Systems and methods of gene-editing to treat spinal muscular atrophy

Abstract

The present disclosure relates to systems and methods for increasing survival motor neuron (SMN) protein by modifying the survival motor neuron-2 (SMN2) gene to treat spinal muscular atrophy (SMA).

Description

[0001] Docket No.103361-599WO1 SYSTEMS AND METHODS OF GENE-EDITING TO TREAT SPINAL MUSCULAR ATROPHY CROSS REFERENCE TO RELATED APPLICATIONS This application claims priority to, and the benefit of, U.S. Provisional Patent Application No. 63 / 582,738, filed September 14, 2023, which is incorporated by reference herein in its entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH This invention was made with government support under Grant Nos. R01 NS123736 and R01 HD060586 awarded by the National Institutes of Health (NIH). The government has certain rights in the invention. REFERENCE TO SEQUENCE LISTING The sequence listing submitted on September 13, 2024, as an .XML file entitled “103361-599WO1_ST26” created on September 13, 2024, and having a file size of 61,154 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5). FIELD The present disclosure relates to systems and methods for increasing survival motor neuron (SMN) protein by modifying the survival motor neuron-2 (SMN2) gene to treat spinal muscular atrophy (SMA). BACKGROUND Spinal muscular atrophy (SMA) is an autosomal recessive disease characterized by survival motor neuron (SMN) protein deficiency which results in motor neuron loss and muscle atrophy. SMA is caused by a loss or mutation of the survival motor neuron 1 (SMN1) gene. An orthologous gene, SMN2, differs from SMN1 by a C to T change in exon 7 that greatly reduces exon 7 inclusion from the majority of its transcripts. SMN protein lacking exon 7 is unstable and rapidly degrades, resulting in reduced levels of SMN protein (Figure 1). Since SMA patients have a loss of function mutation or deletion of SMN1 and retention of SMN2, SMN- dependent therapeutic strategies have focused on either replacing the SMN1 gene or modifying the splicing of SMN2 to increase SMN protein. Docket No.103361-599WO1 ZOLGENSMA® is the only approved gene therapy for the treatment of SMA, specifically indicated in the United States for patients aged less than 2 years old and in Europe for patients with SMA Type 1 or up to 3 SMN2 copies. The drug replaces the missing or defective SMN1 gene in a subject by delivering a new working copy of it into a patient's cells via a one-time intravenous (IV) infusion. While efficacious and approved in more than 47 countries, the lasting effects of treatment remain unknown. SPINRAZA® is an antisense oligonucleotide designed to increase the expression of full length (and therefore functional) SMN protein by binding to the intron-splicing silencer sequence (ISS) N1 in intron 7 of SMN2. However, SPINRAZA® requires invasive re-dosing at set intervals to maintain its effectiveness. EVRYSDI® is a small molecule also designed to increase the expression of full length SMN from SMN2 by stabilizing the transient double-strand RNA structure formed by the 5′ss of SMN2 exon 7 and the U1 snRNP complex, thus converting the weak 5′ splice site of SMN2 exon 7 into a stronger one. However, EVRYSDI® requires daily dosing to maintain its effectiveness. Similar to ZOGLENSMA®, the long-term effects of treatment with splicing modifiers to SMN2 remain unclear. What is needed are new systems and methods for treatment of spinal muscular atrophy (SMA). SUMMARY Disclosed herein are systems and methods for increasing survival motor neuron (SMN) protein by modifying the survival motor neuron-2 (SMN2) gene to treat spinal muscular atrophy (SMA). Accordingly, in one aspect disclosed herein, is a gene-editing system comprising: a single guide RNA (sgRNA) targeting an Element 1 (E1) region in intron 6 or a U1 RNA recognition site in a splice region of exon 7 and intron 7 of a survival motor neuron-2 (SMN2) gene; and an endonuclease, wherein the gene-editing system increases exon 7 inclusion during a splicing event of the SMN2 gene. In some embodiments, the sgRNA is encoded by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5. In some embodiments, the endonuclease is a Cas enzyme. In some embodiments, the endonuclease is a compact Cas enzyme. In some embodiments, the compact Cas enzyme is selected from the group consisting of SaCas9, CasX and CasΦ or a variant thereof. Docket No.103361-599WO1 In some embodiments, the gene-editing system further comprises an adeno-associated virus (AAV) vector. In some embodiments, the AAV vector is AAV2 or AAV9. In some embodiments, the AAV vector comprises a U6 promoter for the sgRNA. In some embodiments, the AAV vector comprises a chicken beta-actin promoter for the compact Cas enzyme. In some embodiments, exon 7 inclusion increases production of a full-length SMN protein. Accordingly, in one aspect disclosed herein is a method of treating a subject with spinal muscular atrophy (SMA) I, II or III comprising: administering a gene-editing system, wherein the gene-editing system comprising, a single guide RNA (sgRNA) targeting an E1 region in intron 6 or a U1 RNA recognition site in a splice region of exon 7 and intron 7, of a survival motor neuron-2 (SMN2) gene; and an endonuclease, wherein the system increases exon 7 inclusion during a splicing event of the SMN2 gene. In some embodiments, the sgRNA is encoded by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5. In some embodiments, the endonuclease is a Cas enzyme. In some embodiments, the endonuclease is a compact Cas enzyme. In some embodiments, the compact Cas enzyme is selected from the group consisting of SaCas9, CasX and CasΦ or a variant thereof. In some embodiments, the gene-editing system further comprises an adeno-associated virus (AAV) vector. In some embodiments, the AAV vector is AAV2 or AAV9. In some embodiments, the AAV vector comprises a U6 promoter for the sgRNA. In some embodiments, the AAV vector comprises a chicken beta-actin promoter for the compact Cas enzyme. In some embodiments, exon 7 inclusion increases production of a full-length SMN protein, in a subject, compared to an untreated control. In some embodiments, the gene-editing system is administered intravenously. In some embodiments, the gene-editing system is administered intrathecally. In some embodiments, the subject is a human. BRIEF DESCRIPTION OF THE DRAWINGS The accompanying figures, which are incorporated in and constitute a part of this specification, illustrate several aspects described below. FIG. 1 shows that SMN protein lacking exon 7 is unstable and rapidly degrades, resulting in reduced levels of SMN protein. Docket No.103361-599WO1 FIG. 2 shows a pictorial representation of the genome editing approach to remove Element 1 using a dual guided CRISPR / Cas9 component system. FIG. 3 shows the positions of the identified KKH-SaCas9 gRNAs (SEQ ID NO: 1-6) relative to E1 (SEQ ID NO:8) of SMN2 (SEQ ID NO: 7). FIG.3 indicates the PAM sequence for the adjacent gRNA and intron 6 (SEQ ID NO: 10), intron 7 (SEQ ID NO: 11), exon 7 (SEQ ID NO: 9), ISS-N1 (SEQ ID NO: 14), and U1 site ((SEQ ID NO: 12-13). FIG. 3 also shows the complementary strand to Partial SMN2 gene sequence (SEQ ID NO: 15). FIG.4 shows a pictorial representation of the gRNA-CRISPR / Cas9 component system. The CBA promoter with SV40 intron drives KKH-SaCas9 expression. The U6 promoter drives gRNA expression. Bleomycin serves as a selectable marker driven by the SV40 promoter. gRNA site 1: guide 4, 30 or 57; gRNA site 2: guide 17 or 31 in all possible permutations. FIG. 5 shows the representation of the bulged adenine of the U1 site of exon 7 and intron 7 known to cause the incorrect splicing of SMN2. Fig.5 shows SMN2 pre-mRNA (SEQ ID NO: 32). The pre-clinical compound Evrysdi increases SMN2 exon 7 inclusion by binding the weak 5’ splice site to stabilize an unpaired bulged adenine in the last nucleotide position of exon 7 while cooperatively binding ESE2 (SEQ ID NO: 33), an internal splice regulator of exon 7. It promotes binding of the U1 snRNP to strengthen the 5’ splice site and increase recognition of exon 7 by the spliceosome. An adenine base editor (ABE) is used to convert the A to G, thereby enhancing incorporation of exon 7. FIG.6 shows levels of SMN2 transcripts in exon 7 with different guide combinations. No significant difference was observed in the amount of SMN2 transcripts that contained exon 7 between the various guide combinations (4,17 p=0.474; 4,31 p=0.989; 30,17 p=0.140; 30,31 p=0.776; 57,17 p=0.954; 57,31 p=0.038; n=3 in all groups) when compared to untreated cells (n=6) (Error bars=SEM, Statistical test: one-way ANOVA). FIG.7 shows levels of SMN2 transcripts in exon 7 with different guide combinations after removal of outliers. An outlier test (Grubb’s Test) was run against data points that deviated from the rest of the values in the given groups. Removing the perceived outlier data points from the given data resulted in significance between the 57, 31 guide combination and untreated iMEFs (p=<0.0001). DETAILED DESCRIPTION Reference will now be made in detail to the embodiments of the invention, examples of which are illustrated in the drawings and the examples. This invention may, however, be Docket No.103361-599WO1 embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. The term “comprising”, and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of” and “consisting of” can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed. The following definitions are provided for the full understanding of terms used in this specification. Terminology In this specification and in the claims which follow, reference will be made to a number of terms which shall be defined to have the following meanings: As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a pharmaceutical carrier” includes mixtures of two or more such carriers, and the like. Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that when a value is disclosed that “less than or equal to” the value, “greater than or equal to the value” and possible ranges between values are also disclosed, as appropriately understood by the skilled artisan. For example, if the value “10” is disclosed the “less than or equal to 10”as well as “greater than or equal to 10” is also disclosed. It is also understood that the throughout the application, data is provided in a number of different formats, and that this Docket No.103361-599WO1 data, represents endpoints and starting points, and ranges for any combination of the data points. For example, if a particular data point “10” and a particular data point 15 are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15. It is also understood that each unit between two particular units is also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed. “Adeno-associated virus” or “AAV” as used herein refers to a member of the class of viruses associated with this name and belonging to the genus dependoparvovirus, family Parvoviridae. Multiple serotypes of this virus are known to be suitable for gene delivery; all known serotypes can infect cells from various tissue types. Non-limiting exemplary serotypes useful in the methods disclosed herein include any of the serotypes, e.g., AAV2, AAV5, and AAV8, or variant serotypes such as AAV-DJ. The AAV can be an AAV derived from a naturally occurring “wild-type” virus, an AAV derived from a rAAV genome packaged into a capsid derived from capsid proteins encoded by a naturally occurring cap gene and / or a rAAV genome packaged into a capsid derived from capsid proteins encoded by a non-natural capsid cap gene. "Administration," or "administering" as used herein refers to introducing a composition into a subject via a pharmaceutically acceptable route. Administration includes self- administration and the administration by another. A suitable route of administration allows the composition or the agent to perform its intended function. “Analog” as used herein refers to a molecule that is not identical to a reference molecule but is characterized by analogous functional or structural features. For example, a polypeptide analog retains the biological activity of a corresponding naturally-occurring polypeptide, while having certain biochemical modifications that enhance the analog's function relative to a naturally occurring polypeptide. Analogs of a given protein may be naturally occurring or engineered. "Comprising" is intended to mean that the compositions, methods, etc. include the recited elements, but do not exclude others. "Consisting essentially of'' when used to define compositions and methods, shall mean including the recited elements, but excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives, and the like. "Consisting of'' shall mean excluding more than Docket No.103361-599WO1 trace elements of other ingredients and substantial method steps for administering the compositions provided and / or claimed in this disclosure. Embodiments defined by each of these transition terms are within the scope of this disclosure. A “control” is an alternative subject or sample used in an experiment for comparison purposes. A control can be "positive" or "negative." “Coding sequence” refers to a nucleic acid molecule