Low-immunogenicity cell expressing MCL1 and preparation method therefor

Abstract

A low-immunogenicity cell expressing MCL1, and a preparation method therefor. The low-immunogenicity pluripotent cell can significantly reduce or escape immune system recognition and attack without changing the renewal and differentiation characteristics of stem cells, especially T-cell, natural killer cell, macrophage and ADCC attack.

Description

Low immunogenic cell expressing MCL1 and preparation method thereof

[0001] This application claims the benefit of Chinese Patent Application No. 2023112190985, filed September 20, 2023. This application incorporates the entirety of the aforementioned Chinese Patent Application. Technical Field

[0002] The present invention belongs to the field of genetic engineering and stem cell technology, and particularly relates to a low-immunogenic cell expressing MCL1 and a preparation method thereof. Background Art

[0003] Stem cells are cells with the ability to self-renew and differentiate into specialized somatic cells. Based on the degree of differentiation in these characteristics, stem cells are primarily categorized as totipotent, pluripotent, and adult stem cells. Induced pluripotent stem cells (iPSCs) possess the potential for unlimited proliferation, self-renewal, and differentiation into various cell types, holding significant promise for the treatment of cancer, neurological, and cardiovascular diseases. However, key challenges such as immune incompatibility and immune rejection of transplanted cells hinder the clinical application of allogeneic functional cell transplantation for therapeutic purposes.

[0004] The human major histocompatibility complex (MHC), also known as human leukocyte antigens (HLA), is the primary cause of immune incompatibility. MHC is composed of a series of genes, divided into classes I, II, and III. MHC-I genes are expressed in nearly all tissue cell types. Transplanted cells expressing "non-self" MHC-I molecules stimulate CD8+ T cell activation and are eliminated. CD4+ helper T cells recognize the MHC-II genes of "non-self" cells, leading to immune rejection. Class III molecules, however, do not participate in immune activity.

[0005] In recent years, it has been reported that by knocking out genes such as B2M and CIITA, the expression of MHC-I and MHC-II cell surface or native genes can be lost, thereby making the cells immune-tolerant or escaping T cell / B cell-specific immune responses, and producing immune-compatible, low-immunogenic pluripotent stem cells.

[0006] Mcl-1 (encoded by the MCL1 gene), a member of the anti-apoptotic family, is expressed in a variety of tissues and tumor cells and influences the development of a variety of malignancies. It is involved in regulating apoptosis and cell survival, maintaining viability but not proliferation. Its effects are mediated through interactions with numerous other apoptosis regulators. Inhibiting Mcl-1 expression has been shown to be crucial for increasing apoptosis and regulating tumorigenesis.

[0007] Summary of the Invention

[0008] To address the shortcomings of existing technologies, the present invention provides a new method for modifying cells to obtain low immunogenicity. By overexpressing the MCL1 gene in stem cells, this method can significantly reduce or escape the immune system's recognition and attack on transplanted cells, especially the attack by natural killer cells, T cells, and macrophages. The present invention proposes a feasible strategy for achieving cellular immune immunity through the development of new genes through unpredictable field transformation.

[0009] The present invention successfully constructed B2M / CIITA biallelic knockout positive clones (DKO) by knocking out β-2-microglobulin (B2M) in the endoplasmic reticulum of human pluripotent stem cells and knocking out CIITA, a positive regulator of MHC-II gene transcription. Lentiviral vectors were then used to overexpress the gene MCL1 in DKO cells. The resulting human pluripotent stem cells were able to evade T cell attack and further NK cell and macrophage killing. At the same time, these low-immunogenic pluripotent stem cells retained their key biological functions, such as their stemness and differentiation capacity.

[0010] In order to achieve the above object, the present invention adopts the following technical solutions:

[0011] In a first aspect, the present invention provides a low immunogenic pluripotent stem cell, comprising: reduced endogenous major histocompatibility class I antigen (MHC-I) function compared to a parental pluripotent stem cell; reduced endogenous major histocompatibility class II antigen (MHC-II) function compared to a parental pluripotent stem cell; and reduced sensitivity to killing by NK cells, macrophages, and T cells compared to a parental pluripotent stem cell, wherein the reduced sensitivity to killing by NK cells, macrophages, and T cells is caused by increased expression of the MCL1 protein.

[0012] In some embodiments, the cells further comprise modifications to increase expression of one or more of the following polypeptides: DUX4, CD27, CD35, CD200, PD-L1, CD47, CD24, CD26, CCL21, Mfge8, and SerpinB9.

[0013] In some embodiments, the MHC-I function is reduced by reducing the activity of an MHC-I class protein or an MHC-I transcriptional regulator.

[0014] In some embodiments, the MHC class I protein comprises an HLA-A protein, an HLA-B protein, or an HLA-C protein.

[0015] In some embodiments, the MHC-I transcriptional regulator comprises a B2M protein, a TAP1 protein, a TAP2 protein, a TAP-related glycoprotein, or a NLRC5 protein.

[0016] In some embodiments, the MHC-I function is reduced by reducing the activity of a B2M protein.

[0017] In some embodiments, the B2M protein is a human B2M protein comprising the amino acid sequence shown in SEQ ID NO: 1 or an amino acid sequence that is 90% identical to the amino acid sequence shown in SEQ ID NO: 1;

[0018] Alternatively, the B2M protein is a monkey B2M protein comprising the amino acid sequence of Accession No. XP_045251305.2 or an amino acid sequence having at least 90% identity with the amino acid sequence of Accession No. XP_045251305.2.

[0019] In some embodiments, the MHC-II function is reduced by reducing the activity of an MHC-II class protein or an MHC-II transcriptional regulator.

[0020] In some embodiments, the MHC class II protein comprises an HLA-DR protein, an HLA-DQ protein, or an HLA-DP protein.

[0021] In some embodiments, the MHC-II transcriptional regulator comprises a CIITA protein, an RFXANK protein, an RFX5 protein, or an RFXAP protein.

[0022] In some embodiments, the MHC-II function is reduced by reducing the activity of the CIITA protein.

[0023] In one embodiment, the CIITA protein is a human CIITA protein comprising the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having 90% identity to the amino acid sequence shown in SEQ ID NO: 2;

[0024] Alternatively, the CIITA protein is a monkey CIITA protein comprising the amino acid sequence of Accession No. XP_005591301.3 or an amino acid sequence having at least 90% identity with the amino acid sequence of Accession No. XP_005591301.3.

[0025] In some embodiments, the MCL1 protein is a human MCL1 protein comprising the amino acid sequence shown in SEQ ID NO: 3 or an amino acid sequence having 90% identity to the amino acid sequence shown in SEQ ID NO: 3;

[0026] Alternatively, the MCL1 protein is a monkey MCL1 protein comprising the amino acid sequence of Accession No. XP_045220294.2 or an amino acid sequence having at least 90% identity with the amino acid sequence of Accession No. XP_045220294.2.

[0027] In some embodiments, the hypoimmunogenic pluripotent stem cells comprise: one or more alterations that reduce the activity of endogenous B2M protein; one or more alterations that reduce the activity of endogenous CIITA protein; and one or more alterations that result in increased expression of MCL1 protein in the hypoimmunogenic pluripotent stem cells.

[0028] In some embodiments, the low immunogenic pluripotent stem cells further comprise one or more changes that increase the expression of the following polypeptides, wherein the increased expression of the polypeptides is selected from: DUX4, CD27, CD35, CD200, PD-L1, CD47, CD24, CD26, CCL21, Mfge8 and SerpinB9.

[0029] In some embodiments, the low immunogenic pluripotent stem cells comprise: one or more alterations that inactivate both alleles of the endogenous B2M gene; one or more alterations that inactivate both alleles of the endogenous CIITA gene;

[0030] and one or more alterations that result in increased MCL1 gene expression in the low immunogenic pluripotent stem cells.

[0031] In a second aspect, the present invention also provides a method for producing the low immunogenic pluripotent stem cells of the present invention, the method comprising: reducing the endogenous major histocompatibility class I antigen (MHC-I) function in the pluripotent stem cells; reducing the endogenous major histocompatibility class II antigen (MHC-II) function in the pluripotent stem cells; and increasing the expression of a protein that reduces the sensitivity of the pluripotent stem cells to killing by NK cells, macrophages and T cells, wherein the protein is MCL1 protein.

[0032] In some embodiments, the method comprises: reducing the activity of a B2M protein in the pluripotent stem cells; reducing the activity of a CIITA protein in the pluripotent stem cells; and increasing the expression of a MCL1 protein in the pluripotent stem cells.

[0033] In some embodiments, the method comprises: eliminating the activity of both alleles of the B2M gene in the pluripotent stem cells; eliminating the activity of both alleles of the CIITA gene in the pluripotent stem cells; and increasing expression of the MCL1 gene in the pluripotent stem cells.

[0034] In some embodiments, the activity of the B2M protein in the pluripotent stem cells is reduced and / or the activity of the CIITA protein in the pluripotent stem cells is reduced by a technique selected from the group consisting of:

[0035] Introducing gene expression modifying molecules, CRISPR, TALEN, ZFN or homologous recombination technology; preferably, the gene expression modifying molecules comprise siRNA, shRNA, microRNA, antisense RNA, antisense oligonucleotide ASO or anti-miRNA oligonucleotide AMO.

[0036] In some embodiments, the method further comprises increasing the expression of at least one gene selected from the group consisting of: DUX4, CD27, CD35, CD200, PD-L1, CD47, CD24, CD26, CCL21, Mfge8, and SerpinB9 in the pluripotent stem cells.

[0037] In some embodiments, the activity of the B2M protein in the pluripotent stem cells is reduced by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology.

[0038] In some embodiments, the activity of CIITA protein in the pluripotent stem cells is reduced by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology.

[0039] In some embodiments, expression of MCL1 protein is increased by modification of an endogenous locus.

[0040] In some embodiments, expression of MCL1 protein is increased by expression of a transgene.

[0041] In some preferred embodiments, a nucleic acid sequence encoding the MCL1 protein is synthesized and constructed into a lentiviral vector, and then at least one copy of the MCL1 gene under the control of a promoter is introduced into the pluripotent stem cells via the lentiviral vector to increase the expression of the MCL1 protein.

[0042] In some embodiments, the nucleic acid sequence encoding the MCL1 protein comprises the nucleic acid sequence shown in SEQ ID NO: 4 or a nucleic acid sequence having at least 80% identity to the nucleic acid sequence shown in SEQ ID NO: 4;

[0043] Alternatively, the nucleic acid sequence encoding the MCL1 protein comprises the nucleic acid sequence with accession number XM_045364359.1 or a nucleic acid sequence having at least 90% identity with the nucleic acid sequence with accession number XM_045364359.1.

[0044] In a third aspect, the present invention provides a composition comprising the low immunogenic cells described in the first aspect or the low immunogenic pluripotent stem cells prepared by the method described in the second aspect. Preferably, the composition further comprises a pharmaceutically acceptable carrier.

[0045] In a fourth aspect, the present invention also provides the use of the low immunogenic pluripotent stem cells as described in the first aspect of the present invention, the low immunogenic pluripotent stem cells prepared by the method described in the second aspect of the present invention, or the composition as described in the third aspect of the present invention in the preparation of a medicament for preventing or treating a disease requiring cell transplantation.

[0046] In some preferred embodiments, the disease comprises acute leukemia, chronic leukemia, lymphoma, myelodysplastic syndrome, multiple myeloma, small cell lung cancer, breast cancer, testicular cancer, neuroblastoma, ovarian cancer, melanoma, aplastic anemia, congenital immunodeficiency, systemic lupus erythematosus, rheumatoid arthritis, ankylosing spondylitis, type I diabetes, Parkinson's disease, Alzheimer's disease, spinal cord injury, retinal degeneration, stroke, Huntington's disease, amyotrophic lateral sclerosis, atherosclerosis, hypertension, rheumatic heart disease, cardiomyopathy, arrhythmia, congenital heart disease, valvular heart disease, carditis, myocardial infarction, heart failure, aortic aneurysm, peripheral arterial disease, type II diabetes, scurvy, hypoglycemia, hyperlipidemia or osteoporosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] FIG1 shows the knockout strategy of the B2M gene in the B2M and CIITA double knockout cell lines (DKO) and the results of B2M gene knockout verification by PCR.

[0048] FIG2 shows the knockout strategy of the CIITA gene in B2M and CIITA double knockout cell lines (DKO) and the results of CIITA gene knockout verification by PCR.

[0049] FIG3 shows the results of qPCR detection of the expression of B2M and CIITA at the RNA level in B2M / CIITA biallelic knockout clone H1 cells DKO.

[0050] FIG4 shows the results of Western blot detection of B2M protein levels in B2M / CIITA biallelic knockout clone H1 cells DKO.

[0051] FIG5 shows the FACS detection results of HLA class I / II molecules on the surface of H1 cells and iPSC cells using IFN-γ to stimulate WT and DKO cells.

[0052] FIG6 shows the karyotype detection results of the B2M / CIITA biallelic knockout clone H1 cell DKO.

[0053] FIG7A shows the results of immunofluorescence detection of the protein levels of stemness genes POU5F1 and NANOG in H1 cells (WT cells) and H1-derived DKO cells (DKO cells).

[0054] FIG7B shows the results of RT-qPCR detection of the expression of stemness genes POU5F1, NANOG, and SOX2 at the RNA level in H1 cells (WT cells) and H1-derived DKO cells (DKO cells).

[0055] FIG7C shows the results of flow cytometry analysis of the expression of surface stemness genes SSEA-4 and Tra1-81 in H1 cells (WT cells) and H1-derived DKO cells (DKO cells).

[0056] FIG7D shows the results of flow cytometry analysis of the expression of stemness genes SSEA-4, TRA-1-60, TRA-1-81, OCT-4, and SOX2 on the cell surfaces of iPSC-WT and iPSC-DKO cells.

[0057] FIG7E shows the results of immunofluorescence detection of the protein levels of stemness genes TRA-1-60, TRA-1-81, OCT-4, SOX2, and NANOG in iPSC-WT cells.

[0058] FIG7F shows the results of immunofluorescence detection of the protein levels of stemness genes TRA-1-60, TRA-1-81, OCT-4, SOX2, and NANOG in iPSC-DKO cells.

[0059] FIG8 shows the results of detecting the immune escape functions of WT and DKO cells as well as iPSC-WT and iPSC-DKO cells by RTCA.

[0060] FIG9 shows a schematic diagram of the structure of the lentiviral vector pGC-EF1a.

[0061] Figure 10 shows the results of validating CD47 overexpression in H1 cell DKO+CD47 cells. Figure 10 A shows the results of FACS analysis of CD47 expression in the H1 cell DKO+CD47 cell line, and Figure 10 B shows the results of qPCR analysis of CD47 expression in the H1 cell DKO+CD47 cell line.

[0062] FIG11 shows the results of RTCA detection of the immune escape function of WT H1 cells and their derived DKO+CD47 cells.

[0063] FIG. 12 shows the results of detecting the overexpression levels of mRNA ( FIG. 12A ) and protein ( FIG. 12B ) in the constructed iPSC-DKO+MCL1 cell line by RT-PCR and FACS.

[0064] FIG13 shows the results of the NK cell killing experiment on iPSC-DKO+MCL1 cells detected by RTCA, wherein FIG13B is a statistical diagram of multiple killings, N=6.

[0065] FIG14 shows the results of an experiment in which NK cells were tested for killing iPSC-DKO+MCL1 cells via ADCC by RTCA, wherein FIG14B is a statistical diagram of multiple killings, N=4.

