Application of RIG-I inducer in preparation of drug for treating DNA demethylation drug resistance acute myelogenous leukemia

Abstract

The invention relates to the technical field of biological medicines, in particular to application of an RIG-I inducer in preparation of a medicine for treating DNA demethylation medicine resistance acute myelogenous leukemia. The invention finds that although ERV dsRNA overload occurs in HMA drug-resistant cells, the viral receptor RIG-I down-regulation results in a drug-resistant mechanism that cannot trigger an IFN anti-tumor pathway, and the HMA drug-resistant mechanism based on viral receptor abnormality is a brand-new and never reported HMA drug-resistant mechanism. ATRA and TAM which can efficiently and specifically kill HMA drug-resistant AML cells are found, ATRA and TAM can specifically kill HMA drug-resistant AML, the killing effect on the drug-resistant AML cells is 4099 times and 28036 times of the killing effect on parent cells respectively, IC50 of TAM on the drug-resistant cells reaches the amazing pmol level, and the results show that ATRA and TAM have huge potential for treating HMA drug-resistant patients.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of biological medicine, and in particular to application of a RIG-I inducer in preparation of a DNA hypomethylation drug-resistant acute myeloid leukemia drug. BACKGROUND

[0002] Acute myeloid leukemia (AML) is a malignant disease caused by abnormal proliferation and differentiation of hematopoietic stem cells (HSC), characterized by proliferation, expansion and differentiation arrest of myeloid precursor cells (i.e. myeloid blast cells) in bone marrow and peripheral blood. The proliferation of such myeloid precursor cells is at the expense of normal production of terminally differentiated blood (such as red blood cells, platelets and white blood cells). Without experiencing myelodysplasia in the early stage, AML usually appears symptoms within a few weeks. In addition to non-specific symptoms such as fatigue and loss of appetite, AML also has the typical characteristics of bone marrow failure: fatigue and shortness of breath after exercise due to anemia, repeated infections due to neutropenia and a tendency to bruising and bleeding due to thrombocytopenia.

[0003] Before the 1960s, AML was considered to be an incurable disease. But with the progress of chemotherapy, allogeneic hematopoietic stem cell transplantation (Allo-HSCT) and supportive therapy, by the 1970s, a small number of patients (mainly people under the age of 60) were able to survive. Since then, the treatment effect of young patients has continued to improve, but the birth rate of elderly patients has not significantly increased.

[0004] Hypomethylating agents (HMA) are widely used in the treatment of myeloid leukemia. In clinical trials and actual applications for the treatment of AML, HMA has shown better efficacy. Typical HMA includes azacytidine (5-azacytidine azacytidine azacytidine, AZA) and decitabine (decitabine decitabine decitabine, DAC). However, almost all patients receiving HMA treatment will develop drug resistance, but the mechanism is not fully elucidated. Although HMA is widely effective for AML patients, the duration of its efficacy is relatively short, and almost all AML patients will develop resistance to HMA treatment and relapse.

[0005] Therefore, it is a major challenge for the clinical treatment of AML to reveal the HMA drug resistance mechanism, overcome the HMA drug resistance, and on this basis, reasonably design a new treatment plan. SUMMARY

[0006] In order to solve the above problems, the purpose of the present application is to provide the application of RIG-I inducer in the preparation of a drug for treating DNA demethylation drug-resistant acute myeloid leukemia.

[0007] The purpose of the present application can be achieved by the following technical solutions:

[0008] The present application provides the application of RIG-I inducer in the preparation of a drug for treating DNA demethylation drug-resistant acute myeloid leukemia.

[0009] Further, the drug is a drug for activating IFN response to kill DNA demethylation drug-resistant acute myeloid leukemia cells.

[0010] Further, the RIG-I inducer is a RIG-I inducer capable of combining with the RAR alpha active pocket.

[0011] Further, the RIG-I inducer is a structural analog of a type I RAR alpha agonist or a structural analog of a type II RAR alpha agonist;

[0012] The structural analog of the type I RAR alpha agonist is selected from one of CD437, Fr12989, Fr12259, Fr12635, Kartogenin, Naptalam, S119-8, Indobufen, Ftaxilide, CHIKV-IN-2, LG-100064, TTNPB, Palovarotene, Ch55, Trifarotene, UVI 3003, PA452, TAZA, WYC-210, SSAA09E3, AES-350, Tazarotene, Adapalene, TAM or AM580;

[0013] The structural analog of the type II RAR alpha agonist is selected from one of AT4OA, Transcrocetin, beta-Apo-8'-carotenal, Retinol, Safranal, ATR, Lycopene, Etretinate, beta-Ionone, Retinyl acetate, beta-Carotene, Canthaxanthin, Fenretinide, SR 11302, Crocin, Zeaxanthin, Fucoxanthin, Astaxanthin, Methyl 13-cis-4-Oxoretinoate, Peretinoin, Isotretinoin, ATRA, or Acitretin.

[0014] Further, the RIG-I inducer is selected from one or more of TAZA or TAM.

[0015] Further, the concentration of TAZA in the drug is 0.01-100 µM; the concentration of TAM in the drug is 0.001-10 µM.

[0016] Further, the RIG-I inducer is ATRA.

[0017] Further, the drug is a drug that uses ATRA to activate RAR alpha to promote RIG-I upregulation and activate IFN response to kill DNA demethylation drug-resistant acute myeloid leukemia cells.

[0018] Further, the concentration of ATRA in the drug is 0.01-10 µM.

[0019] Compared with the prior art, the present application has the following beneficial effects:

[0020] The present application discloses the first HMA drug resistance molecular mechanism based on viral receptor abnormality, reveals and overcomes HMA drug resistance, which is a recognized AML clinical treatment problem to be solved urgently. The present application finds that although the ERV dsRNA of HMA drug-resistant cells is overloaded, the viral receptor RIG-I is down-regulated, which leads to the failure to trigger the IFN anti-tumor pathway, and the drug resistance mechanism is a new one that has never been reported based on viral receptor abnormality.

[0021] The present application finds that ATRA and TAM can efficiently and specifically kill HMA-resistant AML cells. ATRA and TAM are both approved old drugs, which theoretically have the possibility of quickly entering clinical trials for verification. These two drugs have been clinically used for differentiation therapy in APL subtype of AML. The present application first finds that ATRA and TAM can specifically kill HMA-resistant AML, and the killing effect on drug-resistant AML cells is as high as 4099 times and 28036 times, respectively, the killing effect on parent cells. The IC 50 reaches an amazing pmol level, indicating their great potential for treating HMA-resistant patients. Further, the drug resistance mechanism based on RIG-I down-regulation is verified in mice and patient primary samples, and it is observed that ATRA and TAM can efficiently and specifically kill HMA-resistant cells. The old AML treatment drugs ATRA and TAM are expected to be directly used in clinical trials of HMA-resistant AML patients to verify the scientific discovery of the present application, which is expected to more efficiently and quickly provide a treatment plan for HMA-resistant AML patients. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 Preparation of HMA-resistant AML cells; (A) Preparation of DAC-resistant THP-1 cells. (B) Cells were treated with increasing doses of DAC for 72 hours, and then cell viability was detected.