which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5′(amino) terminus and a translation stop codon at the 3′ (carboxy) terminus. A transcription termination sequence may be located 3′ to the coding sequence. “Compact” as used herein with reference to a Cas protein refers to a Cas protein that is smaller than Cas proteins conventionally used in CRISPR-Cas (e.g., Cas9), which can be, for example, 1,000–1,700 amino acids. “Complementary” as used herein refers to the capacity of a pair of single-stranded terminal sequences to anneal to each other via base pairing (e.g., A-T or G-C). The term can be used to describe a nucleic acid sequence 100% complementarity or identity with the comparator nucleotide sequence or it can mean less than 100% complementarity (e.g., about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and the like. “Core splicing signals” as used herein refers to the 5′ splice site (5′ss), the 3′ splice site (3′ss), and the branch point sequence (BPS) that participate in the splicing reaction and are present in introns. “CRISPR / Cas system” as used herein refers to a gene editing system that comprises a sgRNA and a Cas protein. A spacer region of the sgRNA recognizes a target DNA locus. A PAM sequence acts as a binding signal for the Cas protein. Once the spacer region of the gRNA recognizes and binds to the target DNA locus, the Cas protein undergoes a conformational change to induce a double strand break (DSB) at the target site. "crRNA" refers to a polynucleotide sequence (e.g., about 20 nucleotides in length) that is complementary to the target nucleic acid locus. “Downstream” as used herein to a nucleotide sequence that is located 3' to a reference nucleotide sequence. Docket No.103361-599WO1 “Double strand break” or “DSB” as used herein refers to the severing or cleavage of both strands of the DNA double helix. The DSB may result in cleavage of both stands at the same position leading to “blunt ends” or staggered cleavage resulting in a region of single stranded DNA at the end of each DNA fragment, or “sticky ends”. A double strand break may result from the action of one or more DNA nucleases. “Exon skipping” as used herein refers to an alternative splicing event in mammalian cells which results in complete skipping of one or more exons. A "decrease" can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also, for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be, for example, a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% decrease so long as the decrease is statistically significant. “Expression” as used herein refers to the process by which a polynucleotide is transcribed from a DNA template (such as into and mRNA or other RNA transcript) and / or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides are collectively referred to herein as a “gene product.” If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. “Expression cassette” as used herein refers to a DNA coding sequence operably linked to a promoter. “Operably linked” refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For instance, a promoter is operably linked to a coding sequence (or the coding sequence can also be said to be operably linked to the promoter) if the promoter affects its transcription or expression. As used herein, “enhance”, “enhanced”, “enhancement”, “enhancing”, and any grammatical variations thereof as used herein, refers to an act of intensifying, increasing, or further improving the quality, value, or extent of a biological function, composition, compound, cell, or tissue. “Gene editing” as used herein refers to genetic engineering in which a DNA sequence is inserted, deleted, or replaced in the genome of a living organism. Various forms of gene Docket No.103361-599WO1 editing are known in the art, including CRISPR-Cas, base editing, prime editing and PASTE. Any suitable form of gene editing can be utilized to target the target site as described herein. “Guide RNA” as used herein refers to a nucleic acid molecule that specifically directs or guides a Cas protein (nuclease) or other effector molecule (typically in complex with the gRNA molecule) to a target sequence. In some embodiments, this results from binding a portion of the gRNA molecule to the Cas protein and by hybridization of a portion of the gRNA to a target site. In some embodiments, a gRNA molecule consists of a single contiguous polynucleotide molecule, referred to herein as a "single guide RNA" or "sgRNA". A “gene therapy” refers to a medical / clinic approach to treat or prevent a disease, condition, or disorder by correcting an underlying genetic issue. As used herein, the term “genetically modified” refers to a living cell, tissue, or organism whose genetic material has been altered using genetic engineering techniques. The genetical modification results in an alteration that does not occur naturally by mating and / or natural recombination. Modified genes can be transferred within the same species, across species (creating transgenic organisms), and across kingdoms. New, exogenous genes can be introduced, or endogenous genes can be enhanced, altered, or knocked out. The term “increased” or “increase” as used herein generally means an increase by a statistically significant amount, for example “increased” can mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10- fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level so long as the increase is statistically significant. "Inhibit," "inhibiting," and "inhibition" mean to decrease an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the complete ablation of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between as compared to native or control levels. Variants comprising insertions or additions relative to a reference sequence are contemplated herein. The words “insertion” and “addition” refer to changes in an amino acid Docket No.103361-599WO1 or nucleotide sequence resulting in the addition of one or more amino acid residues or nucleotides. An insertion or addition may refer to 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, or 200 amino acid residues or nucleotides. “Modulate” and “modulation” as used here refers to a perturbation of function or activity. In some embodiments, modulation means an increase in gene expression. As used herein, a “mutation” refers to changing the structure of a gene, resulting in a variant form that may be transmitted to later generations. A mutation is caused by the alteration of single nucleotides in DNA, or the deletion, insertion, or rearrangement of larger sections of genes. A mutation can lead to the expression of a protein that has been changed physically or functionally leading to lethality, non-lethal dysfunction effects, or no effects. The term “nucleic acid” as used herein means a polymer composed of nucleotides, e.g., deoxyribonucleotides or ribonucleotides. The term "nucleobase" refers to the part of a nucleotide that bears the Watson / Crick base-pairing functionality. The most common naturally-occurring nucleobases, adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T) bear the hydrogen-bonding functionality that binds one nucleic acid strand to another in a sequence specific manner. The terms “ribonucleic acid” and “RNA” as used herein mean a polymer composed of ribonucleotides. The terms “deoxyribonucleic acid” and “DNA” as used herein mean a polymer composed of deoxyribonucleotides. “Optional” or “optionally” means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not. The terms “identical” or percent “identity,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,94%, 95%, 96%, 97%, 98%, 99% or higher identity over a specified region when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site or the like). Such sequences are then said to be “substantially identical.” This Docket No.103361-599WO1 definition also refers to, or may be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and / or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 10 amino acids or 20 nucleotides in length, or more preferably over a region that is 10-50 amino acids or 20-50 nucleotides in length. As used herein, percent (%) amino acid sequence identity is defined as the percentage of amino acids in a candidate sequence that are identical to the amino acids in a reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared can be determined by known methods. For sequence comparisons, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Preferably, default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters. One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1977) Nuc. Acids Res.25:3389-3402, and Altschul et al. (1990) J. Mol. Biol. 215:403-410, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (ncbi.nlm.nih.gov / ). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al. (1990) J. Mol. Biol. 215:403-410). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are Docket No.103361-599WO1 calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a word length (W) of 11, an expectation (E) or 10, M=5, N=−4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word length of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915) alignments (B) of 50, expectation (E) of 10, M=5, N=−4, and a comparison of both strands. The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01. “Protospacer proximity motif” or “PAM” as used herein refers to a 2–6-base pair double stranded nucleic acid sequence comprising a Cas protein-binding recognition sequence, wherein amino acids of the Cas protein directly interact with the recognition sequence. The PAM sequence is on the non-target strand and can be 5′ or 3′ of a target complement sequence. PAMs are recognized by the Cas proteins prior to target sequence unwinding and hydrogen base-pair bonding between the target sequence and the nucleic acid target binding sequence. A “protein”, "polypeptide", or “peptide” each refer to a polymer of amino acids and does not imply a specific length of a polymer of amino acids. Thus, for example, the terms peptide, oligopeptide, protein, antibody, and enzyme are included within the definition of polypeptide. This term also includes polypeptides with post-expression modification, such as glycosylation (e.g., the addition of a saccharide), acetylation, phosphorylation, and the like. Docket No.103361-599WO1 By “prevent” or other forms of the word, such as “preventing” or “prevention,” is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed. “Promoter” as used herein refers to a DNA regulatory region capable of binding RNA polymerase and initiating transcription of a downstream (3′ direction) coding or non-coding sequence. Promoters may be constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated promoters. By “reduce” or other forms of the word, such as “reducing” or “reduction,” is meant lowering of an event or characteristic (e.g., tumor growth). It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to. For example, “reduces tumor growth” means reducing the rate of growth of a tumor relative to a standard or a control. “Splicing regulatory elements” or “SRE” as used herein refers to various cis-acting regulatory elements that serve as either splicing enhancers or silencers. s. These elements are conventionally classified as exonic splicing enhancers (ESEs) or silencers (ESSs) if from an exonic location they function to promote or inhibit inclusion of the exon in which they reside, or as intronic splicing enhancers (ISEs) or silencers (ISSs) if they enhance or inhibit usage of adjacent splice sites or exons from an intronic location. They generally function by recruiting trans-acting splicing factors that activate or suppress splice site recognition or spliceosome assembly by various mechanisms. As used throughout, by a "subject" (or a “host”) is meant an individual. Thus, the "subject" can include, for example, domesticated animals, such as cats, dogs, etc., livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), laboratory animals (e.g., mouse, rabbit, rat, guinea pig, etc.) mammals, non-human mammals, primates, non-human primates, rodents, birds, reptiles, amphibians, fish, and any other animal. The subject can be a mammal such as a primate or a human. Administration of the therapeutic agents can be carried out at dosages and for periods of time effective for treatment of a subject. Docket No.103361-599WO1 “Target site” and “nuclease target site” are used interchangeably herein to a sequence within a nucleic acid molecule that is bound and cleaved by a nuclease. The target site may be single-stranded or double- stranded. In some embodiments, a target site may be about 10 to about 40 consecutive nucleotides in length located immediately adjacent to a PAM sequence (PAM sequence located immediately 3' of the target region). The term “therapeutically effective” refers to the amount of the composition used is of sufficient quantity to ameliorate one or more causes or symptoms of a disease or disorder. Such amelioration only requires a reduction or alteration, not necessarily elimination. The term “treatment” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder. “Vector” as used herein refers to a genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, virus, virion, etc., which is capable of replication when associated with the proper control elements and which can transfer gene sequences to cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors. As used herein, the terms “may,” “optionally,” and “may optionally” are used interchangeably and are meant to include cases in which the condition occurs as well as cases in which the condition does not occur. Thus, for example, the statement that a formulation “may include an excipient” is meant to include cases in which the formulation includes an excipient as well as cases in which the formulation does not include an excipient. Disclosed herein are the components to be used to prepare the disclosed compositions as to be used in the methods disclosed herein. