched alkyl, C3 to C8 cycloalkyl, heterocyclic ring, aryl, or heteroaryl; or Ri and R2 are joined together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring;R3-R5 are each independently H, halo, -CN, -NO2, -(C=O)R, -(C=O)X, -(C=O)OR, - SO3R, CF3, -(C=O)NRR', or linear or branched alkyl;X is halo;R6-R9 are each independently H, linear or branched alkyl, alkoxy, C3 to C8 cycloalkyl, heterocyclic ring, aryl, or heteroaryl, or Re and R7 are joined together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring, or Rs and R9 are joined together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring;R and R' are each independently selected from H, linear or branched alkyl, C3 to C8cycloalkyl, heterocyclic ring, aryl, and heteroaryl; and wherein the alkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted.

[0075] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula I- A, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinRi and R2 are each independently H, linear or branched alkyl, C3 to C8 cycloalkyl, heterocyclic ring, aryl, or heteroaryl; or Ri and R2 are joined together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring;R3-R5 are each independently H, halo, -CN, -NO2, -(C=O)R, -(C=O)X, -(C=O)OR, - SO3R, CF3, -(C=O)NRR', or linear or branched alkyl;X is halo;R and R' are each independently selected from H, linear or branched alkyl C3 to C8 cycloalkyl, heterocyclic ring, aryl, and heteroaryl; and wherein the alkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted.

[0076] In some embodiments, a broad-spectrum Coronavirus entry inhibitor compound is represented by the structure of Compound 1, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:

[0077] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula n, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinQi and Q2 are each independently CRR', O, NR, or S;R6-R9 are each independently H, linear or branched alkyl, alkoxy, C3 to C8 cycloalkyl, heterocyclic ring, aryl, or heteroaryl; or Re and R7 are joined together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring; or Rs and R9 are joined together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring;W is a bond, alkylene, alkenylene, alkynylene, cycloalkyl, heterocyclic, aryl, heteroaryl, or an ether group;R and R' are each independently selected from H, linear or branched alkyl C3 to C8 cycloalkyl, heterocyclic ring, aryl, and heteroaryl; and wherein the alkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted.

[0078] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula II-A, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinQi and Q2 are each independently CRR', O, NR, or S;R6-R9 are each independently H, linear or branched alkyl, alkoxy, C3 to C8 cycloalkyl, heterocyclic ring, aryl, or heteroaryl; or Re and R7 are joined together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring, or Rs and R9 are joined together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring;R and R' are each independently selected from H, linear or branched alkyl C3 to C8 cycloalkyl, heterocyclic ring, aryl, and heteroaryl; and wherein the alkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted.

[0079] In some embodiments, a broad-spectrum Coronavirus entry inhibitor compound is represented by the structure of Compound 2, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:

[0080] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula HI, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinLi, L2 and L3 are each independently H, linear or branched alkyl, alkoxy, C3 to C8 cycloalkyl, heterocyclic ring, aryl, heteroaryl, -(CH2)n-cycloalkyl, -(CtCjn-heterocyclic ring, - (CH2)n-aryl, or -(ClCjn-heteroaryl; or L2 and L3 are joined together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring; n is an integer between 0-10;Ai and A2 are each independently absent or O; and wherein the alkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted.

[0081] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula III-A, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinX1-X10 are each independently selected from H, halo, -CN, -NO2, -(C=O)R, -(C=O)X, - (C=O)OR, -SO3R, CF3, -(C=O)NRR', and linear or branched alkyl;Ai and A2 are each independently absent or O;R and R' are each independently selected from H, linear or branched alkyl C3 to C8 cycloalkyl, heterocyclic ring, aryl, and heteroaryl; and wherein the alkyl, cycloalkyl, heterocyclic ring, aryl, heteroaryl are each independently substituted or unsubstituted.

[0082] In some embodiments, a broad-spectrum Coronavirus entry inhibitor compound is represented by the structure of Compound 3, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:

[0083] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula IV, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinA is substituted or unsubstituted single or fused aromatic or heteroaromatic ring system, substituted or unsubstituted single or fused C3-C10 cycloalkyl, or substituted or unsubstituted single or fused heterocycloalkyl;Xu, X13, and X14 are each independently CR or N;R10-R12 are each independently selected from H, halo, -CN, -NO2, -(C=O)R, -(C=O)OR, -(C=O)X, -SO3R, CF3, -(C=O)NRR', -OH, -OR, -O(C=O)R, -NR(C=O)R, -NRR, linear or branched alkyl, linear or branched alkoxy, and linear or branched haloalkyl; n and m are each independently an integer of 0-10;X is halo;R and R' are each independently selected from H, linear or branched alkyl C3 to C8 cycloalkyl, heterocyclic ring, aryl, and heteroaryl; and wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, heteroaryl are each independently substituted or unsubstituted.

[0084] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula IV-A, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinXn is CR orN,X12 is CRR, O, S, or NR,Rio is H, halo, -CN, -NO2, -(C=O)R, -(C=O)OR, -(C=O)X, -SO3R, CF3, -(C=O)NRR, -OH, O(C=O)R, -NR(C=O)R', NRR', substituted or unsubstituted, linear or branched alkyl, substituted or unsubstituted, linear or branched alkoxy, or substituted or unsubstituted, linear or branched haloalkyl;W is a bond, alkylene, alkenylene, alkynylene, cycloalkyl, heterocyclic, aryl, heteroaryl, or an ether group; n and m are each independently an integer between 0-10;X is halo;R, R', and R" are each independently selected from H, linear or branched alkyl C3 to C8 cycloalkyl, heterocyclic ring, aryl, and heteroaryl; and wherein the alkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted.

[0085] In some embodiments, a broad-spectrum Coronavirus entry inhibitor compound is represented by the structure of Compound 4, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(4).

[0086] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula V, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinA and B rings are each independently substituted or unsubstituted single or fused aromatic or heteroaromatic ring system, substituted or unsubstituted single or fused C3-C10 cycloalkyl, orsubstituted or unsubstituted single or fused heterocycloalkyl;R3 is H, halo, -CN, -NO2, -(C=O)R, -(C=O)X, -(C=O)OR, -SO3R, CF3, -(C=O)NRR', or linear or branched alkyl;Rio and Rn are each independently selected from H, halo, -CN, -NO2, -(C=O)R, - (C=O)OR, -(C=O)X, -SO3R, CF3, -(C=O)NRR', -OH, O(C=O)R, -NR(C=O)R, NRR', linear or branched alkyl, substituted or unsubstituted, linear or branched alkoxy, and linear or branched haloalkyl;1 is an integer of 0-4; k is an integer of 0-5;R, R', and R" are each independently selected from H, linear or branched alkyl C3 to C8 cycloalkyl, heterocyclic ring, aryl, and heteroaryl; and wherein the alkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted.

[0087] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula V-A, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinR3 is H, halo, -CN, -NO2, -(C=O)R, -(C=O)X, -(C=O)OR, -SO3R, CF3, -(C=O)NRR', or linear or branched alkyl;Rio and Rn are each independently selected from H, halo, -CN, -NO2, -(C=O)R, - (C=O)OR, -(C=O)X, -SO3R, CF3, -(C=O)NRR', -OH, O(C=O)R, -NR(C=O)R, NRR', linear or branched alkyl, linear or branched alkoxy, or linear or branched haloalkyl;1 is an integer of 0-4; k is an integer of 0-5;R, R', and R" are each independently selected from H, linear or branched alkyl C3 to C8 cycloalkyl, heterocyclic ring, aryl, and heteroaryl; and wherein the alkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are eachindependently substituted or unsubstituted.

[0088] In some embodiments, a broad-spectrum Coronavirus entry inhibitor compound is represented by the structure of Compound 5, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:

[0089] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula VI, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:wherein— is a single or double bond,Xu, X13, and X14 are each independently selected from CR and N;X15 and Xi6 are each independently selected from CR, CRR, N, NR, O, and S;R14 and R15 are each independently selected from H, halo, -CN, -NO2, -(C=O)R, - (C=O)OR, -(C=O)X, -SO3R, CF3, -(C=O)NRR, -OH, O(C=O)R, -NR(C=O)R, NRR, linear or branched alkyl, linear or branched alkoxy, and linear or branched haloalkyl; or R14 and R15 are joined together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring; m is an integer between 0-10;R and R' are each independently selected from H, linear or branched alkyl C3 to C8 cycloalkyl, heterocyclic ring, aryl, and heteroaryl; and wherein the alkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted.

[0090] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula VI-A, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinXn is CR orN,R14 and Ris are each independently selected from H, halo, -CN, -NO2, -(C=O)R, - (C=O)OR, -(C=O)X, -SO3R, CF3, -(C=O)NRR', -OH, O(C=O)R, -NR(C=O)R, NRR', substituted or unsubstituted, linear or branched alkyl, substituted or unsubstituted, linear or branched alkoxy, and substituted or unsubstituted, linear or branched haloalkyl; or R14 and Ris are j oined together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring;R and R' are each independently selected from H, linear or branched alkyl C3 to C8 cycloalkyl, heterocyclic ring, aryl, and heteroaryl; and wherein the alkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted.

[0091] In some embodiments, a broad-spectrum Coronavirus entry inhibitor compound is represented by the structure of Compound 6, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:

[0092] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula VII, or an isomer thereof, or aderivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinRe and R7 are each independently H, substituted or unsubstituted, linear or branched alkyl, or substituted or unsubstituted alkoxy; or Re and R7 are joined together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring;R3 is independently H, halo, -CN, -NO2, -(C=O)R, -(C=O)X, -(C=O)OR, -SO3R, CF3, - (C=O)NRR', or substituted or unsubstituted, linear or branched alkyl; k is an integer between 0-3; n is an integer between 0-10;R, R', R", Rie, and R17 are each independently selected from H, linear or branched alkyl C3 to C8 cycloalkyl, heterocyclic ring, aryl, and heteroaryl; and wherein the alkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted.

[0093] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula VII-A, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinR3 is independently H, halo, -CN, -NO2, -(C=O)R, -(C=O)X, -(C=O)OR, -SO3R, CF3, - (C=O)NRR', or substituted or unsubstituted, linear or branched alkyl;Ri6 and R17 are each independently selected from H and substituted or unsubstituted, linear or branched alkyl; k is an integer between 0-3;R, R', and R" are each independently selected from H, linear or branched alkyl C3 to C8 cycloalkyl, heterocyclic ring, aryl, and heteroaryl; and wherein the alkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted.

[0094] In some embodiments, a broad-spectrum Coronavirus entry inhibitor compound is represented by the structure of Compound 7, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:

[0095] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula VIII, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinA ring is a substituted or unsubstituted single or fused aromatic or heteroaromatic ring system, a substituted or unsubstituted single or fused C3-C10 cycloalkyl, or a substituted orunsubstituted single or fused heterocycloalkyl;X12 is CR, O, S, or NRR20 and R21 are each independently H, substituted or unsubstituted, linear or branched alkyl, substituted or unsubstituted C3-C8 carbocyclic ring, -alkyl-C3-C8 carbocyclic ring, substituted or unsubstituted heterocyclic ring, or alkyl-substituted or unsubstituted heterocyclic ring; or R20 and R21 form together a substituted or unsubstituted 5-6 membered ring;R is H, linear or branched alkyl, C3 to C8 cycloalkyl, heterocyclic ring, aryl, or heteroaryl; and wherein the alkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted.

[0096] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula VIII-A, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinXu, X13, and X14 are each independently selected from CR and N;Ris is H, -(C=0)Ri9, -(C=0)0Ri9, -(C=O)NR20R2I, NO2, CN, SO3R, -CF3, substituted or unsubstituted haloalkyl, substituted or unsubstituted C3-C8 carbocyclic ring, or substituted or unsubstituted heterocyclic ring;R19, R20, and R21 are each independently H, substituted or unsubstituted, linear or branched alkyl, substituted or unsubstituted C3-C8 carbocyclic ring, -alkyl-C3-C8 carbocyclic ring, substituted or unsubstituted heterocyclic ring, or alkyl-substituted or unsubstituted heterocyclic ring, or R20 and R21 form together a substituted or unsubstituted 5-6 membered ring; R is H, linear or branched alkyl, C3 to C8 cycloalkyl, heterocyclic ring, aryl, or heteroaryl; andwherein the alkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted.

[0097] In some embodiments, a broad-spectrum Coronavirus entry inhibitor compound is represented by the structure of Compound 8, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:

[0098] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula IX, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinA ring is a substituted or unsubstituted single or fused aromatic or heteroaromatic ring system, a substituted or unsubstituted single or fused C3-C10 cycloalkyl, or a substituted or unsubstituted single or fused heterocycloalkyl;Rio is H, halo, -CN, -NO2, -(C=O)R, -(C=O)OR, -(C=O)X, -SO3R, CF3, -(C=O)NRR', - OH, O(C=O)R, -NR(C=O)R, NRR1, linear or branched alkyl, linear or branched alkoxy, linear or branched haloalkyl, substituted or unsubstituted cycloalkyl, or substituted or unsubstituted heterocyclic ring;R and R' are each independently selected from H, linear or branched alkyl C3 to C8 cycloalkyl, heterocyclic ring, aryl, and heteroaryl; and wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted.

