3'-sialyllactose-producing engineered bacterium, and construction method and application thereof

Abstract

An engineered bacterium producing 3' -sialyllactose and its construction methods and applications. The engineered bacterium has the ability to produce 3' -sialyllactose, and with exogenous UDP-N-acetylglucosamine 2-epimerase gene (neuC), exogenous sialic acid synthase gene (neuB), exogenous N-acetylneuraminate cytidylyltransferase gene (css) and exogenousα-2, 3-sialyltransferase gene (ST) in its genome or in the recombinant plasmid it carries. This engineered bacterium has a high ability to produce 3' -sialyllactose without need for antibiotics.

Description

3’-SIALYLLACTOSE-PRODUCING ENGINEERED BACTERIUM, AND CONSTRUCTION METHOD AND APPLICATION THEREOF

[0001] This application claims priority to Chinese Patent Application No. 202311240995.4, filed on September 22, 2023, titled “3’-SIALYLLACTOSE-PRODUCING ENGINEERED BACTERIUM, CONSTRUCTION METHOD AND APPLICATION THEREOF” .Technical Field

[0002] The present invention belongs to the fermentation field, and specifically relates to an engineered bacterium producing 3’-sialyllactose without antibiotics, as well as the construction method and application thereof.Background of the Invention

[0003] Human milk oligosaccharides (HMOs) are an important type of oligosaccharides present in breast milk. HMOs are composed of five monosaccharides plus lactose molecules arranged in various combinations under the action of specific glycosyltransferases. There are currently more than 30 HMOs which have been structurally determined. A study shows that HMOs can serve as prebiotics to influence the intrinsic components of the intestinal microbiota and maintain the balance of the intestinal microbial environment. HMOs and their metabolites (such as sialic acid, etc. ) play an important role in brain development, neurotransmission and synapse formation, and have functions of promoting brain development and improving cognition in infants and young children, etc.. In addition, HMOs also have functions such as anti-viral functions, immune regulation and can promote human recovery.

[0004] The main types of human milk oligosaccharides currently found include fucosylated-HMOs and sialylated-HMOs. Among sialylated-HMOs, sialyllactose has the highest content, including 3’-sialyllactose (3’-SL) and 6’-sialyllactose (6’-SL) . 3’-SL and 6’-SL are composed of sialic acid and lactose as precursors  connected by α-2, 3 or α-2, 6 glycosidic bonds, respectively. The structural formulas of 3’-SL and 6’-SL are as shown in Formula I and Formula II respectively:

[0005] Current production methods for sialyllactose include chemical synthesis, enzyme-catalyzed synthesis, etc. Chemical synthesis requires expensive raw materials, harsh reaction conditions, higher costs, and results in a lower yield. Enzyme-catalyzed synthesis has a higher yield compared to chemical synthesis, but it requires the use of expensive enzymes, leading to a high cost in overall production. In addition, the enzyme is easily inactivated in enzyme-catalyzed reactions, which affects the enzyme catalytic efficiency and the yield of products. This makes this method also difficult to achieve large-scale production.Summary of the Invention

[0006] The present invention provides an engineered bacterium having a high yield of 3’-sialyllactose without antibiotics, as well as the construction methods and applications thereof, in order to address the problem of low yield of 3’-sialyllactose in the prior art during synthesis.

[0007] The E. coli EBSL005 strain (also known as the SLIS109 strain) herein has been deposited in China General Microbiological Culture Collection Center (CGMCC) on August 24, 2023 under the deposit number CGMCC No.: 28244, and  the deposit address is the Institute of Microbiology Chinese Academy of Sciences, NO.1 West Beichen Road, Chaoyang District, Beijing 100101, China; the strain is classified and named Escherichia coli.

[0008] In one aspect, the invention provides a genetically engineered bacterium having the ability to produce 3’-sialyllactose and having a UDP-N-acetylglucosamine 2-epimerase gene (neuC) , a sialic acid synthase gene (neuB) , an N-acetylneuraminate cytidylyltransferase gene (css) and an α-2, 3-sialyltransferase gene (ST) , wherein the UDP-N-acetylglucosamine 2-epimerase gene (neuC) , the sialic acid synthase gene (neuB) , the N-acetylneuraminate cytidylyltransferase gene (css) and the α-2, 3-sialyltransferase gene (ST) are integrated independently or jointly in any combination into the genome of the genetically engineered bacterium, or are present in a recombinant plasmid carried by the genetically engineered bacterium.

[0009] In one embodiment, the genetically engineered bacterium has an introduced exogenous UDP-N-acetylglucosamine 2-epimerase gene (neuC) , exogenous sialic acid synthase gene (neuB) , exogenous N-acetylneuraminate cytidylyltransferase gene (css) and exogenous α-2, 3-sialyltransferase gene (ST) . The introduced exogenous UDP-N-acetylglucosamine 2-epimerase gene (neuC) , the introduced exogenous sialic acid synthase gene (neuB) , the introduced exogenous N-acetylneuraminate cytidylyltransferase gene (css) and the introduced exogenous α-2, 3-sialyltransferase gene (ST) are integrated independently or jointly in any combination into the genome of the genetically engineered bacterium, or are present in the recombinant plasmid carried by the genetically engineered bacterium.

[0010] In one embodiment, the UDP-N-acetylglucosamine 2-epimerase gene (neuC) , the sialic acid synthase gene (neuB) , the N-acetylneuraminate cytidylyltransferase gene (css) , and the α-2, 3-sialyltransferase gene (ST) are integrated into the genome of the genetically engineered bacterium in a manner that are respectively connected to a separate first promoter and / or terminator, or are present in the recombinant plasmid carried by the genetically engineered bacterium.

[0011] In one embodiment, any two, three or four genes of the UDP-N- acetylglucosamine 2-epimerase gene (neuC) , the sialic acid synthase gene (neuB) , the N-acetylneuraminate cytidylyltransferase gene (css) and the α-2, 3-sialyltransferase gene (ST) , are integrated into the genome of the genetically engineered bacterium in a manner that are jointly connected to the first promoter and / or the terminator, or are co-present in the recombinant plasmid carried by the genetically engineered bacterium.

[0012] In one embodiment, the first promoter is a T2 promoter. In one embodiment, the terminator is a T7 terminator.

[0013] In one embodiment, the recombinant plasmid uses pTU2 as a backbone plasmid.

[0014] In one embodiment, the UDP-N-acetylglucosamine 2-epimerase gene (neuC) , the sialic acid synthase gene (neuB) , the N-acetylneuraminate cytidylyltransferase gene (css) and the α-2, 3-sialyltransferase gene (ST) are inserted into one or more insertion sequences 1 (IS1) of the genome of the genetically engineered bacterium as a gene combination in a manner that are respectively connected to a separate first promoter and / or terminator or jointly connected to the first promoter and / or the terminator.

[0015] In one embodiment, the copy number of the UDP-N-acetylglucosamine 2-epimerase gene (neuC) , the sialic acid synthase gene (neuB) , the N-acetylneuraminate cytidylyltransferase gene (css) and the α-2, 3-sialyltransferase gene (ST) as the gene combination is 10-28, 12-26 or 14-22, such as 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 at the insertion sequence 1 (IS1) .

[0016] In one embodiment, the UDP-N-acetylglucosamine 2-epimerase comprises the amino acid sequence set forth in SEQ ID NO: 82, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 82.

[0017] In one embodiment, the sialic acid synthase comprises the amino acid sequence set forth in SEQ ID NO: 83, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 83.

[0018] In one embodiment, the N-acetylneuraminate cytidylyltransferase comprises the amino acid sequence set forth in SEQ ID NO: 84, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 84.

[0019] In one embodiment, the α-2, 3-sialyltransferase comprises the amino acid sequence set forth in SEQ ID NO: 85, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 85.

[0020] In one embodiment, the genetically engineered bacterium has been modified in one or more of the following manners:

[0021] (1) the genetically engineered bacterium is modified to increase the production of glucosamine 6-phosphate;

[0022] (2) the genetically engineered bacterium is modified to continuously regenerate cytidine-5’-triphosphate;

[0023] (3) the genetically engineered bacterium is modified to inactivate or block the bypass catabolic pathway of N-acetylmannosamine (ManNAc) ;

[0024] (4) the genetically engineered bacterium is modified to inactivate or block the bypass catabolic pathway of phosphoenolpyruvic acid; and

[0025] (5) the genetically engineered bacterium is modified to increase the expression or activity of proteins involved in the oligosaccharide transport pathway;

[0026] (6) the genetically engineered bacterium is modified to reduce or eliminate the expression or activity of endogenous β-galactosidase;

[0027] (7) the genetically engineered bacterium is modified to reduce or eliminate the bypass catabolic pathway of N-acetylneuraminic acid.

[0028] In one embodiment, the genetically engineered bacterium is a bacterium of Escherichia, preferably Escherichia coli, and more preferably Escherichia coli BL21 (DE3) strain.

[0029] In one embodiment, the genetically engineered bacterium has been modified in one or more of the following manners:

[0030] (8) the genetically engineered bacterium is modified to reduce or eliminate  the expression or activity of 6-phosphofructokinase (pfkA) ;

[0031] (9) the genetically engineered bacterium is modified to increase the expression or activity of glucosamine-6-phosphate synthetase (glmS) ;

[0032] (10) the genetically engineered bacterium is modified to reduce or eliminate the expression or activity of N-acetylglucosamine-6-phosphate deacetylase (nagA) and / or glucosamine-6-phosphate deaminase (nagB) ;

[0033] (11) the genetically engineered bacterium is modified to increase the expression or activity of cytidine monophosphate kinase (CMK) and polyphosphate kinase (PPK) ;

[0034] (12) the genetically engineered bacterium is modified to reduce or eliminate the expression or activity of pyruvate kinase (pykA) ;

[0035] (13) the genetically engineered bacterium is modified to increase the expression or activity of oligosaccharide transporters;

[0036] (14) the genetically engineered bacterium is modified to reduce or eliminate the expression or activity of N-acetylneuraminic acid aldolase (nanA) ;

[0037] (15) the genetically engineered bacterium is modified to reduce or eliminate the expression or activity of N-acetylmannosamine kinase (nanK) ;

[0038] (16) the genetically engineered bacterium is modified to reduce or eliminate the expression or activity of N-acetylmannosamine-6-phosphate epimerase (nanE) ;

[0039] (17) the genetically engineered bacterium is modified to reduce or eliminate the expression or activity of β-galactosidase (lacZ) .

[0040] In one embodiment, the genetically engineered bacterium has the 6-phosphofructokinase (pfkA) gene deleted.

[0041] In one embodiment, the genetically engineered bacterium has the glucosamine-6-phosphate synthetase (glmS) gene overexpressed.

[0042] In one embodiment, the genetically engineered bacterium has the glucosamine-6-phosphate deaminase (nagB) gene deleted.

[0043] In one embodiment, the genetically engineered bacterium has the N-acetylmannosamine kinase (nanK) gene deleted.

[0044] In one embodiment, the genetically engineered bacterium has the N- acetylmannosamine-6-phosphate epimerase (nanE) gene deleted.

[0045] In one embodiment, the genetically engineered bacterium has the N-acetylglucosamine-6-phosphate deacetylase (nagA) gene deleted.

[0046] In one embodiment, the genetically engineered bacterium has the cytidine monophosphate kinase (CMK) gene and the polyphosphate kinase (PPK) gene overexpressed.

[0047] In one embodiment, the genetically engineered bacterium has the N-acetylneuraminic acid aldolase (nanA) gene deleted.

[0048] In one embodiment, the genetically engineered bacterium has the pyruvate kinase (pykA) gene deleted.

[0049] In one embodiment, the genetically engineered bacterium has the oligosaccharide transporter setB gene overexpressed.

[0050] In one embodiment, the genetically engineered bacterium has the β-galactosidase (lacZ) gene deleted.

[0051] In one embodiment, the deletion of the 6-phosphofructokinase (pfkA) gene involves the knockout of a part of the nucleotide sequence of the 6-phosphofructokinase (pfkA) gene, and the knockout of the part of the nucleotide sequence comprises retaining a length of the nucleotide sequence at the 5’ end which accounts for 0%-7%of the total length of the nucleotide sequence of the 6-phosphofructokinase (pfkA) gene, and retaining a length of the nucleotide sequence at the 3’ end which accounts for 70%-80%of the total length of the nucleotide sequence of the 6-phosphofructokinase (pfkA) gene.

[0052] In one embodiment, the glucosamine-6-phosphate synthetase (glmS) comprises the amino acid sequence set forth in SEQ ID NO: 89, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 89.

[0053] In one embodiment, the overexpression of the glucosamine-6-phosphate synthetase (glmS) gene involves the integration of the glucosamine-6-phosphate synthetase (glmS) gene into the genome of the genetically engineered bacterium.

[0054] In one embodiment, the deletion of the pyruvate kinase (pykA) gene involves the knockout of a part of the nucleotide sequence of the pyruvate kinase (pykA) gene, and the knockout of the part of the nucleotide sequence comprises retaining the length of the nucleotide sequence at the 5’ end which accounts for 4%-5.5%of the total length of the nucleotide sequence of the pyruvate kinase (pykA) gene, and retaining a length of the nucleotide sequence at the 3’ end which accounts for 10%-20%of the total length of the nucleotide sequence of the pyruvate kinase (pykA) gene.

[0055] In one embodiment, the cytidine monophosphate kinase (CMK) comprises the amino acid sequence set forth in SEQ ID NO: 91, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 91. The polyphosphate kinase (PPK) maycomprise the amino acid sequence set forth in SEQ ID NO: 90, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 90.

[0056] In one embodiment, the overexpression of the cytidine monophosphate kinase (CMK) gene and polyphosphate kinase (PPK) gene involves the integration of the cytidine monophosphate kinase (CMK) gene and the polyphosphate kinase (PPK) gene into the genome of the genetically engineered bacterium.

[0057] In one embodiment, the oligosaccharide transporter setB comprises the amino acid sequence set forth in SEQ ID NO: 93, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 93.

[0058] In one embodiment, the overexpression of the oligosaccharide transporter setB gene comprises integrating the oligosaccharide transporter setB gene into the genome of the genetically engineered bacterium.

[0059] In one embodiment, under the condition that a part of the nucleotide sequence of the 6-phosphofructokinase (pfkA) gene has been knocked out, the glucosamine-6-phosphate synthetase (glmS) gene is inserted into the location where the 6- phosphofructokinase (pfkA) gene has been knocked out.

[0060] In one embodiment, the genetically engineered bacterium has the melibiose permease (melB) gene deleted, and the cytidine monophosphate kinase (CMK) gene and the polyphosphate kinase (PPK) gene are inserted into the location where the melibiose permease (melB) gene has been knocked out.

[0061] In one embodiment, under the condition that a part of the nucleotide sequence of the pyruvate kinase gene (pykA) gene has been knocked out, the oligosaccharide transporter setB gene is inserted into the location where the pyruvate kinase gene (pykA) gene has been knocked out.

[0062] In one embodiment, the cytidine monophosphate kinase (CMK) gene and the polyphosphate kinase (PPK) gene are inserted into the location where the melibiose permease (melB) gene has been knocked out in a manner that are respectively connected to a separate second promoter or jointly connected to the second promoter.

[0063] In one embodiment, the cytidine monophosphate kinase (CMK) gene is located upstream of the polyphosphate kinase (PPK) gene. In one embodiment, the second promoter is a T5 promoter or a tetracycline promoter tet.

[0064] In another aspect, an E. coli strain is provided, deposited as CGMCC No.: 28244.

[0065] In another aspect, the invention provides use of a genetically engineered bacterium as described herein or an E. coli strain as described herein in the production of 3’-sialyllactose using glucose or glycerol as a carbon source.

[0066] In another aspect, the invention provides a method for constructing a genetically engineered bacterium with the ability to produce 3’-sialyllactose, comprising: integrating UDP-N-acetylglucosamine 2-epimerase gene (neuC) , sialic acid synthase gene (neuB) , N-acetylneuraminate cytidylyltransferase gene (css) and α-2, 3-sialyltransferase gene (ST) independently or jointly in any combination into the genome of a host bacterium to obtain the genetically engineered bacterium; or,

[0067] co-introducing the UDP-N-acetylglucosamine 2-epimerase gene (neuC) , the  sialic acid synthase gene (neuB) , the N-acetylneuraminate cytidylyltransferase gene (css) and the α-2, 3-sialyltransferase gene (ST) into a backbone plasmid to obtain a recombinant plasmid; and introducing the recombinant plasmid into the host cell to obtain the genetically engineered bacterium.