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective Docket No.103361-599WO1 combinations and permutation of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. If a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning combinations, A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C- F are considered disclosed. Likewise, any subset or combination of these is also disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E would be considered disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed methods. Gene-editing systems Disclosed herein are systems and methods for increasing survival motor neuron (SMN) protein by modifying the survival motor neuron-2 (SMN2) gene to treat spinal muscular atrophy (SMA). Accordingly, in one aspect disclosed herein, is a gene-editing system comprising, a single guide RNA (sgRNA) targeting an E1 region in intron 6 or an U1 RNA recognition site in splice region of exon 7 and intron 7, of a survival motor neuron-2 (SMN2) gene; and an endonuclease, wherein the gene-editing system increases exon 7 inclusion during a splicing event of the SMN2 gene. Accordingly, in one aspect disclosed herein, is a gene-editing system comprising, a single guide RNA (sgRNA) targeting the E1 region in intron 6 or the U1 RNA recognition site in a splice region of exon 7 and intron 7 of a survival motor neuron-2 (SMN2) gene; and an endonuclease, wherein the system increases exon 7 inclusion during a splicing event of the SMN2 gene. In some embodiments, the U1 RNA recognition site extends one base pair (1bp) into intron 7. In some embodiments, the gene-editing system comprises a CRISPR-Cas system. In some embodiments, the CRISPR-Cas system permits the formation of a CRISPR complex at a target sequence, e.g., a splicing regulatory element (SRE) and more particularly, an intron Docket No.103361-599WO1 splicing silencer in SMN2. Suitable hybridization conditions include physiological conditions normally present in a cell. In some embodiments, the CRISPR-Cas system disclosed herein comprises sequences encoding (i) a guide RNA (e.g., a sgRNA) and (ii) a Cas protein. The Cas protein and guide RNAs can be delivered in form of DNA, RNA / mRNA, or ribonucleoprotein. In some embodiments, the gRNA is synthetic. In some embodiments, the gRNA comprises a crRNA sequence specific for binding to a target nucleotide. Native gRNAs that comprise both a crRNA and a tracrRNA generally comprise two separate RNA molecules that hybridize with each other through the repeat sequence of the crRNA and the anti-repeat sequence of the tracrRNA. In some embodiments wherein the guide RNA is a single guide RNA, the crRNA and tracrRNA are separated by a linker nucleotide sequence. In some embodiments, the guide RNA is a single guide RNA (sgRNA). In some embodiments, the sgRNA is designed on the basis of inferred PAM recognition motifs near the target site. A specific PAM varies depending on the species (e.g., bacterial, viral) from which the Cas protein is derived. PAM prediction methods are either based on in silico, in vivo or in vitro approaches. The canonical PAM (associated with SpCas9) is the sequence 5'-XXX-3'. In some embodiments, the PAM recognition motif is NGRRT or NGRRN. In some embodiments, the PAM recognition motif is TTCN. In some embodiments, the PAM recognition motif is 5′- TBN-3′ PAM. In some embodiments, the sgRNA is designed to be adjacent to a defined PAM recognition site and extend about 20 nucleotides upstream of the same. The length of the sgRNA may vary. In some embodiments, the gRNA is 14 nucleotides or greater, or more particularly, between about 14 and about 30 nucleotides, between about 15 and about 25 nucleotides, or between about 18 and about 24 nucleotides, more particularly, about 20 nucleotides. In some embodiments, the length of the sgRNA may vary. In some embodiments, the sgRNA is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. The sgRNA can be complementary or substantially complementary (e.g., at least about 70% complementary (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more)) to a target sequence. In some embodiments, the sgRNA limits off- target effects. In some embodiments, the GC content of the sgRNA is between about 40 and about 80% and more particularly, about 40%, about 50%, about 60%, about 70%, or about 80% or more. One or more nucleotides at either end of the sgRNA may be modified. In some Docket No.103361-599WO1 embodiments, one or more nucleotides at the 5’end of the sgRNA may be modified. In some embodiments, one or more nucleotides at the 3’ end of the sgRNA may be modified. In some embodiments, one or more of the nucleotides comprising the spacer sequence are modified, e.g., chemically modified at the 5’ end. In some embodiments, the first and last three terminal nucleotides of the sgRNA are chemically modified. In some embodiments, the modifications are selected from 2′-O-methine-4′ bridges, phosphorothioates, 2′-fluoro substituents and combinations thereof. In some embodiments, the spacer sequence is free of secondary structure, which can be determined using any suitable polynucleotide folding algorithm known in the art, including but not limited to mFold and RNAfold. The length of the sgRNA may vary. In some embodiments, the length is between about 18 and about 100 nucleotides, more particularly, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90 or about 100, or about 120, or about 140, or about 160, or more nucleotides. In some embodiments, the length of the sgRNA is about 100 nucleotides. In some embodiments, the sgRNA is encoded by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5. In some embodiments, the sgRNA is encoded by a nucleotide sequence comprising AAGTAAAATGTCTTGTGAAA (SEQ ID NO: 1). In some embodiments, the sgRNA is encoded by a nucleotide sequence comprising CTATATATAGATAGCTTTAT (SEQ ID: 2). In some embodiments, the sgRNA sequence is encoded by a nucleotide sequence comprising TCTGATCATATTTTGTTGAA (SEQ ID NO: 3). In some embodiments, the sgRNA sequence is encoded by a nucleotide sequence comprising ATAGATATAGATAGCTATAT (SEQ ID NO: 4). In some embodiments, the sgRNA sequence is encoded by a nucleotide sequence comprising GTACATTAAAAGACTATCAA (SEQ ID NO: 5). In some embodiments, the sequence encoding the sgRNA can be modified. In some embodiments, the sgRNA is encoded by a nucleotides sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.4%, 99.6%, 99.8%, or 99.9% identical to SEQ ID NO: 1. In some embodiments, the sgRNA is encoded by a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.4%, 99.6%, 99.8%, or 99.9% identical to SEQ ID NO: 2. In some embodiments, the sgRNA is encoded by a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.4%, 99.6%, 99.8%, or 99.9% identical to SEQ ID NO: 3. In some embodiments, the sgRNA is encoded by a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.4%, 99.6%, 99.8%, or 99.9% identical to SEQ ID NO: 4. In some embodiments, the sgRNA is encoded by a Docket No.103361-599WO1 nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.4%, 99.6%, 99.8%, or 99.9% identical to SEQ ID NO: 5. In some embodiments, the guide RNA is a truncated guide RNA. The target sequence to which a guide RNA is directed may vary and is generally adjacent to a protospacer adjacent motif (PAM). A protospacer adjacent motif is generally within about 1 to about 10 nucleotides from the target nucleotide sequence, including about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10 nucleotides from the target nucleotide sequence. The PAM can be 5′ or 3′ of the target sequence. Generally, the PAM is a consensus sequence of about 3-4 nucleotides, but in some embodiments, can be 2, 3, 4, 5, 6, 7, 8, 9, or more nucleotides in length. In some embodiments, the PAM sequence recognized by the presently disclosed In some embodiments, the target sequence is a target knockout sequence, i.e., a portion of a gene that if altered, will result in the alleviation of a disease or disorder (e.g., SMA). In some embodiments, the target sequence is a non-coding genomic sequence. In some embodiments, the target sequence is a splicing regulatory element (SRE). The four core splicing signals are the major determinant of intron and exon definition. However, the splicing pattern of a gene in a specific cell setting is also the result of intricate interplay among multiple cis-acting elements and trans-acting factors, and is influenced by other cellular pathways, such as transcription through chromatin, and signaling pathways. Cis-acting splicing regulatory elements are described on the basis of their location (exonic, intronic) and impact (enhancers, silencers). Most splicing regulatory elements described in the art are single-stranded RNA sequence motifs that are bound by RNA-binding proteins (RBPs), which function as either splicing activators or repressors. The human SMN2 gene contains numerous sequences which regulate the incorporation of SMN exon 7. In particular, intron 6 and 7 contain negative regulatory sequences that in general bind hnRNP1 and encourage skipping of exon 7. In some embodiments, the target sequence is an intronic splicing silencer (ISS) and more particularly, an intronic splicing silencer of the SMN2 gene. In some embodiments, the intronic splicing silencer is Element 1 (intron 6) of SMN2. Element 1 is a 45-nucleotide long sequence spanning -112 to -68 bp (based on numbering from exon 7). In some embodiments, the intronic splicing silencer is ISS-N1 (intron 7). ISS-N1 is a 15-nucleotide long sequence spanning +10 - +24. In some embodiments, the intronic splicing silencer is ISS-N2. ISS-N2 spans position 275 to position 297. In some embodiments, the intronic splicing silencer is not ISS-N1 or ISS-N2. In some embodiments, the Docket No.103361-599WO1 intronic splicing silencer is a combination of Element 1 and ISS-N2. In some embodiments, the intronic splicing silence comprises an AG-core, UG-type, GCWCC- type or GAC-core. In some embodiments, the CRISPR-Cas system disclosed herein is a class 2 CRISPR- Cas system comprising a single Cas protein bound to a guide RNA, where the Cas protein binds to and cleaves a targeted nucleic acid sequence. The Cas protein can be any suitable Cas protein. The Cas protein may be a naturally occurring bacterial or viral Cas protein, as well as an analog or variant thereof (e.g., an engineered, altered, or modified Cas protein). The Cas protein may be enzymatically active. The Cas protein may be a nuclease (an enzyme that cleaves both strands of a double-stranded nucleic acid), a nickase (an enzyme that cleaves one strand of a double-stranded nucleic acid), or an enzymatically inactive (or dead) Case molecule. In some embodiments, the Cas protein utilized in the CRISPR-Cas system disclosed herein is sufficiently small for packaging in an AAV vector. In some embodiments, the Cas protein is 1100 amino acids or less, 1050 amino acids or less, 1000 amino acids or less, 950 amino acids or less, 900 amino acids or less, 850 amino acids or less, 800 amino acids or less, 750 amino acids or less, 700 amino acids or less, 650 amino acids or less, 600 amino acids or less, 550 amino acids or less, 500 amino acids or less, 450 amino acids or less or 400 amino acids or less. In some embodiments, the Cas protein is between 1100 and 900 amino acids, between 900 and 700 amino acids, between 800 and 600 amino acids, between 700 and 500 amino acids, between 600 and 400 amino acids or between 500 and 400 amino acids. In some embodiments, the Cas protein is about 3.6 kB or less, about 3.5 kB or less, about 3.4 kB or less, about 3.3 kB or less, about 3.2 kB or less, about 3.1 kB or less, about 3.0 kB or less, about 2.9 kB or less, about 2.8 kB or less, about 2.7 kB or less or about 2.6 kB or less. In some embodiments, the Cas protein is between about 3.6 and about 3.4 kB, about 3.4 and about 3.2 kB, about 3.2 and about 3.0 kB, about 3.0 and about 2.8 kB, about 2.8 kB and about 2.6 kB. In some embodiments, the Cas protein is a small Cas protein relative to SpCas9 and more particularly, a small Cas protein that can cleave a DNA double bond. In some embodiments, the Cas protein is an endonuclease. In some embodiments, the Cas protein is a hypercompact Cas protein. In some embodiments, the endonuclease is a compact Cas enzyme. In some embodiments, the compact Cas enzyme is selected from the group consisting of SaCas9, CasX Docket No.103361-599WO1 and CasΦ or a variant thereof. In some embodiments, the compact Cas enzyme is SaCas9. In some embodiments, the compact Cas enzyme is CasX. In some embodiments, the compact Cas enzyme is