[0066] Figure 15 shows the results of the RTCA-detected PBMC killing experiment on iPSC-DKO+MCL1 cells, wherein Figure 15B is a statistical graph of multiple killing, N = 4. Figure 15C shows a photograph of iPSC-DKO+MCL1 cells resisting PBMC killing.

[0067] Figure 16 shows the results of the macrophage killing experiment on iPSC-DKO+MCL1 cells detected by RTCA, wherein Figure 16B is a multiple killing statistics chart, iPSC-WT and iPSC-DKO groups, N=9, iPSC-DKO+MCL1 group, N=8.

[0068] Figure 17 shows the results of detecting the stemness of iPSC-DKO+MCL1 cells. Figure 17 A shows the results of immunofluorescence detection of the protein levels of the stemness genes OCT4, NANOG, SOX2, TRA-1-60, and TRA-1-81 in constructed iPSC-DKO+MCL1 cells; Figure 17 B shows the results of flow cytometry detection of the expression levels of the cell surface stemness genes SSEA-4, TRA-1-60, TRA-1-81, and OCT4 in constructed iPSC-DKO+MCL1 cells.

[0069] FIG. 18 shows the results of immunofluorescence detection of the three-germ layer differentiation ability of the constructed iPSC-DKO+MCL1 cells.

[0070] FIG. 19 shows the results of testing the teratoma-forming ability of iPSC-DKO+MCL1 cells.

[0071] FIG20 shows the stemness gene detection of NHP-iPSCs by immunofluorescence (Part A), and immunohistochemistry showing that the cells can form teratomas with endoderm, mesoderm, and ectoderm (Part B).

[0072] FIG21 shows the expression of HLA-I / II in NHP iPSC-WT and NHP iPSC-DKO cells stimulated with INF-gamma in Example 7, detected by flow cytometry.

[0073] Note: The markers NHP WT, NHP DKO1, NHP DKO2, and NHP DKO+MCL1 in Figures 22-25 correspond to NHP iPSC-WT, NHP iPSC-DKO1, NHP iPSC-DKO2, and NHP iPSC-DKO+MCL1.

[0074] FIG22 shows the results of RTCA detection of the killing of NHP iPSC-WT and iPSC-DKO cells by monkey T cells in Example 7.

[0075] FIG. 23 shows the detection of NHP iPSC-DKO+MCL1 overexpression in Example 7.

[0076] FIG24 shows the results of RTCA detection of the killing effect of monkey NK cells on NHP iPSC-WT and iPSC-DKO cells and NHP iPSC-DKO+MCL1 cell lines overexpressing MCL1 protein in Example 7.

[0077] FIG25 shows the results of RTCA detection of the killing effect of monkey PBMC cells on NHP iPSC-WT and iPSC-DKO cells and NHP iPSC-DKO+MCL1 cell lines overexpressing MCL1 protein in Example 7. DETAILED DESCRIPTION

[0078] General Definitions and Terminology

[0079] All patents, patent applications, scientific publications, manufacturer's instructions and guidelines, etc., cited herein, whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein should be construed as an admission that the present disclosure is not entitled to antedate such publication.

[0080] Unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, terms related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, and microbiology used herein are terms widely used in the corresponding fields (see, for example, Molecular Cloning: A Laboratory Manual, 2nd Edition, J. Sambrook et al. eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989). For a better understanding of the present invention, definitions and explanations of relevant terms are provided below.

[0081] As used herein, the expressions "comprise," "include," "contain," and "have" are open ended and mean the inclusion of the listed elements, steps, or components but not the exclusion of other unlisted elements, steps, or components. The expression "consisting of excludes any element, step, or component not specified. The expression "consisting essentially of means that the scope is limited to the specified elements, steps, or components, plus optional elements, steps, or components that do not significantly affect the basic and novel properties of the claimed subject matter. It should be understood that the expressions "consisting essentially of" and "consisting of are encompassed within the meaning of the expression "comprising."

[0082] As used herein, the singular forms "a," "an," or "the" include plural referents unless the context indicates otherwise. The terms "one or more" or "at least one" encompass 1, 2, 3, 4, 5, 6, 7, 8, 9 or more.

[0083] Recitation of ranges of values ​​herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each separate value is incorporated into the specification as if it were individually recited herein.

[0084] Unless expressly stated to the contrary, values ​​or ranges set forth herein are modified by "about" to mean ±20%, ±10%, ±5%, or ±3% of the recited or claimed value or range.

[0085] Unless otherwise specified, the labels such as 1), 2), ..., i), ii), ..., a), b), ... in the method steps described herein are merely examples of distinction and do not imply that the method steps described are performed in such order.

[0086] The term "pluripotent cell" refers to a cell that is capable of self-renewal and proliferation while remaining in an undifferentiated state and that can be induced to differentiate into specialized cell types under appropriate conditions.

[0087] As used herein, the term "pluripotent stem cell" has the potential to differentiate into any one of the following three germ layers: endoderm (e.g., gastric junction, gastrointestinal tract, lung, etc.), mesoderm (e.g., muscle, bone, blood, urogenital tissue, etc.), or ectoderm (e.g., epidermal tissue and nervous system tissue). The term "pluripotent stem cell" as used herein also includes "induced pluripotent stem cells" or "iPSC," a pluripotent stem cell derived from a non-pluripotent cell. Exemplary human pluripotent stem cell lines include H1 human pluripotent stem cell lines, H9 human pluripotent stem cell lines, and iPSC human pluripotent stem cell lines. Additional exemplary pluripotent stem cell lines include those available through the National Institutes of Health Human Embryonic Stem Cell Registry and the Howard Hughes Medical Institute HUES collection (e.g., Cowan CA, et al. Derivation of embryonic stem-cell lines from human blastocysts. N Engl J Med. 2004 Mar 25; 350 (13): 1353-6. described).

[0088] As used herein, the term "totipotent" refers to the ability of a cell to form a complete organism. For example, in mammals, only the zygote and the first cleavage stage blastomere are totipotent. In one embodiment, the pluripotent stem cells described herein do not have totipotency and will not form a complete organism.

[0089] As used herein, the term "low immunogenic cells" refers to cells that are modified using gene editing technology to eliminate immune rejection and achieve low immunogenicity.

[0090] The cells can be from, for example, humans or non-human mammals. Exemplary non-human mammals include, but are not limited to, mice, rats, cats, dogs, rabbits, guinea pigs, hamsters, sheep, pigs, horses, cattle, and non-human primates. In some embodiments, the cells are from adults or non-human mammals. In some embodiments, the cells are from newborn humans, adults, or non-human mammals.

[0091] As used herein, the term "immune rejection" or "immune incompatibility" refers to the inability of allogeneic cells, tissues, or organs to function properly after transplantation to a recipient due to attack by the recipient's own immune cells. The human major histocompatibility complex (MHC), also known as human leukocyte antigens (HLA), is the primary cause of "immune rejection" or "immune incompatibility."

[0092] As used herein, the term "subject" or "patient" refers to any animal, such as a domesticated animal, a zoo animal, or a human. A "subject" or "patient" can be a mammal, such as a dog, a cat, a bird, livestock, or a human. Specific examples of "subjects" and "patients" include, but are not limited to, individuals (particularly humans) with diseases or conditions related to the liver, heart, lungs, kidneys, pancreas, brain, nervous tissue, blood, bones, bone marrow, and the like.

[0093] " Hypoimmunogenic pluripotent stem cells " herein refer to pluripotent stem cells, which retain the characteristics of their pluripotent stem cells and produce a reduced immune rejection reaction when transferred to an allogeneic host. In a preferred embodiment, the hypoimmunogenic pluripotent stem cells do not produce an immune response. Therefore, " hypoimmunogenicity " refers to an immune response that is significantly reduced or eliminated compared to the immune response of the parent (" WT ") stem cell before immune modification. For example, relative to wild-type cells that have not been immune modified, this hypoimmunogenic cell may be about 2.5%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99% or more than 99% less likely to produce immune rejection.

[0094] The term "major histocompatibility complex (MHC)" refers to a gene complex found in all vertebrates. MHC proteins or molecules function in signaling between lymphocytes and antigen-presenting cells during normal immune responses. The human MHC, also known as HLA (human leukocyte antigen), is located on chromosome 6 and includes MHC-I and MHC-II.

[0095] The terms "MHC-I" or "MHC class I" refer to major histocompatibility complex class I proteins or genes. Within the human MHC-I region are the HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, CD1a, CD1b, and CD1c subregions. MHC class I proteins are found on the surface of virtually all cells, including most tumor cells. MHC-I proteins are loaded with antigens, which are usually derived from endogenous proteins or pathogens present within the cell, and then presented to cytotoxic T lymphocytes (CTLs, also known as CD8+ T cells). T cell receptors are able to recognize and bind peptides complexed with MHC class I molecules. Each cytotoxic T lymphocyte expresses a unique T cell receptor that is capable of binding to a specific MHC / peptide complex. MHC class I molecules primarily mediate the presentation of endogenous antigens.

[0096] The term "MHC-II" or "MHC class II" refers to major histocompatibility complex class II proteins or genes. MHC II includes five proteins: HLA-DP, HLA-DM, HLA-DOB, HLA-DQ, and HLA-DR. MHC class II proteins are primarily expressed on antigen-presenting cells such as B cells, monocytes, macrophages, and dendritic cells. MHC class II molecules primarily mediate the presentation of exogenous antigens. They present exogenous antigen peptide molecules to Th cells (helper T cells), which stimulate CD4+ T cells.

[0097] The term "MHC / peptide complex" relates to a non-covalent complex of an MHC class I or MHC class II binding domain and an MHC class I or MHC class II binding peptide.

[0098] "Knockout" herein refers to the process of making a specific gene inactive in the host cell in which it is located, which results in the non-production of the target protein or an inactive form. As will be appreciated by those skilled in the art and described further below, this can be achieved in a variety of different ways, including removing the nucleic acid sequence from the gene, or interrupting the sequence with other sequences, changing the reading frame, or changing the regulatory elements of the nucleic acid. For example, all or part of the coding region of the target gene can be removed or replaced with a "nonsense" sequence, all or part of the regulatory sequence (e.g., promoter) can be removed or replaced, the translation initiation sequence, etc. can be removed or replaced.

[0099] In this article, the terms "reduce" and "reduce" are generally used to represent a statistically significant amount of reduction. However, for the avoidance of doubt, "reduce", "reduce" include reducing by at least 10% compared to a reference level, such as reducing by at least about 20% or at least about 30% compared to a reference level, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100% reduction (i.e., a level that is not present compared to a reference sample), or any reduction between 10-100%.

[0100] As used herein, "knock-in" or "overexpression" refers to the process of adding a genetic function to a host cell. This results in an increase in the level of the encoded protein. As will be appreciated by those skilled in the art, this can be achieved in several ways, including adding one or more additional copies of a gene to the host cell or altering the regulatory components of an endogenous gene to increase protein expression. This can be achieved by modifying the promoter, adding a different promoter, adding an enhancer, or modifying other gene expression sequences.

[0101] As used herein, the term "increase" is generally used to refer to an increase by a statistically significant amount; for the avoidance of any doubt, the term "increase" refers to an increase of at least 10% compared to a reference level, such as an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including a 100% increase or any increase between 10-100%, or at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold or 10 at least about 10-fold compared to a reference level, or any increase between 2-fold and 10-fold or greater than 10-fold.

[0102] The beta-2 microglobulin, or β2M or B2M protein, is a component of MHC class I. B2M is expressed by all nucleated cells (except red blood cells) and can non-covalently bind to the α chain of MHC class I molecules, attaching to cell membranes and being released into various tissue fluids.

[0103] "CD47 protein" or "Integrin-associated protein (IAP)" is an important self-signal that can inhibit the phagocytic function of macrophages and cause immune escape by binding to the N-terminus of the ligand signal regulatory protein α (SIRPα) on immune cells.

[0104] "MHC-II transactivator protein (CIITA) protein" is a key molecule that regulates MHC-II expression. The body mainly regulates the expression level of MHC II genes by controlling the expression of CIITA.

[0105] MCL1 is one of the most frequently amplified anti-apoptotic genes in human cancers, involved in regulating both apoptosis and cell survival, maintaining viability but not proliferation. MCL1 gene isoform 1 in the present invention can inhibit apoptosis by interacting with numerous other apoptosis regulators.

[0106] As used herein, the term "syngeneic" refers to the genetic similarity or identity of the host organism and the cell transplant, wherein there is immunological compatibility; eg, no immune response is generated.

[0107] As used herein, the term "allogeneic" refers to the genetic differences of the host organism and cells transplanted in which an immune response is generated.

[0108] As used herein, the term "B2M- / -" refers to a diploid cell having an inactivated B2M gene in both chromosomes.

[0109] As used herein, the term "CIITA- / -" refers to a diploid cell having an inactivated CIITA gene in both chromosomes.

[0110] As used herein, the term "polypeptide" refers to a polymer comprising two or more amino acids covalently linked by peptide bonds. A "protein" may comprise one or more polypeptides, wherein the polypeptides interact with each other through covalent or non-covalent means. Unless otherwise indicated, "polypeptide" and "protein" are used interchangeably.

[0111] In the context of cells, "wild type" refers to cells found in nature. However, in the context of pluripotent stem cells, as used herein, it also refers to pluripotent stem cells that have not undergone a gene editing procedure to achieve low immunogenicity, for example, the parental pluripotent stem cells (WT) described herein. In the present disclosure, the parental pluripotent stem cells of the H1 cell line are also referred to as WT, and the parental pluripotent stem cells of the iPSC cell line are also referred to as iPSC-WT.

[0112] As used herein, the term "% identity" with respect to sequences refers to the percentage of identical nucleotides or amino acids in an optimal alignment between the sequences to be compared. The differences between the two sequences can be distributed over local regions (segments) or over the entire length of the sequences to be compared. The identity between the two sequences is usually determined after optimal alignment of a segment or "comparison window." Optimal alignment can be performed manually, or by means of algorithms known in the art, including but not limited to the local homology algorithm described by Smith and Waterman, 1981, Ads App. Math. 2,482 and Neddleman and Wunsch, 1970, J. Mol. Biol. 48,443, the search for similarity method described by Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 88,2444, or using computer programs such as GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis. For example, the percent identity of two sequences can be determined using the publicly available BLASTN or BLASTP algorithms of the National Center for Biotechnology Information (NCBI) website.

[0113] In some embodiments, the % homogeneity is given in the region of at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or about 100%. In some embodiments, the homogeneity is given to the whole length of the reference sequence. The comparison of sequence homogeneity can be determined with instruments known in the art, preferably using optimal sequence alignment, for example, using Align, using standard settings, preferably EMBOSS::needle, Matrix:Blosum62, Gap Open 10.0, Gap Extend 0.5.

[0114] As used herein, "nucleotides" include deoxyribonucleotides and ribonucleotides and their derivatives. As used herein, "ribonucleotides" are constituents of ribonucleic acid (RNA), consisting of one base molecule, one pentose molecule, and one phosphate molecule. They refer to nucleotides with a hydroxyl group at the 2' position of the β-D-ribofuranosyl group. "Deoxyribonucleotides" are constituents of deoxyribonucleic acid (DNA), also consisting of one base molecule, one pentose molecule, and one phosphate molecule. They refer to nucleotides in which the hydroxyl group at the 2' position of the β-D-ribofuranosyl group is replaced by hydrogen, and are the main chemical components of chromosomes. "Nucleotides" are usually referred to by a single letter representing the base: "A (a)" refers to deoxyadenosine or adenylate containing adenine, "C (c)" refers to deoxycytidine or cytidine containing cytosine, "G (g)" refers to deoxyguanosine or guanylate containing guanine, "U (u)" refers to uridine containing uracil, and "T (t)" refers to deoxythymidylate containing thymine.