[0068] In one embodiment, a method for constructing a genetically engineered bacterium with the ability to produce the 3’-sialyllactose comprises integrating an introduced exogenous UDP-N-acetylglucosamine 2-epimerase gene (neuC) , an introduced exogenous sialic acid (neuB) , an introduced exogenous N-acetylneuraminate cytidylyltransferase gene (css) and an introduced exogenous α-2, 3-sialyltransferase gene (ST) independently or jointly in any combination into the genome of a host bacterium to obtain the genetically engineered bacterium; or,

[0069] co-introducing the introduced exogenous UDP-N-acetylglucosamine 2-epimerase gene (neuC) , the introduced exogenous sialic acid synthase gene (neuB) , the introduced exogenous N-acetylneuraminate cytidylyltransferase gene (css) and the introduced exogenous α-2, 3-sialyltransferase gene (ST) into a backbone plasmid to obtain a recombinant plasmid; and introducing the recombinant plasmid into the host cell to obtain the genetically engineered bacterium.

[0070] In one embodiment, the host bacterium is a bacterium of Escherichia, preferably Escherichia coli, more preferably Escherichia coli BL21 (DE3) strain.

[0071] In one embodiment, the method for constructing a genetically engineered bacterium with the ability to produce the 3’-sialyllactose further comprises modifying the host bacterium in one or more of the following manners:

[0072] (1) the host bacterium is modified to increase the production of glucosamine 6-phosphate;

[0073] (2) the host bacterium is modified to continuously regenerate cytidine-5’-triphosphate;

[0074] (3) the host bacterium is modified to inactivate or block the bypass catabolic pathway of N-acetylmannosamine (ManNAc) ;

[0075] (4) the host bacterium is modified to inactivate or block the bypass catabolic pathway of phosphoenolpyruvic acid;

[0076] (5) the host bacterium is modified to increase the expression or activity of proteins involved in the oligosaccharide transport pathway;

[0077] (6) the host bacterium is modified to reduce or eliminate the expression or activity of β-galactosidase; and

[0078] (7) the host bacterium is modified to reduce or eliminate the bypass catabolic pathway of N-acetylneuraminic acid.

[0079] In one embodiment, the genetically engineered bacterium has been modified in one or more of following the manners:

[0080] (8) the host bacterium is modified to reduce or eliminate the expression or activity of 6-phosphofructokinase (pfkA) ;

[0081] (9) the host bacterium is modified to increase the expression or activity of glucosamine-6-phosphate synthetase (glmS) ;

[0082] (10) the host bacterium is modified to reduce or eliminate the expression or activity of N-acetylglucosamine-6-phosphate deacetylase (nagA) and / or glucosamine-6-phosphate deaminase (nagB) ;

[0083] (11) the host bacterium is modified to increase the expression or activity of cytidine monophosphate kinase (CMK) and polyphosphate kinase (PPK) ;

[0084] (12) the host bacterium is modified to reduce or eliminate the expression or activity of pyruvate kinase (pykA) ;

[0085] (13) the host bacterium is modified to increase the expression or activity of oligosaccharide transporters;

[0086] (14) the host bacterium is modified to reduce or eliminate the expression or activity of N-acetylneuraminic acid aldolase (nanA) ;

[0087] (15) the host bacterium is modified to reduce or eliminate the expression or activity of N-acetylmannosamine kinase (nanK) ;

[0088] (16) the host bacterium is modified to reduce or eliminate the expression or activity of N-acetylmannosamine-6-phosphate epimerase (nanE) ; and

[0089] (17) the host bacterium is modified to reduce or eliminate the expression or activity of β-galactosidase (lacZ) .

[0090] In one embodiment, the 6-phosphofructokinase (pfkA) gene of the host  bacterium has been deleted.

[0091] In one embodiment, the glucosamine-6-phosphate synthetase (glmS) gene of the host bacterium has been overexpressed.

[0092] In one embodiment, the glucosamine-6-phosphate deaminase (nagB) gene of the host bacterium has been deleted.

[0093] In one embodiment, the N-acetylmannosamine kinase (nanK) gene of the host bacterium has been deleted.

[0094] In one embodiment, the N-acetylmannosamine-6-phosphate epimerase (nanE) gene of the host bacterium has been deleted.

[0095] In one embodiment, the N-acetylglucosamine-6-phosphate deacetylase (nagA) gene of the host bacterium has been deleted.

[0096] In one embodiment, the cytidine monophosphate kinase (CMK) gene and polyphosphate kinase (PPK) gene of the host bacterium have been overexpressed.

[0097] In one embodiment, the N-acetylneuraminic acid aldolase (nanA) gene of the host bacterium has been deleted.

[0098] In one embodiment, the pyruvate kinase (pykA) gene of the host bacterium has been deleted.

[0099] In one embodiment, the oligosaccharide transporter setB gene of the host bacterium has been overexpressed.

[0100] In one embodiment, the β-galactosidase (lacZ) gene of the host bacterium has been deleted.

[0101] In one embodiment, the deletion of the 6-phosphofructokinase (pfkA) gene in the host bacterium involves the knockout of a part of the nucleotide sequence of the 6-phosphofructokinase (pfkA) gene. The knockout of the part of the nucleotide sequence includes retaining a length of nucleotide sequence at the 5’ end which accounts for 0%-7%of the total length of the nucleotide sequence of the 6-phosphofructokinase (pfkA) gene, and retaining a length of nucleotide sequence at the 3’ end which accounts for 70%-80%of the total length of the nucleotide sequence of the 6-phosphofructokinase (pfkA) gene.

[0102] In one embodiment, the glucosamine-6-phosphate synthetase (glmS)  comprises the amino acid sequence set forth in SEQ ID NO: 89, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 89.

[0103] In one embodiment, the overexpression of the glucosamine-6-phosphate synthetase (glmS) gene involves the integration of the glucosamine-6-phosphate synthetase (glmS) gene into the genome of a host bacterium.

[0104] In one embodiment, the deletion of the pyruvate kinase (pykA) gene involves the knockout of a part of the nucleotide sequence of the pyruvate kinase (pykA) gene, and the knockout of the part of nucleotide sequence comprises the length of the nucleotide sequence retained at the 5’ end accounting for 4%-5.5%of the total length of the nucleotide sequence of the pyruvate kinase (pykA) gene, and the length of the nucleotide sequence retained at the 3’ end accounting for 10%-20%of the total length of the nucleotide sequence of the pyruvate kinase (pykA) gene.

[0105] In one embodiment, the cytidine monophosphate kinase (CMK) comprises the amino acid sequence set forth in SEQ ID NO: 91, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 91; the polyphosphate kinase (PPK) comprises the amino acid sequence set forth in SEQ ID NO: 90, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 90.

[0106] In one embodiment, the overexpression of the cytidine monophosphate kinase (CMK) gene and polyphosphate kinase (PPK) gene involves the integration of the cytidine monophosphate kinase (CMK) gene and the polyphosphate kinase (PPK) gene into in the genome of a host bacterium.

[0107] In one embodiment, the oligosaccharide transporter setB comprises the amino acid sequence set forth in SEQ ID NO: 93, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 93.

[0108] In one embodiment, the overexpression of the oligosaccharide transporter setB gene comprises integrating the oligosaccharide transporter setB gene into the genome of a host bacterium.

[0109] In one embodiment, under the condition that a part of the nucleotide sequence of the 6-phosphofructokinase (pfkA) gene has been knocked out, the glucosamine-6-phosphate synthetase (glmS) gene is inserted into the location where the 6-phosphofructokinase (pfkA) gene has been knocked out.

[0110] In one embodiment, the melibiose permease (melB) gene of the host bacterium has been deleted, and the cytidine monophosphate kinase (CMK) gene and the polyphosphate kinase (PPK) gene are inserted into the location where the melibiose permease (melB) gene has been knocked out.

[0111] In one embodiment, under the condition that a part of the nucleotide sequence of the pyruvate kinase gene (pykA) gene has been knocked out, the oligosaccharide transporter setB gene is inserted into the location where the pyruvate kinase gene (pykA) gene has been knocked out.

[0112] In one embodiment, the cytidine monophosphate kinase (CMK) gene and the polyphosphate kinase (PPK) gene are inserted into the location where the melibiose permease (melB) gene has been knocked out in a manner that are respectively connected to a separate second promoter or jointly connected to a second promoter.

[0113] In one embodiment, the cytidine monophosphate kinase (CMK) gene is located upstream of the polyphosphate kinase (PPK) gene. In one embodiment, the second promoter is the T5 promoter or the tetracycline promoter tet.

[0114] In one embodiment, the UDP-N-acetylglucosamine 2-epimerase gene (neuC) , the sialic acid synthase gene (neuB) , the N-acetylneuraminate cytidylyltransferase gene (css) and the α-2, 3-sialyltransferase gene (ST) are inserted into one or more insertion sequences 1 (IS1) of the genome of the host bacterium as a gene combination in a manner that are respectively connected to a separate first promoter and / or terminator or jointly connected to the first promoter and / or terminator.

[0115] In one embodiment, the copy number of the introduced UDP-N- acetylglucosamine 2-epimerase gene (neuC) , sialic acid synthase gene (neuB) , N-acetylneuraminate cytidylyltransferase gene (css) and α-2, 3-sialyltransferase gene (ST) as the gene combination is 10-28, 12-26 or 14-22 at the insertion sequence 1 (IS1) .

[0116] In one embodiment, a pTargetF-nagAB comprising a homology arm 1 and a homology arm 2 is used to knock out nagA and nagB genes. The homology arm 1 is obtained by amplification using the primers of SEQ ID NO: 3 and SEQ ID NO: 4 and using the host bacterial genome as a template, and the homology arm 2 is obtained by amplification using the primers of SEQ ID NO: 5 and SEQ ID NO: 6 and using the host bacterial genome as a template.

[0117] In one embodiment, a glmS knock-in donor-DNA fragment comprising a homology arm 3 and a homology arm 4, and a pTargetF-pfkA-NT1 recombinant plasmid are used to knock out the pfkA gene and knock in the glmS gene into the host bacterial genome where the pfkA gene has been knocked out. The homology arm 3 is obtained by amplification using the primers of SEQ ID NO: 11 and SEQ ID NO: 12 and using the host bacterial genome as a template, and the homology arm 4 is obtained by amplification using the primers of SEQ ID NO: 19 and SEQ ID NO: 20 and using the host bacterial genome as a template.

[0118] In one embodiment, the ppk knock-in donor-DNA comprising a homology arm 5 and a homology arm 6, and a pTargetF-melB-NT1 recombinant plasmid are used to knock in the ppk gene into the host bacterial genome. The homology arm 5 is obtained by amplification using the primers of SEQ ID NO: 35 and SEQ ID NO: 36 and using the host bacterial genome as a template, and the homology arm 6 is obtained by amplification using the primers of SEQ ID NO: 41 and SEQ ID NO: 42 and using the host bacterial genome as a template.

[0119] In one embodiment, the cmk knock-in donor-DNA comprising a homology arm 7 and a homology arm 8, and a pTargetF-melB-NT2 recombinant plasmid are used to knock in the cmk gene into the host bacterial genome. The homology arm 7 is obtained by amplification using the primers of SEQ ID NO: 43 and SEQ ID NO: 44 and using the host bacterial genome as a template, and the homology arm  8 is obtained by amplification using the primers of SEQ ID NO: 49 and SEQ ID NO: 50 and using the host bacterial genome as a template.

[0120] In one embodiment, the setB knock-in at pykA site donor-DNA comprising a homology arm 9 and a homology arm 10, and pTargetF-pykA-NT2 recombinant plasmid are used to knock out the pykA gene and knock in the setB gene into the host bacterial genome where the pfkA gene has been knocked out. The homology arm 9 is obtained by amplification using the primers of SEQ ID NO: 58 and SEQ ID NO: 59 and using the host bacterial genome as a template, and the homology arm 10 is obtained by amplification using the primers of SEQ ID NO: 64 and SEQ ID NO: 65 and using the host bacterial genome as a template. The host bacterium is preferably Escherichia coli.

[0121] In another aspect, provided is a method for fermentative production of 3’-sialyllactose, the method comprising the following steps:

[0122] culturing the genetically engineered bacterium described herein or the E. coli strain described herein in a seed culture medium to obtain a seed fermentation broth;

[0123] inoculating the seed fermentation brothinto a fermentation medium for induction culture, and obtaining the fermentation liquid containing 3’-sialyllactose after the fermentation is completed.

[0124] In one embodiment, the fermentation medium does not comprise antibiotics.

[0125] In one embodiment, the seed culture medium is an LB culture medium.

[0126] In one embodiment, the fermentation medium comprises a TB medium and a carbon source comprising glucose and / or glycerol.

[0127] The advantages of the present invention include that the following:

[0128] 1. provided is an integrated engineering strain with a high amount of 3’-sialyllactose, which has a higher yield of 3’-sialyllactose compared to production strains in the prior art (such as the SLIS026 strain) ;

[0129] 2. the genetically engineered bacterium herein is an integrated strain, which does not suffer from plasmid loss, and exhibits higher genetic stability;

[0130] 3. the method of the present invention integrates the target gene (such as glmS gene, setB gene) at the position where an original gene (such as the pfkA gene) has  been knocked out, thereby achieving overexpression of the target gene in the bacterial cell genome and reducing genetic manipulation steps to reduce the impact on bacterial cell growth and fermentation.

[0131] Description of the Drawings

[0132] Fig. 1 is a diagram of the 3’-SL metabolic pathway of the integrated engineered bacterium.

[0133] Fig. 2 is a plasmid map of pTU2-A-DOE13.

[0134] Fig. 3 is a spectrum of the result of the HPLC detection of 3’-SL.

[0135] Fig. 4 is a graph showing the result of the fermentation of some selected transformants.

[0136] Fig. 5 is a graph showing the growth and yield curve of shake flask fermentation of strain EBSL005.

[0137] Fig. 6 is a plasmid map of pCas-Sac.Detailed description

[0138] In order to make the purpose, technical solutions, and advantages of the present invention clear, the technical solutions in the examples of the present invention will be clearly and completely described below in conjunction with the examples of the present invention. Obviously, the described examples are parts of, but not all of, examples of the present invention. Based on the examples of the present invention, all other examples obtained by those of ordinary skill in the art without creative efforts fall within the scope of protection of the present invention.

[0139] As used herein, an engineered bacterium “having the ability to produce 3’-sialyllactose” refers to a bacterium that, when cultured in a medium, has the ability to produce 3’-sialyllactose and to accumulate the 3’-sialyllactose in the medium and / or in the bacterial cell to the extent that it can be recovered. The engineered bacterium having the ability to produce 3’-sialyllactose may be a strain capable of producing 3’-sialyllactose and accumulating the 3’-sialyllactose in a culture medium and / or in the bacterial cell in a greater amount than a non-modified strain.  The “non-modified strain” refers to a control strain without specific genetic modifications.

[0140] As used herein, the “SLIS026” strain is an E. coli BL21 strain in which the LacZ gene, the nanA gene, and the nanKE gene have been knocked out. The SLIS026 strain is a basic strain constructed in Example 1 of the patent application with publication number CN116200316A applied by SYNAURA BIOTECHNOLOGY (SHANGHAI) CO., LTD., which is incorporated herein by reference. The integrated engineered bacterium herein is constructed using the SLIS026 strain (see CN116200316A) as the starting strain.

[0141] The increase in the copy number of a gene may be achieved by introducing the gene into the genome of a host. In terms of introducing the gene into the genome, it can be performed, for example, by utilizing homologous recombination. A gene introduction method using homologous recombination may include a method using linear DNA such as the Red-driven integration method, a method using a plasmid comprising a temperature-sensitive origin of replication, a method using a plasmid capable of conjugative transfer, a method using a suicide vector without an origin of replication that functions in the host, and a transduction method using a phage. Specifically, a gene can be introduced into the genome of a host by transforming the host with a recombinant DNA comprising the target gene, followed by homologous recombination with the target site on the genome of the host. With respect to the structure of the recombinant DNA used in homologous recombination, there is no particular limitation provided that the homologous recombination may occur in a desired manner. For example, the host may be transformed with a linear DNA comprising the target gene, which is a linear DNA that has the same base sequences at both ends of the gene as those upstream and downstream of the target site on the genome, respectively. The gene may be replaced into the target site through the homologous recombination occurring upstream and downstream of the target site, respectively. The recombinant DNA used in homologous recombination may have a marker gene for selecting transformants. The gene can be introduced in only one copy, or two or more copies.  For example, multiple copies of the gene may be introduced into the genome by homologous recombination using a base sequence having multiple copies on the genome as a target. As for a base sequence having multiple copies on the genome, it may be exemplified by a repetitive DNA sequence, and inverted repeats present at both ends of a transposon. In addition, homologous recombination may also be performed using appropriate base sequences on the genome, such as a gene that is not required in the production of an objective substance, as a target. Moreover, the gene may also be randomly introduced into the genome using a transposon or Mini-Mu. It should be noted that, such a genome modification technique using homologous recombination is not limited to the introduction of a target gene, but can also be used for any modification of the genome, such as modification of an expression regulatory sequence.