[0099] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula IX-A, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinXn is CR, O, S, or NR;R and R' are each independently selected from H, linear or branched alkyl C3 to C8 cycloalkyl, heterocyclic ring, aryl, and heteroaryl; and wherein the alkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted.[000100] In some embodiments, a broad-spectrum Coronavirus entry inhibitor compound is represented by the structure of Compound 9, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:[000101] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula X, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinA ring is a substituted or unsubstituted single or fused aromatic or heteroaromatic ring system, a substituted or unsubstituted single or fused C3-C10 cycloalkyl, or a substituted or unsubstituted single or fused heterocycloalkyl;Rj is H, halo, -CN, -NO2, -(C=O)R, -(C=O)X, -(C=O)OR, -SO3R, CF3, -(C=O)NRR’, or substituted or unsubstituted, linear or branched alkyl;Rio and Ru each independently selected from H, halo, -CN, -NO2, -(C=O)R, -(C=O)OR,-(C=O)X, -SO3R, CF3, -(C=O)NRR’, -OH, O(C=O)R, -NR(C=O)R, NRR’, linear or branched alkyl, linear or branched alkoxy, and linear or branched haloalkyl;R and R’ are each independently selected from H, linear or branched alkyl C3 to C8 cycloalkyl, heterocyclic ring, aryl, and heteroaryl; and wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted.[000102] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula X-A, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinR3 is H, halo, -CN, -N02, -(C=O)R, -(C=O)X, -(C=O)OR, -SO3R, CF3, -(C=O)NRR', or linear or branched alkyl;Rio and Rn each independently selected from H, halo, -CN, -NO2, -(C=O)R, -(C=O)OR, -(C=O)X, -SO3R, CF3, -(C=O)NRR', -OH, O(C=O)R, -NR(C=O)R, NRR, substituted or unsubstituted, linear or branched alkyl, substituted or unsubstituted, linear or branched alkoxy, and substituted or unsubstituted, linear or branched haloalkyl;R and R' are each independently selected from H, linear or branched alkyl C3 to C8 cycloalkyl, heterocyclic ring, aryl, and heteroaryl; and wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted.[000103] In some embodiments, a broad-spectrum Coronavirus entry inhibitor compound is represented by the structure of Compound 10, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(io).[000104] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula XI, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinAi and Az are O;A and B rings are each independently a substituted or unsubstituted single or fused aromatic or heteroaromatic ring system, substituted or unsubstituted single or fused C3-C10 cycloalkyl, or substituted or unsubstituted single or fused heterocycloalkyl;Ris is H, -(C=O)Ri9, -(C=O)ORi9, -(C=O)NR20R2I, NO2, CN, SO3R, -CF3, substituted or unsubstituted haloalkyl, substituted or unsubstituted C3-C8 carbocyclic ring, or substituted or unsubstituted heterocyclic ring;R19, R20, and R21 are each independently H, linear or branched alkyl, C3-C8 carbocyclic ring, -alkyl ene-C3-C8 carbocyclic ring, heterocyclic ring, -alkylene-heterocyclic ring, aryl, - alkyl ene-aryl, heteroaryl, or alkylene-heteroaryl; or R20 and R21 form together a substituted or unsubstituted 5-6 membered ring; n is an integer of 0-10;Ris selected from H, linear or branched alkyl C3 to C8 cycloalkyl, heterocyclic ring, aryl, and heteroaryl; and wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted.[000105] In some embodiments, a compound described herein as a broad-spectrum Coronavirus entry inhibitor is represented by the structure of Formula XI-A, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinAi and A2 are O;Rio, R11, and R12 each independently selected from H, halo, -CN, -NO2, -(C=O)R, - (C=O)OR, -(C=O)X, -SO3R, CF3, -(C=O)NRR', -OH, O(C=O)R, -NR(C=O)R, NRR', substituted or unsubstituted, linear or branched alkyl, substituted or unsubstituted, linear or branched alkoxy, and substituted or unsubstituted, linear or branched haloalkyl;R19 is H, substituted or unsubstituted aromatic ring, or substituted or unsubstituted heteroaromatic ring; andR and R' are each independently selected from H, linear or branched alkyl C3 to C8 cycloalkyl, heterocyclic ring, aryl, and heteroaryl; and wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted.[000106] In some embodiments, a broad-spectrum Coronavirus entry inhibitor compound is represented by the structure of Compound 11, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:[000107] In some embodiments, the term “alkyl” is meant to refer to a saturated hydrocarbon group which is straight-chained or branched. Example alkyl groups include methyl (Me), ethyl (Et), propyl (e.g., n-propyl and isopropyl), butyl (e.g., n-butyl, isobutyl, t-butyl), pentyl (e.g., n- pentyl, isopentyl, neopentyl), and the like. An alkyl group can contain from 1 to about 20, from 2 to about 20, from 1 to about 10, from 1 to about 8, from 1 to about 6, from 1 to about 4, or from 1 to about 3 carbon atoms.[000108] In some embodiments, the term “cycloalkyl” or “carbocyclic ring” refers to nonaromatic carbocycles including cyclized alkyl, alkenyl, and alkynyl groups. Cycloalkyl groups or carbocyclic rings can include mono- or polycyclic (e.g., having 2, 3 or 4 fused rings) ring systems, including spirocycles. In some embodiments, cycloalkyl groups or carbocyclic rings can have from 3 to about 20 carbon atoms, 3 to about 14 carbon atoms, 3 to about 10 carbon atoms, or 3 to 7 carbon atoms. Cycloalkyl groups or carbocyclic rings can further have 0, 1, 2, or 3 double bonds and / or 0, 1, or 2 triple bonds. Also included in the definition of cycloalkyl or carbocyclic rings are moieties that have one or more aromatic rings fused (i.e., having a bond in common with) to the cycloalkyl ring, for example, benzo derivatives of cyclopentane, cyclopentene, cyclohexane, and the like. A cycloalkyl group or a carbocyclic ring having one or more fused aromatic rings can be attached through the aromatic or non-aromatic portion. One or more ring-forming carbon atoms of a cycloalkyl group or a carbocyclic ring can be oxidized, for example, having an oxo or sulfido substituent. Example cycloalkyl groups or carbocyclic rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclopentenyl, cyclohexenyl, cyclohexadienyl, cycloheptatrienyl, norbomyl, norpinyl, norcamyl, adamantyl, and the like.[000109] In some embodiments, the term “heterocycloalkyl” or “heterocyclic ring” refers to a non-aromatic heterocycle where one or more of the ring-forming atoms are a heteroatom such as an O, N, or S atom. Heterocycloalkyl groups or “heterocyclic rings” can include mono- or polycyclic (e.g., having 2, 3 or 4 fused rings) ring systems as well as spirocycles. Example heterocycloalkyl groups include morpholino, thiomorpholino, piperazinyl, tetrahydrofuranyl, tetrahydrothienyl, 2,3 -dihydrobenzofuryl, 1,3 -benzodi oxole, benzo- 1,4-di oxane, piperidinyl, pyrrolidinyl, isoxazolidinyl, isothiazolidinyl, pyrazolidinyl, oxazolidinyl, thiazolidinyl, imidazolidinyl, and the like. Also included in the definition of heterocycloalkyl and heterocyclic rings are moieties that have one or more aromatic rings fused (i.e., having a bond in common with) to the nonaromatic heterocyclic ring, for example phthalimidyl, naphthalimidyl, and benzo derivatives of heterocycles. A heterocycloalkyl group or heterocyclic ring having one or more fused aromatic rings can be attached though either the aromatic or non-aromatic portion. Also included in the definition of heterocycloalkyl are moieties where one or more ring -forming atoms are substituted by 1 or 2 oxo or sulfido groups. In some embodiments, the heterocycloalkyl group or heterocyclic ring has from 1 to about 20 carbon atoms, and in further embodiments from about 3 to about 20 carbon atoms. In some embodiments, the heterocycloalkyl group or heterocyclic ring contains 3 to about 20, 3 to about 14, 3 to about 7, or 5 to 6 ring-forming atoms. In someembodiments, the heterocycloalkyl group or heterocyclic ring has 1 to about 4, 1 to about 3, or 1 to 2 heteroatoms. In some embodiments, the heterocycloalkyl group or heterocyclic ring contains 0 to 3 double bonds. In some embodiments, the heterocycloalkyl group or heterocyclic ring contains 0 to 2 triple bonds.[000110] In some embodiments, the term “aryl” refers to monocyclic or polycyclic (e.g., having 2, 3 or 4 fused rings) aromatic hydrocarbons such as, for example, phenyl, naphthyl, anthracenyl, phenanthrenyl, and the like. In some embodiments, an aryl group has from 6 to about 20 carbon atoms. In some embodiments, “aryl” may be optionally substituted at any one or more positions. [000111] In some embodiments, the term “heteroaryl” refers to an aromatic heterocycle having at least one heteroatom ring member such as sulfur, oxygen, or nitrogen. Heteroaryl groups include monocyclic and polycyclic (e.g., having 2, 3 or 4 fused rings) systems. Any ring-forming N atom in a heteroaryl group can also be oxidized to form an N-oxo moiety. Examples of heteroaryl groups include without limitation, pyridyl, N-oxopyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl, furyl, quinolyl, isoquinolyl, thienyl, imidazolyl, thiazolyl, indolyl, pyrryl, oxazolyl, benzofuryl, benzothienyl, benzthiazolyl, isoxazolyl, pyrazolyl, triazolyl, tetrazolyl, indazolyl, 1,2,4-thiadiazolyl, isothiazolyl, benzothienyl, purinyl, carbazolyl, benzimidazolyl, indolinyl, and the like. In some embodiments, the heteroaryl group has from 1 to about 20 carbon atoms, and in further embodiments from about 3 to about 20 carbon atoms. In some embodiments, the heteroaryl group contains 3 to about 14, 3 to about 7, or 5 to 6 ring-forming atoms. In some embodiments, the heteroaryl group has 1 to about 4, 1 to about 3, or 1 to 2 heteroatoms. In some embodiments, “heteroaryl” may be optionally substituted at any one or more positions capable of bearing a hydrogen atom.[000112] In some embodiments, the term “alkylene” refers to a straight or branched saturated divalent chain of carbon atoms, which may be optionally branched. It is understood that in embodiments that include alkylene, illustrative variations of those embodiments include, but are not limited to, C1-C12 alkylene, Ci-Cs alkylene, Ci-Ce alkylene, C1-C4 alkylene, C1-C3 alkylene, C1-C2 alkylene, Ci alkylene. Representative alkylene groups include, but are not limited to, methylene, ethylene, propylene, n-butylene, ethenylene, propenylene, n-butenylene, propynylene, n-butynylene, and the like.[000113] In some embodiments, the term “alkenylene” refers to a straight or branched divalent aliphatic hydrocarbon group, in certain embodiments having from 2 to about 20 carbon atoms and at least one double bond, e.g., having 2 to 6 carbons, 3 to 4 carbon atoms.[000114] In some embodiments, the term “alkynylene” refers to a straight or branched divalent aliphatic hydrocarbon group, in one embodiment having from 2 to about 20 carbon atoms and at least one triple bond, e.g., having 2 to 6 carbons, or 3 to 4 carbons, or 2 to 12 carbons.[000115] In some embodiments, the term “alkoxy” refers to an -O-alkyl group. Example alkoxy groups include methoxy, ethoxy, propoxy (e.g., n-propoxy and isopropoxy), t-butoxy, and the like.[000116] In some embodiments, the term “halo” or “halogen” includes fluoro, chloro, bromo, and iodo. A “halogen-substitution” or “halo” substitution designates replacement of one or more hydrogen atoms with F, CI, Br, or I.[000117] In some embodiments, the term “haloalkyl” refers to an alkyl group having one or more halogen substituents. Example haloalkyl groups include CF3, C2F5, CHF2, CCI3, CHCh, C2CI5, and the like.[000118] It is understood that each of alkyl, alkylene, alkenylene, alkynylene, cycloalkyl, heterocycloalkyl or heterocyclic ring, aryl, heteroaryl, and alkoxy may be optionally substituted with independently selected groups such as alkyl, haloalkyl, hydroxyalkyl, aminoalkyl, carboxylic acid and derivatives thereof, including esters, amides, and nitrites, hydroxy, alkoxy, acyloxy, amino, alky and dialkylamino, acylamino, thio, and the like, and combinations thereof.[000119] In each of the foregoing and each of the following embodiments, it is to be understood that the formulas also include any and all hydrates and / or solvates of the compound formulas. It is appreciated that certain functional groups, such as the hydroxy, amino, and like groups form complexes and / or coordination compounds with water and / or various solvents, in the various physical forms of the compounds. Accordingly, the above formulas are to be understood to include and represent those various hydrates and / or solvates.[000120] A skilled artisan would appreciate that compounds described herein include isomers, or derivatives, or pharmaceutically acceptable salts, or any combination thereof of the compounds described herein. In some embodiments, a compound may be a derivative and a pharmaceutically acceptable salt of a compound disclosed herein. In some embodiments, a compound may be a isomer and a pharmaceutically acceptable salt. In some embodiments, a compound may be an isomer and a derivative of a compound disclosed herein. In some embodiments, a compound disclosed herein comprises an isomer, a derivative, and a pharmaceutically acceptable salt of any of the formulae and compounds disclosed herein.[000121] In some embodiments, a compound may be a pharmaceutically acceptable salt of anyof the compounds of Formulas I-XII. In some embodiments, a compound may be a pharmaceutically acceptable salt of any of the compounds of Formulas I-A through XII-A and XII-B. In some embodiments, a compound may be a pharmaceutically acceptable salt, of any of the Compounds 1-12. In some embodiments, a compound may be a pharmaceutically acceptable salt, of any of the Compounds 12-A-12-Y. In some embodiments, a compound may be a pharmaceutically acceptable salt of Compound 12a or Compound 12b. In some embodiments, a compound may be a pharmaceutically acceptable salt of Compound 12-Xa or Compound 12- Xb[000122] A skilled artisan would appreciate the compounds of Formulas I-XII includes the compounds of Formulas I-A through XII-A and XII-B, respectively.[000123] In some embodiments, a compound may be an isomer of any of the compounds of Formulas I-XII. In some embodiments, a compound may be an isomer of any of the compounds of Formulas I-A through XII-A and XII-B. In some embodiments, a compound may be an isomer of any of the Compounds 1-12. In some embodiments, a compound may concurrently be an isomer of any of the Compounds 12-A through 12- Y.[000124] In some embodiments, a compound may be a derivative of any of the compounds of Formulas I-XII. In some embodiments, a compound may be a derivative of any of the compounds of Formulas I-A through XII-A and XII-B. In some embodiments, a compound may be a derivative of any of the Compounds 1-12. In some embodiments, a compound may be a derivative of the Compounds 12-A through 12- Y. In some embodiments, a compound may be a derivative of Compound 12a or Compound 12b.[000125] In some embodiments, compounds described herein include isomers, derivatives, or pharmaceutically acceptable salts, or any combination thereof of the compounds of Formula I- XII and Formula 1-A through XII-A and XII-B, and Compounds 1-12 and Compounds 12A through 12Y. In some embodiments, a compound may be a derivative and a pharmaceutically acceptable salt of thereof of the compounds of Formula I-XII and Formula 1-A through XII-A and XH-B, and of Compounds 1-12 and Compounds 12A through 12Y. In some embodiments, a compound may be an isomer and a pharmaceutically acceptable salt of the compounds of Formula I-XII and Formula 1-A through XII-A and XH-B, and Compounds 1-12 and Compounds 12A-12Y.[000126] In some embodiments, a compound may concurrently be an isomer, a derivative, and a pharmaceutically acceptable salt of any of the compounds of Formulas I-XII. In someembodiments, a compound may concurrently be an isomer, a derivative, and a pharmaceutically acceptable salt of any of the compounds of Formulas I-A through XII-A and XII-B. In some embodiments, a compound may concurrently be an isomer, a derivative, and a pharmaceutically acceptable salt, of any of the Compounds 1-12. In some embodiments, a compound may concurrently be an isomer and a pharmaceutically acceptable salt, of any of the Compounds 12- A through 12- Y. In some embodiments, a compound may concurrently be a derivative or a pharmaceutically acceptable salt or a combination thereof, of Compound 12a or Compound 12b. In some embodiments, a compound may concurrently be an isomer or a pharmaceutically acceptable salt or a combination thereof, or Compound 12-Xa or Compound 12-Xb.Isomers[000127] In some embodiments, disclosed herein are isomers of the broad-spectrum Coronavirus entry inhibitor compounds described herein. In certain embodiments, the term “isomer” includes, but is not limited to, stereoisomers including optical isomers and analogs, structural isomers and analogs, conformational isomers and analogs, and the like. In one embodiment, the isomer is a stereoisomer. In another embodiment, the isomer is an optical isomer.[000128] In certain embodiments, a compound disclosed herein may contain at least one chiral center.[000129] Certain compounds may exist in particular geometric or stereoisomeric forms. In certain embodiments, compounds disclosed herein comprise cis- and trans-isomers, R- and S- enanti omers, diastereomers, the racemic mixtures thereof, and other mixtures thereof. Additional asymmetric carbon atoms may be present in a substituent such as an alkyl group. All such isomers, as well as mixtures thereof, are included herein. In some embodiments, a compound disclosed herein comprises a racemic mixture of enantiomers. In some embodiments, a compound disclosed herein comprises an A'-enantiomer. In some embodiments, a compound disclosed herein comprises an A’-enantiomer. In some embodiments, a compound disclosed herein comprises a substantially pure 5-enantiomer. In some embodiments, a compound disclosed herein comprises a substantially pure A’-enantiomer.[000130] In some embodiments, a compound disclosed herein, for example but not limited to Compound 12 or any of Compounds 12A-12Y, comprises a racemic mixture of enantiomers.[000131] In some embodiments, a compound disclosed herein, for example but not limited to Compound 12 or any of Compounds 12A-12Y comprises an 5-enantiomer. In some embodiments, a compound disclosed herein for example but not limited to Compound 12 or anyof Compounds 12A-12Y, comprises an / / -enantiomer. In some embodiments, a compound disclosed herein for example but not limited to Compound 12 or any of Compounds 12A-12Y, comprises a substantially pure 5-enantiomer. In some embodiments, a compound disclosed herein for example but not limited to Compound 12 or any of Compounds 12A-12Y, comprises a substantially pure / / -enantiomer.[000132] In some embodiments, Compound 12a comprises a substantially pure / / -enantiomer. In some embodiments, Compound 12b comprises a substantially pure 5-enantiomer.[000133] In some embodiments, a derivative of Compound 12 comprises an enantiomer. In some embodiments, a derivative of Compound 12 comprises an 5-enantiomer. In some embodiments, a derivative of Compound 12 comprises an / / -enantiomer.[000134] Accordingly, the compounds disclosed herein and used in the methods described below may exist in, and be isolated in, optically active or racemic forms. The compounds may further exist as stereoisomers which may be also optically active isomers (e.g., enantiomers such as (R) or (S)), as enantiomerically enriched mixtures, racemic mixtures, or as single diastereomers, diastereomeric mixtures, or any other stereoisomers, including but not limited to:(R)(R), (R)(S), (S)(S), (S)(R), (R)(R)(R), (R)(R)(S), (R)(S)(R), (S)(R)(R), (R)(S)(S), (S)(R)(S),(S)(S)(R) or (S)(S)(S) stereoisomers. Some compounds may also exhibit polymorphism. It is to be understood that compounds described herein may encompass any racemic, optically active, polymorphic, or stereoisomeric form, or mixtures thereof, which form possesses properties useful in the treatment of the various diseases described herein. It is also to be understood that chirality and / or optical activity can affect biological activity of the compounds.[000135] It is well known in the art how to prepare optically active forms (for example, by resolution of the racemic form by recrystallization techniques, by synthesis from optically active starting materials, by chiral synthesis, or by chromatographic separation using a chiral stationary phase).[000136] In certain embodiments, the compounds disclosed herein can also be present in the form of a racemic mixture, containing substantially equivalent amounts of stereoisomers. In some embodiments, the compounds of can be prepared or otherwise isolated, using known procedures, to obtain a stereoisomer substantially free of its corresponding stereoisomer (i.e., substantially pure). By substantially pure, it is intended that a stereoisomer is at least about 95% pure, more preferably at least about 98% pure, most preferably at least about 99% pure.