CasΦ. In some embodiments, the compact Cas enzyme is selected from the group consisting of SaCas9 (~3.2 kb), CasX (~2.9 kb) and CasΦ (~2.2 kb), or analog or variant thereof, for example, St1Cas9, (∼3.3 kb). In some embodiments, the Cas protein is a derivative of SaCas9, for example a derivative with about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, 99.7%, 99.9% amino acid sequence identity. In some embodiments, the Cas protein is a derivative of CasX, for example a derivative with about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, 99.7%, 99.9% amino acid sequence identity. In some embodiments, the Cas protein is a derivative of Cas Φ, for example a derivative with about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, 99.7%, 99.9% amino acid sequence identity. In some embodiments, the CRISPR-Cas system comprises a sgRNA encoded by a nucleotide sequence comprising SEQ ID: NO. 1 or a derivative thereof and SACas9 or a derivative thereof. In some embodiments, the CRISPR-Cas system comprises a sgRNA encoded by a nucleotide sequence comprising SEQ ID: NO.2 or a derivative thereof and SaCas9 or a derivative thereof. In some embodiments, the CRISPR-Cas system comprises a sgRNA encoded by a nucleotide sequence comprising SEQ ID: NO.3 or a derivative thereof and SaCas9 or a derivative thereof. In some embodiments, the CRISPR-Cas system comprises a sgRNA encoded by a nucleotide sequence comprising SEQ ID: NO.4 or a derivative thereof and SaCas9 or a derivative thereof. In some embodiments, the CRISPR-Cas system comprises a sgRNA encoded by a nucleotide sequence comprising SEQ ID: NO.5 or a derivative thereof and SaCas9 or a derivative thereof. In some embodiments, the CRISPR-Cas system comprises a sgRNA encoded by a nucleotide sequence comprising SEQ ID: NO.1 or a derivative thereof and CasX or a derivative thereof. In some embodiments, the CRISPR-Cas system comprises a sgRNA encoded by a nucleotide sequence comprising SEQ ID: NO.2 or a derivative thereof and CasX or a derivative thereof. In some embodiments, the CRISPR-Cas system comprises a sgRNA encoded by a nucleotide sequence comprising SEQ ID: NO.3 or a derivative thereof and CasX or a derivative thereof. In some embodiments, the CRISPR-Cas system comprises a sgRNA encoded by a Docket No.103361-599WO1 nucleotide sequence comprising SEQ ID: NO.4 or a derivative thereof and CasX or a derivative thereof. In some embodiments, the CRISPR-Cas system comprises a sgRNA encoded by a nucleotide sequence comprising SEQ ID: NO.5 or a derivative thereof and CasX or a derivative thereof. In some embodiments, the CRISPR-Cas system comprises a sgRNA encoded by a nucleotide sequence comprising SEQ ID: NO. 1 or a derivative thereof and Cas Φ or a derivative thereof. In some embodiments, the CRISPR-Cas system comprises a sgRNA encoded by a nucleotide sequence comprising SEQ ID: NO. 2 or a derivative thereof and Cas Φ or a derivative thereof. In some embodiments, the CRISPR-Cas system comprises a sgRNA encoded by a nucleotide sequence comprising SEQ ID: NO. 3 or a derivative thereof and Cas Φ or a derivative thereof. In some embodiments, the CRISPR-Cas system comprises a sgRNA encoded by a nucleotide sequence comprising SEQ ID: NO. 4 or a derivative thereof and Cas Φ or a derivative thereof. In a particular embodiment, the CRISPR-Cas system comprises a sgRNA encoded by a nucleotide sequence comprising SEQ ID: NO.5 or a derivative thereof and Cas Φ or a derivative thereof. In some embodiments, the Cas protein is fused to a polypeptide or domain, e.g., separated or joined by a linker. In some embodiments, the Cas protein comprises a FokI cleavage domain. In some embodiments, the Cas protein comprises a nucleic acid cleavage domain that cleaves the target sequence upon cleavage domain dimerization. Exemplary methods for evaluating the binding of Cas protein to target DNA are known in the art. Optionally, the CRISPR-Cas system may further comprise a DNA donor template that encodes a specific mutation (such as a deletion or insertion) in or near the target region, and / or an agent that enhances the efficiency with which such mutations are generated including, without limitation, a random oligonucleotide, a small molecule agonist or antagonist of a gene product involved in DNA repair or a DNA damage response, or a peptide agent. Upon recognizing its corresponding PAM sequence, the Cas protein can cleave the target nucleotide sequence at a specific cleavage site. Functionally, the CRISPR-Cas system disclosed herein can modify a target DNA locular in various ways including deleting, inserting, translocating, or activating a target nucleotide. In some embodiments, the CRISPR-Cas system disclosed herein is used to delete an intron splicing silencer from the SMN2 gene, e.g., in intron 6 or 7. Docket No.103361-599WO1 In some embodiments, the CRISPR-Cas system comprises a sgRNA encoded by a nucleotide sequence selected from SEQ ID: NO.1 or a derivative thereof and a compact Cas protein, wherein the compact Cas protein is optionally selected from SaCas9, CasX, Cas Φ or a derivative thereof, where the derivative comprises at least about 80%, at least about 85%, at least about 90%, at least about 95% or more sequence identify. In some embodiments, the CRISPR-Cas complex is provided to a cell or subject as the ribonucleoprotein (RNP) complex. The RNP complex may be packaged, for example, into an extracellular vesicle (EV), nanoparticles, or electroporated directly into cells or model organisms. In some embodiments, an expression cassette is provided comprising a sgRNA disclosed herein and optionally, a compact Cas protein disclosed herein. In some embodiments, the expression cassette comprises a plasmid containing KKH- [X], wherein X is SaCas9 or a variant thereof. In some embodiments, an expression cassette is provided that comprises a nucleotide sequence comprising SEQ ID NO: 1. In some embodiments, an expression cassette is provided that comprises a nucleotide sequence comprising SEQ ID NO: 2. In some embodiments, an expression cassette is provided that comprises a nucleotide sequence comprising SEQ ID NO: 3. In some embodiments, an expression cassette is provided that comprises a nucleotide sequence comprising SEQ ID NO: 4. In some embodiments, an expression cassette is provided that comprises a nucleotide sequence comprising SEQ ID NO: 5. The expression cassette can be delivered to a cell or subject by viral (e.g., AAV or lentivirus) or non-viral means. Non-viral delivery methodologies include physical methods (e.g., gene gun delivery, injection) or chemical methods, where chemical methods include both organic methods (e.g., lipid nanoparticles, polymer nanoparticles) and inorganic methods (e.g., gold nanoparticles, iron oxide nanoparticles). In some embodiments, an AAV vector is provided comprising the CRISPR-Cas system disclosed herein, i.e., as an AAV-CRISPR-Cas system. Adeno-associated virus (AAV is the most widely used viral vector for gene delivery). It is a small, non-enveloped human parvovirus that packages a linear strand of single stranded DNA genome that is about 4.7 kb (referred to as its cloning capacity). The AAV genome is composed of a linear single-stranded DNA molecule which consists of two major open reading frames (ORFs) encoding the non-structural Rep (replication) and structural Cap (capsid) proteins. A second ORF within the cap gene was identified that Docket No.103361-599WO1 encodes the assembly-activating protein (AAP). The DNAs flanking the AAV coding regions are two cis-acting inverted terminal repeat (ITR) sequences, approximately 145 nucleotides in length, with interrupted palindromic sequences that can be folded into energetically-stable hairpin structures that function as primers of DNA replication. In addition to their role in DNA replication, the ITR sequences have been shown to be involved in viral DNA integration into the cellular genome, rescue from the host genome or plasmid, and encapsidation of viral nucleic acid into mature virions. The AAV vector utilized in the systems disclosed herein may be any suitable serotype. The AAV serotype may be, for example, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, or AAV12 serotypes. In some embodiments, the AAV vector is serotype 2 (AAV-2). In some embodiments, the AAV vector is serotype 9 (AAV-9) to preferentially infect motor neurons. In some embodiments, the AAV vector is selected from AAV-2 or AAV-9 and comprises a nucleotide sequence selected from SEQ ID NO: 1-5 and optionally, a nucleotide sequence comprising a compact Cas protein disclosed herein. In addition to using different serotypes of the AAV, it is possible to combine different serotypes. In some embodiments, the AAV vector comprises an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, or AAV12 serotype capsid. In some embodiments, the AAV vector comprises AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, or AAV12 serotype inverted terminal repeats (ITRs). In some embodiments, the AAV vector is a single stranded (SS) AAV vector packaged in an AAV9 capsid. In some embodiments, the AAV vector is a self-complementary (sc) AAV vector. Self- complementary adeno-associated vectors (scAAV) are viral vectors engineered from the naturally occurring adeno- associated virus (AAV) for use in gene therapy. ScAAV is termed “self-complementary” because the coding region has been designed to form an intramolecular double-stranded DNA template. A rate- limiting step for the standard AAV genome life cycle involves the second-strand synthesis since the typical AAV genome is a single-stranded DNA template. However, this is not the case for scAAV genomes. Upon infection, rather than waiting Docket No.103361-599WO1 for cell mediated synthesis of the second strand, the two complementary halves of scAAV will associate to form one double stranded DNA (dsDNA) unit that is ready for immediate replication and transcription. AAV vectors can be constructed using known techniques to provide at least the operatively linked components of control elements including a transcriptional initiation region, a heterologous nucleic acid sequence (encoding one or more components of a CRISPR-Cas system), a transcriptional termination region and at least one post-transcriptional regulatory sequence. In some embodiments, the genome present within the recombinant AAV vector lacks AAV rep and cap genes, a heterologous nucleic acid sequence (encoding one or more components of a CRISPR-Cas system flanked by AAV ITRs. In some embodiments, the rAAV vector comprises an AAV9 capsid and a single- stranded genome comprising 5′ and 3′ AAV2 ITRs. The AAV vector can optionally include one or more expression control or regulatory elements, i.e., nucleic acid sequence(s) that influence expression of the exogenous nucleic acid sequence. Control elements include, for example, promoters and enhancers, can optionally be included. In some embodiments, the AAV vector comprises a promoter. According to this embodiment, the exogenous nucleic acid sequence together with a promoter to drive transcription of the gene can be inserted between the inverted terminal repeats (ITR) of the AAV. The promotor may be any suitable promoter. In some embodiments, the promoter is selected from the group consisting of a pol I promoter, a pol II promoter, a pol III promoter, a T7 promoter, a U6 promoter, a H1 promoter, retroviral Rous sarcoma virus LTR promoter, a cytomegalovirus (CMV) promoter, a SV40 promoter, a dihydrofolate reductase promoter, a β-actin promoter, an elongation factor 1α short (EFS) promoter, a β glucuronidase (GUSB) promoter, a cytomegalovirus (CMV) immediate- early (Ie) enhancer and / or promoter, a chicken β-actin (CBA) promoter or derivative thereof such as a CAG promoter, CB promoter, a (human) elongation factor 1α-subunit (EF1α) promoter, a ubiquitin C (UBC) promoter, a prion promoter, a neuron-specific enolase (NSE), a neurofilament light (NFL) promoter, a neurofilament heavy (NFH) promoter, a platelet- derived growth factor (PDGF) promoter, a platelet-derived growth factor B-chain (PDGF-β) promoter, a synapsin (Syn) promoter, a synapsin 1 (Syn1) promoter, a methyl-CpG binding protein 2 (MeCP2) promoter, a Ca2+ / calmodulin-dependent protein kinase II (CaMKII) Docket No.103361-599WO1 promoter, a metabotropic glutamate receptor 2 (mGluR2) promoter, a neurofilament light (NFL) promoter, a neurofilament heavy (NFH) promoter, a β-globin minigene nβ2 promoter, a preproenkephalin (PPE) promoter, an enkephalin (Enk) promoter, an excitatory amino acid transporter 2 (EAAT2) promoter, a glial fibrillary acidic protein (GFAP) promoter, a myelin basic protein (MBP) promoter. In some embodiments, the promoter is functional at least in lower motor neurons or spinal cord glial cells, for example, at least in lower motor neurons. Promoters functional in motor neurons include, without limitation, ubiquitous and motor neuron-specific promoters. Representative ubiquitous promoters include the cytomegalovirus enhancer / chicken beta actin promoter, first exon and first intron / splice acceptor of the rabbit beta-globin gene, the cytomegalovirus enhancer / promoter (CMV) (optionally with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41:521-530 (1985)], the SV40 early