[0142] The introduction of the target gene into the genome may be confirmed by Southern hybridization using a probe having a sequence complementary to all or a part of the gene, or PCR using primers prepared based on the sequence of the gene, or the like.

[0143] Furthermore, an increase in the copy number of a gene may also be achieved by introducing a vector comprising the gene into a host. For example, an expression vector for the gene may be constructed by ligating a DNA fragment comprising a target gene to a vector that functions in the host. By transforming the host with the expression vector, the copy number of the gene may be increased. In terms of the DNA fragment comprising the target gene, for example, it may be obtained by PCR using the genomic DNA of a microorganism having the target gene as a template. As a vector, a vector capable of autonomous replication in a host cell may be used. The vector is preferably a multi-copy vector. In addition, in order to select transformants, it is preferred that the vector has a marker such as an antibiotic resistance gene. In addition, the vector may have a promoter or a terminator for expressing the inserted gene. The vector may, for example, be a vector derived from a bacterial plasmid, a vector derived from a yeast plasmid, a vector, a cosmid or a phagemid derived from a phage, or the like.

[0144] In the case of introducing a gene, it is sufficient for the gene to be maintained in the host in a manner that it can be expressed. Specifically, it is sufficient for the gene to be maintained in a manner that it is expressed under the control based on a promoter that functions in the host. In the case of a promoter, there is no particular limitation provided that it functions in the host. “A promoter that functions in the host” may refer to a promoter that has promoter activity in the host. The promoter may be a promoter derived from the host or a promoter derived from a heterogeneous species. The promoter may be the intrinsic promoter of the introduced gene or a promoter of another gene. For example, a strong promoter may be used as a promoter.

[0145] A terminator for terminating transcription may be configured downstream of the gene. As for the terminator, there is no particular limitation provided that it functions in the host. The terminator may be a terminator derived from the host or a terminator derived from a heterogeneous species. The terminator may be the intrinsic terminator of the introduced gene or the terminator of another gene.

[0146] In addition, when two or more genes are introduced, each gene may be maintained in the host in an expressible manner. For example, each gene may be maintained on a single expression vector, or on the genome. In addition, each gene may be maintained on multiple expression vectors respectively, or on single or multiple expression vectors or on the genome respectively.

[0147] As for the introduced gene, there is no particular limitation provided that it encodes a protein that functions in the host. The introduced gene may be a gene derived from the host or a gene derived from a heterogeneous species. As for the introduced gene, for example, it may be obtained by PCR using primers designed based on the base sequence of the gene and using the genomic DNA of the organism having the gene or a plasmid carrying the gene as a template. In addition, the introduced gene for example may be fully synthesized based on the base sequence of the gene. The obtained gene may be used as is or may be used by appropriate modifications. That is, by modifying the gene, its variant can be obtained. The modification of a gene may be performed by well-known techniques.  For example, through site-specific mutation methods, target mutations can be introduced into a target site of DNA. That is, for example, through site-specific mutation methods, the coding region of a gene can be modified so that the encoded protein comprises the substitution, deletion, insertion, and / or addition of amino acid residues at a specific site. Alternatively, variants of the gene can be fully synthesized.

[0148] In addition, the increase in gene expression may be achieved by improving the efficiency of gene transcription. In addition, the increase in gene expression may be achieved by improving the efficiency of gene translation. The improvement of gene transcription efficiency or translation efficiency may be achieved, for example, by modification of expression regulatory sequences.

[0149] As for the improvement of gene transcription, it may be achieved, for example, by replacing the promoter of a gene on the genome with a stronger promoter. A “stronger promoter” may refer to a promoter by which the transcription of a gene is improved compared to the naturally occurring wild-type promoter.

[0150] “Reduced activity or expression of a protein or enzyme” means that the activity of the protein or enzyme is reduced compared with a non-modified strain or a starting strain. It is noted that “reduced activity or expression of a protein or enzyme” also includes the complete loss of the activity of the protein or enzyme. More specifically, “reduced activity or expression of a protein or enzyme” may mean that, compared to a non-modified strain, the molecule number of the protein or enzyme per cell is reduced and / or the function of the protein or enzyme per molecule is reduced. As for the degree of reduction in the activity or expression of the protein or enzyme, there is no particular limitation provided that the activity of the protein or enzyme is reduced compared with a non-modified strain or a starting strain. The activity of the protein or enzyme may be reduced, for example, to 50%or less, 20%or less, 10%or less, 5%or less, or 0%of that of a non-modified strain.

[0151] The reduction in gene expression, for example, may result from a reduction in transcription efficiency, a reduction in translation efficiency, or a combination thereof. Regarding the reduction in gene expression, it may be achieved, for  example, by modifying expression regulatory sequences such as the promoter, Shine-Dalgarno (SD) sequence (also known as ribosome binding site (RBS) ) , and the spacer region between the RBS and the start codon of a gene. In the case of modifying expression regulatory sequences, it is preferred that 1 or more bases, more preferably 2 or more bases, and particularly preferably 3 or more bases of the expression regulatory sequence are modified. The reduction of transcription efficiency of a gene, may be achieved, for example, by replacing the promoter of a gene on the genome with a weaker promoter. A “weaker promoter” refers to a promoter by which transcription of a gene is weakened compared to the naturally occurring wild-type promoter. As for a weaker promoter, it may be exemplified by an inducible promoter. That is, an inducible promoter may function as a weaker promoter under non-inducing conditions (for example, in the absence of an inducing substance) . In addition, a part or all of the region of the expression regulatory sequence may be deleted (deficient) . In addition, with respect to the reduction of gene expression, it may also be achieved, for example, by manipulating a factor involved in expression control. As for a factor involved in expression control, it may be exemplified by low molecules (inducing substances, inhibitory substances, etc. ) , proteins (transcription factors, etc. ) , and nucleic acids (siRNA, etc. ) involved in transcription and translation control. Furthermore, the reduction of gene expression may also be achieved, for example, by introducing a mutation that reduces gene expression into the coding region of the gene. For example, the expression of a gene may be reduced by replacing codons in the coding region of a gene with synonymous codons that are used less frequently in the host. In addition, for example, the expression of the gene itself may be reduced by disrupting the gene as described below.

[0152] In addition, the modification that reduces the activity or expression of a protein or enzyme may be achieved, for example, by disrupting a gene encoding the protein. The “gene disrupted” means that the gene is modified in a manner that a protein that functions normally is not produced. “A protein that functions normally is not produced” includes a case that no protein is produced from the gene  at all, and a case that a protein whose function (e.g. activity, properties) per molecule has reduced or lost is produced from the gene.

[0153] The disruption of a gene may be achieved, for example, by deleting (losing) genes in the genome. The “deletion of a gene” means the deletion of a part or all of the region of the coding region of a gene. Furthermore, the full gene may also be deleted by deletion along with the sequences preceding and following the coding region of the gene on the genome. The sequences preceding and following the coding region of the gene may include, for example, an expression regulatory sequence of the gene. Provided that the activity of the protein can be reduced, the region to be deleted may be any of the regions such as the N-terminal region (aregion encoding the N-terminal side of the protein) , the internal region, or the C-terminal region (aregion encoding the C-terminal side of the protein) . Generally, the longer the region that is deleted, the more reliably the gene can be inactivated. The region to be deleted may be a region with a length of for example, 10%or more, 20%or more, 30%or more, 40%or more, 50%or more, 60%or more, 70%or more, 80%or more, 90%or more, or 95%or more of the total length of the coding region of the gene. In addition, with respect to the sequences preceding and following the region to be deleted, it is preferred that the reading frames are inconsistent with each other. Through the inconsistent reading frame, a frameshift may occur downstream of the deleted region.

[0154] In addition, as for the disruption of agene it may also be achieved, for example, by introducing amino acid substitutions (missense mutations) , introducing stop codons (nonsense mutations) , or introducing addition or deletion of 1 to 2 bases (frameshift mutation) into the coding region of genes on the genome, etc. Alternatively, it may also be achieved by inserting other base sequences into the coding region of a gene on the genome. The insertion site may be any region of the gene, and the longer the inserted base sequence, the more reliably the gene can be inactivated. In addition, with respect to the sequences preceding and following the insertion site, it is preferred that the reading frames are inconsistent with each other. Through inconsistent reading frames, a frameshift may occur downstream of the  insertion site. As for other base sequences, there is no particular limitation provided that the activity of the encoded protein is reduced or eliminated. In particular, it may be implemented in a manner that the amino acid sequence of the encoded protein or enzyme is deleted (deficient) . In other words, the modification that the activity of a protein or an enzyme is reduced may be, for example, by deleting the amino acid sequence of the protein (apart or all of the region of the amino acid sequence) .

[0155] As used herein, the nanA gene encodes N-acetylneuaminic acid aldolase (EC 4.1.3.3) . N-acetylneuraminic acid aldolase is able to catalyze the cleavage of the C-C bond of N-acetylneuraminic acid (Neu5Ac, also known as sialic acid) , thereby producing N-acetylmannosamine (N-acetyl-D-mannosamine, or ManNAc) and Pyruvic acid (Pyr) . The strain with the nanA gene knocked out substantially does not express active N-acetylneuraminic acid aldolase, thereby substantially not converting Neu5Ac into ManNAc, which represses the consumption of Neu5Ac through this pathway, thereby facilitating the accumulation of Neu5Ac in the bacterial cells.

[0156] As used herein, the nanK gene encodes the N-acetylmannosamine kinase (EC 2.7.1.60) . the N-acetylmannosamine kinase is able to catalyze the transfer of phosphate groups, thereby converting ManNAc into N-acetylmannosamine-6-phosphate (N-acetyl-D-mannosamine-6-phosphate, ManNAc-6-P) . The strain with the nanK gene knocked out substantially does not express active the N-acetylmannosamine kinase, thereby substantially not converting ManNAc into ManNAc-6-P, which represses the consumption of ManNAc through this pathway, thereby facilitating the accumulation of ManNAc in the bacterial cells and then facilitating the accumulation of Neu5Ac (with ManNAc as the precursor) in the bacterial cells.

[0157] As used herein, the nanE gene encodes N-acetylmannosamine-6-phosphate epimerase (N-acetyl-D-mannosamine epimerase, also known as ManNAc-6-P epimerase, EC 5.1.3.9) . N-acetylmannosamine-6-phosphate epimerase is able to catalyze the isomerization of N-acetylmannosamine-6-phosphate (N-acetyl-D- mannosamine-6-phosphate, ManNAc-6-P) to N-acetylglucosamine-6-phosphate (GlcNAc-6-P) . The strain with the nanE gene knocked out substantially does not express active N-acetylmannosamine-6-phosphate epimerase, thereby substantially not occurring the isomerization reaction of ManNAc-6-P to GlcNAc-6-P, which represses the consumption of ManNAc-6-P through such a pathway.

[0158] Genetically engineered bacterium and the construction methods of the present invention

[0159] The gene related to the intracellular degradation of N-acetylneuraminic acid (Neu5Ac) in the wild-type strain BL2l (DE3) has been knocked out previously by CRISPR / Cas9 technology, and then the lacZ gene encoding β-galactosidase has been knocked out, resulting in a non-naturally occurringE. coli strain SLIS026 for the production of Neu5Ac. A Neu5Ac or SL synthesis pathway comprising at least one heterologous enzyme has been constructed in this strain, and the resulting genetically engineered bacterium is able to synthesize Neu5Ac or SL by self-metabolism using a single cheap exogenous carbon source present in the fermentation broth. See the disclosure in the patent application with Publication No. CN116200316A for details.

[0160] Based on the previously obtained genetically engineered bacterium SLIS026, the inventors have performed further genetic modification and obtained an integrated engineered bacterium having a high yield of 3’-sialyllactose without the addition of antibiotics. The construction of the integrated engineered bacterium of the present invention is further described below. The enzymes related to gene modification and their encoding genes are described below.

[0161] As shown in Fig. 1, the lacZ gene inE. coli encodes β-galactosidase. The beta-galactosidase may cut the galactosidic bond of lactose to produce galactose and glucose. The strain with the lacZ gene knocked out substantially does not express active β-galactosidase, which represses the consumption of lactose through this pathway, thereby facilitating the accumulation of lactose in bacterial cells. Because CMP-N-acetylneuraminic acid (CMP-Neu5Ac) and lactose generate 3’- sialyllactose under the catalysis of α-2, 3-sialyltransferase encoded by the ST gene, the accumulation of lactose concentration in the bacterial cells facilitates the increase in the production of 3’-sialyllactose.

[0162] The integrated engineered bacterium of the present invention has undergone any one or more of the following modifications relative to the starting strain (SLIS026 strain) :

[0163] 1. The metabolic pathway of glucosamine 6-phosphate (GlcN-6-P) of the SLIS026 strain has been modified.

[0164] The purpose of this modification is to increase the supply of glucosamine 6-phosphate in bacterial cells by reducing the consumption of glucosamine 6-phosphate in bacterial cells through the bypass pathway. Because glucosamine 6-phosphate is one of the precursors for N-acetylneuraminic acid (Neu5Ac) synthesis, and Neu5Ac, in turn, is one of the precursors for 3’-sialyllactose (3’-SL) synthesis, increasing the supply of glucosamine 6-phosphate contributes to increasing the supply of Neu5Ac, which in turn contributes to increasing the production of 3’-SL.

[0165] The integrated engineered bacterium of the present invention is able to utilize at least glucose or glycerol as a carbon source to produce 3’-SL. Among them, the glucose, after entering the bacterial cell, may be converted into glucose-6-phosphate (G-6-P) under the action of glucose phosphorylation-and transport-related enzymes encoded by genes such as ptsG, ptsH, crr, and ptsL. The glucose-6-phosphate generates fructose-6-phosphate (F-6-P) under the action of phosphoglucose isomerase (PGI) encoded by the pgi gene. The glycerol, after entering the bacterial cell, generates F-6-P by the catalysis of glycerol metabolism-related enzymes encoded by genes such as glpF, glpK, and glpD. F-6-P generates glucosamine 6-phosphate (GlcN-6-P) under the action of glucosamine-6-phosphate synthetase (glmS, EC 2.6.1.16) . The same applies to the utilization of other carbon sources (such as sucrose) .

[0166] In order to increase the supply of glucosamine 6-phosphate (GlcN-6-P) , the following method is utilized in the present invention:

[0167] (1) Knockout of the pfkA gene encoding 6-phosphofructokinase;

[0168] The pfkA gene of E. coli is able to encode 6-phosphofructokinase (EC 2.7.1.11) . 6-Phosphofructokinase may catalyze the transfer of phosphate groups, thereby generating fructose 1, 6-bisphosphate (FBP) from F-6-P. The strain with the pfkA gene knocked out substantially does not express 6-phosphofructokinase, thereby avoiding the conversion of most F-6-P into FBP, and thus reducing the consumption of F-6-P in the bacterial cells, which facilitates the accumulation of F-6-P in the bacterial cells and then facilitates the accumulation of GlcN-6-P in the bacterial cells. In the present invention, when knocking out the pfkA gene, only a part of its nucleotide fragment is knocked out, but not all of its nucleotide fragment. The knockout method of a part of the nucleotide fragment is as follows: the length of the nucleotide sequence retained at the 5’ end accounting for 0%-7%of the total length of the nucleotide sequence of the endogenous 6-phosphofructokinase (pfkA) gene, while the length of the nucleotide sequence retained at the 3’ end accounting for 70%-80%of the total length of the nucleotide sequence of the endogenous 6-phosphofructokinase (pfkA) gene.

[0169] (2) Overexpression of the glmS gene encoding glucosamine-6-phosphate synthetase;

[0170] The glmS gene of E. coli is able to encode glucosamine-6-phosphate synthetase (glmS) . Glucosamine-6-phosphate synthetase glmS may catalyze F-6-P to generate GlcN-6-P. When the glmS gene is overexpressed, the efficiency of the generation of GlcN-6-P from F-6-P will increase, which may in turn improve the efficiency of the conversion of GlcN-6-P into glucosamine-1-phosphate (GlcN-1-P) , thereby facilitating the generation of 3’-SL. In the present invention, the glucosamine-6-phosphate synthetase gene (glmS) is integrated into the genome of the genetically engineered bacterium by increasing the copy number of the glucosamine-6-phosphate synthetase (glmS) gene, thereby achieving overexpression of the glmS gene.

[0171] In the present invention, when the partial fragment of the pfkA gene is knocked out, the glmS gene may be integrated into the location where the pfkA gene has been knocked out (denoted as ΔpfkA: : glmS) , thereby achieving overexpression of  the glmS gene in the bacterial cell genome. This may reduce the steps of genetic manipulation and reduce the impact on bacterial cell growth and fermentation.