[000137] The chiral center of compounds disclosed herein, for example but not limited tocompounds of Formula XII, Formula XII-A, Formula XII-B, Compound 12, and Compounds 12A-12Y, or derivatives or pharmaceutical salts thereof, or any combination thereof, is indicated by a wherein the compound may exist as an (R) or (S) enantiomer or a mixture thereof.Derivatives[000138] As used herein, the term “derivatives of’ refers to additional or removal of any functional group to or from the corresponding compound Formula. Non-limiting examples are ketone, amine, amide, alcohol, ester, ather, alkane, alkene, alkyne, alkyl halide, thiol, aldehyde, or any combination thereof.[000139] Non-limiting examples of derivatives of Compound 12 are presented below.[000140] As discussed throughout, a compound including a chiral sulfoxide, for example, but not limited to the derivatives of Compound 12, (Compounds 12-A-12-Y) may have an (S) or (R) configuration, wherein each enantiomer comprises exactly the same connectivity but opposite three-dimensional shapes.[000141] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-A, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(12-A).[000142] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-B, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(12-B)[000143] In some embodiments, a derivative of Compound 12 is represented by the structureof Compound 12-C, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(12-C).[000144] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-D, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(12-D).[000145] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-E, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(12-E).[000146] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-F, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:[000147] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-G, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(12-G).[000148] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-H, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(12-H). [000149] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-1, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(12-1).[000150] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-J, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:[000151] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-K, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(12-K). [000152] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-L, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:[000153] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-M, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:[000154] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-N, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:[000155] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-0, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(12-0)[000156] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-P, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(12-P). [000157] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-Q, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(12-Q).[000158] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-R, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(12-R).[000159] In some embodiments, a derivative of Compound 12 is represented by the structureof Compound 12-S, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:[000160] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12- T, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:[000161] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-U, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(12-U).[000162] In some embodiments, a derivative of Compound 12 is represented by the structureof Compound 12- V, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(12-V).[000163] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-W, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(12-W).[000164] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12-X, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(12-X).[000165] Compound 12-X, may have an (S) or (R) configuration, wherein each enantiomer comprises exactly the same connectivity but opposite three-dimensional shapes.[000166] In some embodiments, a broad-spectrum Coronavirus entry inhibitor compound is represented by the structure of Compound 12-Xa, or a pharmaceutically acceptable salt thereof, or any combination thereofc (12-Xa; (7?)-2-((l-(4-chlorophenyl)-4- phenyl-lH-imidazol-2-yl)sulfinyl)-N-(3-methoxy-2-methylphenyl)acetamide).[000167] Compound 12-Xa represents the (R) configuration enantiomer of Compound 12-X (PCM-0297098). [000168] In some embodiments, a broad-spectrum Coronavirus entry inhibitor compound is represented by the structure of Compound 12-Xb, or a pharmaceutically acceptable salt thereof, or any combination thereofC!(12-Xb; (S)-2-((l-(4-chlorophenyl)-4-phenyl- lH-imidazol-2-yl)sulfinyl)-N-(3-methoxy-2-methylphenyl)acetamide).[000169] Compound 12-Xb represents the (S) configuration enantiomer of Compound 12-X (PCM-0297098). [000170] In some embodiments, a derivative of Compound 12 is represented by the structure of Compound 12- Y, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof[000171] In some embodiments, a derivative of Compound 12 is represented by the structure of any of Compounds 12-A through 12-Y, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In some embodiments, a derivative of Compound 12 is represented by an isomer of the structure of any of Compounds 12-A through 12-Y. In some embodiments, a derivative of Compound 12 is represented by a pharmaceutically acceptable salt of the structure of any of Compounds 12-A through 12-Y. In some embodiments, a derivativeof Compound 12 is represented by an isomer and pharmaceutically acceptable salt of the structure of any of Compounds 12-A through 12- Y.Pharmaceutical Salts[000172] The term “pharmaceutical salt” as used herein refers to “pharmaceutically acceptable salts” of drug substances according to IUPAC conventions. Pharmaceutical salt is an inactive ingredient in a salt form combined with a drug. The term "pharmaceutically acceptable salt" as used herein, refers to salts of the compounds disclosed herein, for example but not limited to any of compounds of Formulas I-XII, of Formulas I-A through XII-A and XII-B, of Compounds 1-12, of Compounds 12a and 12b, of Compounds 12-A through 12- Y, and of Compounds 12- Xa and 12-Xb, or any other salt form encompassed by the isomers and or derivatives of these formulas, which are substantially non-toxic to living organisms. Typical pharmaceutically acceptable salts include those salts prepared by reaction of the compounds disclosed herein with a pharmaceutically acceptable mineral, base, acid or salt as described herein. Acid salts are also known as acid addition salts. In some embodiments, the pharmaceutically acceptable salts include any pharmaceutically acceptable organic or inorganic acid or base.[000173] Pharmaceutical salts such as are known in the art (Stahl and Wermuth, 2011, Handbook of pharmaceutical salts, second edition), the contents of which are hereby incorporated by reference in their entirety, are exemplified herein below in some non-limiting embodiments.[000174] In one embodiment, the pharmaceutically acceptable organic or inorganic acid or residue of an acid. In another embodiment, the pharmaceutically acceptable organic or inorganic acid or residue of an acid selected from the group consisting of hydrochloric acid, methanesulfonic acid, phosphoric acid, citric acid, lactic acid, succinic acid, tartaric acid, boric acid, benzoic acid, 2-(4-hydroxybenzoyl)-benzoic, toluenesulfonic acid, benzenesulfonic acid, ascorbic acid, sulfuric acid, maleic acid, formic acid, malonic acid, nicotinic acid, oxalic acid, camphorsulfonic acid, cyclamic acid, 2,2-dichloro-acetic acid, di(t-butyl)-naphthalenesulfonic acid, di(t-butyl)-naphthalenedisulfonic acid, dodecylsulfuric acid, ethane-l,2-disulfonic acid, ethanesulfonic acid, fumaric acid, galactaric (mucic) acid, gentisic acid, glucaric acid, gluconic acid, glycerophosphoric acid, hydrobromic acid, hydroiodic acid, 2-hydroxy-ethanesulfonic (isethionic) acid, 1 -hydroxy -2 -naphtoic acid, medronic (bisphosphonic) acid, methaphosphoric acid, methylboronic acid, naphthalene-l,5-disulfonic acid, naphthalene-2-sulfonic acid, nitric acid, orotic acid, 2-oxo-glutaric (ketoglutaric) acid, pamoic (embonic) acid, pyruvic acid, saccharinic acid, salicylic acid, 4-amino-salicylic acid, and thiocyanic acid.[000175] Other embodiments of pharmaceutical acid salt forms can be created from acidsincluding aceturic, 4-acetamido-benzoic, adipic, aminohippuric, 4-amino-salicylic, alginic, aspartic, boric, butyric, capric (decanoic), caproic (hexanoic), carbonic, camphoric, camphorsulfonic, caprylic (octanoic), cyclamic, cinnamic, 2,2-dichloro-acetic, di(t-butyl)- naphthalenesulfonic, di(t-butyl)-naphthalenedisulfonic, dehydroacetic, diatrizoic, dodecyl sulfuric, ethane-l,2-disulfonic, edetic, ethanesulfonic, 2-ethyl-hexanoic, erythorbic, formic, fumaric, galactaric (mucic), gentisic, glucoheptanoic, gluconic, glucuronic, glutamic, glutaric, glycerophosphoric, glycolic, hippuric, hydrochloric, hydrobromic, hydroiodic, 2-(4- hydroxybenzoyl)-benzoic, 2-hydroxy-ethanesulfonic (isethionic), 1 -hydroxy -2 -naphtoic, isobutyric, lactic, lactobionic, lauric, iodoxamic, isostearic, maleic, malic, malonic, mandelic, medronic, methanesulfonic, methaphosphoric, methylboronic, myristic, naphthalene-1,5- disulfonic, naphthalene-2-sulfonic, nicotinic, oleic, oxalic, palmitic, pentetic, propionic, propanoic, pyroglutamic, pyruvic, phosphoric, sebacic, sorbic, stearic (octadecanoic), suberic, succinic, sulfuric, tartaric, thiazoximic, thiocyanic, toluenesulfonic, trifluoroacetic and undecyl enic (undec- 10-enoic) acids. In one embodiment, the pharmaceutically acceptable salt is organic or inorganic base or residue of a base, selected from the group consisting of alkali metals, alkaline earth metals, aluminum, zinc and ammonium.[000176] In another embodiment, the pharmaceutically acceptable salt is inorganic cation selected from the group consisting of lithium, sodium, potassium, calcium, magnesium, aluminum, zinc and ammonium.[000177] In another embodiment, the pharmaceutically acceptable organic amine salt selected from the group consisting of ammonium, a primary amine, a secondary amine, a tertiary amine, a quaternary ammonium compound, an amino alcohol and an amino sugar. Non-limiting examples of organic amine base are benethamine, benzathine, betaine, t-butylamine (erbumine), deanol, dicyclohexylamine, diethylamine, 2-diethylamino-ethanol, diethanolamine, ethanolamine, ethylenediamine, hydrabamine, morpholine, 4-(2 -hydroxy ethyl) morpholine, 1- (2-hydroxyethyl)-pyrrolidine (epolamine), imidazole, N-methylglucamine (meglumine), 4- phenylcyclohexylamine, piperazine, and tromethamine.[000178] In some embodiments, the compounds of any of Formulas I-XII, Formula I-A through Formula XII-A and XII-B, and compounds 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 12a, 12b, 12-A, 12-B, 12-C, 12-D, 12-E, 12-F, 12-G, 12-H, 12-1, 12-J, 12-K, 12-L, 12-M, 12-N, 12-0, 12-P, 12-Q, 12-R, 12-S, 12-T, 12-U, 12- V, 12-W, 12-X, 12-Xa, 12-Xb, and or 12- Y, for use in methods described herein below, may be provided in any form suitable for the intendedadministration. Suitable forms include pharmaceutically (i.e. physiologically) acceptable salt forms of the compound disclosed herein.[000179] Examples of pharmaceutically acceptable addition salts include, without limitation, the non-toxic inorganic and organic acid addition salts such as the hydrochloride, the hydrobromide, the L-tartrate, the nitrate, the perchlorate, the phosphate, the sulphate, the formate, the acetate, the aconate, the ascorbate, the benzene sulphonate, the benzoate, the cinnamate, the citrate, the embonate, the enantate, the fumarate, the glutamate, the glycolate, the lactate, the maleate, the malonate, the mandelate, the methanesulphonate, the naphthal ene-2-sulphonate, the phthalate, the salicylate, the sorbate, the stearate, the succinate, the tartrate, the toluene-p-sulphonate, and the like. Such salts may be formed by procedures well known and described in the art.Synthesis of Compounds[000180] In some embodiments, provided herein is a process for the preparation of Compounds 11 and 12, disclosed herein. (FIGURE 12)Compositions[000181] In some embodiments, provided herein is a pharmaceutical composition comprising any one of the broad-spectrum Coronavirus entry inhibitor compounds disclosed herein. In one embodiment, provided herein is a pharmaceutical composition comprising a pharmaceutically acceptable salt of any one of the broad-spectrum Coronavirus entry inhibitor compounds disclosed herein. In one embodiment, provided herein is a pharmaceutical composition comprising any one of the broad-spectrum Coronavirus entry inhibitor compounds disclosed herein and a pharmaceutically acceptable carrier. In one embodiment, a pharmaceutical composition comprises a preparation of one or more of the broad-spectrum Coronavirus entry inhibitor compounds, described herein with other chemical components, such as physiologically (pharmaceutically) suitable carriers and excipients.[000182] Pharmaceutically acceptable excipients and carriers are known to those skilled in the art and have been amply described in a variety of publications, including, for example, A. Gennaro (1995) "Remington: The Science and Practice of Pharmacy", 19th edition, Lippincott, Williams, & Wilkins Formulations. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism. In certain embodiments, a pharmaceutical composition provides the pharmaceutical dosage form of a broad-spectrum Coronavirus entry inhibitor compound disclosed herein.[000183] In one embodiment, provided herein is a pharmaceutical composition comprising abroad-spectrum Coronavirus entry inhibitor compound. In some embodiments, provided herein is a pharmaceutical composition comprising a compound represented by the structure of any one of Formulas I-XII or Formulas I-A through XII-A and XII-B. In some embodiments, provided herein is a pharmaceutical composition comprising a compound represented by the structure of any one of Formulas I-XII or Formulas I-A through XII-A and XII-B or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiments, provided herein is a pharmaceutical composition comprising a compound represented by the structure of any one of Formulas I, Formula I-A, Formulas II, Formula II- A, Formulas III, Formula HI- A, Formulas IV, Formula IV-A, Formulas V, Formula V-A, Formulas VI, Formula VI- A, Formulas VII, Formula VII- A, Formulas VIII, Formula VIII- A, Formulas IX, Formula IX- A, Formulas X, Formula X-A, Formulas XI, Formula XI- A, Formulas XII, Formula XII-A and Formula XII-B, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof.[000184] In some embodiments, provided herein is a pharmaceutical composition comprising any of Compounds 1-12, Compound 12a, Compound 12b, or Compounds 12-A through Compounds 12-Y. In some embodiments, provided herein is a pharmaceutical composition comprising any of Compounds 1-12, or Compounds 12-A through Compounds 12-Y, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In some embodiments, provided herein is a pharmaceutical composition comprising Compound 12a or Compound 12b, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In some embodiments, provided herein is a pharmaceutical composition comprising Compound 12-Xa or Compound 12-Xb, or a pharmaceutically acceptable salt thereof, or any combination thereof.[000185] In one embodiment, provided herein is a pharmaceutical composition comprising Compound 1, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 2, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 3, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 4, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or anycombination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 5, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 6, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 7, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 8, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 9, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 10, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 11, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12a, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12b, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12- A, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-B, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-C, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-D, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or anycombination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-E, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-F, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-G, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-H, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-1, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-J, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-K, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-L, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-M, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-N, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-0, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-P, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-Q, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-R, or an isomer thereof, or a derivativethereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-S, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12- T, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-U, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12- V, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12- W, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-X, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-Xa, or a pharmaceutically acceptable salt thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12-Xb, or a pharmaceutically acceptable salt thereof. In one embodiment, provided herein is a pharmaceutical composition comprising Compound 12- Y, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof.[000186] In some embodiments, the above compositions comprising a broad-spectrum Coronavirus entry inhibitor compound can be provided to the subj ect with additional active agents to achieve an improved therapeutic effect as compared to treatment with each agent by itself.[000187] In some embodiments, a composition with an appropriate physiologically acceptable carrier may be formulated into preparations in solid, semi-solid, nanoparticle, or liquid forms, such as tablets, capsules, powders, granules, solutions, injections, ointments, inhalants, microspheres, and aerosols. In addition, other pharmaceutically active ingredients and / or suitable excipients such as salts, buffers and stabilizers may, but need not, be present within the composition. As used herein, the term “pharmaceutically acceptable carrier” may in some embodiments be used interchangeably with the terms “physiological carrier,” “physiologically acceptable carrier”, “pharmaceutically acceptable diluent” or “pharmaceutically acceptableexcipient” having all the same qualities and meanings.[000188] A pharmaceutical composition may be in the form of a solid or liquid. In some embodiments, the pharmaceutically acceptable carrier(s) are particulate, so that the compositions are, for example, in tablet or powder form. The pharmaceutically acceptable carrier(s) may be liquid, with the compositions being, for example, an oral oil, injectable liquid or an aerosol, which is useful in, for example, inhalatory administration. When intended for oral administration, the pharmaceutical composition is preferably in either solid or liquid form, where semi-solid, semiliquid, suspension and gel forms are included within the forms considered herein as either solid or liquid.[000189] As a solid composition for oral administration, the pharmaceutical composition may be formulated into a powder, granule, compressed tablet, pill, capsule, chewing gum, wafer or the like. Such a solid composition will typically contain one or more inert diluents or edible pharmaceutically acceptable carriers. In addition, one or more of the following may be present: binders such as carboxymethylcellulose, ethyl cellulose, microcrystalline cellulose, gum tragacanth or gelatin; excipients such as starch, lactose or dextrins, disintegrating agents such as alginic acid, sodium alginate, Primogel, com starch and the like; lubricants such as magnesium stearate or Sterotex; glidants such as colloidal silicon dioxide; sweetening agents such as sucrose or saccharin; a flavoring agent such as peppermint, methyl salicylate or orange flavoring; and a coloring agent. When the pharmaceutical composition is in the form of a capsule, for example, a gelatin capsule, it may contain, in addition to materials of the above type, a liquid pharmaceutically acceptable carrier such as polyethylene glycol or oil.[000190] The pharmaceutical composition may be in the form of a liquid, for example, an elixir, syrup, solution, emulsion or suspension. The liquid may be for oral administration or for delivery by injection, as two examples. When intended for oral administration, preferred composition contain, in addition to the present compounds, one or more of a sweetening agent, preservatives, dye / colorant and flavor enhancer. In a composition intended to be administered by injection, one or more of a surfactant, preservative, wetting agent, dispersing agent, suspending agent, buffer, stabilizer and isotonic agent may be included.