[0115] As used herein, the terms "polynucleotide" and "nucleic acid" are used interchangeably to refer to a polymer of deoxyribonucleotides (deoxyribonucleic acid, DNA) or a polymer of ribonucleotides (ribonucleic acid, RNA). "Polynucleotide sequence," "nucleic acid sequence," and "nucleotide sequence" are used interchangeably to refer to the order of nucleotides in a polynucleotide. It will be understood by those skilled in the art that a DNA coding strand (sense strand) and the RNA it encodes can be considered to have the same nucleotide sequence, with deoxythymidylic acid in the DNA coding strand sequence corresponding to uridine in the RNA sequence it encodes.

[0116] As used herein, the term "expression" includes transcription and / or translation of a nucleotide sequence. Thus, expression can involve the production of transcripts and / or polypeptides. The term "transcription" refers to the process by which the genetic code in a DNA sequence is transcribed into RNA (transcript). The term "in vitro transcription" refers to the synthesis of RNA, particularly mRNA, in a cell-free system (e.g., in an appropriate cell extract) in vitro (see, e.g., Pardi N., Muramatsu H., Weissman D., Karikó K. (2013). 9 In: Rabinovich P. (eds) Synthetic Messenger RNA and Cell Metabolism Modulation. Methods in Molecular Biology (Methods and Protocols), vol 969. Humana Press, Totowa, NJ.). A vector that can be used to produce a transcript is also referred to as a "transcription vector," which contains regulatory sequences required for transcription. The term "transcription" encompasses "in vitro transcription."

[0117] As used herein, "encoding" refers to the inherent property of a specific nucleotide sequence within a polynucleotide, such as a gene, cDNA, or mRNA, which can serve as a template for the synthesis of polymers and macromolecules involved in other biological processes, given a well-defined nucleotide sequence or amino acid sequence. Thus, a gene encoding a protein means that the gene's mRNA, through transcription and translation, produces the protein in a cell or other biological system.

[0118] Unless otherwise stated, all methods described herein can be performed in any suitable order.

[0119] pluripotent stem cells

[0120] In one aspect, the present invention provides a low immunogenicity pluripotent stem cell, comprising:

[0121] reduced endogenous major histocompatibility class I antigen (MHC-I) function compared to parental pluripotent stem cells;

[0122] Reduced endogenous major histocompatibility class II antigen (MHC-II) function compared to the parental pluripotent stem cell; and

[0123] Reduced sensitivity to killing by NK cells, macrophages, and T cells compared to parental pluripotent stem cells.

[0124] Herein, parental pluripotent stem cells refer to parental pluripotent stem cells (also referred to herein as “WT” or “iPSC-WT”) that have not undergone gene editing procedures to achieve low immunogenicity before immune modification.

[0125] In a particularly preferred embodiment, the reduced sensitivity to killing by NK cells, macrophages and T cells is caused by increased expression of the MCL1 protein.

[0126] As will be appreciated by those skilled in the art, reduction of function can be achieved in a variety of ways, including removing nucleic acid sequences from a gene, interrupting a sequence with another sequence, or altering regulatory components of the nucleic acid. For example, all or part of the coding region of the target gene can be removed or replaced with a "nonsense" sequence, frameshift mutations can be performed, all or part of a regulatory sequence, such as a promoter, can be removed or replaced, and a translation initiation sequence can be deleted or replaced.

[0127] As will be appreciated by those skilled in the art, the reduction in MHC I (HLA I when the cells are derived from human cells) function in pluripotent stem cells can be measured using techniques known in the art and described below; for example, FACS techniques using labeled antibodies that bind to the HLA complex; for example, commercially available HLA-A, HLA-B, HLA-C antibodies that bind to human major histocompatibility HLA class I. The reduction in MHC II (HLA II when the cells are derived from human cells) function in pluripotent stem cells can be measured using techniques known in the art and described below; for example, FACS techniques using labeled antibodies that bind to the HLA complex; for example, commercially available HLA-DQ, HLA-DR, HLA-DP antibodies that bind to human major histocompatibility HLA class II.

[0128] In some embodiments, the MHC-I function is reduced by reducing the activity of MHC class I proteins.

[0129] In one embodiment, the MHC class I protein comprises a human leukocyte antigen-A (HLA-A) protein, a human leukocyte antigen-B (HLA-B) protein, or a human leukocyte antigen-C (HLA-C) protein.

[0130] In some embodiments, the MHC-I function is reduced by reducing the activity of an MHC-I transcriptional regulator.

[0131] In some preferred embodiments, the MHC-I transcriptional regulator can be selected from: one or more of: β2 microglobulin (B2M), transporter associated with antigen processing 1 (TAP1), transporter associated with antigen processing 2 (TAP2), transporter associated with antigen processing (TAP)-associated glycoprotein (Tapasin) or NOD-like receptor family caspase recruitment domain 5 (NLRC5).

[0132] In one embodiment, the MHC-I function is reduced by reducing the activity of the HLA-A protein.

[0133] In one embodiment, the MHC-I function is reduced by knocking out the gene encoding the HLA-A protein.

[0134] In one embodiment, the MHC-I function is reduced by reducing the activity of an HLA-B protein.

[0135] In one embodiment, the MHC-I function is reduced by knocking out the gene encoding the HLA-B protein.

[0136] In one embodiment, the MHC-I function is reduced by reducing the activity of the HLA-C protein.

[0137] In one embodiment, the MHC-I function is reduced by knocking out the gene encoding the HLA-C protein.

[0138] In one embodiment, the MHC-I function is reduced by reducing the activity of TAP1 protein.

[0139] In one embodiment, the MHC-I function is reduced by knocking out the gene encoding the TAP1 protein.

[0140] In one embodiment, the MHC-I function is reduced by reducing the activity of the TAP2 protein.

[0141] In one embodiment, the MHC-I function is reduced by knocking out the gene encoding the TAP2 protein.

[0142] In one embodiment, the MHC-I function is reduced by reducing the activity of the Tapasin protein.

[0143] In one embodiment, the MHC-I function is reduced by knocking out the gene encoding the Tapasin protein.

[0144] In one embodiment, the MHC-I function is reduced by reducing the activity of the NLRC5 protein.

[0145] In one embodiment, the MHC-I function is reduced by knocking out the gene encoding the NLRC5 protein.

[0146] In a preferred embodiment, the MHC-I function is reduced by reducing the activity of the B2M protein.

[0147] In one embodiment, the B2M protein is a human B2M protein, which comprises the amino acid sequence shown in SEQ ID NO:1 or an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence shown in SEQ ID NO:1.

[0148] In one embodiment, the MHC-I function is reduced by knocking out the gene encoding the B2M protein.

[0149] In some embodiments, the MHC-II function is reduced by reducing the activity of an MHC class II protein.

[0150] In one embodiment, the MHC class II protein comprises a human leukocyte antigen-DR (HLA-DR) protein, a human leukocyte antigen-DQ (HLA-DQ) protein, or a human leukocyte antigen-DP (HLA-DP) protein.

[0151] In some embodiments, the MHC-II function is reduced by reducing the activity of an MHC-II transcriptional regulator. In some preferred embodiments, the MHC-II transcriptional regulator can be selected from one or more of: MHC-II transactivator protein (CIITA), regulatory factor X-associated anchor protein (RFXANK), regulatory factor X5 (RFX5), and regulatory factor X-associated protein (RFXAP).

[0152] In one embodiment, the MHC-II function is reduced by reducing the activity of the HLA-DR protein.

[0153] In one embodiment, the MHC-II function is reduced by knocking out the gene encoding the HLA-DR protein.

[0154] In one embodiment, the MHC-II function is reduced by reducing the activity of the HLA-DQ protein.

[0155] In one embodiment, the MHC-II function is reduced by knocking out the gene encoding the HLA-DQ protein.

[0156] In one embodiment, the MHC-II function is reduced by reducing the activity of the HLA-DP protein.

[0157] In one embodiment, the MHC-II function is reduced by knocking out the gene encoding the HLA-DP protein.

[0158] In one embodiment, the MHC-II function is reduced by reducing the activity of the RFXANK protein.

[0159] In one embodiment, the MHC-II function is reduced by knocking out the gene encoding the RFXANK protein.

[0160] In one embodiment, the MHC-II function is reduced by reducing the activity of the RFX5 protein.

[0161] In one embodiment, the MHC-II function is reduced by knocking out the gene encoding the RFX5 protein.

[0162] In one embodiment, the MHC-II function is reduced by reducing the activity of the RFXAP protein.

[0163] In one embodiment, the MHC-II function is reduced by knocking out the gene encoding the RFXAP protein.

[0164] In a preferred embodiment, the MHC-II function is reduced by reducing the activity of the CIITA protein.

[0165] In one embodiment, the CIITA protein is a human CIITA protein comprising the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO: 2.

[0166] In one embodiment, the MHC-II function is reduced by knocking out the gene encoding the CIITA protein.

[0167] In a preferred embodiment, CRISPR technology is used to knock out a gene. In some cases, CRISPR technology is used to introduce small deletions / insertions into the coding region of a gene so that no functional protein is produced, usually as a result of a frameshift mutation, which results in the generation of a stop codon, resulting in a truncated, non-functional protein.

[0168] The successful reduction of MHC-I (HLA-I when the cells are derived from human cells) function and MHC-II (HLA-II when the cells are derived from human cells) function in pluripotent stem cells can be measured using techniques known in the art, such as Western blotting using protein antibodies, FACS techniques, RT-PCR, and qPCR techniques.

[0169] In some embodiments, the reduced sensitivity to killing by NK cells, macrophages, and T cells is caused by increased expression of MCL1 protein in pluripotent stem cells. This can be accomplished in several ways, as will be appreciated by those skilled in the art, using "knock-in" or transgenic techniques. In some cases, the increased expression of MCL1 is caused by one or more MCL1 transgenes.

[0170] Thus, in some embodiments, one or more copies of the MCL1 gene are added to pluripotent stem cells under the control of an inducible or constitutive promoter. In some embodiments, a lentiviral construct is used as described herein or known in the art. As is known in the art, the MCL1 gene can be integrated into the genome of the host cell under the control of an appropriate promoter.

[0171] In one embodiment, the increased expression of MCL1 protein is caused by an MCL1 transgene.

[0172] In one embodiment, the MCL1 protein is a human MCL1 protein comprising the amino acid sequence of SEQ ID NO: 3, or an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO: 3.

[0173] The presence of sufficient MCL1 protein expression can be determined using known techniques, such as those described in the Examples, for example, using Western blot, ELISA assay, or FACS assay. Generally, "sufficient" in this context means an increase in MCL1 protein expression on the surface of pluripotent stem cells, which silences NK cell and T cell killing.

[0174] In another aspect, the present invention further provides a low immunogenic pluripotent stem cell comprising:

[0175] One or more changes that reduce the activity of endogenous B2M protein;

[0176] One or more changes that reduce the activity of endogenous CIITA protein; and

[0177] One or more alterations result in increased expression of MCL1 protein in the low immunogenic pluripotent stem cells.

[0178] In one embodiment, the low immunogenic pluripotent stem cells comprise:

[0179] one or more alterations that inactivate both alleles of the endogenous B2M gene;

[0180] One or more alterations that inactivate both alleles of the endogenous CIITA gene; and

[0181] One or more alterations result in increased MCL1 gene expression in the low immunogenic pluripotent stem cells.

[0182] In one embodiment, the low immunogenic pluripotent stem cells further comprise: one or more changes that increase the expression of genes selected from DUX4, CD27, CD35, CD200, PD-L1, CD47, CD24, CD26, CCL21, Mfge8, and SerpinB9.

[0183] As used herein, the term "change" or "hereditary alteration" refers to causing a cell, such as a change in pluripotent stem cells as described herein, which can be achieved, for example, by modifying a genome or introducing a new gene fragment. In this article, modifying a genome refers to modifying the nucleic acid sequence in a cell or under a cell-free condition to produce transformed pluripotent cells and pluripotent stem cells. The technology of exemplary "change" or "hereditary alteration" includes but is not limited to homologous recombination, knocking in, ZFN (zinc finger nuclease), TALEN (transcription activator-like effector nuclease), CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 and other site-specific nuclease technologies. These technologies enable double-stranded DNA breaks to be carried out at the desired gene locus point. These controlled double-stranded breaks promote the homologous recombination of specific gene locus points. The process focuses on the specific sequence of nucleic acid molecules targeted with endonucleases, such as chromosomes, and the endonucleases recognize and bind to sequences and induce double-strand breaks in nucleic acid molecules. Double-strand breaks are repaired by fallible non-homologous end joining (NHEJ) or by homologous recombination (HR). Exemplary "alteration" or "genetic alteration" techniques also include the introduction of gene expression modifying molecules, including but not limited to siRNA, shRNA, microRNA, antisense RNA, antisense oligonucleotides ASO (antisense oligonucleotides) or anti-miRNA oligonucleotides AMO (anti-miRNA oligonucleotides).

[0184] Those skilled in the art will appreciate that many different techniques can be used to engineer the pluripotent cells and pluripotent stem cells of the present invention to render them less immunogenic.

[0185] Typically, these techniques can be used alone or in combination. For example, CRISPR technology is used to reduce the expression of active B2M and / or CIITA proteins in transformed cells, and viral technology (such as lentivirus) is used to knock in the MCL1 gene. In addition, it will be understood by those skilled in the art that these genes can be operated in different orders using different techniques. In some embodiments, one or more changes included in the low immunogenicity pluripotent stem cells of the present invention can reduce endogenous major histocompatibility class I antigen (MHC-I) function. In some embodiments, one or more changes included in the low immunogenicity pluripotent stem cells of the present invention can reduce endogenous major histocompatibility class II antigen (MHC-II) function.

[0186] In some embodiments, the reduced immunogenicity pluripotent stem cells of the present invention comprise one or more alterations that reduce sensitivity to killing by NK cells, macrophages, and T cells.

[0187] In some embodiments, the hypoimmunogenic pluripotent stem cells of the present invention comprise one or more alterations that reduce the activity of endogenous B2M protein. In some embodiments, the hypoimmunogenic pluripotent stem cells of the present invention comprise one or more alterations that reduce the activity of endogenous CIITA protein. In some embodiments, the hypoimmunogenic pluripotent stem cells of the present invention comprise one or more alterations that increase the expression of MCL1 protein.

[0188] In some embodiments, the hypoimmunogenic pluripotent stem cells of the present invention contain one or more alterations that inactivate both alleles of the endogenous B2M gene. In some embodiments, the hypoimmunogenic pluripotent stem cells of the present invention contain one or more alterations that inactivate both alleles of the endogenous CIITA gene. In some embodiments, the hypoimmunogenic pluripotent stem cells of the present invention contain one or more alterations that increase expression of the MCL1 gene.

[0189] In some embodiments, the low immunogenicity pluripotent stem cells of the present invention comprise one or more changes that inhibit the expression of endogenous B2M protein. In some embodiments, the low immunogenicity pluripotent stem cells of the present invention comprise one or more changes that inhibit the expression of endogenous CIITA protein.

[0190] In some embodiments, the low immunogenic pluripotent stem cells of the present invention comprise one or more changes that interfere with the expression of endogenous B2M protein. In some embodiments, the low immunogenic pluripotent stem cells of the present invention comprise one or more changes that interfere with the expression of endogenous CIITA protein.