[0172] (3) Knockout of the nagB gene encoding glucosamine-6-phosphate deaminase;

[0173] The nagB gene of E. coli is able to encode glucosamine-6-phosphate deaminase. Glucosamine-6-phosphate deaminase may catalyze the catabolism of glucosamine 6-phosphate (Glucosamine-6-P, GlcN-6-P) into fructose-6-phosphate (Fructose-6-P, F-6-P) and ammonia. The strain with the nagB gene knocked out may substantially not express active glucosamine-6-phosphate deaminase, thus thereby GlcN-6-P may substantially not be converted into F-6-P, thereby reducing the consumption of GlcN-6-P in the bacterial cells, which facilitates the accumulation of GlcN-6-P in the bacterial cells.

[0174] From the above, it can be seen that in the present invention, the synthesis pathway of GlcN-6-P may be enhanced by overexpressing the glmS gene. Secondly, in the present invention, the catabolic pathway of GlcN-6-P may be inhibited by knocking out the nagB gene and pfkA gene. Therefore, the modification of the metabolic pathway of GlcN-6-P in bacterial cells in the present invention facilitates increasing the supply of GlcN-6-P in bacterial cells, which in turn facilitates increasing the supply of Neu5Ac, and ultimately facilitates increasing the yield of 3’-SL.

[0175] In addition, when knocking out the nagB gene, the nagB gene and nagA gene may be knocked out together, which may reduce the steps of gene manipulation, improve the efficiency of gene manipulation, and reduce the impact on bacterial cell growth and fermentation.

[0176] 2. Overexpression of four key genes related to 3’-SL synthesis

[0177] GlcN-6-P may generate GlcN-1-P under the action of glucosamine phosphate isomerase encoded by the glmM gene. GlcN-1-P generates GlcNAc-1-P under the action of the enzyme encoded by the glmU gene (fused N-acetylglucosamine-1-phosphate uridyltransferase and glucosamine-1-phosphate acetyltransferase) , and then generates UDP-GlcNAc. UDP-GlcNAc, as one of the precursors for 3’-SL  synthesis, may generate 3’-SL under the action of four key enzymes. Therefore, if the genes of these four key enzymes are overexpressed in bacterial cells, the synthesis pathway of 3’-SL will be enhanced, which facilitates increasing the production of 3’-SL.

[0178] The four key genes related to 3’-SL synthesis are: the neuC gene, the neuB gene, the css gene and the ST gene, respectively.

[0179] Among them, the neuC gene encodes the UDP-N-acetylglucosamine 2-epimerase. This enzyme is able to catalyze UDP-GlcNAc to generate ManNAc. In the present invention, the UDP-N-acetylglucosamine 2-epimerase is derived from the Campylobacter jejuni strain, with NCBI accession number WP_002874240.1.

[0180] The neuB gene encodes sialic acid synthase (also known as neuraminidase) . The sialic acid synthase is able to catalyze the reaction of ManNAc and phosphoenolpyruvic acid (PEP) to generate Neu5Ac and phosphoric acid. In the present invention, the gene of sialic acid synthase is derived from the Campylobacter jejuni strain, with GenBank accession number WP_002874241.1.

[0181] The css gene encodes N-acetylneuraminate cytidylyltransferase. The N-acetylneuraminate cytidylyltransferase is able to catalyze Neu5Ac to generate CMP-Neu5Ac and pyrophosphoric acid by using the cofactor CTP. In the present invention, the N-acetylneuraminate cytidylyltransferase is derived from the Neisseria meningitidis strain, with NCBI accession number WP_002215295.1.

[0182] The ST gene encodes α-2, 3-sialyltransferase. The α-2, 3-Sialyltransferase is able to transfer the sialic acid (also known as N-acetylneuraminic acid, Neu5Ac) from the activated glycosyl donor (CMP-Neu5Ac) to lactose, thereby generating 3’-SL and releasing CMP. The ST of the present invention is derived from the Bibersteinia trehalosi strain, with NCBI accession number AGH37861.1.

[0183] The above four genes when overexpressed are constructed separately into different transcription units by using a strong promoter (such as a T2 promoter) and a terminator, and are expressed separately. As an example, the transcription units composed of the above four genes are T2-pET-RBS-css-T7T, T2-pET-RBS-neuB-T7T, T2-pET-RBS-neuC-T7T and T2-pET-RBS-ST. T2 represents the T2  promoter sequence, and RBS represents the ribosome binding site. T7T represents the T7 terminator sequence. The sequence of the T2 promoter is GGATAATCAGATCACGAAATTAATACCACTCACTATAGGAATAGTGCCCGGGTAACCATTCC, with the sequence number SEQ ID NO: 81. The sequence of pET-RBS is TTTAACTTTAAGAAGGAGATATA, with the sequence number SEQ ID NO: 94. The inventors have experimentally confirmed that in addition to the T2 promoter, the lactose promoter (lac promoter) , tryptophan promoter (trp promoter) , and T5 promoter may also be used for the above four genes. However, the T2 promoter has a better effect, so the T2 promoter is selected to be used in the present invention.

[0184] 3. Modification of the supply pathway of cofactors

[0185] In point 2, the N-acetylneuraminate cytidylyltransferase encoded by the css gene requires the cofactor cytidine 5’-triphosphate (CTP) to catalyze Neu5Ac to generate CMP-Neu5Ac and pyrophosphoric acid. The reaction equation is CTP +Neu5Ac→pyrophosphoric acid + CMP-Neu5Ac. This reaction consumes CTP.

[0186] In addition, the α-2, 3-sialyltransferase encoded by the ST gene also releases CMP when catalyzing the reaction of CMP-Neu5Ac and lactose to generate 3’-SL. The reaction equation is CMP-Neu5Ac + lactose→3’-SL + CMP. This reaction leads to the accumulation of CMP.

[0187] If there is insufficient CTP in the bacterial cells, CMP-Neu5Ac will not be produced sufficiently, which will affect the production of 3’-SL. In addition, with the accumulation of CMP, the formation reaction of 3’-SL will also be inhibited. In order to solve the above problems, the cmk gene encoding cytidine monophosphate kinase (CMK) and the ppk gene encoding polyphosphate kinase PPK may be overexpressed in the present invention. The cytidine monophosphate kinase encoded by the cmk gene is able to catalyze the phosphorylation of CMP to generate CDP. The polyphosphate kinase PPK encoded by the ppk gene is able to catalyze the phosphorylation of CDP to produce CTP, thereby realizing the recycling of cofactors and avoiding the inhibitory effect on the production reaction  of 3’-SL due to insufficient cofactors.

[0188] The cmk gene and ppk gene of the present invention are integrated into the genome of the genetically engineered bacterium. The endogenous melibiose permease (melB) gene in the genome of the genetically engineered bacterium is knocked out, and the exogenous cytidine monophosphate kinase (CMK) gene and the exogenous polyphosphate kinase (PPK) gene are inserted into the location where the endogenous melibiose permease (melB) gene has been knocked out. This may reduce the steps of genetic manipulation and reduce the adverse effects of genetic manipulation on strain growth and metabolism.

[0189] 4. Modification of the catabolic pathway of ManNAc

[0190] The ManNAc is one of the precursors for the 3’-SL generation. However, the catabolic pathway of ManNAc present in bacterial cells will cause a decrease in the content of ManNAc in the bacterial cells, thus affecting the production of 3’-SL. The catabolic pathway of ManNAc includes: (1) the N-acetylmannosamine kinase encoded by the nanK gene catalyzes the conversion of ManNAc into ManNAc-6-P; (2) the N-acetylmannosamine-6-phosphate epimerase encoded by the nanE gene isomerizes ManNAc-6-P into GlcNAc-6-P; (3) the N-acetylglucosamine-6-phosphate deacetylase encoded by the nagA gene is able to catalyze the deacetylation of GlcNAc-6-P, thereby producing GlcN-6-P.

[0191] Based on this, the catabolic pathway of ManNAc in the present invention is modified to inactivate the catabolic pathway, thereby facilitating the accumulation of ManNAc in the bacterial cells.

[0192] The strain of the present invention has the nanK gene encoding the N-acetylmannosamine kinase deleted. The strain that has the nanK gene deleted may substantially not express active N-acetylmannosamine kinases, thereby substantially not converting ManNAc into ManNAc-6-P, which facilitates the accumulation of ManNAc in bacterial cells, and in turn facilitates the accumulation of Neu5Ac (with ManNAc as precursor) in the bacterial cells.

[0193] In addition, the strain of the present invention also has the nanE gene encoding N-acetylmannosamine-6-phosphate epimerase deleted. The strain with the nanE  gene knocked out may substantially not express active N-acetylmannosamine-6-phosphate epimerase, thereby substantially not occurring the isomerization reaction of ManNAc-6-P to GlcNAc-6-P.

[0194] Furthermore, the strain of the present invention has the nagA gene encoding N-acetylglucosamine-6-phosphate deacetylase knocked out. The N-acetylglucosamine-6-phosphate deacetylase is able to catalyze the deacetylation of GlcNAc-6-P to produce GlcN-6-P. Therefore, the strain with nagA gene knocked out substantially does not express active N-acetylglucosamine-6-phosphate deacetylase, thereby substantially not causing the reaction of GlcNAc-6-P to GlcN-6-P. As an example, when knocking out the nagA gene, the nagB gene and the nagA gene may be knocked out together, which may reduce the steps of genetic manipulation, improve the efficiency of genetic manipulation, and reduce the impact on bacterial cell growth and fermentation.

[0195] The strain of the present invention has the nanK gene, the nanE gene knocked out, and the nagA gene knocked out. Therefore, ManNAc is difficult to be consumed through the above-mentioned catabolic pathway, which facilitates the accumulation of ManNAc in bacterial cells, and further contributes to increasing the production of 3’-SL.

[0196] 5. Modification of the catabolic pathway of phosphoenolpyruvic acid

[0197] The sialic acid synthase encoded by the neuB gene catalyzes the reaction of ManNAc and phosphoenolpyruvic acid (PEP) to generate Neu5Ac and phosphate. In order to increase the accumulation of Neu5Ac and thereby increase the content of 3’-SL, it is necessary to increase the content of PEP. One pathway of PEP production is that bacterial cells utilize glucose through the glycolysis pathway. However, PEP easily generates enol pyruvic acid under the catalysis of pyruvate kinase (PykA) in bacterial cells. The reaction equation is PEP + 2ADP→enolpyruvic acid + 2ATP. The enolpyruvic acid is in turn converted to pyruvic acid (pyr) . Therefore, in order to increase the content of PEP in the bacterial cells, a partial fragment of the encoding gene pykA for pyruvate kinase is knocked out in the present invention. The knockout of a part of the nucleotide sequence of the  endogenous pyruvate kinase (pykA) gene is performed. Said knockout of the part of the nucleotide sequence is that the length of the nucleotide sequence retained at the 5’ end accounting for 4%-5.5%of the total length of the nucleotide sequence of the endogenous pyruvate kinase (pykA) gene, and the length of the nucleotide sequence retained at the 3’ end accounting for 10%-20%of the total length of the nucleotide sequence of the endogenous pyruvate kinase (pykA) gene.

[0198] 6. Modification of the oligosaccharide transport pathway

[0199] The 3’-SL produced in bacterial cells is required to be pumped out of the cell, otherwise it will inhibit the production of 3’-SL. In the present invention, overexpression of the oligosaccharide transporter gene setB is used to increase the ability of 3’-SL to be pumped out of cells. When knocking out a partial fragment of the pykA gene in the present invention, the setB gene is integrated into the location where the original pykA gene has been deleted (denoted as ΔpykA: : setB) . This may reduce the steps of gene manipulation and reduce the impact on bacterial cell growth and fermentation.

[0200] The genes involved in the present application are shown in Table 1 below:

[0201] Table 1 Gene information involved in the Examples

[0202] The schematic diagram of the metabolic pathway of the integrated engineered bacterium of the present invention is shown in Fig. 1.

[0203] Examples

[0204] In order to further illustrate the technical means and effects of the present invention, a detailed description will be made below with reference to the accompanying drawings and preferred embodiments of the present invention. The experimental methods in the following examples in which particular conditions are not specified, are selected according to conventional methods and conditions, or according to the product instructions.

[0205] The plasmids, PCR reagents, restriction enzymes, plasmid extraction kits, DNA gel recovery kits, etc. used in the following examples are commercial products, and the specific operations are referred to in the instructions.

[0206] Primer synthesis, gene synthesis, and sequencing were all completed by Beijing Tsingke Biotech Co., Ltd. (hereinafter referred to as Tsingke Biotech) .

[0207] The preparation of Escherichia coli competent cells was performed using the Competent Preparation Kit of Sangon Biotech (Shanghai) Co., Ltd.

[0208] The SLIS026 strain is a chassis strain constructed in Example 1 of the patent application with the publication number CN 116200316 A applied by Synaura Biotechnology (Shanghai) Co., Ltd.

[0209] The map of the plasmid pCas-Sac (KanR-resistant) used in the present invention is shown in Fig. 6. Other reagents involved in the following Examples are shown in Table 2 below.

[0210] Table 2. Reagents information list in the Examples

[0211] The in-house reagents involved in the following Examples are as follows:

[0212] (1) the concentration of antibiotics and sugar used: CmR (chloramphenicol) , at a concentration of 25 μg / mL; KanR (kanamycin) , at a concentration of 50 μg / mL; SmR (Spec) (spectinomycin) , at a concentration of 50 μg / mL; Amp (ampicillin) ,  at a concentration of 100 μg / mL; aTc (tetracycline) , at a concentration of 100 ng / mL or 1000 ng / mL; Apr (ampromycin) , at a concentration of 50 μg / mL, rhamnose, at a concentration of 10 mM; sucrose, at a concentration of 10 g / L.

[0213] (2) TB medium: 10 g of tryptone, 18 g of yeast extract, 2.31 g of KH2PO4 (potassium dihydrogen phosphate) and 16.43 g of K2HPO4 (dipotassium hydrogen phosphate) were weighed respectively, dissolved in distilled water and mixed, and then 4 mL of glycerol was added, followed by diluted to 1000 mL with deionized water. The solution is finally dispensed into conical flasks at 100 mL / bottle and wrapped up, sterilized at 121℃ for 20 minutes and stored at room temperature.

[0214] (3) LB medium: 10 g of tryptone, 5 g of yeast extract, 10 g of NaCl and 15 g of agar were weighed respectively, dissolved in distilled water and mixed, and then the pH value was adjusted to 7.2 with 1 mol / L NaOH, followed by diluted to 1 L with distilled water. The solution is finally dispensed into conical flasks and then wrapped up, sterilized at 121℃ for 20 minutes, and stored at 4℃; no agar is added to LB liquid culture medium.

[0215] (4) 200 g / L MgSO4·7H2O mother liquid: 10 g MgSO4·7H2O solution was weighed into deionized water, and diluted to 50 mL after complete dissolution, then sterilized at 121℃ for 20 minutes, and stored at room temperature.

[0216] (5) trace element mother liquid: 54.4 g / L ammonium ferric citrate, 9.8 g / L MnCl2·4H2O, 1.6 g / L CoCl2·6H2O, 1 g / L CuCl2·2H2O, 1.9 g / LH3BO3, 9 g / L ZnSO4·7H2O, 1.1 g / L Na2MoO4·2H2O, 1.5 g / L Na2SeO3 and 1.5 g / L NiSO4·6H2O trace element mother liquid were prepared respectively, sterilized at 121℃ for 20 minutes, and stored at 4℃ for future use.

[0217] (6) 500 g / L glucose: 500 g glucose was weighed and dissolved in deionized water (heating to dissolve) , diluted to 1L, then sterilized at 115℃ for 20 minutes, and stored at room temperature.

[0218] (7) 250 g / L lactose: 250 g lactose was weighed and dissolved in deionized water (heating to dissolve) , diluted to 1L, then sterilized at 121℃ for 20 minutes, and stored at room temperature.

[0219] In the following Examples, the HPLC detection method for 3’-SL obtained by  fermentation is as follows:

[0220] (I) Fermentation sample processing:

[0221] Sample processing method: 1-2 mL of sample (such as fermentation broth) was placed in a metal bath (95℃) and boiled for 30 minutes to remove enzymes, and centrifuged after cooling, and filtered through an aqueous membrane for detection.

[0222] (II) HPLC detection of 3’-SL:

[0223] (1) Instruments and reagents: high-performance liquid chromatograph with UV-visible absorption detector, acetonitrile (chromatographically pure) , purified water, ammonium formate (AR) , formic acid (chromatographic grade) ;

[0224] (2) Chromatographic conditions: chromatographic column: Sepax HP-Amide 250×4.6 mm, 5 μm (amide column) ; buffer salt: 10 mM ammonium formate (pH value 3.0) ; mobile phase: acetonitrile: buffer salt = 70: 30; flow rate: 1.0 mL / min; concentration: 1 mg / mL; detection wavelength: 210 nm; loading volume: 10μL; column temperature: 35℃;

[0225] (3) Detection operation:

[0226] ① The blank loading solution and the diluting solvent are deionized water.