promoter, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the dihydrofolate reductase promoter, the β-actin promoter, and the EF1 promoter. Representative promoters specific for the motor neurons include the promoter of the Calcitonin Gene-Related Peptide (CGRP), a known motor neuron-derived factor. Other promoters functional in motor neurons include the promoters of Choline Acetyl Transferase (ChAT) , Neuron Specific Enolase (NSE), Synapsin, Hb9 or ubiquitous promoters including Neuron-Restrictive Silencer Elements (NRSE). Representative promoters specific for glial cells include the promoter of the Glial Fibrillary Acidic Protein gene (GFAP). In some embodiments, the gRNA is driven by a U6 promoter and the Cas protein is driven by a chicken beta actin (CBA) promoter. To produce rAAV particles, an AAV vector can be introduced into a suitable host cell using known techniques, such as by transfection. Particularly suitable transfection methods include calcium phosphate co-precipitation, direct micro-injection into cultured cells, electroporation, liposome mediated gene transfer, lipid-mediated transduction, and nucleic acid delivery using high-velocity microprojectiles. Suitable host cells for producing rAAV particles include, but are not limited to, microorganisms, yeast cells, insect cells, and mammalian cells, which can be, or have been, used as recipients of an exogenous nucleic acid molecule. The rAAV may be purified by methods standard in the art such as by column chromatography or cesium chloride gradients. Docket No.103361-599WO1 In some embodiments, a non-viral strategy is used for delivery of the CRISPR-Cas system disclosed herein. Representative, non-limiting non-viral delivery systems include liposomes and lipid nanoparticles, lipoplexes and polyplexes, gold particles and other inorganic nanoparticles, and cell-penetrating peptides In some embodiments, the gene-editing system further comprises an adeno-associated virus (AAV) vector. In some embodiments, the AAV vector is AAV2 or AAV9. In some embodiments, the AAV vector comprises a U6 promoter for the sgRNA. In some embodiments, the AAV vector comprises a chicken beta-actin promoter for the compact Cas enzyme. In some embodiments, a cell is provided which comprises the gene-editing system. In some embodiments, a cell is transfected with the gene-editing system. In some embodiments, a cell is provided which comprises the CRISPR-Cas system. In some embodiments, a cell is transfected with the CRISPR-Cas system. In some embodiments, the cell comprises a CRISPR- Cas system comprising a sgRNA encoded by a nucleotide sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO:5 or a derivative or variant thereof and a compact Cas protein. In some embodiments, the sequence encoding the sgRNA can be modified. The cell can comprise any suitable cell. In some embodiments, the cell is a eukaryotic cell or prokaryotic cell. In some embodiments, the cell may be, for example, a bacteria cell, a yeast cell, a fungal cell, a mammalian cell, a plant cell or an animal cell. In some embodiments, the cell is a neuron or motor neuron, for example, an α-motor neuron. Any of the known procedures for introducing genetic material into a cell may be used, including, for example, use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, nucleofection, liposomes, microinjection, naked DNA, plasmid vectors, viral vectors, both episomal and integrative, and any of the other well-known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell. It is only necessary that the particular genetic engineering procedure used be capable of successfully introducing at least one gene into the host cell capable of expressing the gRNA. In some embodiments, the double strand break induced by the CRISPR-Cas system at the target sequence is followed by cellular DNA repair, including NHEJ, microhomology- mediated end joining (MMEJ) or homology directed repair (HDR). In some embodiments, a base editing system is used to modify the SMN2 gene. In some embodiments the base editing system comprises a base-editor. In some embodiments, the base Docket No.103361-599WO1 editor comprises a disabled Cas moiety and a nucleobase modification enzyme. In some embodiments, the nucleobase modification enzyme is naturally occurring. In some embodiments, the nucleobase modification is engineered. In some embodiments, the base editor permits editing of a target site five (5) nucleotides or less in length. In some embodiments, the base editor permits editing of a target site that is 1, 2, 3, 4 or 5 nucleotides in length. In some embodiments, the target site is a target site disclosed herein, i.e., an intron splicing silencer such as E1. In some embodiments, expression cassettes or vectors (e.g., viral vectors) comprising a sequence encoding a base editor are used. In some embodiments, an AAV vector is providing comprising a sequence encoding a base editor disclosed herein. In some embodiments, the AAV vector comprises a small (relative to SpCas9) or hypercompact Cas protein as disclosed herein. In some embodiments, exon 7 inclusion increases production of a full-length SMN protein. Methods of treating spinal muscular atrophy (SMA) In some aspects, disclosed herein is a method of treating a subject with spinal muscular atrophy comprising, administering a gene-editing system, wherein the gene-editing system comprising, a single guide RNA (sgRNA) targeting an E1 region in intron 6, an intron-splicing silencer sequence (ISS) N1 region in intron 7, or a U1 RNA recognition site in exon 7 and intron 7, of a survival motor neuron-2 (SMN2) gene; and an endonuclease, wherein the gene-editing system increases exon 7 inclusion during a splicing event of the SMN2 gene. In some aspects, disclosed herein is a method of treating a subject with spinal muscular atrophy (SMA) I, II or III. SMA is an autosomal recessive disease characterized by motor neuron loss and subsequent muscle atrophy. SMA has an incidence of 1 / 10,000 live births and when untreated is the leading genetic cause of infant death. SMA is caused by a mutation or deletion of the survival motor neuron 1 (SMN1) gene and retention of the SMN2 gene. SMN1 and SMN2 both make full-length SMN protein. However, SMN2 contains a C to T change in exon 7 which results in its exclusion from about 90% of transcripts. The resultant SMN protein is truncated, unstable and rapidly degraded. The about 10% of full-length transcripts produced by SMN2 are insufficient for normal motor function and cause progressive, irreversible motor neuron loss. Thus, SMA is caused by reduced full-length SMN protein levels. The complete Docket No.103361-599WO1 loss of SMN protein in mammals is embryonic lethal, which indicates SMN is an essential protein. While the predominant clinical features of SMA are muscle weakness and atrophy, patients exhibit a broad spectrum of clinical severity, which is inversely correlated to SMN2 copy number. Patients with more functional copies develop milder phenotypes as a result of increased full-length SMN levels. Mildly affected patients with spinal muscular atrophy are partially protected by an increased SMN2 copy number. As such, SMA is classified into different clinical types (0-4) based on disease onset and motor function. Patients with type 1 SMA, the most common form of the disease, typically have 2 copies of SMN2 and account for 45% of cases. Type 1 SMA patients are diagnosed within 6 months of birth, presenting with lack of head control and frog like posture. These patients never gain the ability to sit, stand, or walk independently. Patients with type 2 (typically 3 copies of SMN2) and type 3 (typically 3- 4 copies) display milder phenotypes and account for 20% and 30% of SMA cases, respectively. Type 2 SMA patients can sit and maintain head control, but do not gain the ability to independently stand or walk. Patients with this form of SMA exhibit muscle weakness within 2-18 months of age where symptom onset in Type 3 SMA patients occurs after 18 months of age. These patients typically achieve the ability to stand and walk but will lose these skills over time. In some embodiments, the method disclosed herein is useful for treating an exon- skipping disease, e.g., a neurodegenerative disorder, spinal muscular atrophy (SMA), Alzheimer’s disease, a craniofacial disorder or a disease or disorder of cell proliferation (e.g., cancer). In some embodiments, the method of treating a subject with SMA comprises, administering a gene-editing system, wherein the gene-editing system comprising, a single guide RNA (sgRNA) targeting the E1 region in intron 6 or the U1 RNA recognition site in splice region of exon 7 and intron 7, of a survival motor neuron-2 (SMN2) gene; and an endonuclease, wherein the system increases exon 7 inclusion during a splicing event of the SMN2 gene. In some embodiments, the U1 RNA recognition site extends one base pair (1bp) into intron 7. In some embodiments, the sgRNA encoded by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5. In some embodiments, the sequence encoding the sgRNA can be modified. Docket No.103361-599WO1 In some embodiments, the endonuclease is a compact Cas enzyme. In some embodiments, the compact Cas enzyme is selected from the group consisting of SaCas9, CasX and CasΦ or a variant thereof. In some embodiments, the gene-editing system further comprises an adeno-associated virus (AAV) vector. In some embodiments, the AAV vector is AAV2 or AAV9. In some embodiments, the AAV comprises a U6 promoter for the sgRNA. In some embodiments, the AAV comprises a chicken beta-actin promoter for the compact Cas enzyme. In some embodiments, exon 7 inclusion increases production of a full-length SMN protein, in a subject, compared to an untreated control. In some embodiments, the gene-editing system is administered intravenously. In some embodiments, the gene-editing system is administered intrathecally. In some embodiments, the gene-editing system is administered to a subject in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated. Administration may be topically (including ophthalmically, vaginally, rectally, intranasally), orally, by inhalation, or parenterally, for example by intravenous drip, subcutaneous, intraperitoneal or intramuscular injection. The disclosed pharmaceutical compositions can be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, intracavity, or transdermally. In some embodiments, the gene-editing system is administered to the subject via intracisternal injection. In some embodiments, the gene-editing system is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or more times. In some embodiments, the gene-editing system is administered daily. In some embodiments, the gene- editing system is administered every day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, or more. In some embodiments, the gene-editing system is administered every week, every 2 weeks, every 3 weeks, every 4 weeks, or more. In some embodiments, the gene-editing system is administered every month, every 2 months, every 3 months, every 4 months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, every 11 months, every 12 months, or more. In some embodiments, the gene-editing system is administered every year, every 2 years, every 3 years, every 4 years, every 5 years, or more. In some embodiments, the subject is a human. Docket No.103361-599WO1 In some embodiments of the invention, administration of the gene editing system to a subject in need thereof results in expression of at least about any of 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of levels of SMN expression found in a normal individual. Methods to measure expression of SMN are known in the art; for example, using an anti-SMN antibody. In some embodiments, the gene-editing system edits a splicing regulatory element that impairs exon 7 recognition within the SMN2 gene. In some embodiments, the splicing regulatory element is an intronic splicing silencing element, found in intron 6 or 7 of SMN2. In some embodiments, editing the splicing regulatory element leads to increased exon 7 inclusion in SMN2 transcripts. In some embodiments, exon 7 inclusion increases production of a full-length SMN protein. In some embodiments, the gene-editing system edits about 30 % to about 90% of the splicing regulatory element (e.g., intronic splicing silencing element) in a population of cells to which it is administered. In some embodiments, the gene-editing system edits about 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90% or more of the splicing regulatory element (e.g., intronic splicing silencing element) in a population of cells to which it is administered. In some embodiments, the subject is less than any one of 2 months of age, 3 months of age, 4 months of age, 5 months of age, 6 months of age, 7 months of age, 8 months of age, 9 months of age, 10 months of age, 11 months of age, 12 months of age, 13 months of age, 14 months of age, 15 months of age, 16 months of age, 17 months of age, 18 months of age, 1 year of age, 2 years of age, 3 years of age, 4 years of age, 5 years of age, 6 years of age, 7 years of age, 8 years of age, 9 years of age, 10 years of age, 11 years of age, 12 years of age, 13 years of age, 14 years of age, 15 years of age, 16 years of age, 