[000191] The liquid pharmaceutical compositions, whether they be solutions, suspensions or other like form, may include one or more of the following adjuvants: steril ’ diluents such as water for injection, saline solution, preferably physiological saline, Ringer's solution, isotonic sodium chloride, fixed oils such as synthetic mono or diglycerides which may serve as the solvent orsuspending medium, polyethylene glycols, glycerin, propylene glycol or other solvents; antibacterial agents such as benzyl alcohol or methyl paraben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. Physiological saline is a preferred adjuvant. An injectable pharmaceutical composition is preferably sterile.[000192] A liquid pharmaceutical composition intended for either parenteral or oral administration should contain an amount of a broad-spectrum Coronavirus entry inhibitor compound as herein disclosed, such that a suitable dosage will be obtained.[000193] The pharmaceutical composition may include various materials, which modify the physical form of a solid or liquid dosage unit. For example, the composition may include materials that form a coating shell around the active ingredients. The materials that form the coating shell are typically inert, and may be selected from, for example, sugar, shellac, and other enteric coating agents. Alternatively, the active ingredient (a broad-spectrum Coronavirus entry inhibitor compound disclosed herein) may be encased in a gelatin capsule. The pharmaceutical composition in solid or liquid form may include an agent that binds to the broad-spectrum Coronavirus entry inhibitor compound as disclosed herein, and thereby assists in the delivery of the compound. Suitable agents that may act in this capacity include monoclonal or polyclonal antibodies, one or more proteins or a liposome. The pharmaceutical composition may consist essentially of dosage units that can be administered as an aerosol. The term aerosol is used to denote a variety of systems ranging from those of colloidal nature to systems consisting of pressurized packages. Delivery may be by a liquefied or compressed gas or by a suitable pump system that dispenses the active ingredients. Aerosols may be delivered in single phase, bi-phasic, or tri-phasic systems in order to deliver the active ingredient(s). Delivery of the aerosol includes the necessary container, activators, valves, subcontainers, and the like, which together may form a kit. One of ordinary skill in the art, without undue experimentation may determine preferred aerosols.[000194] The pharmaceutical compositions may be prepared by methodology well known in the pharmaceutical art. For example, a pharmaceutical composition intended to be administered by injection can be prepared by combining a composition that comprises a broad-spectrum Coronavirus entry inhibitor compound as described herein, and optionally, one or more of salts, buffers and / or stabilizers, with sterile, distilled water so as to form a solution. A surfactant maybe added to facilitate the formation of a homogeneous solution or suspension. Surfactants are compounds that non-covalently interact with the broad-spectrum Coronavirus entry inhibitor compound composition so as to facilitate dissolution or homogeneous suspension of a broadspectrum Coronavirus entry inhibitor compound in the aqueous delivery system.[000195] The compositions may be administered in a therapeutically effective amount, which will vary depending upon a variety of factors including the activity of the broad-spectrum Coronavirus entry inhibitor compound employed; the metabolic stability and length of action of the broad-spectrum Coronavirus entry inhibitor compound; the age, body weight, general health, sex, and diet of the patient; the mode and time of administration; the rate of excretion; the drug combination; the severity of the particular allergic or respiratory disorder or condition; and the subject undergoing therapy.[000196] In some embodiments, a pharmaceutically acceptable carrier may be liquid, semi -liquid or solid. Solutions or suspensions used for parenteral, intradermal, subcutaneous or topical application may include, for example, a sterile diluent (such as water), saline solution, fixed oil, polyethylene glycol, glycerin, propylene glycol or other synthetic solvent; antimicrobial agents (such as benzyl alcohol and methyl parabens, phenols or cresols, mercurials, chlorobutanol, methyl and propyl p-hydroxybenzoic acid esters, thimerosal, benzalkonium chloride and benzethonium chloride); antioxidants (such as ascorbic acid and sodium bisulfite; methionine, sodium thiosulfate, platinum, catalase, citric acid, cysteine, thioglycerol, thioglycolic acid, thiosorbitol, butylated hydroxyanisol, butylated hydroxytoluene, and / or propyl gallate) and chelating agents (such as ethylenediaminetetraacetic acid (EDTA)); buffers (such as acetates, citrates and phosphates). If administered intravenously, suitable pharmaceutically acceptable carriers include physiological saline or phosphate buffered saline (PBS), and solutions containing thickening and solubilizing agents, such as glucose, polyethylene glycol, polypropylene glycol and mixtures thereof.[000197] The compositions comprising a broad- spectrum Coronavirus entry inhibitor compound, as described herein, may be prepared with pharmaceutically acceptable carriers that protect the broad-spectrum Coronavirus entry inhibitor compound thereof against rapid elimination from the body, such as time release formulations or coatings. Such pharmaceutically acceptable carriers include controlled release formulations, such as, but not limited to, implants and microencapsulated delivery systems, and biodegradable, biocompatible polymers, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, polyorthoesters, polylactic acid andothers known to those of ordinary skill in the art.[000198] In some embodiments, the terms “pharmaceutical composition” and “composition” may be used interchangeably herein, having all the same meanings and qualities.Use of Broad-Spectrum Coronavirus Entry Inhibitor Compounds[000199] In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a compound represented by the structure of Formula XII, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinA and B rings are each independently a substituted or unsubstituted single or fused aromatic or heteroaromatic ring system, substituted or unsubstituted single or fused C3-C10 cycloalkyl, or substituted or unsubstituted single or fused heterocycloalkyl;L5 and Le are each independently selected from H, linear or branched alkyl, linear or branched alkoxy, linear or branched haloalkyl; single or fused cycloalkyl, single or fused heterocyclic ring, single or fused aryl, single or fused heteroaryl, -(CILjn-cycloalkyl, -(CILjn- heterocyclic ring, -(CFhjn-aryl, and -(CILjn-heteroaryl; or L5 and Le j oin together to form a 5 or 6 membered sub stituted or unsub stituted, aliphatic or aromatic, carbocyclic or heterocyclic ring; and n and m are each independently an integer between 0-10; wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted; and wherein said * indicates a chiral center; wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection.[000200] In some embodiments, disclosed herein is a method of inhibiting or reducing aCoronavirus infection comprising administering to a subject in need, a compound represented by the structure of Formula XII-A, or an isomer thereof, or a derivative thereof, a pharmaceutically acceptable salt thereof, or any combination thereof:whereinC and D rings are each independently a single or fused aryl or heteroaryl;Ls and Le are each independently selected from H, linear or branched alkyl, linear or branched alkoxy, linear or branched haloalkyl, single or fused cycloalkyl, single or fused heterocyclic ring, single or fused aryl, single or fused heteroaryl -(CtCjn-cycloalkyl, -(CILjn- heterocyclic ring, -(CFhjn-aryl, and -(CILjn-heteroaryl; or L5 and Le join together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring; n is an integer between 0-10; wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted; and wherein * indicates a chiral center, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection.[000201] In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a compound represented by the structure of Formula XII-B, or an isomer thereof, or a derivative thereof, a pharmaceutically acceptable salt thereof, or any combination thereof:whereinQio, Qu, Q12, Q13 are each independently H, halo, alkyl, alkylene, haloalkyl, CN, NO2, O(C=O)R, R-O-R, -(C=O)R, -(C=O)OR, -(C=O)NHR, amine, aryl, heteroaryl, cycloalkyl, heterocycloalkyl, SO3R;L5 and Le are each independently selected from H, linear or branched alkyl, linear or branched alkoxy, linear or branched haloalkyl, single or fused cycloalkyl, single or fused heterocyclic ring, single or fused aryl, single or fused heteroaryl, -(CH2)n-cycloalkyl, - (CH2)n-heterocyclic ring, -(CH2)n-aryl, and -(CH2)n-heteroaryl; or L5 and Le join together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring p is an integer between 1-4; q is an integer between 1-4; and wherein * indicates a chiral center. [000202] In some embodiments, disclosed herein is a method of inhibiting or reducing aCoronavirus infection comprising administering to a subject in need, a compound represented by the structure of Compound 12, or an isomer thereof, or a derivative thereof, a pharmaceutically acceptable salt thereof, or any combination thereof:wherein * indicates a chiral center, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection.[000203] In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, an isomer of Compound12, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection, wherein said isomer is represented by the structure of Compound 12a or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof,wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection.[000204] In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, an isomer of Compound 12, wherein said isomer is represented by the structure of Compound 12b, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof,wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection.[000205] In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, to a subject in need, a derivative of Compound 12, wherein said derivative is represented by any one of the structures of Compounds 12-A through 12- Y, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:12-B),wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection.[000206] In some embodiments, disclosed herein is a method of inhibiting or reducing aCoronavirus infection comprising administering to a subject in need, a derivative of Compound12, wherein said derivative is Compound 12-A, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-B, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-C, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-D, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-E, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-F, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-G, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method ofinhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-H, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-1, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-J, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-K, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-L, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-M, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-N, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and saidadministration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-0, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-P, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-Q, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-R, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-S, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12- T, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-U, or an isomer thereof, or a pharmaceuticallyacceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12- V, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-W, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12-X, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, an isomer of Compound 12-X, wherein said isomer is Compound 12-Xa, or a pharmaceutically acceptable salt thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, an isomer of Compound 12-X, wherein said isomer is Compound 12-Xb, or a pharmaceutically acceptable salt thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a derivative of Compound 12, wherein said derivative is Compound 12- Y, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection.[000207] In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a compound represented bythe structure of Formula I-XI, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a compound represented by the structure of Formula I-A through XI-A, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection.[000208] In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a compound represented by any one of Compounds 1-11, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection.[000209] In one embodiment, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a compound represented by Compound 1, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In one embodiment, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a compound represented by Compound 1, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In one embodiment, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a compoundrepresented by Compound 2, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In one embodiment, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a compound represented by Compound 3, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In one embodiment, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a compound represented by Compound 4, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In one embodiment, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a compound represented by Compound 5, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In one embodiment, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a compound represented by Compound 6, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In one embodiment, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a compound represented by Compound 7, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In one embodiment, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a compound represented by Compound 8, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In one embodiment, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to asubject in need, a compound represented by Compound 9, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In one embodiment, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a compound represented by Compound 10, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection. In one embodiment, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering to a subject in need, a compound represented by Compound 11, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said inhibiting is downstream of receptor binding and said administration inhibits or reduces the Coronavirus infection.[000210] In some embodiments, “inhibiting” or “reducing” a Coronavirus infection, may encompass inhibiting or reducing a primary infection or a secondary infections, in both cases improving patient survival. In some embodiments, “inhibiting” or “reducing” a Coronavirus infection, may encompass inhibiting or reducing entry of a Coronavirus into a cell. In some embodiments, a compound disclosed herein comprises a broad-spectrum Coronavirus entry inhibitor. In some embodiments, inhibiting or reducing a Coronavirus infection comprises use of any of the broad-spectrum Coronavirus compounds disclosed herein, wherein said compounds target viral entry at a point downstream of receptor binding, thereby inhibiting or reducing Coronavirus infection.[000211] In some embodiments, inhibiting or reducing a Coronavirus infection comprises inhibiting viral entry mediated by the Spike (S) glycoprotein. In some embodiments, inhibiting or reducing a Coronavirus infection comprises inhibiting viral entry mediated by the S2 component of the Spike (S) glycoprotein. In some embodiments, inhibiting or reducing a Coronavirus infection comprising use of a compound disclosed herein for inhibiting or reducing entry of the Coronavirus downstream of receptor binding. In some embodiments, inhibiting or reducing a Coronavirus infection comprises use of a compound disclosed herein for inhibiting or reducing infection mediated by the S glycoprotein of a Coronavirus. In some embodiments, inhibiting or reducing a Coronavirus infection comprising use of a compound disclosed, comprises inhibiting entry by interfering with S2 functionality. In some embodiments, inhibiting or reducing aCoronavirus infection comprises use of a compound disclosed herein for inhibiting or reducing Coronavirus entry into a host cell downstream of receptor binding. In some embodiments, inhibiting or reducing a Coronavirus infection occurs downstream of receptor binding to the SI component of the Spike (S) glycoprotein. As used throughout, the terms “host cell” and “target cell” may be used interchangeably throughout, having all the same meanings and qualities.[000212] In some embodiments, a method of inhibiting or reducing a Coronavirus infection comprising administering a broad-spectrum Coronavirus entry inhibitor compound disclosed herein, results in between about 35% - 100% inhibition of Coronavirus infection. In some embodiments, a method of inhibiting or reducing a Coronavirus infection comprising administering a broad-spectrum Coronavirus entry inhibitor compound disclosed herein, results in between about 40% - 100% inhibition of Coronavirus infection. In some embodiments, inhibiting or reducing a Coronavirus infection, results in between about 50% - 100% inhibition of Coronavirus infection. In some embodiments, inhibiting or reducing a Coronavirus infection, results in between about 60% - 100% inhibition of Coronavirus infection. In some embodiments, inhibiting or reducing a Coronavirus infection, results in between about 70% - 100% inhibition of Coronavirus infection. In some embodiments, inhibiting or reducing a Coronavirus infection, results in between about 80% - 100% inhibition of Coronavirus infection.[000213] In some embodiments, methods of inhibiting or reducing a Coronavirus infection comprising administering a broad-spectrum Coronavirus entry inhibitor compound disclosed herein, results in about 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% inhibition of Coronavirus infection.[000214] In some embodiments, methods of inhibiting or reducing a Coronavirus infection comprising administering a broad-spectrum Coronavirus entry inhibitor compound disclosed herein, results in between about 35% - 100% inhibition of Coronavirus entry into a host cells. In some embodiments, methods of inhibiting or reducing a Coronavirus infection comprising administering a broad-spectrum Coronavirus entry inhibitor compound disclosed herein, results in between about 40% - 100% inhibition of Coronavirus entry into a host cells. In some embodiments, inhibiting or reducing a Coronavirus entry into a host cells, comprises between about 50% - 100% inhibition of Coronavirus entry into a host cells. In some embodiments, inhibiting or reducing a Coronavirus entry into a host cells, comprises between about 60% - 100% inhibition of Coronavirus entry into a host cells. In some embodiments, inhibiting or reducing a Coronavirus entry into a host cells, comprises between about 70% - 100% inhibition ofCoronavirus entry into a host cells. In some embodiments, inhibiting or reducing a Coronavirus entry into a host cells, comprises between about 80% - 100% inhibition of Coronavirus entry into a host cells.[000215] In some embodiments methods of inhibiting or reducing a Coronavirus infection comprising administering a broad-spectrum Coronavirus entry inhibitor compound disclosed herein, results in about 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% inhibition of Coronavirus entry into a host cells.[000216] In some embodiments, a method of inhibiting or reducing a Coronavirus infection comprising administering a broad-spectrum Coronavirus entry inhibitor compound disclosed herein, results in at least 35% - 100% inhibition of Coronavirus infection. In some embodiments, a method of inhibiting or reducing a Coronavirus infection comprising administering a broadspectrum Coronavirus entry inhibitor compound disclosed herein, results in at least 40% - 100% inhibition of Coronavirus infection. In some embodiments, inhibiting or reducing a Coronavirus infection, results in at least 50% - 100% inhibition of Coronavirus infection. In some embodiments, inhibiting or reducing a Coronavirus infection, results in at least 60% - 100% inhibition of Coronavirus infection. In some embodiments, inhibiting or reducing a Coronavirus infection, results in at least 70% - 100% inhibition of Coronavirus infection. In some embodiments, inhibiting or reducing a Coronavirus infection, results in at least 80% - 100% inhibition of Coronavirus infection.