[0227] ② Preparation of standard solution: 25 mg of the standard substance was accurately weighed into a 25 mL volumetric flask, dissolved and diluted by adding water to the volume, and prepared for injection.

[0228] ③ Preparation of test solution: a certain amount of fermentation broth was heated and inactivated followed by centrifuged; the supernatant was taken and filtered, and prepared for injection.

[0229] (4) Calculation of 3’-SL content: the content was calculated using the external standard method.

[0230] The sample content calculation formula is as follows:

[0231] Note: Atest is the peak area of the sample for test (mAU) , Acontrol is the peak  area of the control (mAU) , Ctest is the concentration of the sample for test (mg / mL) , Ccontrol is the concentration of the control (mg / mL) , Xtest is the content of the sample for test (%) , Xcontrol is the content of the control (%) .

[0232] Example 1: Increase of the supply of glucosamine 6-phosphate (GlcN-6P)

[0233] Glucosamine 6-phosphate is one of the precursors for 3’-SL synthesis, and the supply amount of glucosamine 6-phosphate is one of the rate-limiting steps for 3’-SL synthesis. Therefore, increasing the supply amount of glucosamine 6-phosphate will contribute to improving yield of 3’-SL. In this Example, the metabolic pathway of glucosamine 6-phosphate was modified, thereby increasing the supply amount of glucosamine 6-phosphate, and reducing the decomposition amount of glucosamine 6-phosphate. Specifically, the SLIS026 strain was used as the starting strain in this Example, and the CRISPR / Cas9 gene editing system was used to knock out nagA gene (encoding gene for N-acetylglucosamine-6-phosphate deacetylase) and nagB gene (encoding gene for glucosamine-6-phosphate deacetylase) . Further, a part of the fragment of pfkA gene (encoding gene for 6-phosphofructokinase) was knocked out, and glmS gene (encoding gene for glucosamine-6-phosphate synthetase) was integrated into the location where the pfkA fragment has been knocked out when knocking out the pfkA gene, resulting in the overexpression of the glmS gene (recorded as ΔpfkA: : glmS) . Therefore, the SLIS027 strain was obtained.

[0234] The steps of this Example are as follows:

[0235] 1.1. Design and synthesis of primers required for gene knockout and gene integration

[0236] The nucleotide sequences of nagA gene, nagB gene, pfkA gene and glmS gene were obtained respectively according to Table 1. Based on these sequences, primers for knocking out the nagA gene and nagB gene as well as primers for knocking out a partial fragment of the pfkA gene and integrating the glmS gene into the knocked out fragment of the pfkA gene were designed, respectively, as shown in Table 3. The sequence of sgRNA is shown in Table 4. The above designed primers were  submitted to Beijing Tsingke Biotech Co., Ltd (hereinafter referred to as Tsingke Biotech) for synthesis.

[0237] Table 3 List of primers required for gene knockout and gene integration

[0238] In Table 3, in the column of pTargetF-nagAB, PAM represents the protospacer adjacent motif, used for the Cas9 protein to recognize PAM and target specific DNA sequences under the guidance of sgRNA (single guide RNA) , and then the specific DNA sequence is cut by the Cas9 protein. The homology arm LF1 and homology arm RF1 are used for the nicked DNA sequence to be accurately repaired.

[0239] The glmS knock-in donor-DNA fragment is a donor DNA molecule for glmS knock-in, which comprises a homology arm LF2 sequence, a Tet promoter sequence, a glmS gene sequence, a T7 terminator sequence and a homology arm RF2 sequence, thereby enabling the glmS gene inserted into the location where the pfkA gene was knocked out. The above sequences were amplified by PCR with respective primers and corresponding templates, and then ligated into the glmS knock-in donor-DNA fragment using multi-fragment recombinase from NEB (New England Biolabs) . The same applies to the other knock-in genes.

[0240] Table 4 sgRNA sequence list

[0241] In Table 4, the ΔnagAB indicates knockout of nagA gene and nagB gene. The ΔpfkA: : glmS indicates that a partial fragment of the pfkA gene was knocked out and the glmS gene was integrated into the location where pfkA gene was knocked out.

[0242] 1.2 Construction of related plasmids:

[0243] The primers designed according to Table 3 were used to specifically amplify each gene fragment related to the pTargetF-nagAB and the pTargetF-pfkA-NT1, respectively. The High-Fidelity Enzyme 2× Flash KOD Dye Mix from Toroivd Diagnostic Technology Jiangsu Co., Ltd. was used for PCR reaction. The PCR amplification reaction system is shown in Table 5:

[0244] Table 5 PCR amplification reaction system

[0245] The DNA template in Table 5 refers to the template where each gene fragment in need of specific amplification is located, see the records in the “Template” column in Table 3. The Primer F refers to each forward primer in Table 3, and the Primer R refers to each reverse primer in Table 2.

[0246] The PCR amplification procedure is shown in Table 6:

[0247] Table 6 The PCR reaction procedure

[0248] The 5 μL of amplified product was taken for 1%agarose gel electrophoresis to detect the PCR amplification results. Then the following steps were performed:

[0249] (1) Each DNA fragment with correct PCR amplification results was cut and recovered respectively using UE DNA Gel Recovery Kit from UElandy (Suzhou) Biotechnology Co., Ltd., and the concentration of the recovered DNA fragment was measured using the BioSpec-nano instrument.

[0250] (2) The corresponding ligation and recombination of different DNA fragments was performed using the multi-fragment recombinase from NEB (New England Biolabs) , with the use level of each DNA fragment at 200 ng. Then an equal volume of multi-fragment recombinase was added, blended, and incubated in a 50℃ water bath for 30-60 minutes to obtain different ligation products respectively.

[0251] (3) The E. coli competent cell Trans 10 stored in the ultra-low temperature refrigerator was taken out and placed on ice (E. coli competent cell Trans 10 is used in this Example, while E. coli competent cell C2566 may also be applicable) .

[0252] (4) Each ligation product was pipetted respectively and added respectively to 100 μL E. coli competent cell Trans 10, mixed carefully, and placed on ice for 30 minutes.

[0253] (5) The centrifuge tube comprising the E. coli competent cells in step (4) was placed in the water bath for heat shock for 90 seconds after heating the water bath to 42℃ in advance, and then rapidly ice-bathed for 5 minutes.

[0254] (6) 800 μL of sterilized LB liquid culture medium was added into the centrifuge tube in step (5) , and cultured at 37℃ and 250 rpm for 45 to 60 minutes with shaking.

[0255] (7) After centrifuging the centrifuge tube at 4000 rpm for 1 minute, part of the supernatant was aspirated, and then the remaining bacteria solution was mixed using a pipette, spread on the LB solid plate comprising the corresponding antibiotics, and cultured at 37°overnight.

[0256] (8) After a white single colony grows, the white single colony was picked into a test tube comprising 5 mL of LB liquid culture medium (comprising corresponding antibiotics) , and cultured at 37℃ at 250 rpm for 6 hours with shaking.

[0257] (9) 500 μL of the positive bacteria solution was sent to Tsingke Biotech for sequencing after the bacteria solution was performed for PCR detection, or bacteria solution without PCR detection was directly sent for sequencing, and the remaining bacteria solution was stored in 30%glycerol.

[0258] (10) The correct stain verified by sequencing was expanded, and the Plasmid Mini Extraction Kit from Toroivd Diagnostic Technology Jiangsu Co., Ltd. was used for plasmid extraction. The pTargetF-nagAB plasmid and the pTargetF-pfkA-NT1 plasmid were obtained respectively.

[0259] 1.3 Construction of the glmS knock-in donor-DNA fragment

[0260] According to the primers designed in Table 3, the glmS knock-in donor-DNA  fragment was constructed using overlap extension PCR (OE-PCR) . The procedure of each round of the multiple rounds of PCR in the overlap extension PCR method is shown in Table 6.

[0261] 1.4 Construction of SLIS027 strain

[0262] The SLIS027 strain in this Example was modified using the SLIS026 strain as the starting strain. Compared with the SLIS026 strain, the nagA gene and the nagB gene were deleted, a partial fragment of the pfkA gene was knocked out and the glmS gene was integrated into the location where the pfkA fragment was knocked out, and ultimately the SLIS027 strain was obtained. The nagAB gene of the SLIS026 strain was knocked out using the pTargetF-nagAB plasmid. The partial fragment of the pfkA gene was knocked out and the glmS gene was inserted at the knocked-out pfkA site using the pTargetF-pfkA-NT1 plasmid and the glmS knock-in donor-DNA fragment.

[0263] The construction method of SLIS027 strain comprises the following steps:

[0264] ①Preparation of SLIS026 competent cells: The SLIS026 strain stored at -80℃ was streaked to culture a single colony. A single colony was picked and inoculated into 5 mL LB liquid medium, cultured with shaking at 250 rpm at 37℃until the OD600 of the bacteria solution was about 0.5 (about 3 hours) , and then the bacteria solution was ice-bathed for 30 minutes. The bacteria solution was transferred to a pre-cooled sterile centrifuge tube, and centrifuged at 4000 rpm for 10 minutes at 4℃, the supernatant was discarded, and the wet bacterial cells were collected. The wet bacterial cells were resuspended twice with a pre-cooled 0.1M CaCl2 solution (comprising 15%glycerol) . The resuspension was centrifuged at 4000 rpm for 10 minutes at 4℃ and the supernatant was discarded. Finally, the cells were resuspended in pre-cooled 0.1M CaCl2 solution (comprising 15%glycerol) , aliquoted at 100 μL per tube into 1.5 mL centrifuge tubes, and rapidly frozen in liquid nitrogen, and stored at -80℃ to obtain SLIS026 competent cells.

[0265] ② 3 μL pCas-Sac plasmid was added into a centrifuge tube comprising 100 μL SLIS026 competent cells, and then the centrifuge tube was placed on ice for 30  min followed by heat shock at 42℃ for 45 s, and immediately placed on ice for 2 to 5 minutes; 800 μL LB liquid culture medium was added and incubated in a shaker at 30℃ for 45 minutes, spread on the plate (Kan resistant, LB solid medium) , and inversely placed in an incubator at 37℃ overnight; after a single colony grows out, the single colony was picked into LB liquid medium (Kan resistant) , cultured for several hours and then preserved (at a final concentration of glycerol of 30%) to obtain the pCas-Sac / SLIS026 strain (capable of expressing Cas protein) .

[0266] ③The pCas-Sac transformant (i.e., the pCas-Sac / SLIS026 strain) was picked and inoculated into an LB screen tube (kan resistant) . When bacteria solution was cultured at 37℃ to the OD value of 0.2, the arabinose with a final concentration of 2 g / L was added for induction (in addition, arabinose may also be added when culturing a single colony) , and competent cells were prepared at an OD600 of 0.4 with the same preparation method as operation①, in order to obtain pCas-Sac / SLIS026 competent cells;

[0267] ④ The correctly constructed pTargetF-nagAB plasmid was transformed into pCas-Sac / SLIS026 competent cells through the heat shock method. The cells were spread on LB plates (kan+, spe+) after recovered. The plates were then inversely placed in an incubator at 37℃ and incubated overnight until a single colony grew on the plate.

[0268] ⑤ The PCR verification was performed on a single colony on the resistant plate based on the PCR verification primers in Table 7. The PCR product in which the successful knockout of nagAB gene was verified was sent for sequencing. The primers for sequencing verification are shown in Table 7.

[0269] ⑥According to the sequencing results of⑤, the successfully knocked-out / knocked-in strains were picked for shaking, and rhamnose with a final concentration of 10 mM was added (the amount of rhamnose may be appropriately increased to improve the efficiency of plasmid elimination) and the culture was induced and cultured at 37℃ for 5-7 hours for the plasmid pTargetF-nagAB loss.

[0270] ⑦ The bacteria solution obtained in⑥ was streaked on LB plate (kan+, rhamnose) to obtain a single colony. The loss of the pTargetF-nagAB plasmid was verified using the verification primers in Table 7 by PCR (or was streaked on the LB plate with Spec added for overnight culture for verification of the loss of pTargetF-nagAB plasmid) .

[0271] ⑧ The strain in which treatment for the pTargetF-nagAB plasmid loss was completed was streaked on a 10g / L sucrose plate (the amount of sucrose may be appropriately increased to improve the efficiency of plasmid elimination) , and the plate was inversely placed and cultured at 37℃ overnight. The loss of the pCas-Sac plasmid was verified using the verification primers in Table 8 by PCR (or was streaked on the LB plate with Kan added for overnight culture for verification of the loss of pCas-Sac plasmid ) .

[0272] ⑨ When performing the knock-in and knockout of ΔpfkA: : glmS, the corresponding pTargetF-pfkA-NT1 and the glmS knock-in donor-DNA fragment (donor DNA comprising the gene to be inserted) were transformed together to the corresponding competent cells. The subsequent operations are similar to the gene knockout operation, and the SLIS027 strain was obtained ultimately.

[0273] Table 7 List of Verification primers for SLIS027 strain knock-out and knock-in gene

[0274] Table 8 Verification primers for pCas-Sac and pTargetF elimination

[0275] 1.5 Acquisition and fermentation of fermentation strains EBSL001 and EBSL002

[0276] (1) Design of pTU2-A-DOE13 plasmid. The map of pTU2-A-DOE13 plasmid is shown in Fig. 2. The pTU2-A-DOE13 plasmid carries transcription units of the four genes: T2-pET-RBS-css-T7T, T2-pET-RBS-neuB-T7T, T2-pET-RBS-neuC-T7T and T2-pET-RBS-ST-T7T. The designed pTU2-A-DOE13 plasmid was submitted to Tsingke Biotech for synthesis. The T2 represents the T2 promoter, and all four genes are expressed using the T2 promoter. The RBS represents the ribosome binding site. The css, the neuB, the neuC, and the ST represent the names of four genes related to 3’-SL synthesis. The T7T represents the T7 terminator.

[0277] (2) The pTU2-A-DOE13 plasmid was transformed into the SLIS026 strain to obtain the EBSL001 strain. The pTU2-A-DOE13 plasmid was transformed into the SLIS027 strain to obtain the EBSL002 strain.

[0278] (3) Protein induction expression and fermentation culture: A single colony of EBSL001 strain and EBSL002 strain were inoculated into a 5 mL LB resistant test tube (comprising 25 μg / mL chloramphenicol) , respectively, and cultured at 37℃and 250 rpm for 6-7 hours. The culture was inoculated into a 100 mL TB resistant shake flask (comprising 25 μg  / mL chloramphenicol) at an inoculation amount of 2.5-5% (the specific inoculation amount is determined based on the density of the bacteria in the seed culture medium, in order to make the number of bacterial cells in each inoculation is substantially the same) , and cultured at 37℃, 250 rpm to OD600 of about 1-1.2 (about 4-5h) . After that, IPTG (at a final concentration of 0.1 mM) , 1 mL 200 g / L MgSO4·7H2O (at a final concentration of 2 g / L) , 0.1 mL trace element mother liquid (at a final concentration of 0.1%) , 2 mL 500 g / L glucose (at a final concentration of 10 g / L) and 2 mL 250g / L lactose (at a final concentration of 5 g / L) were added for fermentation culture to produce 3’-SL under the culture conditions at 30℃ and 250 rpm. The starting time for fermentation culture was considered as 0 h, with 2 mL of 500 g / L glucose (final concentration is 10 g / L) added every 12 h, to ensure that the concentration of glucose added within 24 hours  was at least 20 g / L. The total time for fermentation was 48h. The HPLC was then used to detect the content of 3’-SL in the fermentation broth. The final concentration in this Example refers to the initial concentration of each component after being added to the culture solution, that is, the concentration at the beginning of the fermentation culture.

[0279] The fermentation broth of EBSL001 strain was analyzed by HPLC, and the detection result is shown in Fig. 3. As can be seen from Fig. 3, the peak position time of 3’-SL standard sample detected by HPLC was 16.397 min, and the peak position time of 3’-SL in the fermentation broth of EBSL001 strain detected by HPLC was 16.438 min, indicating that the 3’-SL was synthesized by fermentation.

[0280] According to the results of the shake flask fermentation of EBSL001 strain and EBSL002 strain, the 3’-SL yield of EBSL001 strain was 3.1 g / L, and the 3’-SL yield of EBSL002 strain was 3.8 g / L, which increased by 22.58%compared to EBSL001 strain. This shows that increasing the supply of glucosamine 6-phosphate (GlcN-6P) precursor by knocking out nagAB and pfkA and integrating the glmS gene is beneficial to 3’-SL synthesis.