[0191] In some embodiments, the low immunogenicity pluripotent stem cells of the present invention comprise one or more changes that can reduce the expression of endogenous B2M protein. In some embodiments, the low immunogenicity pluripotent stem cells of the present invention comprise one or more changes that can reduce the expression of endogenous CIITA protein.

[0192] In some embodiments, the low immunogenic pluripotent stem cells of the present invention comprise one or more alterations that knock out endogenous B2M protein. In some embodiments, the low immunogenic pluripotent stem cells of the present invention comprise one or more alterations that knock out endogenous CIITA protein.

[0193] In one embodiment, the pluripotent stem cells are altered using Clustered Regularly Interspaced Short Palindromic Repeats / Cas ("CRISPR") technology known in the art to reduce the activity of endogenous B2M protein.

[0194] In one embodiment, the pluripotent stem cells are altered using Clustered Regularly Interspaced Short Palindromic Repeats / Cas ("CRISPR") technology known in the art to reduce the activity of endogenous CIITA protein.

[0195] In one embodiment, the pluripotent stem cells are altered to inactivate both alleles of the endogenous B2M gene using Clustered Regularly Interspaced Short Palindromic Repeats / Cas ("CRISPR") technology known in the art.

[0196] In one embodiment, the pluripotent stem cells are altered using Clustered Regularly Interspaced Short Palindromic Repeats / Cas ("CRISPR") technology known in the art to inactivate both alleles of the endogenous CIITA gene.

[0197] Determination of whether the test gene has been inactivated is known and described herein. In one embodiment, the determination is a Western blot of cell lysates probed with antibodies against B2M protein or CIITA protein. In another embodiment, reverse transcriptase polymerase chain reaction (RT-PCR) confirms the presence of inactivation changes.

[0198] In one embodiment, viral techniques known in the art can be used to induce increased expression of the MCL1 gene in the hypoimmunogenic pluripotent stem cells. Such viral techniques include, but are not limited to, the use of retroviral vectors, lentiviral vectors, adenoviral vectors, and Sendai viral vectors. In some embodiments, a nucleic acid sequence encoding the MCL1 protein is introduced into a selected site in the cells; the selected site in the cells is a safe harbor gene locus, such as AAVS1 or CCR5. As used herein, a "safe harbor gene locus" refers to a site that can be used for safe gene knock-in and ensures normal and stable expression of the introduced gene.

[0199] In a preferred embodiment, a lentiviral vector is used to induce increased expression of the MCL1 gene in the low immunogenic pluripotent stem cells.

[0200] In one embodiment, the low immunogenic pluripotent stem cells are human pluripotent stem cells.

[0201] In one embodiment, the B2M protein is a human B2M protein, which comprises the amino acid sequence shown in SEQ ID NO:1 or an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence shown in SEQ ID NO:1.

[0202] In one embodiment, the CIITA protein is a human CIITA protein comprising the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO: 2.

[0203] In one embodiment, the MCL1 protein is a human MCL1 protein comprising the amino acid sequence of SEQ ID NO: 3, or an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO: 3.

[0204] In one embodiment, the hypoimmunogenic stem cells comprise:

[0205] reduced endogenous major histocompatibility class I antigen (MHC-I) function compared to parental pluripotent stem cells;

[0206] Reduced endogenous major histocompatibility class II antigen (MHC-II) function compared to the parental pluripotent stem cell; and

[0207] Reduced sensitivity to killing by NK cells, macrophages, and T cells compared to parental pluripotent stem cells.

[0208] In one embodiment, the T cell response elicited by the low immunogenicity pluripotent stem cells is lower than the T cell response elicited by the parental pluripotent stem cells, and the parental pluripotent stem cells do not contain the changes that reduce the activity of B2M and CIITA proteins and the changes that cause increased expression of MCL1 protein. In one embodiment, the T cell response is measured by measuring the killing ability of T cells to the low immunogenicity pluripotent stem cells or the parental pluripotent stem cells by real-time label-free dynamic cell analysis (RTCA).

[0209] In one embodiment, the natural killer (NK) cell response triggered by the low immunogenic pluripotent stem cells is lower than the NK cell response triggered by the cloned DKO cells of B2M / CIITA double allele knockout, and the DKO cells include the changes that reduce the activity of B2M and CIITA proteins but do not include the changes that cause increased MCL1 protein expression. In one embodiment, the NK cell response is measured by measuring the IFN-γ level of NK cells incubated in vitro with the low immunogenic pluripotent stem cells or DKO cells. In one embodiment, the NK cell response is measured by real-time label-free dynamic cell analysis (RTCA) to measure the lethality of NK cells to the low immunogenic pluripotent stem cells or DKO cells.

[0210] Method for producing low immunogenic pluripotent stem cells of the present invention

[0211] The present invention also provides a method for producing the low immunogenic pluripotent stem cells of the present invention, the method comprising: reducing the endogenous major histocompatibility class I antigen (MHC-I) function in the pluripotent stem cells; reducing the endogenous major histocompatibility class II antigen (MHC-II) function in the pluripotent stem cells; and increasing the expression of a protein that reduces the sensitivity of the pluripotent stem cells to killing by NK cells, macrophages and T cells, wherein the protein is MCL1 protein.

[0212] In some embodiments, the method comprises: reducing the activity of a B2M protein in the pluripotent stem cells; reducing the activity of a CIITA protein in the pluripotent stem cells; and increasing the expression of a MCL1 protein in the pluripotent stem cells.

[0213] In one embodiment, the method comprises: eliminating the activity of both alleles of the B2M gene in the pluripotent stem cells; eliminating the activity of both alleles of the CIITA gene in the pluripotent stem cells; and increasing the expression of the MCL1 gene in the pluripotent stem cells.

[0214] In some embodiments, the activity of the B2M protein in the pluripotent stem cells can be reduced by the technology of “changing” or “genetic change” as described above. In some embodiments, the activity of the CIITA protein in the pluripotent stem cells can be reduced by the technology of “changing” or “genetic change” as described above. The technology, for example, introduces gene expression modification molecules, clustered regularly interspaced short palindromic repeats (CRISPR) technology, transcription activator-like effector nuclease (TALEN) technology, zinc finger nuclease (ZFN) technology or homologous recombination technology. In a preferred embodiment, the gene expression modification molecule comprises siRNA, shRNA, microRNA, antisense RNA, antisense oligonucleotides ASO (antisenseoligonucleotides) or anti-miRNA oligonucleotides AMO (Anti-miRNA oligonucleotides).

[0215] In some embodiments, the CRISPR / Cas system includes a Cas protein or a nucleic acid sequence encoding a Cas protein and at least one to two ribonucleic acids (e.g., gRNA), which can guide the Cas protein to a target motif of a target polynucleotide sequence and hybridize to the target motif. In some embodiments, the CRISPR / Cas system includes a Cas protein or a nucleic acid sequence encoding a Cas protein and a single ribonucleic acid or at least one ribonucleic acid (e.g., gRNA) pair, which can guide the Cas protein to a target motif of a target polynucleotide sequence and hybridize to the target motif.

[0216] In some embodiments, the Cas protein comprises one or more amino acid substitutions or modifications. In some embodiments, one or more amino acid substitutions comprise conservative amino acid substitutions. In some cases, substitutions and / or modifications can prevent or reduce proteolytic degradation and / or prolong the half-life of the polypeptide in the cell. In some embodiments, the Cas protein may comprise peptide bond replacements (e.g., urea, thiourea, carbamate, sulfonylurea). In some embodiments, the Cas protein may comprise naturally occurring amino acids. In some embodiments, the Cas protein may comprise optional amino acids (e.g., D-amino acids, β-amino acids, homocysteine, phosphoserine). In some embodiments, the Cas protein may comprise modifications to include portions (e.g., pegylation, glycosylation, lipidation, acetylation, capping).

[0217] In some embodiments, the Cas protein comprises a core Cas protein. Exemplary Cas core proteins include but are not limited to Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, and Cas9. In some embodiments, the Cas protein comprises a Cas protein of the Escherichia coli (E. coli) subtype (also referred to as CASS2). Exemplary Cas proteins of the E. coli subtype include but are not limited to Cse1, Cse2, Cse3, Cse4, and Cas5e. In some embodiments, the Cas protein comprises a Cas protein of the Ypest subtype (also referred to as CASS3). Exemplary Cas proteins of the Ypest subtype include but are not limited to Csy1, Csy2, Csy3, and Csy4. In some embodiments, the Cas protein comprises a Cas protein of the Nmeni subtype (also referred to as CASS4). Exemplary Cas proteins of the Nmeni subtype include but are not limited to Csn1 and Csn2. In some embodiments, the Cas protein comprises a Cas protein of the Dvulg subtype (also referred to as CASS1). Exemplary Cas proteins of the Dvulg subtype include but are not limited to Csd1, Csd2, and Cas5d. In some embodiments, the Cas protein comprises a Cas protein of the Tneap subtype (also known as CASS7). Exemplary Cas proteins of the Tneap subtype include but are not limited to Cst1, Cst2, and Cas5t. In some embodiments, the Cas protein comprises a Cas protein of the Hmari subtype. Exemplary Cas proteins of the Hmari subtype include but are not limited to Csh1, Csh2, and Cas5h. In some embodiments, the Cas protein comprises a Cas protein of the Apern subtype (also known as CASS5). Exemplary Cas proteins of the Apern subtype include but are not limited to Csa1, Csa2, Csa3, Csa4, Csa5, and Cas5a. In some embodiments, the Cas protein comprises a Cas protein of the Mtube subtype (also known as CASS6). Exemplary Cas proteins of the Mtube subtype include but are not limited to Csm1, Csm2, Csm3, Csm435, and Csm5. In some embodiments, the Cas protein comprises a RAMP-type Cas protein. Exemplary RAMP-type Cas16 proteins include but are not limited to Cmr1, Cmr2, Cmr3, Cmr4, Cmr5, and Cmr6.

[0218] In some embodiments, the Cas protein is a Streptococcus pyogenes Cas9 protein or a functional portion thereof. In some embodiments, the Cas protein is a Streptococcus aureus Cas9 protein or a functional portion thereof. In some embodiments, the Cas protein is a Streptococcus thermophilus Cas9 protein or a functional portion thereof. In some embodiments, the Cas protein is a Neisseria meningitides Cas9 protein or a functional portion thereof. In some embodiments, the Cas protein is a Treponema denticola Cas9 protein or a functional portion thereof. In some embodiments, the Cas protein is a Cas9 protein or a functional portion thereof from any bacterial species. The Cas9 protein is a member of the Type II CRISPR system, which typically includes a trans-encoded small RNA (tracrRNA), an endogenous ribonuclease 3 (rnc), and a Cas protein. The Cas9 protein (also known as the CRISPR-associated endonuclease Cas9 / Csn1) is a polypeptide comprising amino acids.

[0219] In one embodiment, the activity of B2M protein in the pluripotent stem cells is reduced by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology.

[0220] In one embodiment, the activities of both alleles of the B2M gene in the pluripotent stem cells are eliminated by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology.

[0221] In one embodiment, the activity of CIITA protein in the pluripotent stem cells is reduced by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology.

[0222] In one embodiment, the activity of both alleles of the CIITA gene in the pluripotent stem cells is eliminated by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology.

[0223] In one embodiment, the expression of MCL1 protein is increased by modification of an endogenous locus. In some embodiments, the endogenous locus is modified by a technique of "alteration" or "genetic alteration" as described above. Such techniques include, for example, gene knock-in, clustered regularly interspaced short palindromic repeats (CRISPR) technology, transcription activator-like effector nuclease (TALEN) technology, zinc finger nuclease (ZFN) technology, or homologous recombination technology.

[0224] In one embodiment, the expression of MCL1 protein is increased by expression of a transgene. Transgenic expression techniques known in the art can be used to increase the expression of MCL1 protein, including but not limited to viral technology, Piggybac transposon technology, and SleepingBeauty transposon technology.

[0225] In this article, known recombinant techniques can be used to produce expression constructs as described herein. In certain embodiments, the nucleic acid sequence encoding the target protein can be operably connected to one or more regulatory nucleotide sequences in the expression construct. The regulatory nucleotide sequence is generally suitable for host cells and subjects to be treated. Various types of suitable expression vectors and suitable regulatory sequences are known in the art for use in a variety of host cells. Generally, one or more regulatory nucleotide sequences may include, but are not limited to, promoter sequences, leader sequences or signal sequences, ribosome binding sites, transcription start and stop sequences, translation start and stop sequences, and enhancer or activator sequences. The expression constructs used herein can use constitutive or inducible promoters known in the art. The promoter can be a naturally occurring promoter, or a hybrid promoter combining elements of more than one promoter. The expression construct can be present in the cell on an episome (e.g., a plasmid), or the expression construct can be inserted into a chromosome. In a specific embodiment, the expression vector includes a selectable marker gene to allow selection of transformed host cells. Some embodiments include an expression vector comprising a nucleotide sequence encoding the target protein operably connected to at least one regulatory sequence. Regulatory sequences used herein include promoters, enhancers, and other expression control elements. In certain embodiments, the expression vector is designed to select the host cell to be transformed, the desired protein to be expressed, the copy number of the vector, the ability to control the copy number, or the expression of any other protein encoded by the vector, such as an antibiotic marker. In some embodiments, the promoter is the EF1a promoter.

[0226] Viral technology can be used to induce increased expression of the MCL1 gene in the low immunogenic pluripotent stem cells. The viral technology includes, but is not limited to, the use of retroviral vectors, lentiviral vectors, adenoviral vectors, and Sendai virus vectors.

[0227] In a preferred embodiment, a nucleic acid sequence encoding the MCL1 protein is synthesized and constructed into a lentiviral vector, and then at least one copy of the MCL1 gene under the control of a promoter is introduced into the pluripotent stem cells via the lentiviral vector to increase the expression of the MCL1 protein.

[0228] In one embodiment, a nucleic acid sequence encoding the MCL1 protein is introduced into a selected site in the genome of the pluripotent stem cell. In a preferred embodiment, the selected site is a safe harbor locus of the AAVS1 or CCR5 gene. As used herein, a "safe harbor locus" refers to a site that can be used for safe gene knock-in and ensures normal and stable expression of the transferred gene.

[0229] In one embodiment, the MCL1 protein is a human MCL1 protein.

[0230] In one embodiment, the nucleic acid sequence encoding the MCL1 protein comprises the nucleic acid sequence shown in SEQ ID NO: 4, or a nucleic acid sequence that is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown in SEQ ID NO: 4.

[0231] Prevention or treatment

[0232] The present invention further provides use of the low immunogenic pluripotent stem cells of the present invention or the low immunogenic pluripotent stem cells prepared by the method of the present invention in preparing a medicament for preventing or treating a disease requiring cell transplantation.

[0233] The low immunogenicity pluripotent stem cells of the present invention or the low immunogenicity pluripotent stem cells prepared by the method of the present invention can be induced to differentiate into different cells, which can be used for different prevention or treatment purposes, to prevent or treat different diseases. As will be understood by those skilled in the art, differentiation methods depend on the required cell types using known technology. For example, cells can be suspended for differentiation and then made into a gel matrix form, such as matrigel, gelatin or fibrin / thrombin form, to promote cell survival. Usually differentiation can be determined as known in the art by assessing the presence of cell-specific markers. For example, cells can be differentiated into cardiomyocytes, neurons, glial cells, endothelial cells, T cells, NK cells, NKT cells, macrophages, hematopoietic progenitor cells, mesenchymal cells, islet cells, chondrocytes, retinal pigment epithelial cells, kidney cells, hepatocytes, thyroid cells, skin cells, blood cells or epithelial cells under certain differentiation conditions.