[0023] Figure 2 Screening of FDA-approved drug library; (A) Schematic diagram of high-throughput drug screening with parent and DAC-resistant THP-1 cells. Cells were seeded in 384-well plates, and various FDA-approved drugs (1 μM) were added to treat for 5 days. Cell viability of the two cells was detected and compared. (B and C) Cell viability of parent cells (B) and DAC-resistant cells (C) after drug treatment. Drugs were sorted according to cell viability results. (D) Fold change of parent cell viability compared to drug-resistant cell viability after treatment with each drug. Drugs were sorted according to fold change.

[0024] Figure 3 Results of ATRA efficiently and selectively killing HMA-resistant AML cells; (A, B, D, F) The corresponding cells were treated with increasing doses of ATRA drug for 72 hours, and then cell viability detection was performed. IC 50 values were calculated by nonlinear curve fitting of GraphPad Prism 8.0, and IC 50 shift (fold). (C, E, G) Phase contrast microscope images of the corresponding cells treated with 1 μM ATRA for 72 hours.

[0025] Figure 4Schematic diagram of the changes of dsRNA sensor RIG-I in HMA-resistant strains; (A and B) qRT-PCR detection of the mRNA levels of the corresponding dsRNA sensors in the corresponding cells. (C and D) Immunoblot detection of RIG-I and MAVS proteins in the corresponding cells. (E) Immunofluorescence staining of RIG-I protein in the corresponding cells.

[0026] Figure 5 Schematic diagram of the verification of HMA resistance mechanisms on AML patient primary samples; (A) Schematic diagram of the experimental design for studying RIG-I expression and HMA sensitivity in primary PBMCs. Peripheral blood (PB) samples were collected from 15 newly diagnosed acute myeloid leukemia (AML) patients and 5 AML patients who relapsed after receiving DAC or AZA treatment, followed by isolation and culture of PBMCs. Then the relevant detection was carried out according to the designed experimental steps. The type of HMA (DAC or AZA) used for PBMCs of relapsed patients was the same as that used in the clinical treatment of the patient. (B) qRT-PCR detection of RIG-I in the corresponding primary PBMCs. (C) Immunofluorescence staining of RIG-I in primary PBMCs from patient #2 and patient #16. (D-I) After treating PBMCs with 1 μM of HMA for 72 hours, the relevant detection was carried out according to the experimental design. (D) qRT-PCR detection of IFNA1 and IFNB1. (E) The culture medium was collected and used for ELISA detection of IFN-α and IFN-β secretion. (F) qRT-PCR detection of MX1. (G) Immunofluorescence staining of MX1 protein in representative primary PBMCs. (H) The corresponding cells were observed under a microscope and counted, and the inhibition rate was color-coded according to the quartile. (I) Phase contrast microscope images of the corresponding representative primary PBMCs.

[0027] Figure 6 Schematic diagram of the results of ATRA activating IFN response of HMA-resistant cells by complementing RIG-I; (A) After treating the corresponding cells with ATRA for 24 hours, immunoblot detection of the corresponding proteins was carried out by SDD-AGE and SDS-PAGE. (B and C) After treating the corresponding cells with 1 μM ATRA for 72 hours, the mRNA levels of the corresponding ISGs were detected by qRT-PCR.

[0028] Figure 7Schematic diagram of ATRA promoting RIG-I upregulation through activating RARa; (A and B) Cells were treated with increasing doses of AR7 for 4 hours, followed by 1 mM ATRA for 72 hours, and then cell viability was detected. (C) Cells were treated with increasing doses of AM580 for 72 hours, and then cell viability was detected. (D-F) Cells were pretreated with 10 mM AR7 for 4 hours, followed by 1 mM ATRA for 24 hours and immunoblotting (D), or 72 hours and qRT-PCR detection (E and F), respectively. (G and H) Cells were treated with 1 mM ATRA or AM580 for 24 hours and immunoblotting (G), or 72 hours and qRT-PCR detection (H), respectively. (I-K) Cells were transfected with siRNA for 24 hours, followed by 1 mM ATRA for 48 hours, and then immunoblotting (I) and qRT-PCR detection (J and K), respectively.

[0029] Figure 8 Schematic diagram of the killing effect and mechanism of ATRA in primary samples of AML patients; (A) Schematic diagram of experimental design for studying ATRA sensitivity in primary PBMCs. (B-I) After treating PBMCs with 1 mM ATRA for 72 hours, the relevant detection was performed according to the experimental design. (B) qRT-PCR detection of RIG-I in the corresponding primary PBMCs. (C) Immunofluorescence staining of RIG-I protein in representative primary PBMCs. (D) qRT-PCR detection of IFNA1 and IFNB1. (E) The culture medium was collected and used for ELISA detection of IFN-a and IFN-b secretion. (F) qRT-PCR detection of MX1. (G) Immunofluorescence staining of MX1 protein in representative primary PBMCs. (H) The corresponding cells were observed under a microscope and counted, and the inhibition rate was color-coded according to the quartile. (I) Phase contrast microscope images of the corresponding representative primary PBMCs.

[0030] Figure 9 Survival observation experiment results of HMA-resistant AML mice; (A) Schematic diagram of HMA-resistant AML mouse survival observation experiment. DAC-resistant THP-1 cells were inoculated into NCG mice through tail vein injection (i.v.) on day -7. Mice were dosed from day 0, and were injected intraperitoneally (i.p.) with solvent, DAC or ATRA until death. There were 8 mice in each group. (B) Kaplan-Meier survival curve of mice in (A), plotted using GraphPad Prism 8.0 software. Log-rank (Mantel-Cox) test was used to compare the survival difference between different groups.

[0031] Figure 10Figure for HMA-resistant AML mouse disease progression monitoring experiment; (A) Schematic of HMA-resistant AML mouse disease progression monitoring experiment. The mice were inoculated with DAC-resistant THP-1 cells and treated with HMA (hydroxyurea, HU) or ATRA (all-trans retinoic acid) from day 0. The mice were monitored for disease progression and sacrificed at day 17. Figure 11 (A) Similar, but all mice were sacrificed at day 17 and spleen and peripheral blood were collected for corresponding experiments. (B) Photographs of spleens collected at day 17. (C) Weight of spleens. (D) Proportion of human CD45-positive cells (inoculated DAC-resistant THP-1 cells) in collected peripheral blood was detected by flow cytometry. (E) Hematology parameters in collected peripheral blood: WBC, white blood cell. RBC, red blood cell. HGB, hemoglobin. HCT, hematocrit. PLT, platelet. (F) Expression of corresponding genes in collected peripheral blood and spleen was detected by qRT-PCR.