[0281] Test example 1

[0282] In this Example 1, when knocking out the pfkA gene, only a partial fragment of the pfkA gene, rather than the full gene fragment was knocked out. This is because the inventors knocked out the full gene sequence of the pfkA gene (963 bp) during the experiment, and fermented the genetically engineered bacterium obtained by such a knockout. The results showed that this strain had a very poor growth status and a low passage efficiency, and could not meet the basic requirements as a chassis cell. The inventors believe that this may be because the fieF gene, pfkA gene andsbp gene are closely arranged in tandem in the prokaryotic genome, and the knockout of the 3’ region of the pfkA gene will affect the transcription and expression of other structural genes adjacent to the pfkA gene, thereby affecting the growth and proliferation of the genetically engineered bacterium.

[0283] In this Example, the inventors only knocked out the upstream sequence of the  pfkA gene, but retained the sequence at the 3’ end that is equivalent to 76%of the full-length sequence of the pfkA gene (732 bp) , and fermented and cultured the genetically engineered bacterium obtained after the knockout. The inventors surprisingly found that compared with the previous engineered bacterium in which the full gene fragment was knocked out, partial knockout of the pfkA gene did not affect the growth status and passage efficiency of the engineered bacterium.

[0284] The inventors also found in the study that it is difficult and time-consuming to select a primer with high knockout efficiency if the sequence retained at the 5’ end of the pfkA gene is too long and the sequence retained at the 3’ end is too short when knocking out the intermediate sequence of the pfkA gene. Therefore, for comprehensive considerations, when knocking out the partial fragment of the pfkA gene, it is appropriate that the length of the sequence retained at the 5’ end is in the range of 0%to 7%, and the length of the sequence retained at the 3’ end is in the range of 70%to 80%.

[0285] Example 2: Optimization of the cofactor circulation system

[0286] N-acetylneuraminic acid (Neu5Ac) , also known as Sialic acid (SA) , is one of the precursors for the synthesis of 3’-SL. Neu5Ac requires the participation of the cofactor CTP in the process of generating CMP-Neu5Ac. UTP produces CTP under the catalysis of CTP synthase, and the encoding gene for CTP synthase is the pyrG gene (accession number AAC75822.1) . If the supply of cofactor CTP is insufficient, the production of 3’-SL will be affected. Therefore, in this Example, the SLIS027 strain was used as the starting strain to overexpress the cmk gene encoding cytidine monophosphate kinase (CMK) and the ppk gene encoding polyphosphate kinase PPK, thereby enabling the continuous cyclic regeneration of the cofactor CTP to solve the problem of insufficient supply of the cofactor CTP. The cyclic regeneration of the cofactor refers to the cyclic regeneration from CTP→CMP→CDP→CTP. The cytidine triphosphate is abbreviated as CTP; also known as cytidine triphosphate. The cytidine monophosphate is abbreviated as CMP; also  known as cytidine monophosphate. The cytidine diphosphate is abbreviated as CDP; also known as cytidine diphosphate.

[0287] The steps of this Example are as follows:

[0288] 2.1. Design and synthesis of primers required for gene knockout and integration

[0289] In this Example, primers for gene knockout and integration are shown in Table 9. The sequences of sgRNAs used for gene knockout and integration are shown in Table 10.

[0290] Table 9 List of primers for gene knockout and integration

[0291] Table 10 sgRNA sequence list

[0292] 2.2 Construction of recombinant plasmid and donor-DNA fragment:

[0293] pTargetF-melB-NT1 plasmid and pTargetF-melB-NT2 plasmid were constructed respectively, according to the method in Section 1.2 of Example 1.

[0294] ppk knock-in donor-DNA and cmk knock-in donor-DNA were constructed respectively, according to the method in Section 1.3 of Example 1.

[0295] 2.3 Construction of SLIS028 strain

[0296] The SLIS028 strain in this Example was modified using the SLIS027 strain as the starting strain. Compared with the SLIS027 strain, the cmk gene encoding cytidine monophosphate kinase and the ppk gene encoding polyphosphate kinase were integrated and overexpressed, that is, the partial sequence of the melB site was knocked out and the ppk gene and cmk gene were knocked into the position where the melB gene was knocked out in the genome of SLIS027 strain using the  two-step knock-in method.

[0297] The two-step knock-in method refers to (1) performing the knock-in treatment of the ppk gene by co-transforming the pTargetF-melB-NT1 and the linearized fragment of the ppk gene knock-in donor-DNA, with a T5 promoter used for the ppk gene (denoted as ΔmelB: : T5-ppk) ; (2) performing the knock-in treatment of the cmk gene by co-transforming the pTargetF-melB-NT2 and the linearized fragment of the cmk gene knock-in donor-DNA, with a tetracycline promoter tet for the cmk gene (ΔmelB: : tet-cmk) , and the cmk gene inserted upstream of the ppk gene. See Section 1.4 of Example 1 for specific steps. The same applies to the following Examples.

[0298] After extensive experimental verification, the inventors have found that if the knocked-inppk gene and cmk gene both use the same T2 promoter as the four key genes, then the expression of the ppk gene and cmk gene will interact with the expression of the four key genes, which is not conducive to the improvement of cofactor recycling efficiency and 3’-SL synthesis efficiency. Therefore, the knocked-inppk gene and cmk gene need to use a promoter different from the T2 promoter. In addition, if the knocked-in ppk gene and cmk gene use a promoter stronger than the T2 promoter, the expression of the ppk gene and cmk gene will also increase. However, in fact, since the ppk gene and cmk gene are genes related to the cofactor CTP recycling but not directly related to the synthesis of 3’-SL, there is no linear relationship between the substantial increase in the expression of the two genes and the improvement of the synthesis efficiency of 3’-SL. Therefore, the expression of these two genes does not require a strong promoter for regulation. Instead, a promoter weaker than the T2 promoter may be used to maintain the basic transcription level to promote cofactor recycling. Furthermore, if the ppk gene and the cmk gene use the same weak promoter to regulate gene expression, the same weak promoter will competitively bind to the same type of RNA polymerase, which will also have a certain impact on the respective transcription of the ppk gene and the cmk gene. Thus, the inventors chose to use different types of weak promoters to regulate the transcription of the ppk gene and the cmk gene  respectively. In the present application, the ppk gene uses the T5 promoter to regulate expression, and the cmk gene uses the tetracycline promoter tet to regulate expression. In fact, the ppk gene may also use the tetracycline promoter tet to regulate expression, and the cmk gene may also use the T5 promoter to regulate expression.

[0299] The strong promoter and weak promoter in the present application are relative. A strong promoter means that the recognition and binding ability of the promoter sequence to RNA polymerase is stronger than that of a weak promoter, thereby making the transcription efficiency or transcription level of the downstream structural gene connected to it higher than that of a weak promoter. Specifically, the T2 promoter has a stronger ability to regulate gene transcription than the T5 promoter and tet promoter.

[0300] The melB gene is a gene located in the E. coli genome, which encodes a transporter related to the transport of melibiose, namely melibiose permease (MelB) . Experiments have shown that the knockout of the melB gene in the E. coli genome does not affect the normal growth, metabolism, and proliferation of E. coli. Therefore, in this Example, the ppk gene and cmk gene were selected to be knocked into the location where the melB gene was knocked out.

[0301] PCR detection and sequencing showed that the successful knock-in of the ppk gene and the cmk gene to SLIS027, and the SLIS028 strain was obtained. The list of verification primers is shown in Table 11.

[0302] Table 11 List of verification primers

[0303] 2.4 Acquisition and fermentation of a fermentation strain EBSL003

[0304] EBSL003 strain was obtained by transforming the pTU2-A-DOE13 plasmid into the SLIS028 strain according to the method in Section 1.5 of Example 1, and  the EBSL001, EBSL002 and EBSL003 were subjected to a shake flask fermentation, respectively. The total time for fermentation was 48 hours. HPLC was then used to detect the content of 3’-SL in the fermentation broth.

[0305] According to the results of the shake flask fermentation, the 3’-SL yield of the EBSL001 strain was 3.0 g / L, the 3’-SL yield of the EBSL002 strain was 3.8 g / L, and the 3’-SL yield of the EBSL003 strain was 4.5 g / L, which increased by 18.42%compared to the EBSL002 strain. Therefore, knocking ΔmelB: : T5-ppk and ΔmelB: : tet-cmk into the genome of EBSL002 strain increased the yield of 3’-SL, indicating that optimization of the cofactor recycling system facilitates increasing the supply of CTP, thereby improving the yield of 3’-SL.

[0306] Example 3: Optimization of the supply of PEP and the oligosaccharide transport system

[0307] The sialic acid synthase encoded by the neuB gene catalyzes the reaction of ManNAc and phosphoenolpyruvic acid (PEP) to generate Neu5Ac and phosphoric acid, and Neu5Ac is one of the precursors for 3’-SL synthesis. Therefore, an increase in the supply of PEP is beneficial to increase the yield of 3’-SL. In addition, if the 3’-SL produced in the cells may be pumped out of the bacterial cells in time, it may contribute to the reduction of the degree of inhibition of the 3’-SL synthesis reaction which inhibition is caused by excessive accumulation of 3’-SL in the bacterial cells. Therefore, in this Example, the EBSL003 strain, used as the starting strain, was subjected to the treatments for knocking out the pyruvate kinase gene pykA and enhancing the expression of the oligosaccharide transporter gene setB. After the pyruvate kinase gene pykA was knocked out, the catabolic pathway of PEP was inhibited, which was beneficial to the accumulation of PEP in the bacterial cells. After the expression of the oligosaccharide transporter gene setB was enhanced, the 3’-SL in bacterial cells can be pumped out of the cell promptly after production, which contributes to increasing the accumulated concentration of extracellular 3’-SL.

[0308] The steps of this Example are as follows:

[0309] 3.1. Design and synthesis of primers required for gene knockout and integration

[0310] In this Example, primers for gene knockout and integration are shown in Table 12. The sequences of sgRNAs used for gene knockout and integration are shown in Table 13.

[0311] Table 12 List of primers for gene knockout and integration

[0312] Table 13 List of sgRNA sequences for gene knockout and integration

[0313] In Table 13, tet indicates that the promoter of the setB gene is the tet promoter.

[0314] 3.2 Construction of a plasmid:

[0315] The pTargetF-pykA-NT2 plasmid was constructed with reference to the method in Section 1.2 of Example 1. The donor-DNA for knocking setB gene into  pykA site was constructed using overlap extension PCR (overlap PCR) .

[0316] 3.3 Construction of SLIS029 strain

[0317] The SLIS029 strain in this Example was engineered using the SLIS028 strain as the starting strain. On the basis of the SLIS028 strain, treatments for knocking out the partial fragment of the pyruvate kinase gene pykA and enhancing the expression of oligosaccharide transporter gene setB were performed using the pTargetF-pykA-NT2 plasmid and the donor-DNA for setB gene knocking into the pykA site, to increase the supply of phosphoenolpyruvic acid (PEP) in SL synthesis, and resulting in the SLIS029 strain.

[0318] PCR detection and sequencing showed that the partial fragment of the pykA gene in the SLIS028 strain was successfully knocked out in accordance with the design, and the expression of the oligosaccharide transporter gene setB was enhanced, resulting in the SLIS029 strain. The list of verification primers is shown in Table 13.

[0319] Table 14 List of verification primers for SLIS029 strain knock-in gene

[0320] 3.4 Acquisition and fermentation of fermentation strain EBSL004

[0321] EBSL004 strain was obtained by transforming the pTU2-A-DOE13 plasmid into the SLIS029 strain according to the method in Section 1.5 of Example 1, and the EBSL001, EBSL002, EBSL003 and EBSL004 were subjected to shake flask fermentation, respectively. The total time for fermentation was 48 hours. HPLC was then used to detect the content of 3’-SL in the fermentation broth.

[0322] According to the results of the shake flask fermentation, the 3’-SL yield of EBSL001 strain was 3.0 g / L, the 3’-SL yield of EBSL002 strain was 3.7 g / L, the 3’-SL yield of EBSL003 strain was 4.5 g / L, and the 3’-SL yield of EBSL004 strain was 5.2 g / L. It can be seen that compared with the yield of EBSL003 strain of 4.5  g / L, the yield of EBSL004 strain has increased by 15.56%. This shows that the knockout of the partial fragment of the pykA gene and knock-in of tet-setB (ΔpykA: : tet-setB) are beneficial to 3’-SL synthesis.

[0323] The strains involved in Examples 1 to 3 and their characteristics are shown in Table 15.

[0324] Table 15 List of the strains involved in Examples 1 to 3 and their characteristics

[0325] Test Example 2

[0326] In this Example 1, when knocking out the pykA gene, the intermediate region fragment of the pykA gene was knocked out, while both terminus regions of the pykA gene were retained. Therefore, in this Example, only a partial fragment of the pykA gene, rather than the full gene fragment was knocked out.

[0327] The inventors previously knocked out the full gene sequence of the pykA gene (1443 bp) , and cultured the genetically engineered bacterium obtained by such a  knockout. The inventors found that the strain with the full pykA gene sequence knockout had a poor growth status and a low passage efficiency, and could not meet the basic requirements as a chassis cell.

[0328] In this Example, the inventors only knocked out the intermediate sequence of the pykA gene, but retained the sequence at the 5’ end which is equivalent to 4.7%of the full-length sequence of the pykA gene (68 bp) , and retained the sequence at 3’end that is equivalent to 12.1%of the full-length sequence of the pykA gene (175 bp) . The genetically engineered bacterium obtained by such a knockout was cultured. Surprisingly, the inventors found that the engineered bacterium with the knockout of a part of the pykA gene prepared in the Example showed a good growth status and a high passage efficiency, meeting the basic requirements as a chassis cell.

[0329] The inventors also found in the study that it is difficult and time-consuming to select a primer with high knockout efficiency, if the sequence retained at the 5’ end of the pykA gene is too long and the sequence retained at the 3’ end is too short when knocking out the intermediate sequence of the pykA gene. Therefore, for comprehensive consideration, when knocking out the partial fragment of the pykA gene, it is appropriate that the length of the sequence retained at the 5’ end is in the range of 4%to 5.5%, and the sequence length retained at the 3’ end is preferably in the range of 10%to 20%.

[0330] Example 4: Insertion of the css gene, the neuB gene, the neuC gene and the ST gene into the genome of engineered bacteria

[0331] The pTU2-A-DOE13 plasmid is present in EBSL001, EBSL002, EBSL003 and EBSL004. The plasmid loss are easily occurred during subsequent passages, resulting in poor stability of strain passages. Therefore, multi-copy chromosomal integration by CRISPR-associated transposase (MUCICAT) technology was used in this Example to insert the key genes for synthesizing 3’-SL, the css gene, the neuB gene, the neuC gene and the ST gene, into the genome of the engineered bacterium.

[0332] The steps of this Example are as follows:

[0333] 4.1 Construction of the pRE57-DOE13 plasmid

[0334] The primers required in the pRE57-DOE13 plasmid construction were designed, and the designed primers were submitted to Beijing Tsingke Biotech Co., Ltd. for synthesis. The required primers are shown in Table 16. The crRNA sequences are shown in Table 17.

[0335] Table 16 Primers for pRE57-DOE13 plasmid construction and primers for sequencing

[0336] Table 17 crRNA sequence information

[0337] 4.2 Multi-copy integrated EBSL005 strain without antibiotics obtained by using MUCICAT:

[0338] In order to obtain an integrated strain that does not require plasmids and has high genetic stability, the gene combination (the css, neuB, neuC, ST gene combination) on the pTU2-A-DOE13 plasmid was integrated into the IS1 site of SLIS029 strain using multi-copy chromosomal integration by CRISPR-associated transposase (MUCICAT) technology. There are 28 IS1 sites in the E. coli genome, and each IS1 site has a chance of being inserted by one or several css, neuB, neuC, and ST gene combinations. During each round of induction, different IS1 sites have a chance of being inserted by css, neuB, neuC, and ST gene combinations. As the round number of induction increases, the copy numbers of these gene combinations at different IS1 sites will gradually increase. The inventors found in the study that when the copy number of these gene combinations is within a certain range, the content of 3’-SL increases as the copy number of the gene combination increases. However, when the copy number of these gene combinations increases to a certain value, even if the copy number of these gene combinations continues to increase, the content of 3’-SL no longer increases with the increase in the copy number of gene combinations, but decreases to a certain extent. The number of other IS sequences (such as IS186, IS3, and IS4) in E. coli cells is small and cannot meet requirements for the copy number after structural gene insertion. Therefore, IS1 was selected as the insertion site for structural genes.