[0234] In some embodiments, the disease is cancer, and the cancer comprises solid tumors and hematological tumors. In some embodiments, the solid tumor comprises small cell lung cancer, breast cancer, testicular cancer, neuroblastoma, ovarian cancer, or melanoma. In some embodiments, the hematological tumor comprises acute leukemia, chronic leukemia, lymphoma, myelodysplastic syndrome, or multiple myeloma.

[0235] In one embodiment, the disease comprises aplastic anemia.

[0236] In one embodiment, the disease comprises an innate immune deficiency disease.

[0237] In some embodiments, the disease is an autoimmune disease comprising systemic lupus erythematosus, rheumatoid arthritis, ankylosing spondylitis, or type I diabetes.

[0238] In some embodiments, the disease is a neurodegenerative disease comprising Parkinson's disease, Alzheimer's disease, spinal cord injury, retinal degeneration, stroke, Huntington's disease, or amyotrophic lateral sclerosis.

[0239] In some embodiments, the disease is a cardiovascular disease comprising atherosclerosis, hypertension, rheumatic heart disease, cardiomyopathy, arrhythmia, congenital heart disease, valvular heart disease, carditis, myocardial infarction, heart failure, aortic aneurysm, or peripheral arterial disease.

[0240] In some embodiments, the disease is a metabolic-related disease comprising type II diabetes, scurvy, hypoglycemia, hyperlipidemia, or osteoporosis.

[0241] Differentiation of pluripotent stem cells

[0242] The present invention provides pluripotent stem cells that can be differentiated into different cell types for subsequent transplantation into a recipient subject. As will be appreciated by those skilled in the art, differentiated low immunogenic pluripotent cell derivatives can be transplanted using techniques known in the art, depending on the cell type and the ultimate use of these cells.

[0243] 1. Cardiomyocytes differentiate from pluripotent stem cells

[0244] The present invention provides pluripotent stem cells that can be differentiated into different cardiac cell types for subsequent transplantation or implantation into a subject (eg, a recipient).

[0245] As will be appreciated by those skilled in the art, the differentiation method depends on the desired cell type using known techniques. Exemplary cardiac cell types include, but are not limited to, cardiomyocytes, nodal cardiomyocytes, conducting cardiomyocytes, working cardiomyocytes, cardiomyocyte precursor cells, cardiac stem cells, atrial cardiac stem cells, ventricular cardiac stem cells, epicardial cells, hematopoietic cells, vascular endothelial cells, endocardial endothelial cells, heart valve interstitial cells, and cardiac pacemaker marker cells.

[0246] In some embodiments, cardiomyocyte precursors include cells that are capable of (without dedifferentiation or reprogramming) generating progeny including mature (terminal) cardiomyocytes. Cardiomyocyte precursor cells can generally be identified using one or more markers selected from the GATA-4, Nkx2.5, and MEF-2 transcription factor families.

[0247] In some embodiments, the cardiomyocytes are low immunogenic cardiomyocytes.

[0248] In some embodiments, the cardiomyocytes described herein are administered to a recipient subject to treat a cardiac disorder selected from the group consisting of pediatric cardiomyopathy, age-related cardiomyopathy, dilated cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, chronic ischemic cardiomyopathy, peripartum cardiomyopathy, inflammatory cardiomyopathy, idiopathic cardiomyopathy, other cardiomyopathies, myocardial ischemia-reperfusion injury, ventricular dysfunction, heart failure, congestive heart failure, coronary artery disease, end-stage heart disease, atherosclerosis, ischemia, hypertension, restenosis, angina, rheumatic heart disease, arterial inflammation, cardiovascular disease, myocardial infarction, myocardial ischemia, congestive heart failure, myocardial infarction, Myocardial ischemia, heart injury, myocardial ischemia, vascular disease, acquired heart disease, congenital heart disease, atherosclerosis, coronary artery disease, conduction system dysfunction, coronary artery dysfunction, pulmonary hypertension, arrhythmia, muscle dysfunction trophy, muscle mass abnormalities, muscle degeneration, myocarditis, infectious myocarditis, drug- or toxin-induced muscle abnormalities, allergic myocarditis, and autoimmune endocarditis.

[0249] In some embodiments, a method for generating a low immunogenic cardiomyocyte population from a low immunogenic pluripotent (HIP) stem cell population by in vitro differentiation comprises: (a) culturing the HIP cell population in a culture medium comprising a GSK inhibitor; (b) culturing the HIP cell population in a culture medium comprising a WNT antagonist to generate a pre-cardiomyocyte population; (c) culturing the pre-cardiomyocyte population in a culture medium comprising insulin to generate a low immunogenic cardiomyocyte population. In some embodiments, the GSK inhibitor is CHIR-99021, a derivative thereof, or a variant thereof. In some cases, the concentration range of the GSK inhibitor is from about 2 mM to about 10 mM. In some embodiments, the WNT antagonist is IWR1, a derivative thereof, or a variant thereof. In some cases, the concentration range of the WNT antagonist is from about 2 mM to about 10 mM.

[0250] Other useful methods for differentiating induced pluripotent stem cells or multipotent stem cells into cardiomyocytes are described, for example, in US2017 / 0152485; US2017 / 0058263; US2017 / 0002325; US2016 / 0362661; US2016 / 0068814; US9,062,289; US7,897,389; and US7,452,718. Other methods for generating cardiac cells from induced pluripotent stem cells or multipotent stem cells are described, for example, in Xu et al., Stem Cells and Development, 2006, 15(5):631-9, Burridge et al., Cell Stem Cell, 2012, 10:16-28, and Chen et al., Stem Cell Res, 2015, 15(2):365-375.

[0251] In various embodiments, low immunogenic cardiomyocytes can be cultured in culture medium containing BMP pathway inhibitors, WNT signaling activators, WNT signaling inhibitors, WNT agonists, WNT antagonists, Src inhibitors, EGFR inhibitors, PCK activators, cytokines, growth factors, cardiomyogenic agents, other compounds, etc.

[0252] WNT signaling activators include, but are not limited to, CHIR99021. PCK activators include, but are not limited to, PMA. WNT signaling inhibitors include, but are not limited to, compounds selected from KY02111, SO3031 (KY01-1), SO2031 (KY02-1), SO3042 (KY03-1), and XAV939. Src inhibitors include, but are not limited to, A419259. EGFR inhibitors include, but are not limited to, AG1478.

[0253] Non-limiting examples of reagents for generating cardiomyocytes from iPSCs include activin A, BMP-4, Wnt3a, VEGF, soluble Frizzled, cyclosporin A, angiotensin II, phenylephrine, ascorbic acid, dimethyl sulfoxide, 5-aza-2'-deoxycytidine, and the like.

[0254] 2. Differentiation of pluripotent stem cells into neural cells

[0255] The present invention provides pluripotent stem cells that can be differentiated into different neural cell types for subsequent transplantation or implantation into a recipient subject. As will be appreciated by those skilled in the art, the differentiation method depends on the desired cell type using known techniques. Exemplary neural cell types include, but are not limited to, brain endothelial cells, neurons, glial cells, and the like.

[0256] In some embodiments, the neural cells are administered to a subject to treat Parkinson's disease, Huntington's disease, multiple sclerosis, other neurodegenerative diseases or conditions, attention deficit hyperactivity disorder (ADHD), Tourette syndrome (TS), schizophrenia, psychosis, depression, other neuropsychiatric disorders. In some embodiments, the neural cells described herein are administered to a subject to treat or ameliorate stroke.

[0257] In some embodiments, neurons and glial cells are administered to subjects with amyotrophic lateral sclerosis (ALS). In some embodiments, brain endothelial cells are administered to alleviate the symptoms or effects of cerebral hemorrhage. In some embodiments, dopaminergic neurons are administered to patients with Parkinson's disease. In some embodiments, noradrenergic neurons and GABAergic interneurons are administered to patients who have experienced epileptic seizures. In some embodiments, motor neurons, interneurons, Schwann cells, oligodendrocytes and microglia are administered to patients who have experienced spinal cord injury.

[0258] In some embodiments, brain endothelial cells (EC), their precursors and progenitor cells are differentiated from pluripotent stem cells (e.g., induced pluripotent stem cells) on the surface by culturing cells in a culture medium comprising one or more factors that promote the production of brain endothelial cells or neural cells. In some cases, the culture medium comprises one or more of the following: CHIR-99021, VEGF, basic FGF, and Y-27632. In some embodiments, the culture medium includes supplements designed to promote the survival and function of neural cells. In some embodiments, brain endothelial cells (EC), their precursors and progenitor cells are differentiated from pluripotent stem cells on the surface by culturing cells in unconditioned or conditioned culture medium. In some cases, the culture medium comprises factors or small molecules that promote or promote differentiation. In some embodiments, the medium comprises one or more factors or small molecules selected from VEGR, FGF, SDF-1, CHIR-99021, Y-27632, SB431542, and any combination thereof. In some embodiments, the surface used for differentiation comprises one or more extracellular matrix proteins. In some cases, as known in the art, differentiation is typically measured by assessing the presence of cell-specific markers. In some embodiments, the brain endothelial cells express or secrete a factor selected from CD31, VE-cadherin, and combinations thereof.

[0259] In some embodiments, neurons, their precursors and progenitor cells are differentiated from pluripotent stem cells by culturing the cells in a medium comprising one or more factors. The one or more factors are selected from the group consisting of GDNF, BDNF, GM-CSF, B27, basic FGF, basic EGF, NGF, CNTF, SMAD inhibitors, Wnt antagonists, SHH signaling activators, and any combination thereof. In some embodiments, the SMAD inhibitor is selected from SB431542, LDN-193189, NogginPD169316, SB203580, LY364947, A77-01, A-83-01, BMP4, GW788388, GW6604, SB-505124, lerdebmumab, metebmumab, GC-1008, AP-12009, AP-11014, LY 550410, LY580276, LY364947, LY2109761, SB-505124, E-616452 (RepSoxALK inhibitor), SD-208, SMI6, NPC-30345, K26894, SB-203580, SD-093, activin-M108A, P144, soluble TBR2-Fc, DMH-1, dorsomorphin dihydrochloride and its derivatives.

[0260] In some embodiments, the Wnt antagonist is selected from the group consisting of XAV939, DKK1, DKK-2, DKK-3, Dkk-4, SFRP-1, SFRP-2, SFRP-5, SFRP-3, SFRP-4, WIF-1, Soggy, IWP-2, IWR1, ICG-001, KY0211, Wnt-059, LGK974, IWP-L6, and derivatives thereof. In some embodiments, the SHH signaling activator is selected from the group consisting of Smoothened agonist (SAG), SAG analogs, SHH, C25-SHH, C24-SHH, purmorphamine, Hg-Ag, and derivatives thereof.

[0261] In some embodiments, the stem cells described herein are differentiated into dopaminergic neurons, including dopaminergic progenitor cells. Stem cells are cultured in a differentiation medium containing supplements or additives to induce neuronal differentiation. In some embodiments, cells are cultured in the presence of supplements or additives to induce floor plate cells. In some embodiments, the supplements or additives include BMP inhibitor LDN193189, ALK-5 inhibitor A83-01, Smoothened agonist purmorphamine, FGF8, GSK3 inhibitor CHIR99021, glial cell line-derived neurotrophic factor, GDNF, ascorbic acid, brain-derived neurotrophic factor BDNF, dibutyryladenosine cyclic monophosphate dbcAMP, and ROCK inhibitor Y-27632.

[0262] In some embodiments, a method for generating a low immunogenic dopaminergic neuron population from a low immunogenic induced pluripotent stem cell (HIP cell) population by in vitro differentiation comprises (a) culturing a HIP cell population in a first culture medium comprising one or more factors selected from sonic hedgehog (SHH), BDNF, EGF, bFGF, FGF8, WNT1, retinoic acid, a GSK3 inhibitor, an ALK inhibitor, and a ROCK inhibitor to produce a population of immature dopaminergic neurons; (b) culturing the immature dopaminergic neuron population in a second culture medium different from the first culture medium to produce a dopaminergic neuron population. In some embodiments, the GSK inhibitor is CHIR-99021, a derivative thereof, or a variant thereof. In some cases, the concentration of the GSK inhibitor ranges from about 2 mM to about 10 mM. In some embodiments, the ALK inhibitor is SB-431542, a derivative thereof, or a variant thereof. In some cases, the concentration of the ALK inhibitor ranges from about 1 mM to about 10 mM. In some embodiments, the first culture medium and / or the second culture medium does not contain animal serum.

[0263] Methods for differentiating pluripotent stem cells are described in, for example, Kikuchi et al., Nature, 2017, 548, 592-596; Kriks et al., Nature, 2011, 547-551; Doi et al., Stem Cell Reports, 2014, 2, 337-50; Perrier et al., Proc Natl Acad Sci USA, 2004, 101, 12543-12548; Chambers et al., Nat Biotechnol, 2009, 27, 275-280; Kirkeby et al., Cell Reports, 2012, 1, 703-714. Useful descriptions of neurons derived from stem cells and methods for their preparation can be found, for example, in Kirkeby et al., Cell Rep, 2012, 1:703-714; Kriks et al., Nature, 2011, 480:547-551; Wang et al., Stem Cell Reports, 2018, 11(1):171-182; Lorenz Studer, "Chapter 8 - Strategies for bringing stem cell-derived dopamine neurons into the clinic - the NYSTEM trial," in Progress in Brain Research, 2017, Vol. 230, p. 15. 191-212; Liu et al., Nat Protoc, 2013, 8:1670-1679; Upadhya et al., Curr Protoc Stem Cell Biol, 38, 2D.7.1-2D.7.47; the contents of U.S. patent applications 20160115448 and US8,252,586; US8,273,570; US9,487,752 and US10,093,897 are incorporated herein by reference in their entirety.

[0264] In some embodiments, glial cells, including microglia, astrocytes, oligodendrocytes, ependymal cells, and Schwann cells, glial precursors, and glial progenitor cells, are produced by differentiating pluripotent stem cells into therapeutically effective glial cells, etc. Differentiation of hypoimmunogenic pluripotent stem cells produces hypoimmunogenic neural cells, such as hypoimmunogenic glial cells.

[0265] In some embodiments, glial cells, precursors and progenitors thereof are produced by culturing pluripotent stem cells in a medium comprising one or more agents selected from retinoic acid, IL-34, M-CSF, FLT3 ligand, GM-CSF, CCL2, TGFβ inhibitors, BMP signaling inhibitors, SHH signaling activators, FGF, platelet-derived growth factor PDGF, PDGFR-α, HGF, IGF-1, noggin. Hog (SHH), dorsomorphin, noggin and any combination thereof. In some cases, the BMP signaling inhibitor is LDN193189, SB431542 or a combination thereof.

[0266] In some embodiments, glial cells are determined to express known glial cell biomarkers. Useful methods for generating glial cells, their precursors and progenitors from stem cells can be found in, for example, US7,579,188; US7,595,194; US8,263,402; US8,206,699; US8,252,586; US9,193,951; US9,862,925; US8,227,247; US9,709,553; US2018 / 0187148; US2017 / 0198255; US2017 / 0183627; US2017 / 0182097; US2017 / 253856; US2018 / 0236004; WO2017 / 172976; and WO2018 / 093681.

[0267] In some embodiments, differentiation of pluripotent stem cells is performed by exposing or contacting the cells with specific factors known to give rise to specific cell lineages in order to target their differentiation to a specific, desired lineage and / or cell type.