[0032] Figure 11 Figure for construction of potential RIG-I inducer library; (A) Workflow for construction of potential RIG-I inducer small molecule library. 54 commercially available small molecules were found to bind RARa with high affinity (<-8.0 kcal / mol) by 1-click Docking prediction. In addition, 48 commercially available small molecules with high structural similarity (Tanimoto score > 0.3) to known RARa agonists (Type I TAM, AM580, Tazarotene and Adapalene or Type II Peretinoin, Isotretinoin, ATRA and Acitretin) were collected, which together composed the small molecule library. (B) Tanimoto similarity calculation of 48 RARa agonist analogs. Tanimoto similarity calculation was performed on SMILES format of these small molecules using R language. (C) Schematic of compound screening in parental and DAC-resistant AML cells. Cells were inoculated in 384-well plates and treated with various small molecule compounds (1 mM) in (A) for 5 days. Cell viability of two types of cells was detected and compared.

[0033] Figure 12 Figure for screening of potential RIG-I inducer library; (A-C) Results of 1 mM compound screening experiment. (A and B) Cell viability of parental (A) and DAC-resistant (B) cells after compound treatment. Drugs were ranked according to cell viability results. (C) Fold change of parental cell viability compared to resistant cell viability after each drug treatment. Drugs were ranked according to fold change. (D-F) Results of 0.1 mM compound screening experiment, similar to (A-C) shown. Drugs with larger fold change than ATRA at 1 mM concentration were indicated with red bars or dots.

[0034] Figure 13Pharmacodynamic evaluation results of the screening results of the potential RIG-I inducer library; (A) scatter plot of the fold change of the viability of the parental and DAC-resistant THP-1 cells. The data were derived from the screening experiment using 1 μM and 0.1 μM concentrations of the compound library. (B) Summary table of the IC50values and IC50shift (fold) of the screened compounds in the two cell lines. (C and D) Chemical structures of TAZA and TAM, and the corresponding cell viability curves after treating the parental and DAC-resistant THP-1 cells with increasing doses of TAZA and TAM, respectively, for 72 hours. The IC50values and IC50shift (fold) were calculated. 50 (E) The corresponding cell viability curves after treating the parental and DAC-resistant THP-1 cells with increasing doses of the corresponding compounds, respectively, for 72 hours. The IC50values and IC50shift (fold) were calculated. 50 (E) The corresponding cell viability curves after treating the parental and DAC-resistant THP-1 cells with increasing doses of the corresponding compounds, respectively, for 72 hours. The IC50values and IC50shift (fold) were calculated.

[0035] Figure 14 Results of the killing effect and mechanism of TAZA and TAM in AML patient primary samples; (A-D) PBMCs from 20 newly diagnosed or relapsed AML patients were treated with 1 μM TAZA or TAM, and the relevant tests were performed according to the experimental design after 72 hours. (A) The corresponding cells were observed under a microscope and counted, and the inhibition rate was color-coded according to the quartile. (B) Phase contrast microscope images of the corresponding representative primary PBMCs. (C and D) The culture medium was collected and used for ELISA detection of the secretion amounts of IFN-α and IFN-β.

[0036] Wherein, NES represents the normalized enrichment score; FDR represents the false discovery rate; PT represents the patient; FC represents the fold change; NS, not significant; *P < 0.05, **P < 0.01; ***P < 0.001; Cpds, compound; r is the Pearson correlation coefficient; the scale is 50 μm, and the legends are the same in the same group of figures. DETAILED DESCRIPTION

[0037] The application will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0038] In the following examples, unless otherwise specified, the reagents used are commercially available reagents, and the detection means and methods used are conventional detection means and methods in the art; the results are shown as mean ± standard deviation (n = 3 biological replicates).

[0039] Example 1

[0040] This example provides a high-throughput screening of drugs that specifically kill HMA-resistant AML cells, as follows:

[0041] (1) Cell culture and cryopreservation

[0042] THP-1, OCI-AML3, and HL-60 cells were cultured in RPMI 1640 medium (p22400105, Thermo Fisher), supplemented with 10% fetal bovine serum (FBS), 100 U / mL penicillin, and 100 mg / mL streptomycin (p15140-122, Thermo Fisher). OCI-AML3 cells were purchased from the German Society for the Preservation of Microbial Cultures (DSMZ), and the other cell lines were purchased from the American Type Culture Collection (ATCC). All cell lines were identified by short tandem repeat (STR) sequence analysis and confirmed to be free of mycoplasma contamination. Peripheral blood mononuclear cells (PBMCs) from patients with acute myeloid leukemia were cultured in RPMI 1640 medium containing 20% ​​FBS, 100 U / mL penicillin, and 100 mg / mL streptomycin. All cells were incubated at 37°C with 5% CO2.

[0043] (2) Construction of HMA-resistant AML cells

[0044] Using IC 90 After treating AML cells with HMA until 90% of the cells die, the cells are cultured in HMA-free medium until they confluence; then the next round of HMA treatment is performed.

[0045] The above treatment was repeated for 3 months until significant HMA resistance was observed.

[0046] (3) Compound screening

[0047] For THP-1 parental cells and DAC-resistant cells, a systematic screening was performed using an FDA-approved small molecule drug library (n=1898, 1μM concentration, Tao Shu). After 5 days of compound treatment, cell viability was measured using the CellTiter-Glo cell viability assay kit (G7573, Promega). DMSO (D2650, Sigma) was included as a negative control in each culture plate.

[0048] Results analysis:

[0049] THP-1 cells were treated with DAC at an IC90 dose until cell viability dropped to 10%; the surviving cells were then transferred to fresh medium without DAC and cultured until confluence, followed by another round of DAC treatment. Figure 1 (As shown in A). Repeat the above procedure for 3 months until the IC of the DAC on the drug-resistant strain is detected. 50 The value was significantly increased compared to the parent strain. The IC50 value of DAC was... 50values from 2.31 μM on parental strains to 96.6 μM on drug-resistant strains, with IC 50 values differing by 42-fold, a significant DAC resistance was observed (as shown in Figure 1 B). It was shown that the HMA-resistant AML cells were successfully constructed in this example.

[0050] Further, 1898 FDA-approved drugs were screened by a high-throughput automated drug screening workstation for cell seeding and drug addition, and the CellTiter-Glo method was used to detect cell viability, aiming to screen drugs with the potential to selectively kill DAC-resistant AML cells (as shown in Figure 2 A). After treating THP-1 parental cells (as shown in Figure 2 B) and DAC-resistant THP-1 cells (as shown in Figure 2 C) with 1898 FDA-approved small molecule drugs (at a concentration of 1 μM), it was found that some drugs showed significant selectivity in killing DAC-resistant THP-1 cells (as shown in Figure 2 D, upper right dot). Among them, ATRA, Duvelisib and Afatinib were the most prominent in selectively killing DAC-resistant THP-1 cells.