[0339] This MUCICAT technology requires multiple rounds of induction of the SLIS029 strain. After each round of induction, multiple transformants were randomly selected for fermentation screening (preliminary screening) in 96-well  plates to screen out transformants with higher 3’-SL content. When selecting the transformants, only a part of the colony was picked up from each selected transformant in the amount sufficient for preliminary screening. In each round, the remaining transformants after picking were mixed with the unpicked transformants for the next round of induction, and then the above process was repeated on multiple transformants obtained from the next round of induction. Transformants picked after each round of induction need to be treated for plasmid loss before shake flask fermentation, while transformants that have not been picked do not need to be treated for plasmid loss.

[0340] The steps of preliminary screening were as follows: the transformants selected after multiple rounds of induction were added into a 96-well plate containing TB liquid culture medium (600 μL) for IPTG-induced fermentation screening, with the fermentation time of 48 hours, and then the supernatant of the fermentation broth was taken and the content of 3’-SL in the supernatant was determined by HPLC. Finally, 36 transformants with higher 3’-SL content were screened out and then subjected to shake flask fermentation (re-screening) .

[0341] The steps of re-screening (shake flask fermentation) were as follows: the loss of pTet-tns, pQCascade-IS1, and pRE57-DOE13 plasmids was performed using rhamnose, the loss of the pCutamp plasmid was performed using sucrose, and finally multiple plasmid-free multi-copy strains were obtained. These plasmid-free multi-copy strains were transferred to shake flasks containing TB liquid culture medium, and fermented with IPTG induction for 48 hours. Then the fermentation broth was centrifuged and the obtained supernatant was taken to determine the content of 3’-SL in the supernatant by using HPLC.

[0342] In this Example, some of the strains with different yields were selected from 36 transformants and the copy number was measured (refer to the description in Section 4.8 of CN 113249400 A) , as shown in Table 18 below.

[0343] Table 18 List of the yield and copy number of some transformants

[0344] From the results in Table 18 and Fig. 4, it can be seen that as the copy number increases, the production of 3’-SL also increases. When the copy number reaches 16, the 3’-SL production is the highest. After that, as the copy number continues to increase, the production of 3’-SL no longer increases. Strain No. 35 with the copy number of 16 was named strain EBSL005 (also known as SLIS109 strain) .

[0345] Table 19 Gene information table of EBSL005 strain (SLIS109 strain)

[0346] The specific steps of MUCICAT technology in this Example are as follows:

[0347] (1) the crRNA sequence corresponding to the target gene was constructed into the pRE57-Ter plasmid through seamless cloning using ClonExpress II One Step Cloning Kit (Nanjing Vazyme Biotech Co., Ltd., Cat. No.: C112-01) , to prepare different pRE57-DOE13 (subsequently used with pQCascade-IS1) . The crRNA sequence used in the gene site-directed insertion process is shown in Table 17.

[0348] (2) The three plasmids, 300 ng pDonor (pRE57-Ter or other variants) , 300 ng  pQCascade, and 300 ng pTnsABC (pTet-tns or other variants) , were co-transformed into E. coli BL21 (DE3) cells by electrotransformation. After recovery for 2 hours at 37℃ in fresh LB liquid medium, the E. coli BL21 (DE3) cells were inoculated into a triple antibiotic LB agar plate containing 100 μg / mL ampicillin (Amp) , 50 μg / mL kanamycin (Kan) , and 50 μg / mL spectinomycin (Spec) .

[0349] (3) After 16 hours of growth at 37℃, several colonies were scraped from the culture dish. Some of the colonies were resuspended in fresh LB liquid culture medium. The resuspension comprising the colony cells was then transferred to LB agar plates containing three antibiotics and 100 ng / mL to induce the expression of transposition-related protein, and was cultured at 30℃ for an additional 16 hours. After biofilm formation, cells were scraped off and resuspended in an LB liquid medium. The cells were re-diluted appropriately, and placed onto a triple antibiotic LB agar plate (i.e. induction plate) containing 100 ng / mL tetracycline (aTc) and cultured at 37 ℃ overnight.

[0350] (4) In order to increase clonal growth and integration rate, colonies were transferred by re-splitting as follows. The colonies growing on the above induction plate were defined as Transfer1, and a part of the colonies were scratched onto a novel triple antibiotic LB agar plate containing aTc and grown overnight at 30℃to generate a new transfer, namely Transfer2. Transfers were performed continuously to generate transfer n (n=3, 4…) .

[0351] (5) PCR for the colonies was then performed to identify whether the combination of four genes was correctly inserted into the genome of the cells, in order to obtain cells in which the four genes were correctly inserted.

[0352] (6) The pCutamp plasmid (used to eliminate the three plasmids) was electroporated into the cells in which the four genes were correctly inserted (cells which still carried the above three plasmids) . The cells were recovered in 1 mL LB medium at 37℃ for 1 hour. In order to improve the elimination efficiency of the plasmids, the recovered cells were transferred to 4 mL LB medium containing 50 μg / mL apramycin and 10 mM rhamnose for culture, with shaking at 37℃ for 7-10 hours (for further improvement of the elimination efficiency of the above three  plasmids, the induction time may be appropriately extended) . 100 μL of culture was then plated on LB agar plates containing 50 μg / mL apramycin (Apr) and 10 mM rhamnose and cultured overnight at 37℃.

[0353] (7) The pCutamp plasmid also comprises a SacB gene encoding levansucrase, which catalyzes sucrose hydrolysis and fructan polymerization. Thus E. coli carrying the pCutamp plasmid cannot grow in LB agar plates containing 10 g / L sucrose. Therefore, colonies grown on LB agar plates containing apramycin and rhamnose were selected and cultured by turns on four LB agar plates containing 100 μg / mL ampicillin, 50 μg / mL kanamycin, 50 μg / mL spectinomycin, and 10 g / L sucrose, respectively. The colonies that failed to grow on LB agar plates containing ampicillin, kanamycin, and streptomycin were considered to have eliminated the three plasmids pDonor, pTnsABC, and pQCascade. The corresponding colonies grown on LB agar plates containing sucrose were then re-plated on non-selective LB agar plates and LB agar plates containing apramycin to verify the digestion of the pCutamp plasmid. The colonies that failed to grow on LB agar plates containing apramycin are plasmid-free multi-copy integrated strains.

[0354] According to the records in Table 19, the four gene combinations of the SLIS109 strain each have their own promoters and terminators, thus forming four separate transcription units.

[0355] 4.3 Fermentation of multi-copy integrated EBSL005 strain without antibiotics

[0356] The EBSL005 strain (see Table 18) was subjected to shake flask fermentation. After 48 hours of shake flask fermentation, the 3’-SL yield reached 6.60 g / L. After 52 hours of fermentation, the 3’-SL yield reached 6.90 g / L, which was significantly improved compared to the 3’-SL yield of the EBSL004 strain. Fig. 5 is a graph showing the growth and yield curve of shake flask fermentation of strain EBSL005.

[0357] Further, the EBSL005 strain was subjected to scale-up fermentation in a 5L fermenter. The conditions of the scale-up fermentation in a 5L fermenter were as follows:

[0358] A single colony of the EBSL005 strain was picked and inoculated into 5 mL  of LB medium, cultured at 37℃ and 250 rpm for 6-7 hours. The culture was inoculated into a 5L fermenter at an inoculation amount of 2.5-5% (the specific inoculation amount is determined based on the density of the bacteria in the seed culture medium, in order to make the number of bacterial cells in each inoculation substantially the same) and cultured at 37℃ and 250 rpm to the OD600 of about 1-1.2. After that, IPTG (at a final concentration of 0.1 mM) , 200 g / L of MgSO4·7H2O (at a final concentration of 2 g / L) , trace element mother liquid (at a final concentration of 0.1%) , 500 g / L glucose (at a final concentration of 10 g / L) and 250g / L lactose (at a final concentration of 5 g / L) were added for fermentation culture of the 3’-SL-producing strain under the culture conditions at 30℃ and 250 rpm. The starting time for fermentation culture was considered as 0 h, with 500 g / L glucose added every 12 h (at a final concentration of 10 g / L) . The total time for fermentation was 52 hours. The HPLC was then used to detect the content of 3’-SL in the fermentation broth. After fermentation, the 3’-SL yield of EBSL005 strain reached 79 g / L.

[0359] The results of this Example show that the EBSL005 strain was obtained by integrating the css-neuB-neuC-ST gene combination into the genome of the strain multiple times using multi-copy chromosomal integration by CRISPR-associated transposase (MUCICAT) technology. The EBSL005 strain showed a higher yield of 3’-SL compared with strains carrying plasmids carrying the css-neuB-neuC-ST gene combination (the EBSL001 to EBSL004 strains) . Due to the EBSL005 being an integrated strain, there was no loss of the plasmid carrying the css-neuB-neuC-ST gene combination during the fermentation process, resulting in higher genetic stability.

[0360] In summary, the EBSL005 strain reached a very high level when synthesizing 3’-SL in both shake flask fermentation and fermentation in a 5L fermenter.

[0361] Although the invention has been described with reference to specific embodiments thereof, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from  the spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation, material, composition, method, and one or more step (s) of the method to the purpose, spirit and scope of the invention. All such modifications are intended to be within the scope of the appended claims.

[0362] Sequence

[0363] >WP_002874240.1 UDP-N-acetylglucosamine 2-epimerase [Campylobacter jejuni]

[0364] SEQ ID NO: 82

[0365] >WP_002874241.1 sialic acid synthase [Campylobacter jejuni subsp. jejuni 81-176]

[0366] SEQ ID NO: 83

[0367] >WP_002215295.1 N-acylneuraminate cytidylyltransferase [Neisseria meningitidis]

[0368] SEQ ID NO: 84

[0369] AGH37861.1 Bibersteinia trehalosi

[0370] SEQ ID NO: 85

[0371] >ACT42510.1 N-acetylglucosamine-6-phosphate deacetylase [Escherichia coli BL21 (DE3) ]

[0372] SEQ ID NO: 86

[0373] >ACT42511.1 glucosamine-6-phosphate deaminase [Escherichia coli BL21 (DE3) ]

[0374] SEQ ID NO: 87

[0375] >ACT45594.1 6-phosphofructokinase I [Escherichia coli BL21 (DE3) ]

[0376] SEQ ID NO: 88

[0377] SEQ ID NO: 89

[0378] >ACT44213.1 polyphosphate kinase, component of RNA degradosome [Escherichia coli BL21 (DE3) ]

[0379] SEQ ID NO: 90

[0380] SEQ ID NO: 91

[0381] >ACT43679.1 pyruvate kinase II [Escherichia coli BL21 (DE3) ]

[0382] SEQ ID NO: 92

[0383] >ACT43922.1 lactose / glucose efflux system [Escherichia coli BL21 (DE3) ]