[0268] In some embodiments, terminally differentiated cells show special phenotypic properties or characteristics.In certain embodiments, stem cell differentiation as herein described becomes neuroectoderm, neuron, neuroendocrine, dopaminergic, cholinergic, serotonergic (5-HT), glutamatergic, GABAergic, adrenergic, noradrenergic, sympathetic neuron, parasympathetic neuron, sympathetic peripheral neuron or neuroglial cell group.In some cases, neuroglial cell colony includes microglial cell colony or macroglial cell (central nervous system cell: astrocyte, oligodendrocyte, ependymal cell and radial glial cell; With peripheral nervous system cell: Schwann cell and satellite cell) cell colony, or the precursor and progenitor cell of any aforementioned cell.

[0269] Protocols for generating different types of neural cells are described in PCT Application No. WO2010144696, U.S. Patent Nos. 9,057,053; 9,376,664; and 10,233,422. Additional descriptions of methods for differentiating low immunogenic pluripotent cells can be found, for example, in Deuse et al., Nature Biotechnology, 2019, 37, 252-258 and Han et al., Proc Natl Acad Sci USA, 2019, 116(21), 10441-10446. Methods for determining the effects of neural cell transplantation in animal models of neurological diseases or disorders are described in the following references: for spinal cord injury - Curtis et al., Cell Stem Cell, 2018, 22, 941-950; for Parkinson's disease - Kikuchi et al., Nature, 2017, 548:592-596; for ALS - Izrael et al., Stem Cell Research, 2018, 9(1):152 and Izrael et al., IntechOpen, DOI:10.5772 / intechopen.72862; for epilepsy - Upadhya et al., PNAS, 2019, 116(l):287-296 The efficacy of neural cell transplantation for spinal cord injury can be evaluated, for example, in rat models of acute spinal cord injury, such as McDonald et al., Nat. Med., 1999, 5:1410) and Kim et al., Nature, 2002, 418:50. For example, a successful transplant may show that after 2-5 weeks, there are transplanted cells at the lesion, which differentiate into astrocytes, oligodendrocytes and / or neurons and migrate along the spinal cord from the lesion end, and gait, coordination and weight-bearing are improved. A specific animal model is selected according to the type of neural cells and the neurological disease or condition to be treated. The neural cells can be administered in a manner that allows them to be transplanted to the intended tissue site and to rebuild or regenerate the functional defect area. For example, depending on the disease being treated, the neural cells can be directly transplanted into the substance or intrathecal position of the central nervous system. In some embodiments, any neural cell described herein, including brain endothelial cells, neurons, dopaminergic neurons, ependymal cells, astrocytes, microglia, oligodendrocytes and Schwann cells, is injected into the patient's body by intravenous, intraspinal, intraventricular, intrathecal, intraarterial, intramuscular, intraperitoneal, subcutaneous, intramuscular, intraperitoneal, intraocular, retrobulbar and combinations thereof. In some embodiments, the cells are injected or deposited in the form of a bolus or continuous infusion. In certain embodiments, the neural cells are administered by injection into the brain, near the brain, or a combination thereof. For example, the injection can be performed through a burr hole made in the skull of the subject.Suitable sites for administering neural cells to the brain include, but are not limited to, the cerebral ventricles, lateral ventricles, cerebellar cisternae, putamen, basal ganglia, hippocampal cortex, striatum, caudate region of the brain, and combinations thereof.

[0270] Additional description of neural cells including dopaminergic neurons for use in the present invention can be found in WO2020 / 018615, the disclosure of which is incorporated herein by reference in its entirety.

[0271] 3. Endothelial Cell Differentiation from Pluripotent Stem Cells

[0272] The present invention provides pluripotent stem cells that can be differentiated into various endothelial cell types for subsequent transplantation or implantation into a subject (e.g., a recipient). As will be appreciated by those skilled in the art, the method of differentiation depends on the desired cell type using known techniques. Exemplary endothelial cell types include, but are not limited to, capillary endothelial cells, vascular endothelial cells, aortic endothelial cells, arterial endothelial cells, venous endothelial cells, kidney endothelial cells, brain endothelial cells, and liver endothelial cells.

[0273] In some embodiments, the endothelial cells described herein are administered to a recipient subject to treat a vascular disorder selected from the group consisting of vascular injury, cardiovascular disease, vascular disease, peripheral vascular disease, ischemic disease, myocardial infarction, congestive heart failure, peripheral vascular occlusive disease, hypertension, ischemic tissue damage, reperfusion injury, limb ischemia, stroke, neuropathy (e.g., peripheral neuropathy or diabetic neuropathy), organ failure (e.g., liver failure, renal failure), diabetes, rheumatoid arthritis, osteoporosis, cerebrovascular disease, hypertension, angina and myocardial infarction due to coronary heart disease, renovascular hypertension, renal failure due to renal artery stenosis, leg claudication, other vascular conditions or diseases.

[0274] In some embodiments, low immunogenic pluripotent cells are differentiated into endothelial colony forming cells (ECFCs) to form new blood vessels to solve peripheral arterial disease. The technology of differentiating endothelial cells is known. See, for example, Prasain et al., doi:10.1038 / nbt.3048, the entire contents of which are incorporated herein by reference, and are particularly directed to methods and reagents for producing endothelial cells from human pluripotent stem cells, and also to transplantation techniques. Differentiation can be determined as known in the art, typically by assessing the presence of endothelial cell-related markers or specific markers or by functional measurements.

[0275] In some embodiments, the method of generating a low immunogenic endothelial cell population from a low immunogenic pluripotent cell population by in vitro differentiation comprises: (a) culturing the HIP cell population in a first culture medium comprising a GSK inhibitor; (b) culturing the HIP cell population in a second culture medium comprising VEGF and bFGF to generate a pre-endothelial cell population; and (c) culturing the pre-endothelial cell population in a third culture medium comprising a ROCK inhibitor and an ALK inhibitor to generate a low immunogenic endothelial cell population.

[0276] In some embodiments, the GSK inhibitor is CHIR-99021, a derivative thereof, or a variant thereof. In some cases, the concentration range of the GSK inhibitor is about 1 mM to about 10 mM. In some embodiments, the ROCK inhibitor is Y-27632, a derivative thereof, or a variant thereof. In some cases, the concentration range of the ROCK inhibitor is about 1 pM to about 20 pM. In some embodiments, the ALK inhibitor is SB-431542, a derivative thereof, or a variant thereof. In some cases, the concentration range of the ALK inhibitor is about 0.5 pM to about 10 pM.

[0277] In some embodiments, the first culture medium comprises 2 pM to about 10 pM CHIR-99021. In some embodiments, the second culture medium comprises 50 ng / mL VEGF and 10 ng / mL bFGF. In other embodiments, the second culture medium further comprises Y-27632 and SB-431542. In various embodiments, the third culture medium comprises 10 pM Y-27632 and 1 pM SB-431542. In certain embodiments, the third culture medium further comprises VEGF and bFGF. In certain instances, the first culture medium and / or the second culture medium does not contain insulin.

[0278] In some embodiments, the low immunogenic endothelial cell population is isolated from non-endothelial cells. In some embodiments, the isolated low immunogenic endothelial cell population is expanded prior to administration. In certain embodiments, the isolated low immunogenic endothelial cell population is expanded and cryopreserved prior to administration.

[0279] Additional description of endothelial cells for use in the present invention can be found in WO2020 / 018615, the disclosure of which is incorporated herein by reference in its entirety.

[0280] 4. Thyroid cells differentiate from pluripotent stem cells

[0281] In some embodiments, pluripotent stem cells can be differentiated into thyroid progenitor cells and thyroid follicular organoids, which can secrete thyroid hormone to address autoimmune thyroiditis. Techniques for differentiating thyroid cells are known in the art. See, for example, Kurmann et al., Cell Stem Cell, November 5, 2015; 17(5):527-42, the entire contents of which are incorporated herein by reference, and are particularly directed to methods and reagents for generating thyroid cells from human pluripotent stem cells and transplantation techniques. Differentiation can be determined as known in the art, typically by assessing the presence of thyroid cell-related or specific markers or by functional measurements.

[0282] 5. Differentiation of pluripotent stem cells into hepatocytes

[0283] In some embodiments, pluripotent stem cells can be differentiated into hepatocytes to address hepatocyte function loss or cirrhosis. There are a variety of techniques available for differentiating HIP cells into hepatocytes; see, for example, Pettinato et al., doi:10.1038 / spre32888, Snykers et al., Methods Mol Biol 698:305-314 (2011), Si-Tayeb et al., Hepatology 51:297-305 (2010) and Asgari et al., Stem Cell Rev (:493-504 (2013), all of which are incorporated herein by reference in their entirety and are particularly directed to methods and reagents for differentiation. As known in the art, differentiation is typically determined by evaluating the presence of hepatocyte-related and / or specific markers, including but not limited to albumin, alpha-fetoprotein, and fibrinogen. Differentiation can also be functionally measured, such as ammonia metabolism, LDL storage and uptake, ICG uptake and release, and glycogen storage.

[0284] 6. Pancreatic islet cells differentiated from pluripotent stem cells

[0285] The present invention provides pluripotent stem cells that can be differentiated into various islet cell types for subsequent transplantation or implantation into a subject (e.g., a recipient). As will be appreciated by those skilled in the art, differentiation methods depend on the desired cell type using known techniques. Exemplary islet cell types include, but are not limited to, islet progenitor cells, immature islet cells, and mature islet cells. In some embodiments, the pancreatic cells described herein are administered to a subject to treat diabetes.

[0286] In some embodiments, the islet cells are derived from the hypoimmunogenic pluripotent cells described herein.Useful methods for differentiating pluripotent stem cells into islet cells are described, for example, in US 9,683,215; US 9,157,062; and US 8,927,280.

[0287] In some embodiments, low immunogenic pluripotent cells are differentiated into beta-like cells or pancreatic islet organoids for transplantation to address type 1 diabetes (T1DM). Cell systems are a promising approach to address T1DM, see Ellis et al. Nat Rev Gastroenterol Hepatol. 2017 Oct; 14(10): 612-628, incorporated herein by reference. In addition, Pagbuca et al. (Cell, 2014, 159(2): 428-39) reported the successful differentiation of b cells from hiPSC, the contents of which are incorporated herein by reference in their entirety, particularly the methods and reagents outlined therein for large-scale production of functional human b cells from human pluripotent stem cells). In addition, Vegas et al. generated human B cells from human pluripotent stem cells and then encapsulated to avoid host immune rejection; Vegas et al., Nat Med, 2016, 22(3):306-11, the entire contents of which are incorporated herein by reference, particularly the methods and reagents outlined therein for large-scale production of functional human B cells from human pluripotent stem cells.

[0288] In some embodiments, the method of producing a low immunogenic islet cell population from a low immunogenic pluripotent cell population by in vitro differentiation comprises: (a) culturing a HIP cell population in a first culture medium comprising one or more factors selected from insulin-like growth factor (IGF), transforming growth factor (TGF), fibroblast growth factor (EGF), epidermal growth factor (EGF), hepatocyte growth factor (HGF), sonic hedgehog (SHH) and vascular endothelial growth factor (VEGF), transforming growth factor-b (TORb) superfamily, bone morphogenetic protein-2 (BMP2), bone morphogenetic protein-7 (BMP7), GSK inhibitors, ALK inhibitors, BMP type 1 receptor inhibitors and retinoic acid to produce an immature islet cell population; (b) culturing the immature islet cell population in a second culture medium different from the first culture medium to produce a low immune islet cell population. In some embodiments, the GSK inhibitor is CHIR-99021, a derivative thereof, or a variant thereof. In some cases, the concentration of the GSK inhibitor ranges from about 2 mM to about 10 mM. In some embodiments, the ALK inhibitor is SB-431542, a derivative thereof, or a variant thereof. In some cases, the concentration of the ALK inhibitor ranges from about 1 pM to about 10 pM. In some embodiments, the first culture medium and / or the second culture medium does not contain animal serum.

[0289] In some embodiments, the low immunogenic islet cell population is isolated from non-islet cells. In some embodiments, the isolated low immunogenic islet cell population is expanded prior to administration. In certain embodiments, the isolated population of low immunogenic islet cells is expanded and cryopreserved prior to administration.

[0290] As known in the art, differentiation is typically determined by assessing the presence of b cell-related or specific markers (including but not limited to insulin). Differentiation can also be measured functionally, such as measuring glucose metabolism, generally referring to Muraro et al., Cell Syst. October 26, 2016; 3 (4): 385-394.e3, which is hereby incorporated by reference in its entirety, and particularly for the biomarkers outlined therein. Once beta cells are produced, they can be transplanted (either as a cell suspension or in a gel matrix discussed herein) into the portal vein / liver, omentum, gastrointestinal mucosa, bone marrow, muscle or subcutaneous sac.

[0291] Additional description of pancreatic islet cells comprising dopaminergic neurons for use in the present invention can be found in WO2020 / 018615, the disclosure of which is incorporated herein by reference in its entirety.

[0292] 7. Retinal pigment epithelial (RPE) cells differentiated from pluripotent stem cells

[0293] The invention provides low immunogenicity pluripotent cells, which can be divided into various RPE cell types, for subsequently transplanting or being implanted in a subject (for example, a recipient). As will be appreciated by those skilled in the art, differentiation method depends on the required cell type using known technology. Exemplary RPE cell types include but are not limited to retinal pigment epithelium (RPE) cells, RPE progenitor cells, immature RPE cells, mature RPE cells, functional RPE cells.

[0294] Useful methods for differentiating pluripotent stem cells into RPE cells are described in, for example, US9,458,428 and US9,850,463, and these disclosures are incorporated herein by reference in their entirety, including description. Other methods for producing RPE cells from human induced pluripotent stem cells can be found in, for example, Lamba et al., PNAS, 2006, 103(34): 12769-12774; Melough et al., stem cell, 2012, 30(4): 673-686; Idelson et al., cell stem cell, 2009, 5(4): 396-408; Rowland et al., Journal of Cellular Physiology, 2012, 227(2): 457-466, Buchholz et al., Stem Cells Trans Med, 2013, 2(5): 384-393, da Cruz et al., Nat Biotech, 2018, 36: 328-337.

[0295] In some embodiments, the RPE cells described herein are administered to a subject to treat an ocular condition selected from wet macular degeneration, dry macular degeneration, juvenile macular degeneration (e.g., Stargardt's disease, Best disease, and juvenile retinoschisis), Leber's congenital melanoderma, retinitis pigmentosa, retinal detachment, age-related macular degeneration (AMD), early AMD, intermediate AMD, late AMD, non-neovascular age-related macular degeneration.

[0296] Human pluripotent stem cells have been used by Kamao et al., Stem Cell Reports 2014:2: The technology outlined in 205-18 is differentiated into RPE cells, and the document is incorporated herein by reference in its entirety, particularly the method and reagent for differentiation techniques and reagent outlined therein; Also referring to Mandai et al., N Engl J Med, 2017,376:1038-1046, its entirety is incorporated herein to understand the technology for generating RPE cell sheets and being transplanted into patients. Differentiation can be measured as known in the art, typically by assessing the presence of RPE-related and / or specific markers or by functional measurement. Referring to, for example, Kamao et al., Stem Cell Reports, 2014,2 (2): 205-18, its content is incorporated herein by reference in its entirety, and particularly for the mark outlined in the first paragraph of results section.