17 years of age, 18 years of age. In some embodiments, the subject is greater than 18 years of age. In some embodiments, the method of treatment is pre-symptomatic, i.e., the subject has yet to exhibit one or more symptoms of SMA. Reduction or amelioration of the symptoms of SMA can be measured, for example, by improved motor muscle action potential, achieved milestones, decreased dependency on ventilation, increased quality of life and longevity. For example, improvement can be measured Docket No.103361-599WO1 by less dependence on ventilation and cough assistance machines, or the use of feeding tubes. Improvement can also be measured by gross motor functions such as sitting unaided, head control and the ability to walk. Increases in motor unit number estimation (MUNE), improvement in compound motor action potential (CMAP), increase in Hammersmith functional motor score (HFMS), improvement in pulmonary functional tests (FVC), and improvement of gross muscle physiology using MRI imaging, alone or in combination are indicative of therapeutic efficacy. Milestones can be measured with respect to the subject before the treatment of the invention, in comparison with non-treated peers, or in comparison with historical records. It is further contemplated herein that the disclosed treatment methods and compositions can be used in conjunction with other known agents. Thus, combination therapies are also contemplated by the invention. Combination as used herein includes both simultaneous treatment and / or sequential treatments. In some embodiments, the second therapeutic agent is a small molecule or biologic agent. EXAMPLES The following examples are set forth below to illustrate the compositions, cells, methods, and results according to the disclosed subject matter. These examples are not intended to be inclusive of all aspects of the subject matter disclosed herein, but rather to illustrate representative methods and results. These examples are not intended to exclude equivalents and variations of the present invention which are apparent to one skilled in the art. Example 1: Production of sgRNAs Using a custom python script, inferred Cas PAM recognition motifs near E1 were annotated. gRNAs were designed to be adjacent to the defined PAM recognition site and extend 20 nucleotides upstream of the 5’ end of the PAM motif. Using this approach, a list of potential gRNAs that target E1 were generated and at minimum two gRNAs were tested for each regulatory element. Example 2: Disruption Testing In Vivo Mouse embryonic fibroblasts (iMEFs) that express a single copy of SMN2 were derived and immortalized and the gRNAs were tested in this cell line. The gRNAs were synthesized and delivered to iMEFs with SaCas9 mRNA using Invitrogen Lipofectamine 3000 reagent. Docket No.103361-599WO1 This method is currently established, and has been optimized for use with plasmids, protein and mRNA in iMEFs. Within 24 hours, DNA and RNA were isolated from the same cell population to determine if the gRNA / Cas component can effectively disrupt the regulatory elements and establish if there is an increase in SMN expression. The efficacy of gRNA / Cas editing was assessed by quantifying exon 7 inclusion within SMN2 mRNA using droplet digital PCR by measuring FL-SMN relative to mouse Smn. All treated cell populations and untreated controls (2 gRNAs x 2 sites x 3 replicates + 3 biological replicates of untreated / edited cell population + 3 biological replicates of cells lacking human SMN) were analyzed using the targeted sequencing technique multiplexed direct genomic selection (MDiGS) as previously performed. Briefly, the entire SMN2 gene is biotinylated and used as bait to capture the fragment of the SMN2 gene in each sample. The DNA is sonicated to obtain 300-800 bp fragments which are then indexed and pooled. The pooled DNA is hybridized and captured with streptavidin beads. The enriched target regions are run on the Illumina MiSeq, demultiplexed and individual samples aligned to SMN2 reference to characterize the gRNA generated indels. Example 3: Measuring Off-Target Effects Off-target effects were determined by CIRCLE-Seq, a protocol developed in the Joung Lab. Briefly, genomic DNA is sheared and circularized by intramolecular ligation. Circular DNA molecules containing Cas cleavage sites can then be linearized to release newly cleaved DNA ends for adapter ligation, PCR amplification and pair-end high throughput sequencing. The complete sequencing information for a single off-target site is contained in each pair of reads generated by Cas cleavage. The identified off- target regions will be evaluated and prioritized by frequency, exonic regions and intronic regions. Identified exonic and intronic regions were further assessed to determine if the generated indels express in tissues that are targeted by AAV9. The most efficient guides at increasing SMN with the fewest detrimental off-target effects define which gRNA(s) are used to generate an AAV- CRISPR / Cas component system. Example 4: Production of AAV-CRISPR-Cas System The validated gRNAs for E1 that effectively increase full-length SMN, with the fewest detrimental off-target effects, were cloned into a gRNA / Cas9 expression cassette between the inverted terminal repeats (ITRs) of a single stranded AAV construct. The gRNA was driven by Docket No.103361-599WO1 the U6 promoter and Cas driven by the chicken beta actin (CBA) promoter as has previously been done for SMN. The assembled AAV-CRISPR / Cas system was validated using the iMEF cell line with MDiGS and CIRCLE-seq as previously described and packaged into AAV serotype 9 to target motor neurons. Example 5: Treatment of pre-symptomatic ∆7SMA mice The SaCas9 / gRNA component system in AAV9 was administered to pre-symptomatic ∆7SMA mice via ICV injection on day of birth (DOB). Mice were genotyped, randomized, and applied to the same exclusion criteria as described earlier. Control groups include mice treated with scAAV9-SMN at DOB, ASO against ISS-N1 at DOB, uninjected ∆7SMA, and ∆7 heterozygotes. The critical outcome measures for efficacy of AAV-CRISPR / Cas treatment led to FL- SMN production, survival and recovery of CMAP and MUNE. As such two cohorts of mice (n=10 mice per treatment group) were assessed: (1) FL-SMN mRNA expression and SMN protein expression and (2) weight, survival, and electrophysiology measurements. In the first cohort of mice, FL-SMN mRNA expression and SMN protein expression was quantified in brain and spinal cord of treated ∆7SMA mice sacrificed at 10 days of age. The droplet digital PCR was used to quantify the inclusion of exon 7 in SMN2 transcripts and SMN protein was quantified by ELISA as previously described. Mice were monitored daily for weight, morbidity, and mortality in the second cohort. CMAP and MUNE were recorded at P12 and at additional timepoints of P30 and P60, permitting survival, as previously described. Example 6: Exon 7 inclusion in SMN2 transcripts It was chosen to target Element1 on both the 5’ and 3’ end using two different gRNAs to ensure its removal. Multiple guides on either end were tested in various combinations and placed under selection of bleomycin to allow generation of stable lines. Two combinations (57,31 and 4,17) yielded the most colonies under selection with the remaining combinations yielding 6 colonies or less. Interestingly, guide combination 4,17 places both guide locations directly in E1 and combination 57,31 are both furthest away from E1 on the 5’ and 3’ ends respectfully. Following the generation of stable lines with these guide combinations, cells were collected, and the amount exon 7 incorporation was performed to determine the efficacy of editing. Docket No.103361-599WO1 Since editing efficiency needs to be high enough to see a change in the amount of FL- SMN transcript that is produced, the amount of SMN2 transcripts that contained exon 7 relative to the amount of SMN2 transcripts that did not within the cells transfected with dual guided expression cassettes under selection with bleomycin was measured. This assay is sensitive enough to detect fluctuations and abundance of exon 7 included products by removing the error inherently present when using a normalizing gene. Instead, it uses the same set of primers to amplify two different products from the same gene to see the variation between transcripts that contain exon 7 versus those that don’t. There was a more than 2-fold increase in the amount of SMN2 transcripts that contained exon 7 with 57, 31 guide combination (0.699 ± 0.210 relative florescent units (RNU)), a 1.8- fold increase with 30, 17 guide combination (0.583 ± 0.302 RNU), and a nearly 1.5-fold increase with 4, 17 guide combination (0.447 ± 0.138 RNU) when compared to untreated iMEFs (immortalized mouse embryonic fibroblasts) (0.325 ± 0.011 RNU). However, there was no significant difference in the amount of SMN2 transcripts that contained exon 7 between the various guide combinations (4,17 p=0.474; 4,31 p=0.989; 30,17 p=0.140; 30,31 p=0.776; 57,17 p=0.954; 57,31 p=0.038; n=3 in all groups) when compared to untreated cells (n=6) (Error bars=SEM, Statistical test: one-way ANOVA). When removing the perceived outlier data points from the given data there is significance between the 57, 31 guide combination and untreated iMEFs (p=<0.0001). However, an outlier test (Grubb’s Test) was run against data points that deviated from the rest of the values in the given groups. Example 7: Cas protein and guide RNA selection Using a custom python script, Cas PAM recognition motifs were annotated 150 nucleotides upstream and 50 nucleotides downstream of E1 for Cas proteins that fit the sizer equirement for packaging in the intended AAV delivery method (Table 3.1). gRNAs were designed to be adjacent to the defined PAM recognition site and extend 20 nucleotides upstream of the 5’ end of the PAM motif. A list of potential gRNAs that target E1 were identified, and a modified Staphylococcus aureus Cas9 (KKH-SaCas9) was selected (Kleinstiver, Prew et al.2015). Specifically, three guides upstream and two guides downstream of E1 were selected to test within a dual-guided system to force removal of E1 by targeting on the 5’ and 3’ end of the element. Docket No.103361-599WO1 Example 8: Cloning of gRNA / KKH-SaCas9 expression cassettes CRISPR plasmids were constructed by cloning two separate gRNA cassettes into a plasmid containing KKH-SaCas9 driven by the CBA promoter (Addgene 70708) (Kleinstiver, Prew et al.2015). All cloning steps used the NEBuilder HiFi DNA Assembly cloning kit (NEB). First, a U6 sgRNA expression cassette containing an empty BsmBI cassette (Addgene 70709) was cloned into the KKH-SaCas9 plasmid into both SpeI and PflMI restriction sites. The bleomycin resistance gene driven by the SV40 promoter was cloned into the AvrII site of the KKH-SaCas9 plasmid. Individual guides were then each cloned into one of the empty BsmBI cassettes to obtain single gRNA / KKH-SaCas9 expression plasmids. This was repeated to generate gRNA / KKH-SaCas9 expression plasmids that contained two different guides. Table 3.3 contains all generated dual gRNA / KKH-SaCas9 expression plasmids tested. Constructs were transformed into 10-beta chemically competent Escherichia coli (NEB) and grown overnight on LB agar plates at 37°C with 100μg / mL ampicillin. Colonies were selected and verified by Sanger sequencing. Verified plasmids were prepared by miniprep (Qiagen). Example 9: Cell culture The derived and immortalized mouse embryonic fibroblasts (iMEFs) that express a single copy of SMN2 were used to test gRNA expression cassettes (Blatnik, McGovern et al. 2020). Cells were seeded to ~80% confluency and transfected with the generated plasmids containing KKH-SaCas9 and dual gRNA expression cassettes using Mirus Bio Ingenio Electroporation Solution (Fisher Scientific) in replicates (n=4). Cells were cultured in 12% FBS DMEM supplemented with L-glutamine, Penicillin, and streptomycin under 37°C, 5% CO2 (12% FBS Atlanta, 10% PenStrep / L-Glutamine Gibco, DMEM Gibco). Three biological replicates were cultured for 3 days and collected using TRIzol reagent (Invitrogen) for an initial readout of expression. The other biological replicate was treated with 500μg / mL Zeocin (ThermoFisher) beginning 24 hours after transfection, with new media and antibiotic supplemented every 3 days to generate stable lines. Selected cells were grown into a single mono layer and expanded before collection with TRIzol. Example 10: Quantification of Element1 and gRNA / KKH-SaCas9 editing efficiency by ddPCR RNA was isolated from cells using TRIzol reagent (Invitrogen) and ethanol precipitation. Samples were treated with DNaseI (Ambion), and cDNA was synthesized using Docket No.103361-599WO1 pdN6 primers (Sigma), RNaseOUT (Invitrogen), and AMV-RT enzyme (NEB) in accordance with the manufacturer’s protocol. As previously described, mRNA expression was measured in a multiplex droplet digital PCR (ddPCR) reaction (QX200 BioRad System- BioRad QX Software Version 2.1) to determine the efficiency of editing of the CRISPR / Cas component system. Exon 7 inclusion was quantified using an assay that measures the amount of SMN2 transcripts that contained exon 7 relative to the amount of SMN2 transcripts that did not.