[0384] SEQ ID NO: 93

[0385] SEQ ID NO: 95

[0386] SEQ ID NO: 96

[0387] SEQ ID NO: 97

[0388] ST SEQ ID NO: 98

[0389] SEQ ID NO: 99

[0390] SEQ ID NO: 100

[0391] SEQ ID NO: 101

[0392] setB SEQ ID NO: 102

Claims

1.A genetically engineered bacterium having the ability to produce 3’-sialyllactose and having a UDP-N-acetylglucosamine 2-epimerase gene (neuC) , a sialic acid synthase gene (neuB) , a N-acetylneuraminate cytidylyltransferase gene (css) and an α-2, 3-sialyltransferase gene (ST) ;wherein the UDP-N-acetylglucosamine 2-epimerase gene (neuC) , the sialic acid synthase gene (neuB) , the N-acetylneuraminate cytidylyltransferase gene (css) and the α-2, 3-sialyltransferase gene (ST) are integrated independently or jointly in any combination into the genome of the genetically engineered bacterium, or are present in a recombinant plasmid carried by the genetically engineered bacterium.2.The genetically engineered bacterium according to claim 1, wherein the UDP-N-acetylglucosamine 2-epimerase gene (neuC) , the sialic acid synthase gene (neuB) , the N-acetylneuraminate cytidylyltransferase gene (css) and the α-2, 3-sialyltransferase gene (ST) are integrated into the genome of the genetically engineered bacterium in a manner that are respectively connected to a separate first promoter and / or terminator, or are present in the recombinant plasmid carried by the genetically engineered bacterium; or,any two, three or four genes of the UDP-N-acetylglucosamine 2-epimerase gene (neuC) , the sialic acid synthase gene (neuB) , the N-acetylneuraminate cytidylyltransferase gene (css) and the α-2, 3-sialyltransferase gene (ST) are integrated into the genome of the genetically engineered bacterium in a manner that are jointly connected to the first promoter and / or the terminator, or are co-present in the recombinant plasmid carried by the genetically engineered bacterium; and / orthe genetically engineered bacterium is a bacterium ofEscherichia, preferably Escherichia coli, more preferablyEscherichia coli BL21 (DE3) strain;preferably, the first promoter is a T2 promoter; the terminator is a T7 terminator; and / orthe recombinant plasmid uses pTU2 as a backbone plasmid.3.The genetically engineered bacterium according to claim 2, wherein the UDP-N-acetylglucosamine 2-epimerase gene (neuC) , the sialic acid synthase gene (neuB) , the N-acetylneuraminate cytidylyltransferase gene (css) and the α-2, 3-sialyltransferase gene (ST) are inserted into one or more insertion sequences 1 (IS1) of the genome of the genetically engineered bacterium as a gene combination in a manner that are respectively connected to a separate first promoter and / or terminator, or jointly connected to the first promoter and / or the terminator;more preferably, the copy number of the UDP-N-acetylglucosamine 2-epimerase gene (neuC) , the sialic acid synthase gene (neuB) , the N-acetylneuraminate cytidylyltransferase gene (css) and the α-2, 3-sialyltransferase gene (ST) as the gene combination is 10-28, 12-26 or 14-22 at the insertion sequence 1 (IS1) .4.The genetically engineered bacterium according to any one of claims 1 to 3, wherein the UDP-N-acetylglucosamine 2-epimerase comprises the amino acid sequence set forth in SEQ ID NO: 82, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 82; and / orthe sialic acid synthase comprises the amino acid sequence set forth in SEQ ID NO: 83, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 83; and / orthe N-acetylneuraminate cytidylyltransferase comprises the amino acid sequence set forth in SEQ ID NO: 84, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 84; and / orthe α-2, 3-sialyltransferase comprises the amino acid sequence set forth in SEQ ID NO: 85, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 85.5.The genetically engineered bacterium according to any one of claims 1 to 4, wherein the genetically engineered bacterium has been modified in one or more of the following manners:(1) the genetically engineered bacterium is modified to increase the production of glucosamine-6-phosphate;(2) the genetically engineered bacterium is modified to continuously regenerate cytidine-5’-triphosphate;(3) the genetically engineered bacterium is modified to inactivate or block the bypass catabolic pathway of N-acetylmannosamine (ManNAc) ;(4) the genetically engineered bacterium is modified to inactivate or block the bypass catabolic pathway of phosphoenolpyruvic acid; and(5) the genetically engineered bacterium is modified to increase the expression or activity of proteins involved in the oligosaccharide transport pathway;(6) the genetically engineered bacterium is modified to reduce or eliminate the expression or activity of β-galactosidase;(7) the genetically engineered bacterium is modified to reduce or eliminate the bypass catabolic pathway of N-acetylneuraminic acid.6.The genetically engineered bacterium according to any one of claims 1-5, wherein the genetically engineered bacterium has been modified in one or more of the following manners:(8) the genetically engineered bacterium is modified to reduce or eliminate the expression or activity of 6-phosphofructokinase (pfkA) ;(9) the genetically engineered bacterium is modified to increase the expression or activity of glucosamine-6-phosphate synthetase (glmS) ;(10) the genetically engineered bacterium is modified to reduce or eliminate the expression or activity of N-acetylglucosamine-6-phosphate deacetylase (nagA) and / or glucosamine-6-phosphate deaminase (nagB) ;(11) the genetically engineered bacterium is modified to increase the expression or activity of cytidine monophosphate kinase (CMK) and polyphosphate kinase (PPK) ;(12) the genetically engineered bacterium is modified to reduce or eliminate the expression or activity of pyruvate kinase (pykA) ; and(13) the genetically engineered bacterium is modified to increase the expression or activity of oligosaccharide transporters;(14) the genetically engineered bacterium is modified to reduce or eliminate the expression or activity of N-acetylneuraminic acid aldolase (nanA) ;(15) the genetically engineered bacterium is modified to reduce or eliminate the expression or activity of N‐acetylmannosamine kinase (nanK) ;(16) the genetically engineered bacterium is modified to reduce or eliminate the expression or activity of N-acetylmannosamine-6-phosphate epimerase (nanE) ;(17) the genetically engineered bacterium is modified to reduce or eliminate the expression or activity of β-galactosidase (lacZ) .7.The genetically engineered bacterium according to any one of claims 1-6, wherein the genetically engineered bacterium has the 6-phosphofructokinase (pfkA) gene deleted; and / orthe genetically engineered bacterium has the glucosamine-6-phosphate synthetase (glmS) gene overexpressed; and / orthe genetically engineered bacterium has the glucosamine-6-phosphate deaminase (nagB) gene deleted; and / orthe genetically engineered bacterium has the N-acetylmannosamine kinase (nanK) gene deleted; and / orthe genetically engineered bacterium has the N-acetylmannosamine-6-phosphate epimerase (nanE) gene deleted; and / orthe genetically engineered bacterium has the N-acetylglucosamine-6-phosphate deacetylase (nagA) gene deleted; and / orthe genetically engineered bacterium has the cytidine monophosphate kinase (CMK) gene and the polyphosphate kinase (PPK) gene overexpressed; and / orthe genetically engineered bacterium has the N-acetylneuraminic acid aldolase (nanA) gene deleted; and / orthe genetically engineered bacterium has the pyruvate kinase (pykA) gene deleted; and / orthe genetically engineered bacterium has the oligosaccharide transporter setB gene overexpressed; and / orthe genetically engineered bacterium has the β-galactosidase (lacZ) gene deleted.8.The genetically engineered bacterium according to claim 7, wherein the deletion of the 6-phosphofructokinase (pfkA) gene involves knockout of a part of the nucleotide sequence of the 6-phosphofructokinase (pfkA) gene, and the knockout of the part of the nucleotide sequence comprises retaining a length of nucleotide sequence at the 5’ end which accounts for 0%-7%of the total length of the nucleotide sequence of the 6-phosphofructokinase (pfkA) gene, and retaining a length of nucleotide sequence at the 3’ end which accounts for 70%-80%of the total length of the nucleotide sequence of the 6-phosphofructokinase (pfkA) gene; and / orthe glucosamine-6-phosphate synthetase (glmS) comprises the amino acid sequence set forth in SEQ ID NO: 89, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 89; and / orthe overexpression of the glucosamine-6-phosphate synthetase (glmS) gene involves the integration of the glucosamine-6-phosphate synthetase (glmS) gene into the genome of a genetically engineered bacterium; and / orthe deletion of the pyruvate kinase (pykA) gene involves the knockout of a part of the nucleotide sequence of the pyruvate kinase (pykA) gene, and the knockout of the part of the nucleotide sequence comprises retaining a length of the nucleotide sequence at the 5’ end which accounts for 4%-5.5%of the total length of the nucleotide sequence of the pyruvate kinase (pykA) gene, and retaining a length of the nucleotide sequence at the 3’ end which accounts for 10%-20%of the total length of the nucleotide sequence of the pyruvate kinase (pykA) gene; and / orthe cytidine monophosphate kinase (CMK) comprises the amino acid sequence set forth in SEQ ID NO: 91, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 91; the polyphosphate kinase (PPK) comprises the amino acid sequence set forth in SEQ ID NO: 90, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 90; and / orthe overexpression of the cytidine monophosphate kinase (CMK) gene and polyphosphate kinase (PPK) gene involves the integration of the cytidine monophosphate kinase (CMK) gene and the polyphosphate kinase (PPK) gene into in the genome of the genetically engineered bacterium; and / orthe oligosaccharide transporter setB comprises the amino acid sequence set forth in SEQ ID NO: 93, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 93; and / orthe overexpression of the oligosaccharide transporter setB gene comprises integrating the oligosaccharide transporter setB gene into the genome of the genetically engineered bacterium.9.The genetically engineered bacterium according to claim 8, wherein under the condition that a part of the nucleotide sequence of the 6-phosphofructokinase (pfkA) gene was knocked out, the glucosamine-6-phosphate synthetase (glmS) gene is inserted into the location where the 6-phosphofructokinase (pfkA) gene has been knocked out; and / orthe genetically engineered bacterium has the melibiose permease (melB) gene deleted, and the cytidine monophosphate kinase (CMK) gene and the polyphosphate kinase (PPK) gene are inserted into the location where the melibiose permease (melB) gene has been knocked out; and / orunder the condition that a part of the nucleotide sequence of the pyruvate kinase gene (pykA) gene has been knocked out, the oligosaccharide transporter setB gene is inserted into the location where the pyruvate kinase gene (pykA) gene has been knocked out;more preferably, the cytidine monophosphate kinase (CMK) gene and the polyphosphate kinase (PPK) gene are inserted into the location where the melibiose permease (melB) gene has been knocked out in a manner that are respectively connected to a separate second promoter or jointly connected with a second promoter;further preferably, the cytidine monophosphate kinase (CMK) gene is located upstream of the polyphosphate kinase (PPK) gene; and / or the second promoter is a T5 promoter or a tetracycline promoter tet.10.AnEscherichia coli strain having the deposit number CGMCC No. : 28244.11.Use of a genetically engineered bacterium according to any one of claims 1 to 9 or an Escherichia coli strain according to claim 10 in the production of 3’-sialyllactose using glucose or glycerol as a carbon source.12.A method for constructing a genetically engineered bacterium with the ability to produce 3’-sialyllactose, comprising: integrating UDP-N-acetylglucosamine 2-epimerase gene (neuC) , sialic acid synthase gene (neuB) , N-acetylneuraminate cytidylyltransferase gene (css) and α-2, 3-sialyltransferase gene (ST) independently or jointly in any combination into the genome of a host bacterium to obtain the genetically engineered bacterium; or,co-introducing the UDP-N-acetylglucosamine 2-epimerase gene (neuC) , the sialic acid synthase gene (neuB) , the N-acetylneuraminic acid cytidyltransferase gene (css) and the α-2, 3-sialyltransferase gene (ST) into a backbone plasmid to obtain a recombinant plasmid; and introducing the recombinant plasmid into the host bacterium to obtain the genetically engineered bacterium;preferably, wherein the host bacterium is a bacterium of the genus Escherichia, preferably Escherichia coli, and more preferably Escherichia coli BL21 (DE3) strain.13.The method according to claim 12, further comprising: modifying the host bacterium in one or more of the following manners:(1) the host bacterium is modified to increase the production of glucosamine-6-phosphate;(2) the host bacterium is modified to continuously regenerate cytidine-5’-triphosphate;(3) the host bacterium is modified to inactivate or block the bypass catabolic pathway of N-acetylmannosamine (ManNAc) ;(4) the host bacterium is modified to inactivate or block the bypass catabolic pathway of phosphoenolpyruvic acid; and(5) the host bacterium is modified to increase the expression or activity of proteins involved in the oligosaccharide transport pathway;(6) the host bacterium is modified to reduce or eliminate the expression or activity of β-galactosidase;(7) the host bacterium is modified to reduce or eliminate the bypass catabolic pathway of N-acetylneuraminic acid.14.The method according to claims 12 or 13, wherein the genetically engineered bacterium has been modified in one or more of the following manners:(8) the host bacterium is modified to reduce or eliminate the expression or activity of 6-phosphofructokinase (pfkA) ;(9) the host bacterium is modified to increase the expression or activity of glucosamine-6-phosphate synthetase (glmS) ;(10) the host bacterium is modified to reduce or eliminate the expression or activity of N-acetylglucosamine-6-phosphate deacetylase (nagA) and / or glucosamine-6-phosphate deaminase (nagB) ;(11) the host bacterium is modified to increase the expression or activity of cytidine monophosphate kinase (CMK) and polyphosphate kinase (PPK) ;(12) the host bacterium is modified to reduce or eliminate the expression or activity of pyruvate kinase (pykA) ; and(13) the host bacterium is modified to increase the expression or activity of oligosaccharide transporters;(14) the host bacterium is modified to reduce or eliminate the expression or activity of N-acetylneuraminic acid aldolase (nanA) ;(15) the host bacterium is modified to reduce or eliminate the expression or activity of N-acetylmannosamine kinase (nanK) ;(16) the host bacterium is modified to reduce or eliminate the expression or activity of N-acetylmannosamine-6-phosphate epimerase (nanE) ; and(17) the host bacterium is modified to reduce or eliminate the expression or activity of β-galactosidase (lacZ) .15.The method according to any one of claims 12-14, wherein the 6-phosphofructokinase (pfkA) of the host bacterium has been deleted; and / orthe glucosamine-6-phosphate synthetase (glmS) gene has been overexpressed in the host bacterium; and / orthe glucosamine-6-phosphate deaminase (nagB) gene of the host bacterium has been deleted; and / orthe N‐acetylmannosamine kinase (nanK) gene of the host bacterium has been deleted; and / orthe N-acetylmannosamine-6-phosphate epimerase (nanE) gene of the host bacterium has been deleted; and / orthe N-acetylglucosamine-6-phosphate deacetylase (nagA) gene of the host bacterium has been deleted; and / orthe cytidine monophosphate kinase (CMK) gene and the polyphosphate kinase (PPK) gene have been overexpressed in the host bacterium; and / orthe N-acetylneuraminic acid aldolase (nanA) gene of the host bacterium has been deleted; and / orthe pyruvate kinase (pykA) gene of the host bacterium has been deleted; and / orthe oligosaccharide transporter setB gene has been overexpressed in the host bacterium; and / orthe β-galactosidase (lacZ) gene of the host bacterium has been deleted.16.The method according to claim 15, wherein the deletion of the 6-phosphofructokinase (pfkA) gene in the host bacterium involves knockout of a part of the nucleotide sequence of the 6-phosphofructokinase (pfkA) gene, and the knockout of the part of the nucleotide sequence comprises retaining a length of nucleotide sequence at the 5’ end which accounts for 0%-7%of the total length of the nucleotide sequence of the 6-phosphofructokinase (pfkA) gene, and retaining a length of nucleotide sequence at the 3’ end which accounts for 70%-80%of the total length of the nucleotide sequence of the 6-phosphofructokinase (pfkA) gene; and / orthe glucosamine-6-phosphate synthetase (glmS) comprises the amino acid sequence set forth in SEQ ID NO: 89, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 89; and / orthe overexpression of the glucosamine-6-phosphate synthetase (glmS) gene in the host bacterium involves the integration of the glucosamine-6-phosphate synthetase (glmS) gene into the genome of a host bacterium; and / orthe deletion of the pyruvate kinase (pykA) gene in the host bacterium involves the knockout of a part of the nucleotide sequence of the pyruvate kinase (pykA) gene, and the knockout of the part of the nucleotide sequence comprises retaining a length of the nucleotide sequence at the 5’ end which accounts for 4%-5.5%of the total length of the nucleotide sequence of the pyruvate kinase (pykA) gene, and retaining a length of the nucleotide sequence at the 3’ end which accounts for 10%-20%of the total length of the nucleotide sequence of the pyruvate kinase (pykA) gene; and / orthe cytidine monophosphate kinase (CMK) comprises the amino acid sequence set forth in SEQ ID NO: 91, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 91; the polyphosphate kinase (PPK) comprises the amino acid sequence set forth in SEQ ID NO: 90, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 90; and / orthe overexpression of the cytidine monophosphate kinase (CMK) gene and polyphosphate kinase (PPK) gene involves the integration of the cytidine monophosphate kinase (CMK) gene and the polyphosphate kinase (PPK) gene into in the genome of a host bacterium; and / orthe oligosaccharide transporter setB comprises the amino acid sequence set forth in SEQ ID NO: 93, or an amino acid sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or 99%sequence identity to the amino acid sequence set forth in SEQ ID NO: 93; and / orthe overexpression of the oligosaccharide transporter setB gene comprises integrating the oligosaccharide transporter setB gene into the genome of a host bacterium.17.The method of claim 16, wherein under the condition that a part of the nucleotide sequence of the 6-phosphofructokinase (pfkA) gene has been knocked out, the glucosamine-6-phosphate synthetase (glmS) gene is inserted into the location where the 6-phosphofructokinase (pfkA) gene has been knocked out; and / orthe melibiose permease (melB) gene of the host bacterium has been deleted, and the cytidine monophosphate kinase (CMK) gene and the polyphosphate kinase (PPK) gene are inserted into the location where the melibiose permease (melB) gene has been knocked out; and / orunder the condition that a part of the nucleotide sequence of the pyruvate kinase gene (pykA) gene has been knocked out, the oligosaccharide transporter setB gene is inserted into the location where the pyruvate kinase gene (pykA) gene has been knocked out;more preferably, the cytidine monophosphate kinase (CMK) gene and the polyphosphate kinase (PPK) gene are inserted into the location where the melibiose permease (melB) gene has been knocked out in a manner that are respectively connected to a separate second promoter or jointly connected to a second promoter;further preferably, the cytidine monophosphate kinase (CMK) gene is located upstream of the polyphosphate kinase (PPK) gene; and / or the second promoter is a T5 promoter or a tetracycline promoter tet.18.The method according to any one of claims 12 to 17, wherein the UDP-N-acetylglucosamine 2-epimerase gene (neuC) , the sialic acid synthase gene (neuB) , the N-acetylneuraminate cytidylyltransferase gene (css) and the α-2, 3-sialyltransferase gene (ST) are inserted into one or more insertion sequences 1 (IS1) of the genome of the host bacterium as a gene combination in a manner that are respectively connected to a separate first promoter and / or terminator or jointly connected to the first promoter and / or the terminator;more preferably, the copy number of the introduced exogenous UDP-N-acetylglucosamine 2-epimerase gene (neuC) , exogenous sialic acid synthase gene (neuB) , exogenous N-acetylneuraminate cytidylyltransferase gene (css) and exogenous α-2, 3-sialyltransferase gene (ST) as a gene combination is 10-28, 12-26 or 14-22 at the insertion sequence 1 (IS1) .19.The method according to any one of claims 12 to 18, wherein a pTargetF-nagAB construct comprising a homology arm 1 and a homology arm 2 is used to knock out nagA and nagB genes, with the homology arm 1 obtained by  amplification using the primers of SEQ ID NO: 3 and SEQ ID NO: 4 and using the host bacterial genome as a template, and the homology arm 2 obtained by amplification using the primers of SEQ ID NO: 5 and SEQ ID NO: 6 and using the host bacterial genome as a template; and / orthe glmS knock-in donor-DNA fragment comprising a homology arm 3 and a homology arm 4, and a pTargetF-pfkA-NT1 recombinant plasmid are used to knock out the pfkA gene and insertthe glmS gene into the host bacterial genome where the pfkA gene has been knocked out, with the homology arm 3 obtained by amplification using the primers of SEQ ID NO: 11 and SEQ ID NO: 12 and using the host bacterial genome as a template, and homology arm 4 obtained by amplification using the primers of SEQ ID NO: 19 and SEQ ID NO: 20 and using the host bacterial genome as a template; and / orthe ppk knock-in donor-DNA comprising a homology arm 5 and a homology arm 6, and a pTargetF-melB-NT1 recombinant plasmid are used to knock in the ppk gene into the host bacterial genome, with the homology arm 5 obtained by amplification using the primers of SEQ ID NO: 35 and SEQ ID NO: 36 and using the host bacterial genome as a template, and the homology arm 6 obtained by amplification using the primers of SEQ ID NO: 41 and SEQ ID NO: 42 and using the host bacterial genome as a template; and / orthe cmk knock-in donor-DNA comprising a homology arm 7 and a homology arm 8, and a pTargetF-melB-NT2 recombinant plasmid are used to knock in the cmk gene into the host bacterial genome, with the homology arm 7 obtained by amplification using the primers of SEQ ID NO: 43 and SEQ ID NO: 44 and using the host bacterial genome as a template, and the homology arm 8 obtained by amplification using the primers of SEQ ID NO: 49 and SEQ ID NO: 50 and using the host bacterial genome as a template; and / orthe setB knock-in at pykA site donor-DNA comprising a homology arm 9 and a homology arm 10 and a pTargetF-pykA-NT2 recombinant plasmid are used to knock out the pykA gene and knock in the setB gene into the host bacterial genome where the pfkA gene has been knocked out, with the homology arm 9 obtained by amplification using the primers of SEQ ID NO: 58 and SEQ ID NO: 59 and using the host bacterial genome as a template, and the homology arm 10 obtained by amplification using the primers of SEQ ID NO: 64 and SEQ ID NO: 65 and using the host bacterial genome as a template.20.A method for fermentative production of 3’-sialyllactose, the method comprising:culturing the genetically engineered bacterium according to any one of claims 1 to 9 or the E. coli strain according to claim 10 in a seed culture medium to obtain a seed fermentation broth;inoculating the seed fermentation broth into a fermentation medium for induction culture, and obtaining the fermentation liquid containing 3’-sialyllactose after the fermentation is completed.21.The method according to claim 20, wherein the fermentation medium does not comprise antibiotics; and / orthe seed culture medium is LB culture medium; and / orthe fermentation medium includes TB medium and a carbon source including glucose and / or glycerol.

Images