[0297] In some embodiments, the method for producing low immunogenicity retinal pigment epithelium (RPE) cell group from low immunogenicity multipotent cell group by in vitro differentiation includes: (a) cultivating low immunogenicity multipotent cell group in the first culture medium, wherein the first culture medium includes and is selected from activin A, bFGF, BMP4 / 7, DKK1, IGF1, noggin, BMP inhibitor, ALK inhibitor, ROCK inhibitor and VEGFR inhibitor can produce front RPE cell group; (b) cultivating front RPE cell group in the second culture medium different from the first culture medium, to produce low immunogenicity RPE cell group. In some embodiments, ALK inhibitor is SB-431542, its derivative or its variant. In some cases, the concentration range of ALK inhibitor is about 2mM to about 10mM. In some embodiments, ROCK inhibitor is Y-27632, its derivative or its variant. In some cases, the concentration range of ROCK inhibitor is about 1pM to about 10pM. In some embodiments, the first culture medium and / or the second culture medium do not contain animal serum.

[0298] Differentiation can be determined as known in the art, typically by assessing the presence of RPE-related and / or specific markers or by functional measurement.See, for example, Kamao et al., Stem Cell Reports, 2014, 2(2):205-18, the contents of which are incorporated herein by reference in their entirety, and in particular for the Results section.

[0299] Additional description of RPE cells for use in the present invention can be found in WO2020 / 018615, the disclosure of which is incorporated herein by reference in its entirety.

[0300] 8. NK cells differentiated from pluripotent stem cells

[0301] The present invention provides low immunogenic pluripotent cells that can differentiate into natural killer (NK) cells. In some embodiments, a method for generating a natural killer (NK) cell population from a low immunogenic pluripotent cell population by in vitro differentiation comprises: (a) culturing the stem cell population in a first culture medium containing a ROCK inhibitor under conditions sufficient to form aggregates; (b) culturing the aggregates in a second culture medium containing BMP-4; (c) culturing the aggregates in a third culture medium containing BMP-4, FGF2, a WNT pathway activator, and activin A; (d) culturing the aggregates in a third culture medium containing FGF2, VEGF, TPO, SCF, IL-3, FLT3L, WNTC-5, and activin A. (e) culturing the cell population in a fifth culture medium comprising FGF2, VEGF, TPO, SCF, IL-3, and FLT3L; (f) culturing the cell population in a sixth culture medium comprising IL-3, IL-7, FLT3L, IL-15, and SCF; and (g) culturing the cell population in a seventh culture medium comprising IL-7, FLT3L, IL-15, and SCF for a time sufficient to generate NK cells.

[0302] In some embodiments, the first culture medium comprises 10 μM ROCK inhibitor. In some embodiments, the second culture medium comprises 30 ng / mL BMP-4. In some embodiments, the second culture medium comprises 30 ng / mL BMP-4 and 10 μM ROCK inhibitor. In some embodiments, the third culture medium comprises 30 ng / mL BMP-4, 100 ng / mL FGF2, 6 μM CHIR-99021, and 2.5-5 ng / mL Activin A. In some embodiments, the third culture medium comprises 30 ng / mL BMP-4, 100 ng / mL FGF2, 7 μM CHIR-99021, and 2.5-5 ng / mL Activin A. In some embodiments, the fourth and fifth culture media comprise 20 ng / mL FGF, 20 ng / mL VEGF, 20 ng / mL TPO, 100 ng / mL SCF, 40 ng / mL IL-3, and 10-20 ng / mL FLT3L. In some embodiments, the fourth culture medium further comprises 2 μM WNT C-59 and 5 μM SB-431542. In some embodiments, the fourth culture medium further comprises 5 μM SB-431542. In some embodiments, the fourth culture medium does not include WNT C-59. In some embodiments, the sixth and seventh culture media comprise 20 ng / mL IL-7, 10-20 ng / mL FLT3L, 10-20 ng / mL IL-15, and 20 ng / mL SCF. In some embodiments, the sixth culture medium comprises 5 ng / mL IL-3. In some embodiments, the eighth culture medium comprises IL-7, FLT3L, IL-15, SCF, and nicotinamide.

[0303] Additional description of NK cells for use in the present invention can be found in US20220169700A1, the disclosure of which is incorporated herein by reference in its entirety.

[0304] For therapeutic applications, cells prepared according to the disclosed methods can generally be provided in the form of a pharmaceutical composition comprising an isotonic excipient and prepared under sufficiently sterile conditions for human administration. For general principles of pharmaceutical formulations of cell compositions, see "Cell Therapy: Stem Cell Transplantation, Gene Therapy, and Cellular Immunotherapy," edited by Morstyn & Sheridan, Cambridge University Press, 1996; and "Hematopoietic Stem Cell Therapy," E.D. Ball, J. Lister & P. ​​Law, Churchill Livingstone, 2000. The cells can be packaged in a device or container suitable for distribution or clinical use. Beneficial effects

[0305] The pluripotent stem cells of the present invention and the low-immunogenic pluripotent stem cells prepared by the method of the present invention can exhibit excellent effects, such as but not limited to: (1) having good self-renewal and differentiation abilities; (2) being able to escape ADCC killing; (3) being able to escape NK cell killing; (4) being able to escape PBMC cell killing; (5) being able to escape MAC cell killing; and / or (6) the differentiated cells can also escape killing by NK cells, T cells, MAC cells or ADCC; thereby showing excellent application potential.

[0306] Example

[0307] The present invention is further described with reference to the following examples. It should be understood that these examples are intended to be illustrative only and are not intended to limit the present invention. The following materials and instruments are commercially available or prepared according to methods known in the art. The following experiments were performed according to the manufacturer's instructions or according to methods and procedures known in the art.

[0308] The experimental methods in the following examples where specific conditions are not specified were generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer.

[0309] Unless defined otherwise or clearly indicated by the context, all technical and scientific terms in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0310] Example 1. Construction of B2M and CIITA double knockout cell line (DKO)

[0311] 1.1 Construction of B2M and CIITA double knockout cell line (DKO)

[0312] In the following examples, human induced pluripotent stem cells (iPSCs) were used to construct target cell lines. The human induced pluripotent stem cells (iPSCs) used were generated using CTS TM CytoTune TM -iPS2.1 Sendai virus reprogramming kit (CTS TM CytoTune TM iPS2.1 (Sendai Reprogramming Kit, Catalog No. A34546) is prepared from human peripheral blood cells. Alternatively, target cell lines can be constructed using the human pluripotent stem cell lines H1 (Wicell, WA01) or H9 (Wicell, WA09) (also known as hESCs). The cell culture and gene knockout reagents used are listed in Table 1.

[0313] Table 1. Cell culture and gene knockout reagents

[0314] CRISPR / CAS9 was used to knock out β-2-microglobulin (B2M) in the endoplasmic reticulum, preventing the formation of functional MHC-I molecules on the cell surface, thereby escaping allogeneic CD8 + Killing of T cells; killing of escaping CD4+ T cells is achieved by knocking out CIITA, a positive regulator of MHC-II gene transcription, thereby reducing the expression of MHC-II molecules. In this disclosure, double knockout pluripotent stem cells (DKO) of the H1 cell line are also referred to as DKO cells or H1 cell-derived DKO cells, and double knockout pluripotent stem cells (DKO) of the iPSC cell line are referred to as iPSC-DKO cells or iPSC-derived DKO cells.

[0315] The CRISPR / CAS9 gene knockout strategy for B2M, as well as the gRNA sequences and identification primers used, are shown in Figure 1 and Table 2. B2M-gRNA1 and B2M-gRNA2 (EasyEdit sgRNA, GenScript) were used to directly knockout the B2M exon segment at both ends. The knockout of the genomic sequence was then verified using two pairs of PCR primers, B2M-F1 / R1 and B2M-F2 / R2, respectively. Figure 1A shows the knockout strategy for the B2M gene in the B2M and CIITA double knockout cell lines (DKO), Figure 1B shows the results of B2M gene knockout verification in the H1 cell line by PCR, and Figure 1C shows the results of B2M gene knockout verification in the iPSC cell line by PCR.

[0316] In addition, the CRISPR / CAS9 gene knockout strategy for CIITA, as well as the gRNA sequences and identification primers used, are shown in Figure 2 and Table 2. CIITA-gRNA1 and CIITA-gRNA2 (EasyEdit sgRNA, GenScript) were used to directly knockout the CIITA exon segment at both ends. Then, two pairs of PCR primers, CIITA-F1 / R1 and CIITA-F2 / R2, were used to verify the genomic sequence knockout. Figure 2A shows the knockout strategy for the CIITA gene in B2M and CIITA double knockout cell lines (DKO), Figure 2B shows the results of CIITA gene knockout verification in the H1 cell line by PCR, and Figure 2C shows the results of CIITA gene knockout verification in the iPSC cell line by PCR.

[0317] Table 2. gRNA sequences and identification primers

[0318] The specific operations are as follows:

[0319] 1) Culture human induced pluripotent stem cells in mTeSR1 medium supplemented with Y-27632 on a Matrigel-coated 6-well plate to 80% density. Digest with TrypLE, neutralize with DMEM / F12, and count. 6 Place cells in EP tubes and discard the supernatant after centrifugation.

[0320] 2) According to the Neon transfection system (ThermoFisher), 100 μL electroporation system was added with 15 μg TrueCut TM Cas9 Protein + 3μg RNA (B2M-gRNA1 + B2M-gRNA2 + CIITA-gRNA1 + CIITA-gRNA2) constitute a ribonucleoprotein complex (RNP) system, which is mixed and placed at room temperature for 20 minutes.

[0321] 3) Resuspend the cells in 100 μL of RNP electroporation system and electroporate using the Neon transfection system at 1200 V, 30 ms, and 1 pause. Quickly add preheated culture medium to the electroporated cells and plate evenly in one well of a Matrigel-coated 6-well plate.

[0322] 4) Replace the culture medium with fresh mTeSR1 daily. Once single cells have grown, isolate individual clones in a 48-well plate. After clonal expansion, collect genomic samples for PCR analysis to verify gene editing. PCR results are shown in Figures 1 and 2. PCR-positive clones are sent to the company for further verification by Sanger sequencing.

[0323] 5) Expand, culture, and freeze the positive B2M / CIITA biallelic knockout (DKO) clones.

[0324] 1.2 Detection of RNA expression levels of B2M and CIITA in DKO

[0325] Total RNA was extracted from H1 cells and derived DKO cells using FastPure Cell / Tissue Total RNA Isolation Kit V2 (Novagen, RC112-01), and then converted to cDNA using HiScript III RT SuperMix for qPCR (Novagen, R323-01) according to the manufacturer's instructions.

[0326] qPCR was used to detect the expression of B2M and CIITA at the RNA level in DKO cells derived from H1 cells with biallelic knockout of B2M / CIITA. The primers used are shown below.

[0327] B2M-F(SEQ ID NO:19):AAGATGAGTATGCCTGCCGT

[0328] B2M-R(SEQ ID NO:20):ATGCGGCATCTTCAAACCTC

[0329] CIITA-F (SEQ ID NO:21): CCTGGAGCTTCTTAACAGCGA

[0330] CIITA-R (SEQ ID NO:22): TGTGTCGGGTTCTGAGTAGAG

[0331] Using the Roche 480II instrument, the reaction system is as follows:

[0332] Pre-incubation, 95℃, 30s.

[0333] Amplification, 95°C for 10 s, 60°C for 30 s, 40 cycles.

[0334] Melting curve and Cooling are the default programs.

[0335] The qPCR results are shown in Figure 3. Compared with untreated wild-type human pluripotent stem cells, the expression of B2M and CIITA at the RNA level in the B2M / CIITA biallelic knockout clones (DKO) was almost absent, confirming the successful knockout of B2M and CIITA.

[0336] 1.3 Detection of B2M protein expression in DKO

[0337] Western blotting was used to detect the expression of B2M protein levels in DKO cells derived from B2M / CIITA biallelic knockout clone H1 cells (B2M antibody catalog number is ab75853; internal control antibody GAPDH catalog number is ab181602, both purchased from Abcam).

[0338] As shown in Figure 4 , the Western blot results show that compared with wild-type human pluripotent stem cells, the B2M protein in H1 cell-derived DKO was significantly decreased, confirming that the B2M protein was successfully knocked out.

[0339] 1.4 Detection of HLA-I / II molecules in DKO

[0340] IFN-γ (PeproTech, Cat#300-02) was used to stimulate WT and DKO cells to detect HLA class I / II molecules on the surface of H1 cells (WT) and iPSC (iPSC-WT) cell lines, as well as their corresponding derived DKO cells (DKO cells and iPSC-DKO cells). The specific detection method is as follows:

[0341] The cells were plated and culture medium containing IFN-γ was added to the cells when the medium was changed on the next day. After 48 hours, the cells were digested and the expression of HLA-I / II was detected using a flow cytometer (Agilent Technologies, NovoCyte).

[0342] The flow cytometry results are shown in Figure 5 , where Figure 5A shows the results for H1 cells and DKO cells, and Figure 5B shows the results for iPSC cells and iPSC-DKO cells. In all figures, HLA-ABC is used on the left side to detect HLA-I molecules; HLA-DR, DQ, and DP are used on the right side to detect HLA-II molecules; T cells serve as a positive control for the assay. It was observed that DKO cells (both DKO and iPSC-DKO cells) derived from cloned H1 and iPSC-derived cell lines with biallelic knockout of B2M / CIITA failed to express HLA-I / II molecules in response to IFN-γ stimulation, demonstrating reduced HLA-I and HLA-II function in DKO and iPSC-DKO cells.

[0343] 1.5 Karyotyping of DKO

[0344] Karyotype detection was performed on the obtained B2M / CIITA biallelic knockout H1 cell positive clones (DKO). The specific detection method is as follows:

[0345] Chromosome specimens fixed on glass slides are treated with trypsin and then stained with Giemsa stain. Metaphase chromosomes are analyzed for number and morphology based on characteristics such as chromosome length, centromere position, ratio of long and short arms, and the presence of satellites to determine whether their karyotype is consistent with a normal karyotype.

[0346] The results of karyotype detection are shown in Figure 6 . The karyotype of DKO cells derived from H1 cells was normal, with no significant changes compared with the normal karyotype.

[0347] Example 2. Stemness and immune function of DKO cell lines

[0348] This example further examines whether the stemness and immune function of pluripotent stem cells change after knocking out both B2M / CIITA alleles.

[0349] 2.1 Expression of stemness genes in DKO cells

[0350] Immunofluorescence was used to detect the protein levels of stemness genes in WT cells (WT cells and iPSC-WT cells) and derived DKO cells (DKO cells and iPSC-DKO cells) of iPSC and H1 cell lines. RT-qPCR was used to detect the expression of stemness genes at the RNA level in H1 cells (WT cells) and derived DKO cells (DKO cells). Flow cytometry was used to detect the expression of corresponding proteins of stemness genes on the surface of H1 cells (WT cells) and iPSC-WT cells and DKO cells (DKO cells and iPSC-DKO cells). The specific detection methods are as follows:

[0351] Immunofluorescence assay: WT or DKO cells were plated in 12-well plates. After cells reached 60-80% confluence, the medium was aspirated and fixed with 4% paraformaldehyde. After permeabilization, cells were incubated with primary antibodies against POU5F1, NANOG, and other stemness-related gene proteins at 4°C overnight. After washing away the primary antibodies, fluorescently labeled secondary antibodies were incubated at room temperature. Images were then taken using a fluorescence microscope (Nikon Ts2R-FL).

[0352] RT-qPCR detection:

[0353] Using the Roche 480II instrument, the reaction system is as follows:

[0354] Pre-incubation, 95℃, 30s.

[0355] Amplification, 95°C for 10 s, 60°C for 30 s, 40 cycles.

[0356] Melting curve and Cooling are the default programs.

[0357] Mesenchymal stem cells (MSCs) served as a negative control for stemness gene expression.