[0051] Further, the ability of ATRA to kill HMA-resistant AML cells was further explored. In THP-1 cells, ATRA showed extremely strong anti-tumor activity (IC 50 = 8.48 nM) and killing selectivity (4099-fold difference in IC50 values between parental cells and drug-resistant cells) (as shown in Figure 3 A) compared with parental cells. Similarly, in AZA-resistant cells, ATRA also showed extremely strong killing activity (IC 50 = 11.37 nM) and significant selectivity (3055-fold difference in IC 50 values between parental cells and drug-resistant cells) (as shown in Figure 3 B). In THP-1 cells, 1 μM ATRA treatment for 72 hours resulted in the death of almost all DAC- and AZA-resistant cells, while having no significant effect on parental cells (as shown in Figure 3 C). In addition, ATRA also showed great potential in other AML cell lines. In OCI-AML3 cells, ATRA showed a killing selectivity of DAC-resistant cells as high as 1270-fold (IC 50 value of 8.29 nM), and in HL-60 cells, it also showed a selectivity of 404-fold (IC 50 value of 10.73 nM, Figure 3 D-G).

[0052] In summary, this embodiment identifies that ATRA can be used as a new type of potent and highly selective drug to kill HMA-resistant AML cells, laying a foundation for subsequent mechanism research and clinical application.

[0053] Example 2

[0054] This embodiment provides an exploration of the mechanism of HMA resistance and the silencing of IFN anti-cancer immune response in AML, as follows:

[0055] (1) Cell culture and cryopreservation: HEK293T cells were cultured in DMEM medium (11995073, ThermoFisher), and the specific details are referred to step (1) of Example 1.

[0056] (2) Real-time quantitative qPCR (RT-qPCR)

[0057] The drug-treated cells were centrifuged and collected, and total RNA extraction kit was used to isolate RNA from the cells. The quality and concentration of the extracted RNA were determined by absorbance detection on a Nanodrop Eight (Thermo Fisher) instrument. Then 1 μg of total RNA from each sample was transcribed using QIAGEN® II Q RT SuperMix for qPCR (+gDNAwiper) reverse transcription reagent. ChamQTM qPCR Master Mix (Low ROX Premixed) (Q331-02 / 03, Vazyme Biotech, China) was configured as follows:

[0058] 10 μL of reaction system: SYBR qPCR Mix, 5 μL; forward and reverse primers (specific as shown in Table 1, species: human), 0.3 μL each; cDNA template, 0.5 μL; ddH2O, 3.9 μL.

[0059] After adding the above system to the 384-well plate, the PCR special sealing film was pasted, centrifuged for half a minute, and then placed in a ViiA TM7PCR was performed on a 7900HT Fast Real-Time PCR System (Applied Biosystems) instrument with the following conditions (3 replicates per sample): 1) 95°C for 5 min; 2) 95°C for 15 s; 3) 60°C for 60 s; repeat steps 2)~3) for 40 cycles. At the last step of the program, a melting curve was plotted. After the run, the specificity of the PCR product for each primer and sample was checked by melting curve analysis (only results that showed a single peak plot were analyzed). All relative gene expression levels were normalized to RPLP0 expression levels by the comparative Ct method.

[0060] Table 1. Summary of primer sequences

[0061] Sequence ID NO. Name Sequence (5'-3') SEQ ID NO. 1 IFI27-F1 ACCTCATCAGCAGTGACCAGT SEQ ID NO. 2 IFI27-R1 ACATCATCTTGGCTGCTATGG SEQ ID NO. 3 IFI44-F1 GAGAGATGTGAGCCTGTGAGG SEQ ID NO. 4 IFI44-R1 TTTTCCTTGTGCACAGTTGAT SEQ ID NO. 5 ISG15-F ACTCATCTTTGCCAGTACAGGAG SEQ ID NO. 6 ISG15-R CAGCATCTTCACCGTCAGGTC SEQ ID NO. 7 RIG-I-F ATCCCAGTGTATGAACAGCAG SEQ ID NO. 8 RIG-I-R GCCTGTAACTCTATACCCATGTC SEQ ID NO. 9 MDA5-F TCGAATGGGTATTCCACAGACG SEQ ID NO. 10 MDA5-R GTGGCGACTGTCCTCTGAA SEQ ID NO. 11 TLR3-F TTGCCTTGTATCTACTTTTGGGG SEQ ID NO. 12 TLR3-R TCAACACTGTTATGTTTGTGGGT SEQ ID NO. 13 IFNA1-F GCCTCGCCCTTTGCTTTACT SEQ ID NO. 14 IFNA1-R CTGTGGGTCTCAGGGAGATCA SEQ ID NO. 15 IFNB1-F1 CAGCAATTTTCAGTGTCAGAAGC SEQ ID NO. 16 IFNB1-R1 TCATCCTGTCCTTGAGGCAGT SEQ ID NO. 17 MX1-F CTGTAAATCTCTGCCCCTGTTAG SEQ ID NO. 18 MX1-R TCGTGTCGGAGTCTGGTAAAC SEQ ID NO. 19 RPLP0-F GCTTCCTGGAGGGTGTCC SEQ ID NO. 20 RPLP0-R GGACTCGTTTGTACCCGTTG

[0062] (3) Western blot

[0063] After cell collection, PBS was added to wash the cells, and lysis buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% NP-40, 1 mM EDTA, and 1% SDS) was added to mix the cells, which were boiled at 100°C for 5 min. The protein samples were quantified using a BCA kit, and the sample protein concentration was adjusted to be consistent using a protein lysis buffer. The corresponding volume of loading buffer was added, vortexed to mix, and denatured at 100°C for 5 min. The samples were loaded onto a SDS polyacrylamide gel by electrophoresis, and the proteins were transferred from the gel to a PVDF membrane (10600029, GE Healthcare) by electrophoresis again. The PVDF membrane was blocked with milk and incubated with the primary antibody at 1:1000 at 4°C overnight. After washing the membrane with TBST twice, the HRP-conjugated secondary antibody was incubated at room temperature for 1 h. After washing the membrane with TBST three times, the protein bands were visualized using a color developing substrate.

[0064] (4) Detection of MAVS oligomerization

[0065] Mitochondria were isolated using a mitochondria isolation kit (89874, Thermo Fisher) and resuspended with lx sample buffer (0.5x TBE, 10% glycerol, 2% SDS, and 0.0025% bromophenol blue) to perform a semi-denaturing agarose gel electrophoresis (SDD-AGE). The samples were loaded onto a 1.5% vertical agarose gel. After electrophoresis at a constant voltage of 100 V for 40 min in an electrophoresis buffer (lx TBE and 0.1% SDS) at 4°C, the proteins were transferred to a PVDF membrane for immunoblotting.

[0066] (5) Cell viability assay: Cells were seeded in 96-well plates at a density of 20% and 100 μL of culture medium was added (cells were not seeded in the wells near the edge and PBS buffer was added to avoid the influence of solution evaporation on experimental results). Control and blank groups were designed and gradient-diluted drugs were added in the remaining wells in a sample of three wells as a biological repeat. After incubation in an incubator for 3-5 days (depending on the characteristics of the drug), 10 μL of Cell Counting Kit-8 reagent was added to each well, and then incubated in the incubator for 2 hours. The absorbance of each well at 450 nm was measured by a microplate reader, and after obtaining the data, the absorbance values of all drug-treated samples were compared with the control group without drugs to calculate the relative cell viability.