[000217] In some embodiments, methods of inhibiting or reducing a Coronavirus infection comprising administering a broad-spectrum Coronavirus entry inhibitor compound disclosed herein, results in about 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% inhibition of Coronavirus infection.[000218] In one embodiment, the term “about”, refers to a deviance of between 0.0001-5% from the indicated number or range of numbers. In one embodiment, the term “about”, refers to a deviance of between 1 -10% from the indicated number or range of numbers. In one embodiment, the term “about”, refers to a deviance of up to 25% from the indicated number or range of numbers.[000219] Throughout this application, various embodiments may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.[000220] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging / ranges between” a first indicate number and a second indicate number and “ranging / ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals there between. [000221] In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a compound represented by the structure of Formula XII, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinA and B rings are each independently a substituted or unsubstituted single or fused aromatic or heteroaromatic ring system, substituted or unsubstituted single or fused C3-C10 cycloalkyl, or substituted or unsubstituted single or fused heterocycloalkyl;Ls and Le are each independently selected from H, linear or branched alkyl, linear or branched alkoxy, linear or branched haloalkyl; single or fused cycloalkyl, single or fused heterocyclic ring, single or fused aryl, single or fused heteroaryl -(CFFjn-cycloalkyl, -(CFhjn- heterocyclic ring, -(CFhjn-aryl, and -(CFFjn-heteroaryl; or L5 and Le join together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring; n and m are each independently an integer between 0-10;wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted; and wherein said * indicates a chiral center; wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells.[000222] In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a compound represented by the structure of Formula XII-A, or an isomer thereof, or a derivative thereof, a pharmaceutically acceptable salt thereof, or any combination thereof:whereinC and D rings are each independently a single or fused aryl or heteroaryl;L5 and Le are each independently selected from H, linear or branched alkyl, linear or branched alkoxy, linear or branched haloalkyl; single or fused cycloalkyl, single or fused heterocyclic ring, single or fused aryl, single or fused heteroaryl -(CICjn-cycloalkyl, -(CILjn- heterocyclic ring, -(CFhjn-aryl, and -(CILjn-heteroaryl; or L5 and Le join together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring; n is an integer between 0-10; wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted; and wherein * indicates a chiral center, and wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells.[000223] In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said methodcomprising administering a compound represented by the structure of Formula XII-B, or an isomer thereof, or a derivative thereof, a pharmaceutically acceptable salt thereof, or any combination thereof:whereinQio, Qu, Q12, Q13 are each independently H, halo, alkyl, alkylene, haloalkyl, CN, NO2, O(C=O)R, R-O-R, -(C=O)R, -(C=O)OR, -(C=O)NHR, amine, aryl, heteroaryl, cycloalkyl, heterocycloalkyl, SO3R;L5 and Le are each independently selected from H, linear or branched alkyl, linear or branched alkoxy, linear or branched haloalkyl, single or fused cycloalkyl, single or fused heterocyclic ring, single or fused aryl, single or fused heteroaryl, -(CH2)n-cycloalkyl, - (CH2)n-heterocyclic ring, -(CH2)n-aryl, and -(CH2)n-heteroaryl; orL5 and Le join together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring p is an integer between 1-4; q is an integer between 1-4; and wherein * indicates a chiral center.[000224] In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a compound represented by the structure of Compound 12, or an isomer thereof, or a derivative thereof, a pharmaceutically acceptable salt thereof, or any combination thereof:wherein * indicates a chiral center, and wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells.[000225] In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering an isomer of Compound 12, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells, wherein said isomer is represented by the structure of Compound 12a or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof,wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering an isomer of Compound 12, wherein said isomer is represented by the structure of Compound 12b, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof,wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells.[000226] In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is represented by any one of the structures of Compounds 12-A through 12- Y, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:(12-B),(12-G),wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus 5 infection by reducing viral entry into cells.[000227] In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12- A, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-B, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-C, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-D, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-E, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-F, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administrationtreats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-G, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-H, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-1, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-J, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-K, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-L, or an isomer thereof, or apharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-M, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-N, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-0, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-P, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-Q, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative ofCompound 12, wherein said derivative is Compound 12-R, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-S, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-T, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-U, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-V, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-W, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk ofcontracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12-X, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering an isomer of Compound 12-X, wherein said isomer is Compound 12-Xa, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering an isomer of Compound 12-X, wherein said isomer is Compound 12-Xb, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a derivative of Compound 12, wherein said derivative is Compound 12- Y, or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells.[000228] In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering a compound represented by the structure of any of Formula I-XI, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In some embodiments, disclosed herein is a method of inhibiting or reducing a Coronavirus infection comprising administering a compound represented by the structure of any of Formula I- A through XII-A and XII-B, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells.[000229] In some embodiments, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a compound represented by any one of Compounds 1-11, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In one embodiment, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method comprising administering a compound represented by Compound 1, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In one embodiment, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method infection comprising administering a compound represented by Compound 1, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In one embodiment, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method infection comprising administering a compound represented by Compound 2, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In one embodiment, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method infection comprising administering a compound represented by Compound 3, or an isomer thereof, or a derivative thereof, or apharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In one embodiment, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method infection comprising administering a compound represented by Compound 4, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In one embodiment, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method infection comprising administering a compound represented by Compound 5, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In one embodiment, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method infection comprising administering a compound represented by Compound 6, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In one embodiment, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method infection comprising administering a compound represented by Compound 7, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In one embodiment, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method infection comprising administering a compound represented by Compound 8, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In one embodiment, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting aCoronavirus infection, said method infection comprising administering a compound represented by Compound 9, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In one embodiment, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method infection comprising administering a compound represented by Compound 10, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells. In one embodiment, disclosed herein is a method of treating a Coronavirus infection in a subject or treating a subject at risk of contracting a Coronavirus infection, said method infection comprising administering a compound represented by Compound 11, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof, wherein said administration treats said Coronavirus infection or reduces said risk of Coronavirus infection by reducing viral entry into cells.[000230] As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.[000231 ] As used herein, the terms “treating” or “treatment” and the like, refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or lessen the targeted pathologic condition or disorder as described hereinabove. In some embodiments, the object is to prevent or lessen a Coronavirus infection. In some embodiments, the object is to prevent or lessen entry of a Coronavirus into a cell. In some embodiments, the targeted pathological condition or disorder is COVID-19. In some embodiments, the object is to prevent or lessen a SARS-CoV, SARS-CoV-2, or MERS-CoV infection. In some embodiments, the object is to prevent or lessen entry of SARS-CoV, SARS-CoV-2, or MERS-CoV into a cell.[000232] Thus, in one embodiment, treating may include directly affecting or curing, suppressing, inhibiting, preventing, reducing the severity of, delaying the onset of, reducing symptoms associated with the disease, disorder or condition, or a combination thereof. Thus, in one embodiment, “treating” refers inter alia to delaying progression, speeding recovery, increasing efficacy of or decreasing resistance to alternative therapeutics, or a combinationthereof. In one embodiment, “preventing” refers, inter alia, to delaying the onset of symptoms, preventing relapse to a disease, decreasing the number or frequency of relapse episodes, increasing latency between symptomatic episodes, or a combination thereof. In one embodiment, “suppressing” or “inhibiting”, refers inter alia to reducing the severity of symptoms, reducing the severity of an acute episode, reducing the number of symptoms, reducing the incidence of disease- related symptoms, reducing the latency of symptoms, ameliorating symptoms, reducing secondary symptoms, reducing secondary infections, prolonging patient survival, or a combination thereof.[000233] In some embodiments, methods of inhibiting or reducing a Coronavirus infection comprising administering a broad-spectrum Coronavirus entry inhibitor compound disclosed herein, results in at least 35% - 100% inhibition of Coronavirus entry into a host cells. In some embodiments, methods of inhibiting or reducing a Coronavirus infection comprising administering a broad-spectrum Coronavirus entry inhibitor compound disclosed herein, results in at least 40% - 100% inhibition of Coronavirus entry into a host cells. In some embodiments, inhibiting or reducing a Coronavirus entry into a host cells, comprises at least 50% - 100% inhibition of Coronavirus entry into a host cells. In some embodiments, inhibiting or reducing a Coronavirus entry into a host cells, comprises at least 60% - 100% inhibition of Coronavirus entry into a host cells. In some embodiments, inhibiting or reducing a Coronavirus entry into a host cells, comprises at least 70% - 100% inhibition of Coronavirus entry into a host cells. In some embodiments, inhibiting or reducing a Coronavirus entry into a host cells, comprises at least 80% - 100% inhibition of Coronavirus entry into a host cells.[000234] In some embodiments methods of inhibiting or reducing a Coronavirus infection comprising administering a broad-spectrum Coronavirus entry inhibitor compound disclosed herein, results in about 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% inhibition of Coronavirus entry into a host cells.[000235] A skilled artisan would appreciate that the term "subject" may encompass a vertebrate, in some embodiments, to a mammal, and in some embodiments, to a human. In some embodiments, a subject is a human child between the ages of newborn and 21. In some embodiments, a subject is a human adult.[000236] In some embodiments, subjects at risk of contracting a Coronavirus infection comprise human adults over the age of 50 and or a subject suffering from a serious health problem. In some embodiments, a serious health problem comprises a heart disease or condition, a lung disease orcondition, a weakened immune system, obesity, diabetes, or any combination thereof. In some embodiments, a heart disease or condition comprises a cardiomyopathy, a congenital heart disease or condition, heart failure, or a coronary heart / artery disease, or any combination thereof. In some embodiments, a lung disease or condition comprises chronic obstructive pulmonary disease (COPD), lung cancer, cystic fibrosis, pulmonary hypertension, pulmonary embolism, pulmonary fibrosis, or moderate to severe asthma, or any combination thereof. In some embodiments, a subject comprising a weakened immune system has undergone an organ transplant, cancer treatment, a bone marrow transplant, or suffers from HIV / AIDS, or has long term use of prednisone or a similar drug that weakens the immune system. In some embodiments, diabetes comprises type 1 or type 2 diabetes. In some embodiments, serious health problems comprise a brain or nervous system condition including stroke and dementia, a cancer, sickle cell anemia, thalassemia, chronic liver disease, chronic kidney disease, or Downs syndrome, or any combination thereof.[000237] In some embodiments of methods of use described herein, a Coronavirus comprises SARS-CoV, SARS-CoV-2, or MERS-CoV. In some embodiments of methods of use described herein, a Coronavirus comprises SARS-CoV, SARS-CoV-2, or MERS-CoV, or any combination thereof. In some embodiments of methods of use described herein, a Coronavirus comprises SARS-CoV. In some embodiments of methods of use described herein, a Coronavirus comprises SARS-CoV-2. In some embodiments of methods of use described herein, a Coronavirus comprises MERS-CoV. In some embodiments of methods of use described herein, a Coronavirus comprises a novel Coronaviruses that may emerge in the future.[000238] In some embodiments of methods of use described herein, a Coronavirus comprises a variant of SARS-CoV, SARS-CoV-2, or MERS-CoV. In some embodiments of methods of use described herein, a Coronavirus comprises a variant of SARS-CoV, SARS-CoV-2, or MERS- CoV, or any combination thereof. In some embodiments of methods of use described herein, a Coronavirus comprises a variant of SARS-CoV. In some embodiments of methods of use described herein, a Coronavirus comprises a variant of SARS-CoV-2. In some embodiments of methods of use described herein, a Coronavirus comprises a variant of MERS-CoV.[000239] A skilled artisan would appreciate that SARS-CoV-2 is the virus that causes COVID- 19 in a subject.[000240] In some embodiments of methods disclosed herein, a SARS-CoV-2 variant comprises a variant of concern, a variant of interest, or a variant under monitoring, or any combinationthereof. In some embodiments of methods disclosed herein, a SARS-CoV-2 variant comprises a variant of concern. In some embodiments of methods disclosed herein, a SARS-CoV-2 variant comprises a variant of interest. In some embodiments of methods disclosed herein, a SARS-CoV- 2 variant comprises a variant under monitoring. In some embodiments, a SARS-CoV-2 variant comprises a variant listed by the World Health Organization (WHO) at https: / / www.who.int / publications / m / item / updated-working-definitions-and-primary-actions-for- -sars-cov-2 -variants.[000241] In some embodiments, a variant of SARS-CoV-2 comprises an alpha, beta, gamma, delta, epsilon, eta, iota, kappa, lambda, omicron, zeta, mu, or Wuhan variant. In some embodiments, a variant of SARS-CoV-2 comprises an alpha variant. In some embodiments, a variant of SARS-CoV-2 comprises a beta variant. In some embodiments, a variant of SARS-CoV- 2 comprises a gamma variant. In some embodiments, a variant of SARS-CoV-2 comprises a delta variant. In some embodiments, a variant of SARS-CoV-2 comprises an epsilon variant. In some embodiments, a variant of SARS-CoV-2 comprises an eta variant. In some embodiments, a variant of SARS-CoV-2 comprises an iota variant. In some embodiments, a variant of SARS- CoV-2 comprises a kappa variant. In some embodiments, a variant of SARS-CoV-2 comprises a lambda variant. In some embodiments, a variant of SARS-CoV-2 comprises an omicron variant. In some embodiments, a variant of SARS-CoV-2 comprises an omicron subvariant. In some embodiments, a variant of SARS-CoV-2 comprises a zeta variant. In some embodiments, a variant of SARS-CoV-2 comprises a mu variant. In some embodiments, a variant of SARS-CoV-2 comprises a Wuhan variant. In some embodiments, a variant of SARS-CoV-2 comprises a variant arising from an individual infected by two or more Coronaviruses. In some embodiments, what appears to be a variant of SARS-CoV-2 comprises a distinct Coronavirus.EXAMPLES[000242] The Examples provided below present a HTS platform wherein approximately 200,000 diverse chemical compounds were screened. A pseudotyped Vesicular Stomatitis Virus (VSV) model was developed that overcomes biosafety restrictions associated with CoVs and robustly quantifies the inhibitory effect of compounds on infection mediated by the CoV spike glycoprotein (FIGURES 1A-1G). The design employed a three-step approach, screening against the glycoproteins of two distinct CoVs that bind different cellular receptors, and the structurally distant VSV glycoprotein (VSV-G), thereby targeting the S2 domain of S glycoproteins. These extensive HTS efforts resulted in the identification and validation of novel broad-spectrumantiviral compounds as well as the known inhibitor Nafamostat. Table 1 below provides the amino acid sequences of the Coronavirus Spike proteins used in the below Examples.[000243] Table 1: Amino Acid Sequences of Coronavirus Spike proteins.Example 1: Materials and Methods[000244] DNA constructs[000245] pCAGGS-G, encoding the Vesicular Stomatitis Virus G glycoprotein from the Indiana serotype (VSV-G), was a kind gift from Benjamin Podbilewicz (Technion - Israel Institute of Technology). pcDNA3.1-SARS-CoV-2-Spike-C9, encoding the Spike glycoprotein of Wuhan SARS-CoV-2 fused to a C-terminal C9 tag (Sw) was a kind gift from Fang Li (Addgene plasmid # 145032;http: / / n2t.net / addgene: 145032; RRID:Addgene_145032) (Shang, J. et al. (2020) Structural basis of receptor recognition by SARS-CoV-2. Nature 581, 221-224. pCGl-SARS2- Spike-HA, encoding the Wuhan SARS-CoV-2 Spike protein fused to a C-terminal HA tag was a kind gift from Gideon Schreiber, pCMV3-SARS2-Spike-Flag, encoding the Wuhan SARS-CoV- 2 Spike protein fused to a C-terminal FLAG tag, pCMV3-SARS2-SpikeA19, encoding the Wuhan SARS-CoV-2 Spike protein with 19 amino acids removed at the cytoplasmic tail, and pCMV3-SARS2-SpikeA19-Flag, with an added C-terminal FLAG tag were a kind gift from and Yosef Shaul (Weizmann Institute of Science) (Strobelt, R. et al. (2022) Imatinib inhibits SARS- CoV-2 infection by an off-target-mechanism. Sci. Reports 12, 5758). pcDNA3.1 -SARS-CoV-2 - Sa-C9, pcDNA3.1-SARS-CoV-2-Ss-C9, and pcDNA3.1-SARS-CoV-2-S0-C9, encoding the Spike glycoprotein of Wuhan SARS-CoV-2 variants fused to a C-terminal C9 tag were generated by DNA synthesis (GeneScript, USA). pcDNA3.1-MERS-Spike-C9, encoding the Spike glycoprotein of the MERS-CoV (SM) fused to a C-terminal C9 tag was generated by sub-cloning the MERS Spike protein from a pLVX-EFlalpha-MERS-Spike plasmid (Weizmann Plasmid Bank) into a pcDNA3.1 expression plasmid using the GeneArt Gibson Assembly HiFi mastermix (Thermo Fisher Scientific). The following primers were used to generate the vector fragment (Primers VI : CGCACAAGGTCCACGTCCACGGCTCCACCGAGACATCCC (SEQ ID NO: 6) and V2: AGAAAAACTGAATGAATCATGCTAGCCAGCTTGGGTC (SEQ ID NO: 7); template DNA: pcDNA3.1-SARS-Spike alpha) and the insert fragment (Primers II : GGAGACCCAAGCTGGCTAGCATGATTCATTCAGTTTTTCTGCTCATGTTTC (SEQ ID NO: 8) and 12: TGGGATGTCTCGGTGGAGCCGTGGACGTGGACCTTGTGC (SEQ ID NO: 9); template DNA: pLVX-EFlalpha-MERS-Spike).