[0002] Docket No.103361-599WO1 TABLES Table 1: KKH-SaCas9 gRNAs that were selected to target removal of E1. Guides selection criteria included position relative to E1, Tm, %GC, presence of a variant and repeat nucleotides on either the 5’ or 3’ end Table 2: gRNAs for the ABE genome editing strategy of the U1 site in exon 7 and intron 7. PAM requirement NGG (SpCas9)

[0003] Docket No.103361-599WO1 SEQUENCES SEQ ID NO: 1 sgRNA -4 AAGTAAAATGTCTTGTGAAA SEQ ID NO: 2 sgRNA -17 CTATATATAGATAGCTTTAT SEQ ID NO: 3 sgRNA -30 TCTGATCATATTTTGTTGAA SEQ ID NO: 4 sgRNA -31 ATAGATATAGATAGCTATAT SEQ ID NO: 5 sgRNA -57 GTACATTAAAAGACTATCAA SEQ ID NO: 6 sgRNA 48 TTATTCAACAAAATATGATC SEQ ID NO: 7 Partial SMN2 gene sequence: 5’- partial intron 6—exon7—partial intron 7-3’ (introns = lowercase, exon = uppercase, Element 1 = italics and underlined, bulged A of U1 site in exon 7 and intron 7 = bold and underlined) 5’ccctacctccgcctcccaaagttgtgggattgtaggcatgagccactgcaagaaaaccttaactgcagcctaataattgttttctttgg gataacttttaaagtacattaaaagactatcaacttaatttctgatcatattttgttgaataaaataagtaaaatgtcttgtgaaacaaaatgc tttttaacatccatataaagctatctatatatagctatctatatctatatagctattttttttaacttcctttattttccttacagGGTTTTAG ACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTAAGGAgtaagtctgccag Docket No.103361-599WO1 cattatgaaagtgaatcttacttttgtaaaactttatggtttgtggaaaacaaatgtttttgaacatttaaaaagttcagatgttagaaagttgaa aggttaatgtaaaacaatcaatattaaagaattttgatgccaaaactattagataaaaggttaatctacatccctactagaattctcatactta actggttggttgtgtggaagaaacatactttcacaataaagagctttaggatatgatgccattttatatcactagtaggcagaccagcaga cttttttttattg-3’ SEQ ID NO: 8 Element 1 in Partial SMN2 gene sequence gtaaaatgtcttgtgaaacaaaatgctttttaacatccatataaa SEQ ID NO: 9 Exon 7 in partial SMN2 gene sequence GGTTTTAGACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTAAGGA SEQ ID NO: 10 Partial Intron 6 in Partial SMN2 gene sequence ccctacctccgcctcccaaagttgtgggattgtaggcatgagccactgcaagaaaaccttaactgcagcctaataattgttttctttgggat aacttttaaagtacattaaaagactatcaacttaatttctgatcatattttgttgaataaaataagtaaaatgtcttgtgaaacaaaatgctttt taacatccatataaagctatctatatatagctatctatatctatatagctattttttttaacttcctttattttccttacag SEQ ID NO: 11 Partial Intron 7 in Partial SMN2 gene sequence gtaagtctgccagcattatgaaagtgaatcttacttttgtaaaactttatggtttgtggaaaacaaatgtttttgaacatttaaaaagttcagat gttagaaagttgaaaggttaatgtaaaacaatcaatattaaagaattttgatgccaaaactattagataaaaggttaatctacatccctacta gaattctcatacttaactggttggttgtgtggaagaaacatactttcacaataaagagctttaggatatgatgccattttatatcactagtagg cagaccagcagacttttttttattg SEQ ID NO: 12 Change to U1 site in exon 7 of SMN2: (introns = lowercase, exon = uppercase, Element 1 = italics and underlined, base pair change from A to G in the U1 site in exon 7 and intron 7 = bold and underlined) 5’ccctacctccgcctcccaaagttgtgggattgtaggcatgagccactgcaagaaaaccttaactgcagcctaataattgttttctttgg gataacttttaaagtacattaaaagactatcaacttaatttctgatcatattttgttgaataaaataagtaaaatgtcttgtgaaacaaaatgc tttttaacatccatataaagctatctatatatagctatctatatctatatagctattttttttaacttcctttattttccttacagGGTTTTAG Docket No.103361-599WO1 ACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTAAGGGgtaagtctgccag cattatgaaagtgaatcttacttttgtaaaactttatggtttgtggaaaacaaatgtttttgaacatttaaaaagttcagatgttagaaagttgaa aggttaatgtaaaacaatcaatattaaagaattttgatgccaaaactattagataaaaggttaatctacatccctactagaattctcatactta actggttggttgtgtggaagaaacatactttcacaataaagagctttaggatatgatgccattttatatcactagtaggcagaccagcaga cttttttttattg-3’ SEQ ID NO: 13 Exon 7 in partial SMN2 gene sequence with base pair change from A to G in the U1 site in exon 7 GGTTTTAGACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTAAGGG SEQ ID NO: 14 ISS-N1 GGTCGTAATACTTTCACTTAGAATGAAA SEQ ID NO: 15 Complementary strand to Partial SMN2 gene sequence AAAGTAAGATTCACTTTCATAATGCTGGCAGACATTACTCCTTAATTTAAGGAAT GTGAGCACCTTCCTTCTTTTTGATTTTGTCTAAAACCCTGTAAGGAAAATAAAGG AAGTTaaaaaaaatagctatatagatagctatatatagatagctttatatggatGTTAAAAAGCATTTTGTTTCAC AAGACATTTTACTTATTTTATTCAACAAAATATGATCAGAAATTAAGTTGATAGT CTTTTAATGTACTTTAAAAGTTATCCCAAAGAAAACAATTATTAGGCTGCAGTTA AGGTTTTCTTgcagtggctcatgcctacaatcccacaactttgggaggcggaggtaggg SEQ ID NO: 16 sgRNA -4 actual PAM sequence CAAAAT SEQ ID NO: 17 sgRNA -17 actual PAM sequence ATGGAT Docket No.103361-599WO1 SEQ ID NO: 18 sgRNA -30 actual PAM sequence TAAAAT SEQ ID NO: 19 sgRNA -31 actual PAM sequence ATAGAT SEQ ID NO: 20 sgRNA -57 actual PAM sequence CTTAAT SEQ ID NO: 21 sgRNA -4 full sequence with actual PAM sequence AAGTAAAATGTCTTGTGAAACAAAAT SEQ ID NO: 22 sgRNA -17 full sequence with actual PAM sequence CTATATATAGATAGCTTTATATGGAT SEQ ID NO: 23 sgRNA -30 full sequence with actual PAM sequence TCTGATCATATTTTGTTGAATAAAAT SEQ ID NO: 24 sgRNA -31 full sequence with actual PAM sequence ATAGATATAGATAGCTATATATAGAT SEQ ID NO: 25 sgRNA -57 full sequence with actual PAM sequence GTACATTAAAAGACTATCAACTTAAT Docket No.103361-599WO1 SEQ ID NO: 26 Position 70076557 guide TGCTCACATTCCTTAAATTA SEQ ID NO: 27 Position 70076564 guide CAGACTTACTCCTTAATTTA SEQ ID NO: 28 Position 70076587 guide AAGATTCACTTTCATAATGC SEQ ID NO: 29 Position 70076557 guide full sequence with PAM TGCTCACATTCCTTAAATTAAGG SEQ ID NO: 30 Position 70076564 guide full sequence with PAM CAGACTTACTCCTTAATTTAAGG SEQ ID NO: 31 Position 70076587 guide full sequence with PAM AAGATTCACTTTCATAATGCTGG SEQ ID NO: 32 SMN2 pre-mRNA (.. indicate deleted nucleotides) GGUU..AAUCAAAAAGAAGGAAGGUGCUCACAUUCCUUAAGGAguaagucugccagcau uaugaaaguga SEQ ID NO: 33 ESE2 AAAAAGAAGGAA Docket No.103361-599WO1 SEQ ID NO: 34 5’ss GAguaagu SEQ ID NO: 35 ISS-N1 ccagcauuaugaaag SEQ ID NO: 36 Exon 7 SMN2 pre-mRNA GGUUAAUCAAAAAGAAGGAAGGUGCUCACAUUCCUUAAGGA SEQ ID NO: 37 Intron 7 SMN2 pre-mRNA Guaagucugccagcauuaugaaaguga SEQ ID NO: 38 sgRNA -4 AAGUAAAAUGUCUUGUGAAA SEQ ID NO: 39 sgRNA -17 CUAUAUAUAGAUAGCUUUAU SEQ ID NO: 40 sgRNA -30 UCUGAUCAUAUUUUGUUGAA SEQ ID NO: 41 sgRNA -31 AUAGAUAUAGAUAGCUAUAU Docket No.103361-599WO1 SEQ ID NO: 42 sgRNA -57 GUACAUUAAAAGACUAUCAA SEQ ID NO: 43 sgRNA 48 UUAUUCAACAAAAUAUGAUC SEQ ID NO: 44 KKH variant-SaCas9 atggggaaacggaactacatcctggggcttgacattgggataaccagcgttggctacggaattattgattatgagacacgcgatgtgat tgacgccggggttaggctgttcaaagaggccaacgttgaaaacaacgagggaagacggagtaagcgcggagcaagaagactcaa gcgcagacggagacatcggattcagagggtgaaaaagctgctcttcgattacaatctcctgaccgatcatagtgagctgagcggaatc aacccctacgaggcgcgagtgaaagggctttcccagaagctgtccgaagaggagttctccgccgcgttgctgcacctggccaaacg gaggggggttcacaatgtaaacgaagtggaggaggacacgggcaatgaacttagtacgaaagaacagatcagtaggaactctaag gctctcgaagagaaatacgtcgctgagttgcagcttgagagactgaaaaaagacggcgaagtacgcggatctattaataggttcaaga cttcagattacgtaaaggaagccaagcagctcctgaaagtacagaaagcgtaccatcagctcgatcagagcttcatcgatacctacata gatttgctggagacacggaggacatactacgagggcccaggggaaggatctccttttgggtggaaggacatcaaggaatggtacga gatgcttatgggacattgtacatattttccggaggagctcaggagcgtcaagtacgcctacaatgccgacctgtacaatgccctcaatga cctcaataacctcgtgattaccagggacgagaacgagaagctggagtactatgaaaagttccagattatcgagaatgtgtttaagcaga agaagaagccgacacttaagcagattgcaaaggaaatcctcgtgaatgaggaagatatcaagggatacagagtgacaagtacaggc aagcccgagttcacaaatctgaaggtgtaccacgatattaaggacataaccgcacgaaaggagataatcgaaaacgctgagctcctc gatcagatcgcaaaaattcttaccatctaccagtctagtgaggacattcaggaggaactgactaatctgaacagtgagctcacccaaga ggaaattgagcagatttcaaacctgaaaggctacaccgggacgcacaatctgagcctcaaagcaatcaacctcattctggatgaacttt ggcacacaaatgacaaccaaattgccatattcaaccgcctgaaactggtgccaaaaaaagtggatctgtcacagcaaaaggaaatcc ctacaaccttggttgacgattttattctgtcccccgttgtcaagcggagcttcatccagtcaatcaaggtgatcaatgccatcattaaaaaat acggattgccaaacgatataattatcgagcttgcacgagagaagaactcaaaggacgcccagaagatgattaacgaaatgcagaagc gcaaccgccagacaaacgaacgcatagaggaaattataagaacaaccggcaaagagaatgccaagtatctgatcgagaaaatcaag ctgcacgacatgcaagaaggcaagtgcctgtactctctggaagctatcccactcgaagatctgctgaataatccattcaattacgaggtg gaccacatcatccctagatccgtaagctttgacaattccttcaataacaaagttctggttaaacaggaggaaaattctaaaaaagggaac cggaccccgttccagtacctgagctccagtgacagcaagattagctacgagacttttaagaaacatattctgaatctggccaaaggcaa aggcaggatcagcaagaccaagaaggagtacctcctcgaagaacgcgacattaacagatttagtgtgcagaaagatttcatcaaccg aaaccttgtcgatactcggtacgccacgagaggcctgatgaatctcctcaggagctacttccgcgtcaataatctggacgttaaagtcaa gagcataaatgggggattcaccagctttctgaggagaaagtggaagtttaagaaggaacgaaacaaaggatacaagcaccatgctga Docket No.103361-599WO1 ggatgctttgatcatcgctaacgcggactttatctttaaggaatggaaaaagctggataaggcaaagaaagtgatggaaaaccagatgt tcgaggagaagcaggcagagtcaatgcctgagatcgagacagagcaggaatacaaggaaattttcatcacccctcatcagattaaac acataaaggacttcaaagactataaatactctcatagggtggacaaaaaacccaatcgcaagctcattaatgacaccctgtactcaaca cggaaggatgataaaggtaataccttgattgtgaataatcttaatggattgtatgacaaagataacgacaagctcaagaagctgatcaac aagtctccagagaagctccttatgtatcaccacgacccacagacttatcagaaattgaaactgatcatggagcaatacggggatgagaa gaacccactctacaaatattatgaggaaacaggtaattacctgaccaagtactccaagaaggataacggaccagtgatcaaaaagata aagtactatggcaacaaacttaatgcgcatttggacataactgacgattaccccaattctcgaaacaaggttgtgaagctctccctgaag ccttatagatttgacgtgtacctggataatggggtttataaattcgtcaccgtgaaaaatctggacgtgatcaaaaaggagaactattatga agtaaactcaaagtgctatgaggaggcgaagaagctgaagaagatctccaatcaggccgagttcatcgcttccttctataagaacgatc tcatcaagatcaatggagagctttatcgcgtcattggtgtgaacaatgacttgctgaacaggatcgaagtcaatatgatagacattaccta ccgggagtatctcgaaaacatgaatgataaacggccgcctcacatcatcaagacaatcgcatctaaaactcagtcaataaaaaagtact ctaccgatatcctggggaatctctatgaagtgaagtcaaagaagcacccacaaatcattaaaaaaggtggatcccccaagaagaaga ggaaagtctcgagcgactacaaagaccatgacggtgattataaagatcatgacatcgattacaaggatgacgatgacaagtaa SEQ ID NO: 45 sgRNA 48 actual PAM sequence AGAAAT SEQ ID NO: 46 sgRNA -57 actual PAM sequence TTTAAT SEQ ID NO: 47 PAM sequence Tgcagt