[0067] (6) Immunofluorescence staining: The suspended cells to be observed were spread on the glass slide by the method of spinning, and then the cells were fixed in 4% paraformaldehyde-PBS buffer for 15 minutes, and then permeated by 0.2% Triton X-100 for 5 minutes, and then blocked in 1% BSA solution prepared with PBS for 10 minutes. After washing away the blocking solution, the primary antibody was incubated for 1 hour. After washing twice with PBS, the secondary antibody was incubated for 20 minutes, and after washing three times, DAPI-containing mounting medium and a cover glass were added, and the image was observed and collected under a fluorescence microscope.

[0068] (7) Peripheral blood mononuclear cell (PBMC) extraction

[0069] Fresh peripheral blood of patients was collected in purple EDTA anticoagulant tubes, and the following extraction was performed. First, the peripheral blood in the anticoagulant tube was sucked into a 15 mL centrifuge tube, 4 mL per tube. Then an equal volume of PBS was added and mixed gently. A new 15 mL centrifuge tube was taken and 3 mL of separation solution (Stemcell, 07851) was added. The diluted peripheral blood was slowly added to the separation solution along the wall of the tube. Centrifuge at 2000 rpm for 15 min, and the speed of both up and down is adjusted to 3 gears (the highest is 9 gears). After centrifugation, the cells suspended in the middle layer (a very thin layer of white cells) were sucked into a 15 mL centrifuge tube containing 10 mL of PBS. Centrifuge at 2000 rpm for 5 min, and the speed of both up and down is adjusted to 9 gears. After centrifugation, the supernatant was discarded. The cell pellet was frozen, and 2 tubes could be frozen for every 5 mL of blood.

[0070] (8) ELISA detection

[0071] After the PBMCs were treated with drugs, the supernatant was collected and subjected to ELISA detection, and the steps were as follows:

[0072] 1) Prepare various solutions according to the instructions of the ELISA kit.

[0073] 2) Determine the number of strips required according to the number of samples to be tested and the number of standard samples, and add 1 hole as a blank control hole. Add the supernatant and different concentrations of standard samples (100 μL / hole) into the corresponding holes (zero hole only adds standard sample / sample diluent), seal the reaction holes with sealing tape, and incubate in a 37°C incubator for 90 minutes (except for the blank control hole).

[0074] 3) Wash the plate 4 times: shake off the liquid in the hole, add 350 μL of washing liquid to each hole, stand for 30 seconds, then shake off the liquid, and dry on thick stacked absorbent paper.

[0075] 4) Add biotinylated antibody working solution (100 μL / hole). Seal the reaction holes with sealing tape, and incubate in a 37°C incubator for 60 minutes (except for the blank control hole).

[0076] 5) Wash the plate 4 times.

[0077] 6) Add enzyme conjugate working solution (100 μL / hole). Seal the reaction holes with sealing tape, and incubate in a 37°C incubator for 30 minutes (except for the blank control hole).

[0078] 7) Wash the plate 4 times.

[0079] 8) Add 100 μL of color developing agent per hole, avoid light, and incubate in a 37°C incubator for 15 minutes.

[0080] 9) Add 100 μL of termination solution per hole, mix immediately, and then measure the OD450 value (within 5 minutes).

[0081] Result analysis:

[0082] There are three common dsRNA receptors, including RIG-I, MDA5, and TLR3. Among the three receptors, only the transcription level of RIG-I was significantly down-regulated in DAC and AZA resistant THP-1 cells ( Figure 4 A). This phenomenon is not limited to DAC resistant THP-1 cells, but also observed in DAC resistant OCI-AML3 and HL-60 cells ( Figure 4 B).

[0083] Further, the related proteins were detected by immunoblotting and immunofluorescence staining. The results showed that in DAC and AZA resistant THP-1 cells, the protein level of RIG-I was significantly down-regulated ( Figure 4 C and 4E). And in DAC resistant OCI-AML3 and HL-60 cells, the protein level of RIG-I was also significantly down-regulated ( Figure 4 D and 4E).

[0084] Further, it was investigated whether the above HMA resistance mechanisms exist in AML patients who relapsed after HMA treatment. A total of 20 AML patients (Table 2) were followed up. Among them, 15 were newly diagnosed AML patients, and 5 were AML patients who relapsed after HMA treatment, including 3 patients who received DAC treatment and 2 patients who received AZA treatment.

[0085] Table 2 Detailed information of 20 AML patients from PBMC

[0086] Patient No. Gender Age Disease Type Status 1 Female 58 AML-M4 Initial diagnosis 2 Male 75 AML-M5 Initial diagnosis 3 Male 19 AML Initial diagnosis 4 Male 53 AML-M4 Initial diagnosis 5 Female 57 AML-M5 Initial diagnosis 6 Male 54 AML-M2 Initial diagnosis 7 Male 51 AML-M4 Initial diagnosis 8 Male 72 AML Initial diagnosis 9 Female 72 AML Initial diagnosis 10 Female 68 AML Initial diagnosis 11 Male 62 AML-M2 Initial diagnosis 12 Male 57 AML-M5 Initial diagnosis 13 Male 54 AML-M5 Initial diagnosis 14 Male 59 AML-M5 Initial diagnosis 15 Male 60 AML-M4 Initial diagnosis 16 Male 64 MDS to AML-M5 Relapse after DAC treatment 17 Female 64 MDS to AML Relapse after DAC treatment 18 Female 61 AML-M4 / 5 Relapse after DAC treatment 19 Male 68 AML-M4 Relapse after AZA treatment 20 Female 35 AML-M2 Relapse after AZA treatment

[0087] First, the peripheral blood (PB) of the above patients was collected, and the primary PBMCs were extracted and cultured therefrom. Then, the RIG-I related detection was performed on these PBMCs Figure 5 A). In order to simulate the clinical treatment response, the PBMCs were treated with HMA corresponding to the HMA (i.e. DAC or AZA) used by the patients Figure 5 A).

[0088] It was found by qRT-PCR detection that the transcription level of RIG-I in the PBMCs of relapsed AML patients was significantly lower than that in the PBMCs of newly diagnosed AML patients Figure 5 B, P=0.0134). This result suggests that the AML patients who relapsed after HMA treatment may have down-regulation of RIG-I and its downstream signaling pathway. Further immunofluorescence staining results showed that the expression level of RIG-I protein in the PBMCs of relapsed patients was also significantly reduced compared with that in the PBMCs of newly diagnosed patients (Figure 57C, representative samples from patient #2 and patient #16). HMA treatment effectively increased the transcription of IFN-a and IFN-β in the PBMCs from 15 newly diagnosed patients Figure 5 D) and the secretion level thereof Figure 5 E), while the PBMCs from 5 relapsed patients did not show this response. In addition, HMA treatment significantly enhanced the transcription level of interferon-stimulated gene MX1 in the PBMCs of newly diagnosed patients Figure 5 F) and the expression of MX1 protein Figure 5 G), while the same phenomenon was not observed in the PBMCs of relapsed patients. It was found in the cytotoxicity experiment that there was a significant difference in the inhibition of cell viability of PBMCs treated with 1 μM concentration of HMA (as shown in Figure 5 H). The cell viability of 9 out of 15 PBMC samples from newly diagnosed patients was significantly inhibited (inhibition rate more than 50%), while the cell viability of 5 PBMC samples from relapsed patients did not show significant inhibition. Representative samples showed that the PBMCs from newly diagnosed patient #2 were significantly killed after 1 μM HMA treatment, while the cells from relapsed patient #16 were not significantly affected (as shown inFigure 5 I) (Fig. 1B).