[000246] Cell culture[000247] Baby Hamster Kidney cells (BHK-21; ATCC) were maintained in Dulbecco's modified Eagle medium (DMEM, Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Biological Industries, Israel), 1% penicillin-streptomycin (PS, Biological Industries) and 25mM HEPES (Biological Industries).[000248] Human Embryonic Kidney-293T cells (HEK-293T; ATCC), HEK-293T overexpressing either ACE2 (HEK-293T-ACE2) or both ACE2 and TMPRSS2 (HEK-293T- ACE2-TMPRSS2), or ACE2, DPP4 and TMPRSS2 (HEK-293T-ACE2-TMPRSS2-DPP4) were cultured in DMEM supplemented with 8.1% FBS, 1% PS, 25mM HEPES (Biological Industries). HEK-293T-ACE2, HEK-293T-ACE2-TMPRSS2, HEK-293T-ACE2-DPP4-TMPRSS2 were maintained by supplementing the culture medium with 1 pg / ml Puromycin (Sigma-Aldrich, USA), and 1.5 ng / ml Blasticidin (InvivoGen, USA) respectively. All cell lines were cultured in a 5% CO2incubator at 37°C. HEK-293T-ACE2 and HEK-293T-ACE2-TMPRSS2 were a kind gifts from Yosef Shaul (Weizmann Institute of Science). HEK-293T-ACE2-TMPRSS2-DPP4 cells were established by lentiviral transduction. 0.3 x 106HEK-293T-ACE2-TMPRSS2 cells were seeded in each well of a 6 well plate and cultured to 70-80% confluency. The growth medium was replaced with 1 ml of medium containing human CD26 / DPP4 pre-packaged lentiviral particles (LTV-CD26, G&P Biosciences) at a multiplicity of infection (MOI) of 5. To enhance transduction efficiency, 1: 1000 of polybrene Infection Reagent (Sigma-Aldrich) was added to the medium. The cells were incubated with the lentivirus for 24h at 37 °C with 5% CO2. After the transduction period, the viral supernatant was removed, and a fresh growth medium containing 1 pg / ml Puromycin was added to the cells to initiate the selection process.[000249] Vero E6 (ATCC) and Vero E6-TMPRSS2 (NIBSC, UK) were maintained in DMEM supplemented with 10% FBS, 1% PS. Vero E6-TMPRSS2 were maintained by supplementing the culture medium with 1 mg / ml Geneticin (Thermo Fisher Scientific).[000250] SARS-CoV-2 virus[000251] Delta B.1.617.2: The variant was supplied by Virus and Immunity Unit in Institut Pasteur headed by Olivier Schwartz. It was isolated from a nasopharyngeal swab of a hospitalized patient who had returned from India. The swab was provided and sequenced by the Laboratoire de Virologie of the Hopital Europeen Georges Pompidou (Assistance Publique des Hopitaux de Paris).[000252] XBB.1.5: The strain hCoV-19 / France / PDL-IPP58867 / 2022 was supplied by the National Reference Centre for Respiratory Viruses hosted by Institut Pasteur (Paris, France) and headed by Dr. Etienne Simon -Lori ere. The human sample from which strain hCoV- 19 / France / PDL-IPP58867 / 2022 was isolated has been provided from the Centre Hospitalier de Laval.[000253] CELLI: The strain hCoV-19 / France / NAQ-IPP58166 / 2022 was also supplied by the National Reference Centre for Respiratory Viruses hosted by Institut Pasteur (Paris, France). The human sample from which strain hCoV-19 / France / NAQ-IPP58166 / 2022 was isolated has been provided from the Selas Cerballiance Charentes.[000254] Preparation of VSVAG pseudoviruses[000255] To generate 5 ml of “glycoprotein X” complemented pseudoviruses (VSVAG-X), 1.2* 106BHK-21 cells were plated in a 100 mm dish (Greiner, Austria) one day prior to transfection. The cells were transfected using JetPrime transfection reagent (Polyplus, France) at 75-80% confluence with 15pg / ml of a plasmid expressing the viral glycoprotein. 24 h after transfection, cells were infected with VSVAG-G pseudovirus at a multiplicity of infection (MOI) of 5, with 1 : 1,000 polybrene infection reagent . Cells were incubated for 1 h at 37°C in a 5% CO2 incubator shaking every 15 min. Post infection, cells were washed with Dulbecco's Phosphate- Buffered Saline (DPBS, Biological Industries) six times, and the medium was replaced with a 5 ml growth medium. 30 h post-infection, cells and the supernatant containing the pseudoviruses were collected and centrifuged at 500 g for 10 mins at 4°C. Clean supernatant was collected, aliquoted, and frozen at -80 °C for further experiments.[000256] Viral titer[000257] To accurately determine viral titers of VSVAG complemented pseudoviruses at the conditions of the high throughput screen, 10 pl of pseudovirus suspension was dispensed in a 384 well plate (Greiner, Austria) in sextuplicate. Then, 103HEK-293T-ACE2-TMPRSS2 cells were added to each well allowed to settle for 15 mins at RT before centrifugation at 1000g for 1 hr atRT too maximize infection. The plates were subsequently incubated for 24 h in a 5% CO2 incubator at 37 °C.[000258] After 24 hours, the plates were imaged using Cell Discoverer 7 (Carl Zeiss, Germany) in widefield mode with sCMOS 702 camera (Carl Zeiss, Germany). Images were acquired using aPlan-APOCHROMAT 5x / 0.35 Autocorr Objective (Carl Zeiss, Germany). ZENblue software 3.1 (Carl Zeiss, Germany) was used for image acquisition using 470 nm excitation for the acquisition of the infected channel. The infected cells were segmented and counted using Cellpose (Stringer, et al., (2021) Cellpose: a generalist algorithm for cellular segmentation. Nat Methods 18, 100-106). Infectious units / ml were extrapolated by calculating the geometric mean of the number of infected cells multiplied by 100 to convert the units from pl to ml. Where applicable, the pseudovirus containing supernatant was first incubated with anti-G neutralizing antibody (1 : 1000 dilution, clone 1E9F9 (a-G; Absolute Antibody, UK) at a 1 : 1000 dilution for 1 h at room temperature (RT) to remove residual VS VAG-G background infections before titering.[000259] Compound libraries[000260] The compound collection of the Nancy and Stephen Grand Israel National Center for Personalized Medicine (G-INCPM) was used for screening (https: / / g- incpm.weizmann.ac.il / units / WohlDrugDiscovery / chemical-libraries). One-hundred and seventy- three thousand two hundred and twenty-seven (173,227) unique compounds from commercial sub-collections were used. The composition of the screening set was 0.7% Bioactive Screening Libraries (Selleck Chemicals, USA), 7.6% HitFinder Collection (Maybridge, USA), 10.8% Drug Like Set (Enamine, Ukraine), 26.8% DIVERset-CL (Chembridge, USA), 54.1% Diversity Library (ChemDiv, USA). Compounds were stored in 100% DMSO in acoustic dispenser certified plates. Hit compounds were purchased from Sigma-Aldrich, Aldrich Market Select (Sigma-Aldrich), Enamine or MolPort (Latvia) chemical suppliers.[000261] Phenotypic assay: pseudotype-based HTS imaging inhibition assay[000262] Compounds were spotted using Echo 555 Liquid Handler (Beckman Coulter, USA) on 384-well assay plates in 10 pM final concentration. To avoid background from any residual VSVAG-G activity, pseudoviruses were incubated with a-G neutralizing antibody (1 :5000, clone 1E9F9) for 1 h at RT. Subsequently, 10 pl of the pseudovirus suspension were dispensed using Multidrop™ Combi (Thermo Fisher Scientific) and incubated with compounds for 15 mins at RT. HEK-293T-ACE2-TMPRSS2 were trypsinized, counted and diluted to 0.5xl06cells / ml. 20 pl of this cell suspension was dispensed (Multidrop Combi) in each well containing the compoundand the neutralized pseudoviruses and incubated for an additional 15 mins at RT. To maximize infection, assay plates were then subjected to 1000g centrifugation for 1 h at RT and incubated overnight in a 5% CO2 incubator at 37°C.[000263] To account for the toxicity at 10 pM for a compound, wells were stained for nuclei with 5 pg / ml Hoechst 33342 (Thermo Fisher Scientific) and incubated for 10 mins at 37°C, 5% CO2 before live cell imaging was done by (ImageXpressMicro-confocal, Molecular Devices, USA) equipped with 4x S Fluor lens in two channels: filter set DAPI (ex 377 nm / em 447 nm) and FITC (ex 475 nm / em 536 nm) for total cells and infected cells, respectively.[000264] Images were analyzed using MetaXpress CME (Molecular Devices) to quantify the number of total and infected cells. Settings for segmentation: cell / nuclei size 5-30 pm and intensity >2000 AU.[000265] The inhibition % was calculated accordingly to: 100Icompound = Number of infected cells in presence of compounds.I max—Number of infected cells in absence of compounds.Imin = Number of infected cells in absence of viruses.[000266] Dose response assay[000267] For dose-response assay the compounds were serially diluted to cover a range of 40- 0.31 pM. The assay is identical to the phenotypic assay as described above. Six different VSVAG viruses representing G, WT, Alpha, Delta, Omicron, and MERS were tested. Data were deposited in Collaborative Drug Discovery platform (CDD vault; Collaborative Drug discovery, USA) and dose response curves were analyzed from image analysis. Dose response curves were generated and fitted to the Levenberg-Marquardt algorithm that is used to fit a Hill equation to doseresponse data.[000268] Cell viability assay[000269] To assess compounds toxicity to cells, a copy of the compound as in the dose-response experiment were assayed for live-dead assay. Cells were stained with Hoechst in addition to 1.5 pM Propidium Iodide (Life Technologies. USA) and 2 pM Calcein AM (Life Technologies.). Images were then captured using the ImageXpressMicro-confocal, and analysis was performed by MetaXpress CME adjusted to quantify total, live or dead cells.[000270] Spike-ACE2 binding assay[000271] To test if the compounds inhibited SI -domain and ACE2 interactions, a commercial ELISA kit (SARS-CoV-2 Spike SI RBD: ACE2 Inhibitor Screening Assay Kit; BPS Bioscience, USA) was used according to the manufacturer's protocol. The compounds were tested in triplicates with serial dilutions covering a range of 10-0.01 pM, while the positive control, soluble Spike was tested in serial dilutions covering a range of 0.7-0.001 pM. The soluble Spike was produced from a plasmid obtained from Florian Krammer (Icahn School of Medicine, Mt. Sinai, USA) by The Dana and Yossie Hollander Center for Structural Proteomics, Weizmann Institute of Science (Amanat, F. et al., (2020) A serological assay to detect SARS-CoV-2 seroconversion in humans. Nat. Med. 26, 1033-1036).[000272] Briefly, a 96-well nickel-coated plate was coated with ACE2-His and incubated for 60 min before washing. The plate was then incubated with a blocking buffer for 10 mins and removed. Next, the compounds or soluble Spike were added and incubated for 60 min at room temperature with slow shaking. Following incubation, SARS-CoV-2 spike (RBD)-Fc was added into all wells except for the blank, and the plate was left to sit with slow shaking. After 60 min, an anti -mouse Fc-HRP antibody was added, followed by the addition of an Enhanced chemiluminescence (ECL) solution to produce chemiluminescence. Finally, a Cytation 5 plate reader (BioTek, USA) was used to read and quantify the luminescence. The final concentration of DMSO was 5% in each wells.[000273] Liquid Chromatography-Mass Spectrometry (LC / MS)[000274] Flash chromatography was first performed by automated CombiFlash Systems (Teledyne ISCO, USA) with RediSep Rf Normal -phase silica gel columns (Teledyne ISCO) or Silica gel Kieselgel 60 (0.04-0.06 mm) columns (Merck, USA). Purification of the compounds was then performed using preparative HPLC; Waters Prep 2545 Preparative Chromatography System (Waters, USA), with 2489 UV / Vis detector (Waters), using XBridge HPLC Column (Waters). Compounds purity was monitored by UPLC-MS system: Acquity UPLC H class with PDA detector and ELSD detector (Waters), and using Acquity UPLC BEH C18 Column (Waters). MS-system: SQ detector 2 (Waters). UPLC Method using HPLC grade solvents: 5 min gradient 95:5 Water (Merck): Acetonitrile (Merck) 0.05% formic acid (Bio-lab, Israel) to Acetonitrile 0.05% formic acid, flowrate 0.5 mL / min, column temp 40°C.[000275] Synthesis of PCM-0163855 (Compound 11) and PCM-0282478 (Compound 12)[000276] All reagents, solvents and building blocks used for synthesis without furtherpurification. All solvents used for reactions were of HPLC grade. Solvent and reagent abbreviations: Ethyl acetate (EtOAc; Bio-lab), Dichlormethane (DCM; Bio-lab), Dimethylformamide (DMF; Sigma Aldrich), Tetrahydrofuran (THF; Sigma Aldrich), Acetonitrile (MeCN; Bio-Lab), l,8-Diazabicyclo[5.4.0]undec-7-ene (DBU; Sigma Aldrich), Diisopropyl ethyl amine (DIPEA; Sigma Aldrich), Trifluoroacetic acid (TFA; Sigma Aldrich), Sodium sulfate (Na2SO4; Sigma Aldrich), Lithium hydroxide (LiOH; Sigma Aldrich), Hydrochloric acid (HC1; Bio-lab), Hexafluorophosphate azabenzotriazole tetramethyl uronium (HATU; Sigma Aldrich), meta-Chloroperoxybenzoic acid (mCPBA; Sigma Aldrich), Sodium sulfite (Na2SO3; Sigma Aldrich).[000277] Reactions on microwave were done on Initiator-i- (Biotage, Sweden).1H NMR spectra were recorded on Avance III (Bruker, USA)-300 MHz, 400 MHz and 500 MHz spectrometer, equipped with QNP probe. Chemical shifts are reported in ppm on the 6 scale and are calibrated according to the deuterated solvents. All . / values are given in Hertz. Numbers used in the scheme of FIGURE 12 and below do not reflect Broad-spectrum Coronavirus Compound numbering used throughout this application.[000278] Ethyl 2-((l-(4-chlorophenyl)-4-phenyl-lH-imidazol-2-yl)thio) acetate (2) To a 5 mL crimp vial, ethyl bromo acetate (87.3 mg, 0.52 mmol; Sigma Aldrich) was added followed by 1- (4-chlorophenyl)-4-phenyl-lH-imidazole-2-thiol (1) (100.0 mg, 0.35 mmol) and DIPEA (182.0 pl, 1.05 mmol) (Sujatha, K. & Khanapurmath, N. (2021) Solvatochromic Studies On 4-(l,4 diphenyl-lH imidazole-2-ylthio)-2H-chromen-2-one. Rasayan. J. Chem. 14, 2263-2272). The vial was crimped and heated at 90 °C for 5min in microwave reactor, and the reaction was cooled and diluted with EtOAc (10 ml), the organic layer was washed IX water, IX brine (Sigma Aldrich) and dried on Na2SO4. The organic layer was concentrated onto silica (Sigma Aldrich) and purified on a Combi-Flash Systems , using a 24 g silica gel column gradient (15 min) from DCM to EtOAc. The fraction that eluted in 50% EtOAc gave compound 2 (123.0 mg, 94 % yield).[000279] 2-((l-(4-chlorophenyl)-4-phenyl-lH-imidazol-2-yl)thio)acetic acid (3). Compound 2 (123.0 mg, 0.33 mmol) was dissolved in THF (2 ml), then LiOH (197.0 mg, 8.24 mmol) was dissolved in water (2 ml), and the freshly prepared solution was added to the reaction and stirred overnight. The reaction mixture was cooled to 0°C and acidified to pH = 4 with HC1 IM (~ 9 ml), the aqueous layer was extracted 3x EtOAc, the combined organic layers were washed with brine dried on Na2SO4. The organic layer was concentrated to give compound 3 (106.2 mg, 93% yield).[000280] 2-((l-(4-chlorophenyl)-4-phenyl-lH-imidazol-2-yl)thio)-N-(2,3- dimethylphenyl)acetamide (4): In a 25 mL round bottom flask, compound 3 (106.0 mg, 0.31 mmol) and 2,3 -dimethylaniline (72.7 mg, 0.46 mmol) was dissolved in DMF (2 ml). Then DIPEA (214.0 pl, 1.23 mmol) was added followed by HATU (128.6 mg, 0.34 mmol) and the reaction was stirred for 12h. The reaction was then poured into brine (10 ml) and the aqueous layer was extracted 3 X EtOAc, the combined organic layer was washed with lx water, lx brine and dried on Na2SO4. The organic layer was concentrated onto 0.5 g silica and purified on Combi-Flash Systems, using a 24 g silica gel column gradient (17 min) from DCM to EtOAc, the fraction that eluted in 50% EtOAc gave compound 4 (108.2 mg, 79% yield).[000281 ] 2-((l-(4-chlorophenyl)-4-phenyl-lH-imidazol-2-yl)sulfonyl)-N-(2,3- dimethylphenyl)acetamide (PCM-0163855). To a 25 mL round bottom flask, compound 4 (19.5 mg, 0.044 mmol) was dissolved in DCM (2 ml), then mCPBA (24.4 mg, 0.11 mmol) was added in one portion. After 2h an additional amount of mCPBA (10 mg) was added and the reaction was stirred overnight. The reaction mixture was quenched with Na2SOs (30 pl) and concentrated on rotary evaporator. Purification of the crude reaction mixture by HPLC water to MeCN gradient 45 min, the desired compound eluted in 80% MeCN to give PCM-0163855 (13.5 mg, 62% yield). 1H-NMR (300 MHz, DMSO-d6) 8 9.82 (s, 1H), 8.22 (s, 1H), 7.88 (d, 2H, J= 8 Hz), 7.60-7.50 (m, 4H), 7.48-7.40 (m, 2H), 7.37-7.29 (m, 1H), 7.08-7.00 (m, 3H), 4.67 (s, 2H), 2.24 (s, 3H), 1.97 (s, 3H); ES-LRMS: (m / z) calculated for C25H23CIN3O3S ([M+H]+) 480.1, found 480.3.[000282] 2-((l-(4-chlorophenyl)-4-phenyl-lH-imidazol-2-yl)sulfinyl)-N-(2,3- dimethylphenyl)acetamide (PCM-0282478). To a 25 ml round bottom flask, compound 4 (52.0 mg, 0.012 mmol) was dissolved in DCM (2 ml), then mCPBA (28.6 mg, 0.013 mmol) was added in one portion and the reaction was stirred overnight. The reaction mixture was quenched with Na2SC>3 (30 pl) and the reaction was concentrated on rotary evaporator. Purification of the crude reaction mixture by HPLC water to MeCN gradient 45 min, the desired compound eluted in 80% MeCN to give PCM-0282478 (35.1 mg, 65% yield). Chiral Separation was performed at Lotus Separations (USA, http: / / lotussep.com / ). lH-NMR (300 MHz, DMSO-d6) 8 10.02 (s, 1H), 8.31 (s, 1H), 7.95 (d, 2H, 7=7.5 Hz), 7.78-7.68 (m, 4H), 7.51-7.41 (m, 2H), 7.38-7.30 (m, 1H), 7.06- 6.98 (m, 3H), 4.98 (d, 1H, 7=14 Hz), 4.64 (d, 1H, 7=14 Hz), 2.21 (s, 3H), 1.96 (s, 3H); (ES- LRMS: (m / z) calculated for C25H23CIN3O2S ([M+H]+) 464.1, found 464.3.[000283] SARS-CoV-2 replication assay[000284] Clear-bottomed 384-well black plates were seeded with 3,000 Vero E6 cells or VeroE6-TMPRSS2 cells per well. The following day, individual compounds were added at ten specified concentrations, 2 h prior to infection. Each plate included 0.5% DMAO and 25 pM Remdesivir (SelleckChem) controls. After the pre-incubation period, the cells were exposed to the Delta B.1.617.2 inoculum (at a multiplicity of infection of 0.05 PFU / Vero E6 cell and 0.2 PFU / Vero TMPRSS2 cell). After a one-hour adsorption at 37°C, the supernatant was aspirated and replaced with 2% FBS / DMEM media containing the respective compounds at the indicated concentrations. The cells were then incubated at 37°C for 2 days. Supernatants were collected and heat inactivated at 80 °C for 20 minutes. The Luna Universal One-Step RT-qPCR Kit (New England Biolabs, USA) was used for the detection of viral genomes in the heat-inactivated samples performed through reverse transcription quantitative polymerase chain reaction (RT- qPCR). Specific primers targeting the N gene region of SARS-CoV-2 (5'- TAATCAGACAAGGAACTGATTA-3' (SEQ ID NO: 10) and 5'- CGAAGGTGTGACTTCCATG-3' (SEQ ID NO: 11)) were utilized. The cycling conditions involved an initial step at 55 °C for 10 minutes, followed by 95 °C for 1 minute. Subsequently, 40 cycles were carried out with denaturation at 95 °C for 10 seconds and annealing / extension at 60 °C for 1 minute using an QuantStudio 6 thermocycler (Applied Biolsystems, USA). The quantity of viral genomes is expressed as Ct and was normalized against the Ct values of the negative and positive controls.[000285] In parallel, cytotoxicity was assessed using the CellTiter-Glo luminescent cell viability kit (Promega, USA). 3,000 cells / well of Vero E6 were seeded in white with clear bottom 384- well plates. The following day, compounds were added at concentrations indicated. 0.5% DMSO and 10 pM Camptothecin (Sigma Aldrich) controls were added in each plate. After 48 h incubation, 10 pl of CellTiter Gio reagent was added in each well and the luminescence was recorded using a luminometer (Berthold Technologies, Germany) with 0.5 sec integration time. [000286] Raw data were normalized against appropriate negative (0 %) and positive controls (100 %) and are expressed in % of viral replication inhibition or % of cytotoxicity. Curve fits and IC50 / CC50 values were obtained in Prism (GraphPad, USA) using the variable Hill slope model.[000287] SARS-CoV-2 plaque assay[000288] Plaque assay was performed to determine the viral load of bona fide SARS-COV-2 Delta variant with a dose-response of two enantiomers of PCM0282478 (in duplicates). Vero E6 cells were seeded in 24-well plates at a concentration of 7.5 x 104cells per well. The following day, serial dilutions of each supernatant were performed in serum-free DMEM medium. AfterI h absorption at 37 °C, 2 / overlay medium was added to the inoculum to give a final concentration of 2% (v / v) FBS in DMEM and 0.4% (w / v) agarose (Sigma Aldrich) to achieve a semi-solid overlay. Plaque assays were incubated at 37 °C for 3 days. Samples were fixed using 4% formaldehyde solution and plaques were visualized using crystal violet solution (Merck). To calculate the plaque forming units (PFU) per well, counts from duplicate wells were averaged, and the average was multiplied by the dilution factor and the volume of inoculum plated. The calculation is: the average value of plaques in duplicate wells x dilution factor virus inoculum volume (in pL) x volume per well = titer in PFU / well.