Claims

Docket No.103361-599WO1 CLAIMS What is claimed is:

1. A gene-editing system comprising, a single guide RNA (sgRNA) targeting an Element 1 (E1) region in intron 6 or a U1 RNA recognition site in splice region of exon 7 and intron 7 of a survival motor neuron-2 (SMN2) gene; and an endonuclease, wherein the gene-editing system increases exon 7 inclusion during a splicing event of the SMN2 gene.

2. The gene-editing system of claim 1, wherein the U1 RNA recognition site extends one base pair (1bp) into intron 7.

3. The gene-editing system of claim 1, wherein the sgRNA is encoded by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO:

5.

4. The gene-editing system of any one of claims 1-3, wherein the endonuclease is a compact Cas enzyme.

5. The gene-editing system of claim 4, wherein the compact Cas enzyme is selected from the group consisting of SaCas9, CasX and CasΦ or a variant thereof.

6. The gene-editing system of any one of claims 1-5, further comprising an adeno- associated virus (AAV) vector.

7. The gene-editing system of claim 6, wherein the AAV vector is AAV2 or AAV9.

8. The gene-editing system of any one of claims 6-7, wherein the AAV vector comprises a U6 promoter for the sgRNA.

9. The gene-editing system of any one of claims 6-8, wherein the AAV vector comprises a chicken beta-actin promoter for the compact Cas enzyme.Docket No.103361-599WO1 10. The gene-editing system of any one of claims 1-9, wherein exon 7 inclusion increases production of a full-length SMN protein.

11. A method of treating a subject with spinal muscular atrophy, comprising: administering a gene-editing system to the subject, wherein the gene-editing system comprises: a single guide RNA (sgRNA) targeting an Element 1 (E1) region in intron 6 or a U1 RNA recognition site in splice region of exon 7 and intron 7 of a survival motor neuron-2 (SMN2) gene; and an endonuclease, wherein the gene-editing system increases exon 7 inclusion during a splicing event of the SMN2 gene.

12. The method of claim 11, wherein the U1 RNA recognition site extends one base pair (1bp) into intron 7.

13. The method of claim 11, wherein the sgRNA is encoded by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO:

5.

14. The method of any one of claims 11-13, wherein the endonuclease is a compact Cas enzyme.

15. The method of claim 14, wherein the compact Cas enzyme is selected from the group consisting of SaCas9, CasX and CasΦ or a variant thereof.

16. The method of any one of claims 11-15, further comprising an adeno-associated virus (AAV) vector.

17. The method of claim 16, wherein the AAV vector is AAV2 or AAV9.

18. The method of any one of claims 16-17, wherein the AAV vector comprises a U6 promoter for the sgRNA.Docket No.103361-599WO1 19. The method of any one of claims 16-18, wherein the AAV vector comprises a chicken beta-actin promoter for the compact Cas enzyme.

20. The method of any one of claims 11-19, wherein exon 7 inclusion increases production of a full-length SMN protein in a subject compared to an untreated control.

21. The method of any one of claims 11-20, wherein the gene-editing system is administered intravenously.

22. The method of any one of claims 11-21, wherein the gene-editing system is administered intrathecally.

23. The method of any one of claims 11-22, wherein the subject is a human.

Images