[0089] In summary, downregulation of RIG-I might be an important mechanism for the silencing of IFN immune response in relapsed AML patients after HMA treatment. This finding provides a new perspective for understanding the mechanism of HMA resistance and may provide a theoretical basis for the development of future treatment strategies for relapsed AML patients with HMA resistance.

[0090] Example 3

[0091] This example provides a study on the mechanism of ATRA-specific killing of HMA-resistant AML, as follows:

[0092] (1) Cell culture and cryopreservation: For specific details, please refer to step (1) of Example 1.

[0093] (2) Immunoblotting: For specific details, please refer to step (3) of Example 2.

[0094] (3) MAVS oligomerization detection: For specific details, please refer to step (4) of Example 2.

[0095] (4) Real-time quantitative qPCR: For specific details, please refer to step (2) of Example 2.

[0096] (5) Cell viability assay: For specific details, please refer to step (5) of Example 2.

[0097] (6) siRNA transfection: RARA siRNA was synthesized by GenScript, and the siRNA sequences are as follows:

[0098] RARA siRNA #1 (SEQ ID NO. 21, 5'-3'): GGUAUUAAUUCUCGCUGGU

[0099] RARA siRNA #2 (SEQ ID NO. 22, 5'-3'): CUCAGAACAACGUGUCUCU

[0100] Cells (THP-1 (DAC-Res) and THP-1 (AZA-Res)) were seeded in a 6-well plate at a density of 50%, and RFect siRNA transfection was performed according to the manufacturer's instructions.

[0101] Transfection reagent (11012, Bio-Rad) was used for transfection. Transfection system was configured according to the instructions, 30 pmol siRNA and 10 μL RFect siRNA transfection reagent were diluted with 250 μL Opti-MEM respectively, incubated at room temperature for 5 minutes, mixed gently to obtain a mixture, and then incubated at room temperature for another 20 minutes. 500 μL of the mixture was added to the culture well containing 2.5 mL of cultured cells. Shake the culture plate gently to mix, and continue to culture at 37°C for 24 hours.

[0102] (7) Immunofluorescence staining: refer to step (6) of Example 2 for specific details.

[0103] (8) Peripheral blood mononuclear cell extraction: refer to step (7) of Example 2 for specific details.

[0104] (9) ELISA detection: refer to step (8) of Example 2 for specific details.

[0105] Result analysis:

[0106] Through systematic screening, an FDA-approved drug with the strongest selective killing of HMA-resistant cells was found: ATRA (as shown in Figure 2 D). Further studies found that ATRA treatment could restore the expression level of the originally down-regulated RIG-I gene in DAC-resistant THP-1 cells to normal level ( Figure 6 A). In addition, it was also found that during ATRA treatment, the MAVS protein in DAC-resistant THP-1 cells appeared oligomerization phenomenon ( Figure 6 A). Further studies found that in DAC- and AZA-resistant THP-1 cells, ATRA could induce representative interferon-stimulated genes (ISGs), including IFI27, IFI44 and ISG15 ( Figure 6 B and 6C).

[0107] Further, the blocking or simulation of ATRA-induced HMA-resistant AML cell death, the experimental results showed that AR7 could inhibit ATRA-induced HMA-resistant AML cell death in a dose-dependent manner ( Figure 7 A and 7B), while AM580 could simulate the selective killing effect of ATRA, effectively killing DAC-resistant THP-1 cells ( Figure 7 C, reaching 14328-fold change). Mechanistically, AR7 effectively prevented the induction of representative interferon-stimulated genes (ISGs) in ATRA-resistant AML cells by blocking ATRA-induced up-regulation of RIG-I and oligomerization of MAVS (as shown in Figure 7 D). Figure 7E and 7F). However, AM580 significantly promoted RIG-I expression and MAVS oligomerization in DAC-resistant THP-1 cells (E and 7F). Figure 7 G), which in turn led to an upward adjustment of ISG ( Figure 7 H).

[0108] To ensure that the above experimental phenomena were not caused by off-target effects of AR7 or AM580, gene knockdown and overexpression techniques were further employed. RARα was knocked down or overexpressed to block or promote RIG-I expression, respectively. Experimental results showed that RARα knockdown effectively blocked RIG-I expression and MAVS oligomerization. Figure 7 I), subsequently disrupting the induction of representative ISG in DAC-resistant THP-1 cells by ATRA ( Figure 7 Conversely, in DAC-resistant THP-1 cells, overexpression of RARα significantly induced RIG-I expression and MAVS oligomerization. Figure 8 K).

[0109] In addition, in the parallel experiment conducted on primary PBMCs from 20 AML patients mentioned in Example 2, after induction treatment of cells with ATRA, the transcriptional expression of RIG-I, the activation level of the IFN signaling pathway, and the cell inhibition rate were systematically evaluated. Figure 8 As shown in Figure A). Comparative analysis of PBMC samples from relapsed and newly diagnosed patients revealed that after ATRA induction treatment, the RIG-I transcription level in PBMCs of relapsed patients (as shown in Figure A) was significantly lower. Figure 8 B) and protein expression levels (representative images are shown in...) Figure 8 C) was significantly higher than the corresponding indicators in newly diagnosed patients. Further testing showed that ATRA significantly promoted the transcriptional expression of IFN-α and IFN-β in PBMCs of relapsed patients. Figure 8 D) and its secretion level ( Figure 8 E). However, ATRA did not show such an effect in PBMCs of newly diagnosed patients. Furthermore, the transcriptional level of the interferon-stimulated gene MX1 (ISG) was also observed. Figure 8 F) and the expression level of MX1 protein ( Figure 8 G) was significantly upregulated in PBMCs of relapsed patients rather than newly diagnosed patients.

[0110] In cytotoxicity assays, treatment with 1 μM ATRA for 72 hours resulted in significant cell-killing effects in all 5 PBMC samples from relapsed patients, specifically cell inhibition rates exceeding 50%. However, in 15 PBMC samples from newly diagnosed patients, the killing effect of ATRA was significantly weakened, inducing only low levels of cell inhibition. Figure 8H; representative cell morphology images are shown in FIG. 1B. SEQUENCE ID NO. I). The experimental results show that, in both cultured cell lines and patient-derived primary cells, ATRA selectively kills HMA-resistant AML cells by complementing the expression of RIG-I. This finding provides important experimental evidence for developing more effective treatment strategies for HMA-resistant AML.

[0111] Example 4

[0112] This example provides an investigation of ATRA significantly prolonging the survival of HMA-resistant AML mice, as follows:

[0113] (1) Cell culture and cryopreservation: For specific details, please refer to step (1) of Example 1.