[000289] Quantification and statistical analysis[000290] Statistical analysis and tools[000291] Data from analyzed images was processed using Genedata Screener (Genedata, Switzerland). Normalization was the percent of infection where neutral control is 0% inhibition of infection and “No-Virus” control is 100% inhibition of infection. Further chemoinformatic data visualizations were made with D360 software (Certara, USA), which is integrated with the CDD vault. Excel (Microsoft, USA) was used to analyze the data and Prism was used to plot the data. Whenever comparing between two conditions, data was analyzed with two tailed student’ s t-test. Measurements are reported as mean of at least three biological repeats, and the error bars denote standard error of mean (SEM). Throughout the study, threshold for statistical significance was considered for p-values<0.05, denoted by one asterisk (*), two (**) if P<0.01, three (***) if P <0.001 and four ( ****) if P<0.001.Example 2: Pseudoviruses expressing fluorescent reporters enable robust quantification of infection[000292] Objective'. To develop an effective high-throughput screening (HTS) assay for SARS- CoV-2.[000293] Results'. Pseudoviruses featuring the S glycoprotein of the SARS-CoV-2 Wuhan variant (VSVAG-Sw) on a VSV backbone lacking VSV-G (VSVAG) were produced. (FIGURES 1A-1B) VSVAG, which expresses a fluorescent reporter from the viral genome after infection was chosen for use throughout these studies. A fluorescent reporter was employed, instead of the more commonly used luciferase, because it allows direct visualization and robust quantification of single infection events, overcoming the need for averaging and the additional processing steps for the Luciferase enzymatic reaction. VSV-GAG, which express a fluorescentreporter from the viral genome after infection were used. (FIGURE 1C).[000294] The specific tropism of the VSVAG-Sw pseudoviruses was confirmed by comparing infected ACE2-overexpressing Human Embryonic Kidney (HEK-293T-ACE2) cells and ACE- 2-defici ent Baby Hamster Kidney (BHK-21) cells (FIGURE ID). To eliminate potential residual infections from VSVAG-G that might have been left over during production, all experiments were performed in the presence of a neutralizing antibody against VSV-G. Ten-thousand (10,000)-fold more infections in HEK-293T-ACE2 were observed, with an additional 3.8-fold increase in cells co-expressing TMPRSS2 (HEK-293T-ACE2-TMPRSS2), consistent with the tropism of SARS-CoV-2 (FIGURE ID).[000295] Next, the methods to enhance virus titers were explored, comparing modifications to the cytosolic tail of the S glycoprotein and optimizing the production and infection procedures (FIGURE IE and FIGURES 2A-2B). Modifications included truncating the 19-amino acid ER retention sequence and adding an HA, flag or C9 tag to the C-terminus of the S glycoprotein. Optimal titers were achieved with C9 and HA tagged S glycoproteins without further modifications (FIGURE IE). Moreover, peak titers were obtained when the cell supernatant containing VSVAG-Sw was harvested 30 hours after infection with the VSVAG-G helper virus. Notably, infection rates doubled when cultures were centrifuged post-infection (FIGURES 2A- 2B) These optimizations significantly improved the sensitivity and reproducibility of infection counts.[000296] Subsequently, high titer pseudoviruses featuring the S glycoproteins of MERS-CoV (VSVAG-SM) and SARS-CoV-2 variants Alpha (VSVAG-Sa), Delta (VSVAG-Sa), and Omicron (VSVAG-So) were produced and obtained, and their infection rates quantified in both HEK-293T- ACE2-TMPRSS2-DPP4 and HEK-293T-ACE2-TMPRSS2 cell lines (FIGURE IF). Importantly, the infection rates of VSVAG pseudoviruses expressing either GFP or RFP and featuring the S glycoprotein (VSVAGGFP-SW) or VSV-G (VSVAGRFP-G), respectively, were assessed (FIGURE 1G)[000297] Summary. The results showed that comparable titers were achieved in both single and multiplexed infections, demonstrating the feasibility of multiplexing the assay using pseudoviruses expressing different fluorophores (FIGURE 1G).Example 3: Optimization and validation of a high throughput screening assay for infection inhibitors[000298] Objective'. To optimize and validate a high throughput screening assay for infection inhibitors.[000299] Results'. Building on the robust segmentation and quantification capabilities of the automated imaging system used and the fluorescence-based assay using VSVAG pseudoviruses (FIGURES 1B-1C), the assay was tailored for high throughput screening (HTS) in a 384-well format (FIGURE 3A). To streamline the plating process and ensure robust and reproducible quantification, compounds in DMSO were pre-plated in 384-well plates. Then, 10 pl of a pseudovirus suspension that contained between 500-1000 infectious units was added to each well. Subsequently, 10,000 HEK-293T-ACE2-TMPRSS2 cells were added to each well and the plates were centrifuged and incubated for 24 hours.[000300] Results'. Post infection, the nuclei were stained to estimate cell count. Automated HTS imaging was then used to obtain images of the infected cells and nuclei in each well. These images were automatically segmented and analyzed by a dedicated pipeline (FIGURE 1C and FIGURE 3B) The first columns of each plate, which contained viruses and cells, was used as a neutral control, providing the baselines for the infection and cell number counts (FIGURE 3B and FIGURE 4) The raw infection and cell number counts from each well were normalized with the geometric means of the infection and cell number counts in the neutral control to determine the baselines for the inhibition and cytotoxicity profiles for each compound (FIGURE 3B and FIGURE 4). The second column of each plate contained only cells and served as the baseline for 0% infection as the geometric mean of counts in these wells, which also served as the positive controls (FIGURE 3B and FIGURE 4) For consistency, all wells without compounds were supplemented with DMSO to achieve a final concentration of 0.1%.[000301] To test the reproducibility of the assay and ascertain if a one-time screen at a single concentration for each compound would be likely to identify putative inhibitors, a pilot screen with a subset of 2,489 compounds was run; this was approximately 1.25% of the entire compound library (FIGURE 3C). Each compound was assessed at a concentration of 10 pM for its ability to inhibit VSVAG-SW in two separate experiments. Compounds were reliably detected with similar inhibition levels (R2= 0.60), independent of day-to-day variations, regardless of the number of cells or the raw infection counts, confirming the robustness of the assay, with Z' factors 0.66±0.04 and 0.76±0.07 for the respective runs. To set a cut-off threshold for the screen,compounds chosen were those showing at least 35% inhibition, as this level of inhibition showed high reproducibility in the pilot screen (R2= 0.85). (FIGURE 3C).Example 4: A three-tiered screen identifies CoV entry inhibitors downstream of receptor binding[000302] Objective'. To identify potential S2-domain specific inhibitors, the screening process was divided into three distinct tiers (FIGURE 5A).[000303] Results'. The primary screen evaluated an extensive library of approximately 200,000 compounds against VSVAG-Sw at a single concentration of 10 pM. This process identified 733 compounds capable of inhibiting VSVAG-Sw infection by at least 35% while maintaining a cell viability of 65% (FIGURE 6 (Table 2)). For the secondary screen, the 733 compounds were tested against VSVAG-G to distinguish Sw-specific inhibitors from non-specific ones. Since VSVAG-Sw and VSVAG-G share the VSVAG backbone and only differ in the surface glycoproteins, compounds inhibiting VSVAG-Sw but not VSVAG-G were deemed Sw-specific. The screening identified 65 Spike-specific inhibitors that inhibited VSVAG-Sw infection by at least 35% without inhibiting VSVAG-G infection more than 35% (FIGURE 7 (Table 3)).[000304] Subsequently, these 65 compounds were subjected to a tertiary screen against VSVAG-SM, to differentiate them from receptor binding inhibitors. Since MERS-CoV utilizes DPP4 as its host receptor, compounds inhibiting both VSVAG-Sw and VSVAG-SM likely act downstream of receptor binding. This screen yielded 22 putative S2-domain specific inhibitors that reduced VSVAG-SM infection by at least 35% (FIGURE 8 (Table 4)). Out of these, 11 most drug-like inhibitors that were previously unreported , and Nafamostat, a known TMPRSS2 protease inhibitor, were chosen. Nafamostat, was used as a positive control in subsequent experiments (Hoffmann, M. et al. (2020) Nafamostat Mesylate Blocks Activation of SARS-CoV- 2: New Treatment Option for COVID- 19. Antimi crob Agents Ch 64, e00754-20).[000305] To evaluate the screening platform, HTS parameters were calculated such as Z' factor, signal-to-background (S / B), and coefficient of variation (%CV) for 569 plates from all three screening levels (FIGURE 5B) (Zhang et al (1999). A simple statistical parameter for use in evaluation and validation of high throughput screening assays. J. Biomol. Screen 4, 67-73) These showed the robust performance of the screening platform with a high Z' factor (0.8±0.09) and a very high S / B (103), suggesting excellent sensitivity and accuracy. In addition, the low %CV (1.9±0.74% for neutral controls and 0.1±0.03% for positive control) indicates the high reproducibility and precision of the platform. Plates that failed to meet the accepted Z' cut-off of0.5 underwent manual checks for errors in the infection counts of the positive and negative controls, and any outlier wells were excluded before data normalization.To ensure the reliability of the HTS platform and rule out potential false positives due to compound degradation or quality, 4 compounds of the 11 novel compounds (Compounds 1 (PCM-0068389), 5 (PCM-0166392), 6 (PCM-0179622), and 11 (PCM-0163855); FIGURE 8 (Table 4)) and Nafamostat were resourced from alternative vendors and their activity against VSVAG-Sw, VSVAG-G, and VSVAG-SM was reassessed (FIGURES 5C-5D). These compounds demonstrated varied inhibitory activity against VSVAG-Sw (38%-87%) and VSVAG-SM (27%-94%) but did not significantly inhibit VSVAG-G (-23% to 0%) confirming their selectivity (FIGURE 5D).Example 5: Dose response and cytotoxicity of putative candidate compounds[000306] Objective'. To further assess the putative candidate compounds.[000307] Results'. Next, the cytotoxicity (CC50) and IC50 values for each compound were evaluated using a concentration range of 0.3125 - 40 pM against VSVAG-Sw, VSVAG-G, and VSVAG-SM, as well as VSVAG-Sa, VSVAG-Sa, and VSVAG-S0. Since the purity of these compounds ranged from 70% to 95%, and as an additional validation step, these experiments were performed on the compounds before and after HPLC purification. All compounds showed low to moderate cytotoxicity before and after purification (FIGURE 9 and FIGURE 10, respectively).[000308] Nafamostat showed similar IC50 values against VSVAG-Sw (0.90 pM vs 1.31 pM) and VSVAG-SM (0.13 pM vs 0.21 pM) before and after purification, with no significant activity against VSVAG-G, and was also active against VSVAG-Sa(0.92 pM vs 0.93 pM), and VSVAG- Sa (0.31 pM vs 0.94 pM), and VSVAG-S0, but the latter only after purification (Not calculated vs 1.81 pM) (FIGURE 9 and FIGURE 10). PCM-0068389, while showing extremely promising activity and selectivity before purification, completely lost all activity against VSVAG-Sw, its variants and VSVAG-SM after purification and showed some activity against VSVAG-G at concentrations higher than 10 pM (FIGURE 9 and FIGURE 10). PCM-0166392 and PCM- 0179622 while retaining relatively high activity against VSVAG-Sw and its variants was not selective against VSVAG-SM yielding a dose-response curves that were not significantly different from VSVAG-G (FIGURE 9 and FIGURE 10)[000309] PCM-0163855 retained high selectivity to VSVAG-Sw (0.60 pM vs 0.70 pM), VSVAG-Sa(0.37 pM vs 0.40 pM), and VSVAG-Sa (0.45 pM vs 0.49 pM), with only moderateactivity against VSVAG-S0(41.18 pM vs 30.77 pM) but was inactive against VSVAG-SM, showing no significant difference from VSVAG-G above 10 pM concentration (FIGURE 9 and FIGURE 10). Consistently, PCM-0163855 inhibited the replication of bona fide SARS-CoV-2 Delta (B.1.617.2) in VeroE6 cells with and without TMPRSS2 overexpression (6.71 pM and 6.43 pM respectively; FIGURE 11 A).Example 6: A PCM-0163855 derivative (Compound 12), is a broad-spectrum candidate[000310] Objective'. To assess if a derivative of PCM-0163855 may also be a broad-spectrum Coronavirus entry inhibitor candidate.[000311] Results'. PCM-0163855 (Compound 11) and its sulfoxide derivative (PCM-0282478; Compound 12) were synthesized (FIGURE 12). The IC50 value of these two compounds was evaluated against VSVAG-Sa, VSVAG-S0, VSVAG-G, and VSVAG-SM, and bona fide SARS- CoV-2 variants, Delta (B.l.617.2), XBB.1.5 and CH.1.1 (FIGURE 13A and FIGURE 14A). Dose-response curves demonstrated that PCM-0282478 (Compound 12) was approximately 10 times more potent than synthesized PCM-0163855 (Compound 11) against VSVAG-Sa (1.13 pM and 14.40 pM respectively) and selective against VSVAG-S0and VSVAG-SM (14.67 pM and 17.12 pM respectively). Neither PCM-0163855 nor PCM-0282478 inhibited VSVAG-G up to 10 pM. Furthermore, only PCM-0282478 inhibited bona fide SARS-CoV-2 Delta (B.1.617.2) replication in VeroE6 cells (4.49 pM; FIGURE 13A), and neither inhibited XBB.1.5 and CH.1.1 at the concentration range tested.[000312] PCM-0282478 was synthesized as a racemic mixture. To evaluate the contribution of each enantiomer, the enantiomers were separated and are identified herein as PCM-0296173 (5- enantiomer; Compound 12b) and PCM-0296174 ( ’-enantiomer; Compound 12a), and evaluated their IC50 value against VSVAG-Sa, VSVAG-S0, VSVAG-G, and VSVAG-SM (FIGURE 13B). Only PCM-0296174 potently inhibited VSVAG-Sa and was selective against VSVAG-So and VSVAG-SM (12.75 pM and 30.19 pM, respectively). The IC50 of value of PCM- 0296174 against VSVAG-Sa was approximately half compared to the racemic mixture PCM- 0282478 (0.56 pM vs 1.13 pM, respectively), showing potency increased two-fold. Both PCM- 0296173 and PCM-0296174 did not inhibit VSVAG-G up to 10 pM. Further, only PCM-0296174 inhibited SARS-CoV-2 Delta (B. l.617.2) replication, and its IC50 improved by 2-folds in presence of an inhibitor against the multi drug resistance protein 1 (MDR1) efflux transporter (1.88 pM vs 0.89 pM respectively; FIGURE 13B). Furthermore, PCM-0296174 reduced theinfectivity by 100 folds in a plaque assay (FIGURES 15A-15C). Finally, PCM-0296174 did not inhibit Spike-mediated receptor interactions (FIGURE 16). Taken together, these experiments suggest that PCM-0296174 is abroad-spectrum selective S glycoprotein inhibitor downstream of receptor binding.[000313](FIGURE 17A and FIGURE 17B) As part of a structure-activity relationship (SAR) study, 24 racemic derivatives of PCM-0282478 were synthesized and evaluated for their inhibitory activity against VSVAG-Ss, VSVAG-S0, VSVAG-SM, and VSVAG-G (FIGURE 18). Among the derivatives tested, PCM-097098 emerged as the most potent compound, exhibiting lower IC50 values against VSVAG-Ss (1.12 pM), VSVAG-S0(6.97 pM), and VSVAG-SM (7.22 pM) compared to the parent compound PCM-0282478 (IC50 values: 5.43 pM, 23.72 pM, and 21.42 pM, respectively). Notably, PCM-097098 showed no inhibitory activity against VSVAG-G at concentrations up to 10 pM, indicating a high degree of selectivity for CoVs. (FIGURE 18) Interestingly, racemic PCM-0282478 was more potent against VSVAG-Ss, VSVAG-S0, and VSVAG-SM than enantiomerically pure PCM-0296174 (5.21 pM, 18.64 pM, and 15.12 pM, respectively). Given the superior potency and selectivity of racemic PCM-097098, its enantiomerically pure form may be even more potent and selective against VSVAG-Ss, VSVAG- So, and VSVAG-SM.Summary of Examples 2-6[000314] The Covid-19 pandemic highlighted the pressing need for antiviral therapeutics capable of mitigating infection and spread of emerging coronaviruses (CoVs). A promising therapeutic strategy lies in inhibiting viral entry mediated by the Spike (S) glycoprotein. To identify small molecule inhibitors that block entry downstream of receptor binding, a high- throughput screening (HTS) platform was established based on pseudoviruses. A three-step process was employed to screen nearly 200,000 small molecules. First, potential inhibitors were identified by assessing their ability to inhibit pseudoviruses bearing the SARS-CoV-2 S glycoprotein. Subsequent counter-screening against pseudoviruses with the Vesicular Stomatitis Virus glycoprotein (VSV-G), yielded sixty-five SARS-CoV-2 S-specific inhibitors. These were further tested against pseudoviruses bearing the MERS-CoV S glycoprotein, which uses a different receptor. Out of these, five compounds including the known broad-spectrum inhibitor Nafamostat, were subjected to further validation, testing them against pseudoviruses bearing theS glycoprotein of the alpha, delta, and omicron variants as well as against bona fide SARS-CoV- 2 in vitro. This rigorous approach revealed a novel inhibitor and a derivative thereof (Compound 12 and Compound 12a, respectively, as potential broad-spectrum antivirals. These results validate the HTS platform and set the stage for lead optimization and future pre-clinical, in vivo studies. [000315] Briefly, to identify potential CoVs fusion inhibitors (viral entry inhibitors), an HTS platform was developed that relies on a phenotypic assay of infection using well -characterized, replication-deficient VSVAG pseudoviruses that can be studied at biosafety level 2 (BSL-2) and express a fluorescent reporter upon infection. This allowed the production and accurate tittering of pseudoviruses featuring the S glycoproteins from SARS-CoV-2 variants and MERS-CoV, which was essential for establishing pseudoviruses preparation with titers of 104infections per ml (FIGURE IF). If the titers had dropped below 103infections per ml, the feasibility of using 384-well plates would have been compromised, rendering the screening process both economically and logistically prohibitive.[000316] Fluorescent reporters were employed instead of the more commonly used luciferase, demonstrating their advantages which include direct measurement of single infection events, high signal -to-noise ratio, and reduced processing (FIGURES 1B-1C). Moreover, fluorescent reporters with different wavelengths enable the simultaneous examination of multiple viruses under the same experimental conditions (FIGURE 1G).[000317] The HTS platform was leveraged to screen a comprehensive library of approximately 200,000 compounds, targeting potential CoV fusion inhibitors (FIGURE 5A). The three-tiered assay incorporated two class I viral glycoproteins from phylogenetically distant CoVs (SARS- CoV-2 & MERS-CoV), and a class III glycoprotein from VSV (FIGURE 5A). The primary screen against VSVAG-Sw yielded 733 compounds with inhibitory activity, including known inhibitors of proteases, ubiquitin-specific peptidases, and viral gene expression regulated by the HSP90 protein family. The secondary screen showed that most of these compounds also inhibit VSVAG-G, yielding only 65 putative spike-specific inhibitors. Finally, the tertiary screen against VSVAG-SM separated receptor binding and putative S2-specific inhibitors, highlighting four compounds, Compounds 1, 5, 6, and 11, and the known TMPRSS2 inhibitor Nafamostat (FIGURES 5C-5D)[000318] Following validation only PCM-0163855 was retained as a potential selective S glycoprotein inhibitor (FIGURE 10). Surprisingly, its sulfoxide derivative PCM-0282478 inhibited VSVAG-Sw, VSVAG-S0, VSVAG-SM and bona fide SARS-CoV-2 delta virusreplication (FIGURES 13A and 13B). This rigorous approach revealed a novel inhibitor, Compound 11, and its derivative, Compound 12, as potential broad-spectrum antiviral compounds. Finally, it was shown that only one of the PCM-0282478 derived enantiomers, PCM- 0296174, inhibits VSVAG-Sw, VSVAG-S0, VSVAG-SM and bona fide SARS-CoV-2 delta virus replication, highlighting its potential as a broad-spectrum inhibitor of CoVs (FIGURES 13A and 13B). Intriguingly, Nafamostat failed to inhibit bona fide SARS-CoV-2 delta virus replication, perhaps due to the capacity of CoVs to infect cells in a TMPRSS2-independent pathway (FIGURE 14)[000319] These findings reinforce the utility of the HTS platform in identifying novel CoVs inhibitors with the potential to deepen our understanding of coronavirus biology. Elucidating the precise antiviral mechanisms employed by these inhibitors warrants further exploration. The synthesis and analysis of novel compound of Formula 11A, provides a promising compound with broad-spectrum antiviral activity. Hence, the present study lays the groundwork for potential development of a new class of small molecules, holding promise for mitigating the impacts of future pandemics.[000320] While certain features of the broad spectrum Coronavirus entry inhibitor compounds and uses thereof have been illustrated and described herein, many modifications, substitutions, changes, and equivalents will now occur to those of ordinary skill in the art. It is, therefore, to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention.