[0114] (2) Cell-derived xenograft (CDX) mouse experiments: The NCG mice (strain name: NOD- Prkdcem26Cd52Il2rgem26Cd22 / NjuCrl) used were purchased from Jiangsu Jicui Yekang Biotechnology Co., Ltd. and were raised in a specific pathogen-free (SPF) barrier environment. All animal experiments were strictly conducted in accordance with the ethical guidelines approved by the Shanghai Jiao Tong University Institutional Animal Care and Use Committee (IACUC).

[0115] (201) Survival observation experimental procedure:

[0116] 1) Model construction: 6-week-old female NCG mice were injected with 100 μL of PBS suspension containing 1 x 10 7 DAC-resistant THP-1 cells via the tail vein on day -7 of the experiment;

[0117] 2) Group intervention: After 7 days of tumor cell inoculation (day 0 of the experiment), the mice were divided into three groups (n = 8 / group) according to the random number table method and received the following treatments:

[0118] ① PBS (negative control group); ② 1 mg / kg decitabine (DAC, catalog number T1508, Taochu); ③ 10 mg / kg all-trans retinoic acid (ATRA, catalog number T1051, Taochu); daily intraperitoneal injection of drugs, and continuous observation of survival status.

[0119] 3) Endpoint evaluation: Survival was recorded every 12 hours, and survival analysis was performed using the Log-rank test (Mantel-Cox method).

[0120] (203) Disease progression monitoring experiment:

[0121] 1) Model construction: The DAC-resistant THP-1 cell transplantation model was established according to the same method described above;

[0122] 2) Group treatment: Seven days after tumor cell inoculation (day 0 of the experiment), mice were randomly divided into three groups (n=3 / group) and received intraperitoneal injections of PBS, DAC (1mg / kg) or ATRA (10mg / kg), respectively.

[0123] 3) Sample collection: On day 17 of the experiment, mice were anesthetized with isoflurane, peripheral blood (PB) was collected, and the spleen was completely removed. The mice were then euthanized, and the collected mouse samples were used for subsequent index testing.

[0124] (3) Flow cytometry: After cleavage treatment of peripheral blood samples, extracellular staining was performed using monoclonal anti-human CD45 antibody (304007, BioLegend). The stained cells were then processed in BD LSR Fortessa. TM The analysis was performed using an X-20 flow cytometer (BDBiosciences).

[0125] (4) Complete blood count: Peripheral blood samples were collected using EDTA tubes, diluted with instrument-specific sheath fluid (1:7), and each sample was immediately subjected to a complete blood count and analysis using a fully automated blood cell analyzer.

[0126] (5) Real-time quantitative qPCR: For details, please refer to step (2) of Example 2. In this example, the primers used are IFNB1-F and IFNB1-R, IFI27-F and IFI27-R, IFI44-F and IFI44-R (as shown in Table 3, species: mouse).

[0127] Table 3 Summary of primer sequences

[0128] NAME SEQUENCE (5'-3') SEQ ID NO. 23 IFNB1-F2 CAGCTCCAAGAAAGGACGAAC SEQ ID NO. 24 IFNB1-R2 GGCAGTGTAACTCTTCTGCAT SEQ ID NO. 25 IFI27-F2 CATCATTGGATTCGGTTCCTGT SEQ ID NO. 26 IFI27-R2 CCTTCTTGCTGCTTTGCCTG SEQ ID NO. 27 IFI44-F2 AGTCCTGTGAAGTCCAAGCTG SEQ ID NO. 28 IFI44-R2 CAGCTGCCACTCTGAGACAT Figure 9

[0129] Results analysis:

[0130] DAC-resistant THP-1 cells were selected and transplanted into mice via tail vein injection. The mice were then randomly divided into groups and treated with either DAC or ATRA until death, and their survival was observed. Figure 9 A). To ensure the scientific validity and reliability of the survival observation data, eight mice were used as the research sample in each experiment. The results showed that the median survival of mice in the DAC treatment group was 24.5 days, which was longer than the 20.5 days in the control group, but this extension was not statistically significant. Figure 9 B, P>0.05). In stark contrast, the median survival of mice in the ATRA treatment group was significantly prolonged to 45 days (B, P>0.05). Figure 10B, P<0.0001), indicating that ATRA has strong clinical potential in treating HMA-resistant AML.

[0131] To verify the correlation between the prolonged survival and the inhibition of leukemia cell proliferation and the reactivation of the IFN signaling pathway, survival observation experiments were continuously conducted, and the mice were euthanized on day 17. The spleen and PB samples of the mice were collected for systematic detection (such as Figure 10 A).

[0132] The experimental results show that, compared with the DAC treatment group, the ATRA treatment group of mice showed improvement in spleen swelling on day 17 ( Figure 10 B) and slowing down of the growth of the spleen weight ( Figure 10 C). Flow cytometry analysis found that the number of human CD45-positive THP-1 cells in the peripheral blood of the ATRA treatment group was significantly reduced ( Figure 10 D, P<0.01), while the DAC treatment group did not observe similar effects. In terms of whole blood cell analysis experiments, ATRA treatment significantly improved a number of hematological indicators: effectively inhibited white blood cell proliferation (WBC), while increasing red blood cell count (RBC), hemoglobin concentration (HGB), hematocrit (HCT), and platelet level (PLT), with statistically significant differences between groups ( Figure 10 E, P<0.01).

[0133] The mRNA transcription level of the representative genes of the IFN signaling pathway (IFNB1, IFI27, IFI44) in the peripheral blood and spleen tissue of the ATRA treatment group was significantly up-regulated ( Figure 11 F, P<0.01). The above evidence shows that ATRA exhibits good therapeutic effect in the HMA-resistant AML xenograft model by reactivating the IFN signaling pathway.

[0134] Example 5

[0135] This example provides a logical screening of small molecules that strongly and specifically kill HMA-resistant AML, as follows:

[0136] (1) Library establishment of potential RIG-I inducers: Firstly, 10352 high drug-likeness fragments were selected from ZINC database (https: / / zinc.docking.org / ), and then the predicted docking affinity of these fragments with RARa protein was calculated online through mcule 1-click Docking website (https: / / mcule.com / apps / 1-click-docking / ). In addition, for about 760,000 small molecule compounds (including about 180,000 natural products, 117,000 bioactive compounds and 463,000 fragments) in the Topscience database (https: / / www.screeningcompound.com / ), the structural similarity (Tanimoto coefficient) of them with eight known RARa agonists (TAM, AM580, Tazarotene, Adapalene, Peretinoin, Isotretinoin, ATRA and Acitretin) was analyzed using R language. The detailed information of 102 potential RIG-I inducer molecules collected is shown in Table 4.

[0137] (2) Compound similarity analysis: Compound similarity analysis was based on R Studio. Firstly, the SMILES structure of the compound was exported to an Excel table, the table was imported into the R language package and the SMILES column was selected, and then calculation was performed. The R language package can convert the SMILES of the compound into a molecular fingerprint, and then calculate the similarity of the molecular fingerprint. Finally, the similarity between the compounds can be exported, that is, the similarity coefficient Tanimoto. If completely similar, Tanimoto is equal to 1.

[0138] (3) Compound screening: For THP-1 parent cells and DAC-resistant cells, this chapter used a potential RIG-I inducer library (n = 102, 1 mM or 0.1 mM concentration) for systematic screening. For specific details of compound screening, please refer to Example 1 step (3).

[0139] (4) Cell viability assay: For specific details, please refer to Example 2 step (5).

[0140] (5) ELISA detection: For specific details, please refer to Example 2 step (8).

[0141] Results analysis:

[0142] In one aspect, based on the affinity of the compound and the target protein, 10,352 high-druggable fragments in the ZINC database were first screened systematically by 1-click Docking analysis, and the prediction results showed that there were 147 small molecules that could bind to RARa with high affinity (<-8.0 kcal / mol). Finally, 54 of them were collected as commercially available small molecules. Figure 11 A, left side).

[0143] On the other hand, based on the structural similarity of the compounds, about 760,000 small molecule compounds in the Topscience database were systematically analyzed. By analyzing the Tanimoto structural similarity coefficients of these compounds with existing RARa agonists through R language, the results showed that there were 195 compounds with high structural similarity (Tanimoto score > 0.3) with known type I RARa agonists TAM, AM580, Tazarotene and Adapalene or type II RARa agonists Peretinin, Isotretinoin, ATRA and Acitretin, and 48 of them were collected as commercially available small molecules. Figure 11 A, right side; Figure 11 B).

[0144] The above 102 compounds formed a potential RIG-I inducer library, and then the compounds were screened. Through a similar drug screening process as in Example 1, the killing ability and selectivity of these compounds on THP-1 parent cells and DAC-resistant THP-1 cells were evaluated. Figure 12 C).

[0145] Among the logically constructed small molecule compound library, as many as 13 compounds can moderately kill THP-1 parent cells at a concentration of 1 μM Figure 12 A, red line), and significantly kill DAC-resistant cells Figure 12 B, red line). These 13 compounds showed a significantly superior selectivity feature in killing DAC-resistant cells than ATRA Figure 12 C, red dots and black dots). In order to further verify the potential application value of these compounds, a repeat screening experiment was carried out using a potential RIG-I inducer compound at a concentration of 0.1 μM Figure 13 D~12F).

[0146] In the process of screening the potential RIG-I inducer library at different concentrations, a group of highly similar compounds were systematically identified Figure 13A, r = 0.8182, P < 0.0001). Subsequently, a systematic pharmacodynamic evaluation of these 13 screened compounds was performed on ATRA. Experimental results showed that these 14 compounds had an effect on the IC50 of THP-1 parental cells. 50 The values ​​ranged from 2.67 μM to 305.30 μM, while the IC50 value for DAC-resistant THP-1 cells was [missing value]. 50 The value range decreased significantly, from 0.00078 to 0.46530 μM. Figure 13 E, detailed data is summarized in Figure 13 B). These pharmacodynamic evaluations further confirmed that these compounds exhibited significant activity in specifically killing DAC-resistant THP-1 cells.

[0147] Among them, tazarotenic acid (TAZA), a metabolite of the parapsoriasis treatment drug tazarotene, exhibited the strongest selectivity in killing DAC-resistant THP-1 cells. Figure 13 C, with a difference of up to 38,719 times; in addition, the efficacy evaluation results of the M3AML treatment drug Tamibarotene (TAM) in killing DAC-resistant THP-1 cells were particularly outstanding, with its IC50 value reaching 38,719 times. 50 With a value of only 779 pM, it exhibits the strongest lethality. Figure 14 D).

[0148] Furthermore, validation experiments were conducted using primary cells from AML patients. In primary PBMCs from 20 AML patients mentioned in Example 2, both TAZA and TAM demonstrated stronger potency and selectivity in killing relapsed AML patient PBMCs. Figure 14 A). Specifically, after 72 hours of culture following treatment with 1 μM TAM, over 75% of PBMCs died in samples from all 5 relapsed patients (corresponding representative cell morphologies are shown in Figure 1). Figure 14 B). Further analysis revealed a link between the therapeutic effects of TAZA and TAM and the activation of intracellular IFN signaling. Following TAZA or TAM treatment, PBMCs from relapsed AML patients secreted higher levels of IFN-α (…). Figure 14 C, upregulated by 3 to 104 times) and IFN-β ( ​ As shown in D, the concentration was upregulated (4 to 7 times) into the culture medium.

[0149] Table 4. Detailed information on potential RIG-I-induced small molecules.

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160] The foregoing description of the embodiments is for the purpose of enabling a person with ordinary skill in the art to make and use the invention. Various modifications to these embodiments can be readily made, and the generic principles taught herein can be applied to other embodiments without the use of inventive faculty. Therefore, the present invention is not intended to be limited to the embodiments described herein but is to be accorded the full scope of the claims, and equivalents thereof.

Claims

1. Use of a RIG-I inducer in the preparation of a medicament for treating DNA hypomethylating drug-resistant acute myeloid leukemia.

2. Use according to claim 1, characterized in that, The medicament is a medicament that activates the IFN response to kill DNA hypomethylating drug-resistant acute myeloid leukemia cells.

3. Use according to claim 1, characterized in that, The RIG-I inducer is a RIG-I inducer capable of binding to the RARα active pocket.

4. Use according to claim 3, characterized in that, The RIG-I inducer is a structural analog of a type I RARα agonist or a structural analog of a type II RARα agonist. The structural analog of a type I RARα agonist is selected from one of CD437, Fr12989, Fr12259, Fr12635, Kartogenin, Naptalam, S119-8, Indobufen, Ftaxilide, CHIKV-IN-2, LG-100064, TTNPB, Palovarotene, Ch55, Trifarotene, UVI 3003, PA452, TAZA, WYC-210, SSAA09E3, AES-350, Tazarotene, Adapalene, TAM or AM580. The structural analog of a type II RARα agonist is selected from one of AT4OA, Transcrocetin, β-Apo-8'-carotenal, Retinol, Safranal, ATR, Lycopene, Etretinate, β-Ionone, Retinyl acetate, β-Carotene, Canthaxanthin, Fenretinide, SR 11302, Crocin, Zeaxanthin, Fucoxanthin, Astaxanthin, Methyl 13-cis-4-Oxoretinoate, Peretinoin, Isotretinoin, ATRA or Acitretin.

5. Use according to claim 4, characterized in that, The RIG-I inducer is selected from one or several of TAZA or TAM.

6. Use according to claim 5, characterized in that, The concentration of TAZA in the medicament is 0.01-100 μM.

7. Use according to claim 5, characterized in that, The concentration of TAM in the medicament is 0.001-10 μM.

8. Use according to claim 3, characterized in that, The RIG-I inducer is ATRA.

9. Use according to claim 8, characterized in that, The medicament is a medicament that activates RARα using ATRA to promote RIG-I upregulation and thereby activate the IFN response to kill DNA hypomethylating drug-resistant acute myeloid leukemia cells.

10. Use according to claim 8, characterized in that, The concentration of ATRA in the medicament is 0.01-10 μM.

Images