Claims

CLAIMSWhat is claimed is:

1. A compound represented by the structure of Formula XII, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinA and B rings are each independently a substituted or unsubstituted single or fused aromatic or heteroaromatic ring system, substituted or unsubstituted single or fused C3-C10 cycloalkyl, or substituted or unsubstituted single or fused heterocycloalkyl;L5 and Le are each independently selected from H, linear or branched alkyl, linear or branched alkoxy, linear or branched haloalkyl; single or fused cycloalkyl, single or fused heterocyclic ring, single or fused aryl, single or fused heteroaryl -(CH2)n- cycloalkyl, -(CH2)n-heterocyclic ring, -(CH2)n-aryl, and -(CH2)n-heteroaryl; or L5 and Le join together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring; n and m are each independently an integer between 0-10; wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted; and wherein said * indicates a chiral center.

2. The compound according to claim 1, represented by the structure of Formula XII-A, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:whereinC and D rings are each independently a single or fused aryl or heteroaryl;L5 and Le are each independently selected from H, linear or branched alkyl, linear or branched alkoxy, linear or branched haloalkyl; single or fused cycloalkyl, single or fused heterocyclic ring, single or fused aryl, single or fused heteroaryl -(CH2)n- cycloalkyl, -(CH2)n-heterocyclic ring, -(CH2)n-aryl, and -(CH2)n-heteroaryl; or L5 and Le join together to form a 5 or 6 membered substituted or unsubstituted, aliphatic or aromatic, carbocyclic or heterocyclic ring; n is an integer between 0-10; wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocyclic ring, aryl, and heteroaryl are each independently substituted or unsubstituted; and wherein * indicates a chiral center.

3. The compound according to claim 1 or claim 2, represented by the structure of Compound 12, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:wherein * indicates a chiral center.

4. The compound according to claim 3, wherein said isomer is represented by the structure of Compound 12a or a derivative thereof, or a pharmaceutically acceptablesalt thereof, or any combination thereof,5. The compound according to claim 3, wherein said isomer is represented by the structure of Compound 12b or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof,6. The compound according to claim 3, wherein said derivative is represented by the structure of Compound 12-X or an isomer thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof,7. The compound according to claim 6, wherein said isomer is represented by the structure of Compound 12-Xa, or a pharmaceutical acceptable salt thereof, or any combination thereof.

8. The compound according to claim 6, wherein said isomer is represented by the structure of Compound 12-Xb, or a pharmaceutical acceptable salt thereof, or any combination thereof.

9. A pharmaceutical composition comprising a compound according to any of claims 1-8.

10. A compound according to any one of claims 1-8 or a pharmaceutical composition according to claim 9, for use in inhibiting or reducing a Coronavirus infection, wherein said inhibiting is downstream of receptor binding.

11. The compound for use according to claim 10, wherein said inhibition or reduction of the Coronavirus infection comprises inhibition of a primary infection or a secondary infection.

12. The compound for use according to claim 10 or claim 11, wherein said Coronavirus comprises a Spike glycoprotein homologous to the Spike of SARS-CoV, SARS-CoV-2, or MERS-CoV and their variants.

13. A compound represented by any one of the structures of Compounds 1-11, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:for use inhibiting or reducing a Coronavirus infections, wherein said inhibiting is downstream of receptor binding.

14. The compound for use according to claim 13, wherein said inhibition or reduction of the Coronavirus infection comprises inhibition of a primary infection or a secondary infection.

15. The compound for use according to claim 13 or claim 14, wherein said Coronavirus comprises SARS-CoV, SARS-CoV-2, or MERS-CoV.

16. A compound according to any one of claims 1-8 or a composition according to claim 9, for use treating a Coronavirus infection.

17. The compound for use according claim 16, wherein said Coronavirus comprises a Spike glycoprotein homologous to the Spike of SARS-CoV, SARS-CoV-2, or MERS-CoV and their variants.

18. A compound represented by any one of the structures of Compounds 1-11, or an isomer thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof, or any combination thereof:for use treating a Coronavirus infection.

19. The compound for use according to claim 18, wherein said Coronavirus comprises a Spike glycoprotein homologous to the Spike of SARS-CoV, SARS-CoV-2, or MERS-CoV, and their variants.

Images