[0358] Flow cytometry:

[0359] After harvesting the cells, incubate the antibodies in an EP tube at 4°C in the dark for 30 minutes. Then, select the appropriate fluorescence acquisition channel based on the antibody information and monitor the fluorescence on a fluorescence microscope. All antibodies were from BD Biosciences.

[0360] The results of immunofluorescence detection are shown in Figure 7A. Both H1 cell WT and H1 cell-derived DKO cells express the stemness genes POU5F1 and NANOG at the protein level, and there is no significant difference in the expression of stemness genes POU5F1 and NANOG in H1 cell-derived DKO cells compared with WT cells. The results of RT-qPCR detection are shown in Figure 7B. H1 cell WT and H1 cell-derived DKO cells express the stemness genes POU5F1, NANOG and SOX2 at the RNA level, and there is no significant difference in the expression of stemness genes POU5F1, NANOG and SOX2 in H1 cell-derived DKO cells compared with H1 cell WT cells. The results of flow cytometry detection are shown in Figure 7C. Both H1 cell WT and H1 cell-derived DKO cells highly express the stemness gene corresponding proteins SSEA-4 (WT 100% and DKO 99.98%) and Tra1-81 (WT 96.75% and DKO 96.75%) on their cell surfaces. 99.13%), Figure 7D shows the results of flow cytometry detection of the expression of stemness genes SSEA-4, TRA-1-60, TRA-1-81, OCT-4, and SOX2 on the surface of iPSC-WT and iPSC-DKO cells. Both iPSC-cell WT and iPSC-derived DKO cells highly expressed the corresponding proteins of stemness genes on their surfaces. Figure 7E shows the results of immunofluorescence detection of the protein levels of stemness genes TRA-1-60, TRA-1-81, OCT-4, SOX2, and NANOG in iPSC-WT cells. The corresponding proteins of stemness genes were highly expressed on the surface of iPSC-WT. Figure 7F shows the results of immunofluorescence detection of the protein levels of stemness genes TRA-1-60, TRA-1-81, OCT-4, SOX2, and NANOG in iPSC-DKO cells. The corresponding proteins of stemness genes were highly expressed on the surface of iPSC-derived DKO cells.

[0361] 2.2 Differentiation capacity of DKO cells

[0362] In this example, the differentiation ability of DKO cells was detected. The specific detection method was as follows: 100 μL containing 5×10 5 DKO cell suspension was prepared and the teratoma volume was larger than 1.5 cm 3 The tissues were then removed, sectioned into paraffin and stained with hematoxylin and eosin.

[0363] The staining results showed that DKO cells derived from H1 cells with B2M / CIITA biallelic knockout could form teratomas in vivo and differentiate into cells of the inner, middle and outer germ layers. DKO cells derived from H1 cells had normal differentiation ability of the three germ layers.

[0364] 2.3 Immune function of DKO cells

[0365] T cell and NK cell cytotoxicity assays were performed using the xCELLigence RTCA Instrument to examine changes in immune function in H1 cells, iPSCs, and derived DKO cells. Reagents used in these cytotoxicity assays are listed in Table 3.

[0366] The specific assay method is as follows: Equal amounts of WT and DKO cell lines were resuspended in Essential 8 medium containing human IL-2 and seeded onto 96-well Matrigel-coated E-plates. Activated T cells (XC11228, purchased from SAILYBIO) or NK cells (XC11013, purchased from SAILYBIO) were added for cell killing assays. T cells were assayed for CD3, CD4, and CD8 by flow cytometry, while NK cells were assayed for CD16 and CD56 by flow cytometry before use to ensure the function of the T and NK cells used. RTCA assay data were analyzed using xCELLigence software to calculate cell killing rate and escape function.

[0367] Table 3. Reagents used in the killing experiment

[0368] The RTCA results are shown in Figure 8. WT cells escape NK cell killing due to the expression of HLA-I, but are killed by T cells. DKO cells can escape T cell killing and are more sensitive to NK cell killing. The top three figures in Figure 8A are the results of RTCA detection of the killing rate of NK cells on H1 cells WT and H1 cell-derived DKO cells, that is, the results of the detection of the immune escape function of H1 cells WT and H1 cell-derived DKO cells against NK cells; the second three figures in Figure 8A are the results of RTCA detection of the killing rate of T cells on H1 cells WT and H1 cell-derived DKO cells, that is, the results of the detection of the immune escape function of WT cells and H1 cell-derived DKO cells against T cells. The top three figures in Figure 8B are the results of RTCA detection of the killing rate of NK cells against iPSC-WT and iPSC-DKO cells, that is, the detection results of the immune escape function of iPSC-WT and iPSC-DKO cells against NK cells; the second three figures in Figure 8B are the results of RTCA detection of the killing rate of T cells against iPSC-WT and iPSC-DKO cells, that is, the detection results of the immune escape function of iPSC-WT and iPSC-DKO cells against T cells.

[0369] Example 3. Construction of DKO+CD47 cell line and verification of immune function

[0370] 3.1 Construction of H1 cell DKO+CD47 cell line

[0371] In this example, a lentiviral vector was used to overexpress CD47 (NM_198793) in the DKO cells obtained in Example 1. The amino acid sequence of CD47 is shown in SEQ ID NO: 5.

[0372] The nucleic acid sequence encoding the CD47 protein (SEQ ID NO: 6) was constructed into a lentiviral vector (pGC-EF1a) driven by EF1a and carrying a puromycin selection marker. The structure of the pGC-EF1a vector is shown in Figure 9. The specific operation method is as follows:

[0373] The lentiviral vector was digested with BamHI / NheI, and the nucleic acid sequence encoding the CD47 protein (SEQ ID NO: 6) was ligated into the lentiviral vector. Sanger sequencing was used to verify the correctness of the inserted sequence, and viral packaging was performed. The lentiviral vector was transfected into the DKO cells constructed in Example 1. After 24 hours, the medium was changed, and after 48 hours, the medium was changed to puromycin-containing medium for selection.

[0374] The constructed stably transfected cell line DKO+CD47 was subjected to flow cytometry (CD47 antibody purchased from FACS: Biolegend, catalog number: 323108) and qPCR detection. The qPCR primers are:

[0375] CD47-F (SEQ ID NO:26): AGAAGGTGAAACGATCATCGAGC;

[0376] CD47-R (SEQ ID NO:27): CTCATCCATACCACCGGATCT.

[0377] The test results are shown in Figure 10, A and B. The expression level of CD47 in the constructed DKO+CD47 cell line was significantly higher than that in WT cells. The validated DKO+CD47 cell line was then expanded and subsequently functionally tested.

[0378] 3.2 Verification of the immune function of DKO+CD47

[0379] RTCA was used to detect whether the overexpressed DKO+CD47 cell line could successfully escape the killing of NK cells while escaping T cell killing. For the specific detection method, see Example 2.3.

[0380] RTCA assay is shown in Figure 11 , showing that NK cells can effectively kill DKO cells, whereas WT and DKO+CD47-overexpressing cells can escape NK killing.

[0381] Example 4. Construction of DKO+MCL1 cell line and detection of stemness and differentiation ability

[0382] 4.1 Construction of iPSC-DKO+MCL1 cell line and overexpression detection

[0383] The nucleic acid sequence encoding the MCL1 protein (the amino acid sequence of the MCL1 protein is shown in SEQ ID NO: 3) was directly synthesized.

[0384] MCL1 amino acid sequence (SEQ ID NO: 3):

[0385] MCL1 nucleic acid sequence (SEQ ID NO: 25):

[0386] As described in Example 3.1, the nucleic acid sequence encoding the MCL1 protein was constructed into a lentiviral vector (pGC-EF1a) driven by EF1a and carrying a puromycin selection marker. The structure of the pGC-EF1a vector is shown in Figure 9. The specific operation is as follows: the vector is digested with BamHI / NheI, and the synthesized MCL1 nucleic acid sequence is ligated into the lentiviral vector. After successful ligation, Sanger sequencing is used to verify the correctness of the inserted sequence and viral packaging is performed. The lentiviral vector is transfected into the iPSC-DKO cells constructed in Example 1. After 24 hours, the medium is changed. After 48 hours, the medium is replaced with puromycin-containing medium for selection. The resulting cell line is named iPSC-DKO+MCL1 cells.

[0387] Overexpression of MCL1 was tested in the constructed iPSC-DKO+MCL1 cell line. qRT-PCR was used to detect mRNA overexpression levels, with iPSC-WT cells serving as a negative control. The primers used are shown in Table 4. Protein overexpression was detected by FACS, with iPSC-WT cells serving as a negative control (the middle peak in Figure 12B) and the isotype as a negative control for detection signal (the left peak in Figure 12B).

[0388] Table 4. qPCR detection primers for MCL1

[0389] The detection results are shown in FIG12A and B , which show that MCL1 is highly expressed in the constructed iPSC-DKO+MCL1 cell line (the right peak in FIG12A and B ).

[0390] Example 5. Immune escape function of iPSC-derived DKO+MCL1 cell line

[0391] To verify the ability of iPSC-derived DKO+MCL1 cells to escape different immune cells, experiments were conducted using NK cells, ADCC (antibody-dependent cellular cytotoxicity), PBMC (mixed T cells and NK cells), and macrophages. RTCA was used to assess the ability of iPSC-DKO+MCL1 cells to escape different immune cells. For detailed assay methods, see Example 2.3.

[0392] 5.1 iPSC-DKO+MCL1 cells resist NK cell killing

[0393] NK cell killing assay was performed on the XCelligence platform (ACEA BioSciences). Various iPSC cells (iPSC-WT cells, iPSC-DKO cells, iPSC-DKO+MCL1 cells) were resuspended in 100 μL of cell-specific culture medium and plated on a 96-well E-plate (ACEA BioSciences) coated with Matrigel (Sigma-Aldrich). After the cell index value reached 1, NK cells were added at an E:T ratio of 1:1. The data were standardized and analyzed using RTCA software (ACEA). As shown in Figure 13, iPSC-DKO+MCL1 cells can significantly escape NK killing, and the escape effect is better than that of iPSC-WT.

[0394] 5.2 iPSC-DKO+MCL1 cells resist ADCC killing

[0395] NK cell ADCC killing assays were performed on the XCelligence platform (ACEA BioSciences). Each type of iPSC cell was resuspended in 100 μL of cell-specific culture medium and plated on a 96-well E-plate (ACEA BioSciences) coated with Matrigel (Sigma-Aldrich). After the cell index value reached 1, NK cells and IgG Fc antibodies were added at an E:T ratio of 1:1. The data were normalized and analyzed using RTCA software (ACEA). As shown in Figure 14, iPSC-DKO+MCL1 cells significantly escaped ADCC killing, with an escape effect superior to that of iPSC-WT.

[0396] 5.3 DKO+MCL1 cells resist PBMC cell killing

[0397] NK activating factors were added to PBMCs in advance to increase the proportion of NK cells and the cytotoxicity of T cells. Activated mixed lymphocytes (PBMCs) were then used as effector cells in a RTCA assay to comprehensively assess the immune evasion ability of iPSC-DKO+MCL1 cells (method reference PMID: 33309274). The PBMC cytotoxicity assay was performed on the XCelligence platform (ACEA BioSciences). Each type of iPSC was resuspended in 100 μL of cell-specific culture medium and plated on a 96-well E-plate (ACEA BioSciences) coated with Matrigel (Sigma-Aldrich). After the cell index value reached 1, PBMCs were added at an E:T ratio of 2:1. Data were normalized and analyzed using RTCA software (ACEA). As shown in Figure 15, A and B, iPSC-DKO+MCL1 cells significantly evaded PBMC cytotoxicity, achieving a superior evasion effect compared to iPSC-WT cells.

[0398] At the same time, iPSC WT, iPSC-DKO, and iPSC-DKO+MCL1 cells were plated in 12-well plates. After 24 hours, the culture medium was discarded and PBMC cells were added for culture. The results, as shown in Figure 15C, show that compared with iPSC-WT and iPSC-DKO cells, iPSC-DKO+MCL1 cells were less susceptible to cell killing by PBMC cells, indicating that iPSC-DKO+MCL1 cells have a significantly higher ability to escape PBMC cell killing than iPSC-WT and iPSC-DKO cells.

[0399] 5.4 iPSC-DKO+MCL1 cells resist macrophage killing

[0400] MAC cell killing assays were performed on the XCelligence platform (ACEA BioSciences). Each type of iPSC cell was resuspended in 100 μL of cell-specific culture medium and plated on a 96-well E-plate (ACEA BioSciences) coated with Matrigel (Sigma-Aldrich). After the cell index value reached 1, MAC cells were added at an E:T ratio of 3:1. The data were normalized and analyzed using RTCA software (ACEA). As shown in Figure 16, iPSC-DKO+MCL1 cells significantly evaded macrophage killing, with a superior evasion effect compared to iPSC-WT and iPSC-DKO cells.

[0401] Example 6. Stemness of iPSC-DKO+MCL1 Cell Line

[0402] This example further examined whether the stemness of iPSC-derived DKO+MCL1 pluripotent stem cells changed.

[0403] 6.1 Expression of stemness genes in DKO cells

[0404] Immunofluorescence was used to detect the protein levels of stemness genes in iPSC-DKO+MCL1 cells, and flow cytometry was used to detect the expression of corresponding proteins of stemness genes on the surface of iPSC-DKO+MCL1 cells. The specific detection methods are as follows:

[0405] Immunofluorescence assay: iPSC-DKO+MCL1 cells were plated in 12-well plates. After cells reached 60-80% confluence, the medium was aspirated and fixed with 4% paraformaldehyde. After permeabilization, cells were incubated with primary antibodies against OCT4, NANOG, and other stemness-regulating genes overnight at 4°C. After washing away the primary antibodies, fluorescently labeled secondary antibodies were incubated at room temperature. Images were then taken using a fluorescence microscope (Nikon Ts2R-FL).

[0406] Flow cytometry:

[0407] After harvesting the cells, incubate the antibodies in an EP tube at 4°C in the dark for 30 minutes. Then, select the appropriate fluorescence acquisition channel based on the antibody information and monitor the fluorescence on a fluorescence microscope. All antibodies were from BD Biosciences.

[0408] Figure 17A shows the results of immunofluorescence detection of the protein levels of stemness genes NANOG, OCT4, SOX2, TRA-1-60, and TRA-1-81 in iPSC-DKO+MCL1 cells; Figure 17B shows the results of flow cytometry detection of the expression of stemness genes SSEA-4, TRA-1-60, TRA-1-81, and OCT-4 on the surface of iPSC-DKO+MCL1 cells.

[0409] 6.2 Tri-germ layer differentiation capacity of the iPSC-DKO+MCL1 cell line

[0410] iPSC-DKO+MCL1 cells were used to test the ability of three germ layers to differentiate. In order to generate mesoderm, endoderm, and ectoderm cells, the dissociated iPSC-DKO+MCL1 single cells were resuspended in three germ layer culture media supplemented with Y27632, and an appropriate amount of cells were attached to a well plate coated with a matrix gel with a cell slide. After 24 hours, the culture medium was replaced with preheated differentiation medium. The medium was changed every day until the seventh day to obtain mesoderm, endoderm, and ectoderm cells. The expression of three germ layer marker proteins was detected by immunofluorescence to detect the three germ layer differentiation ability of iPSC-DKO+MCL1 cells.

[0411] The results of immunofluorescence detection are shown in Figure 18. iPSC-DKO+MCL1 cells express ectoderm marker proteins: PAX6 and GAD1; mesoderm marker proteins: Brachyury and NCAM; and endoderm marker proteins: SOX17 and FOXA2 at the protein level.

[0412] 6.3 Differentiation capacity of DKO cells

[0413] In this example, the differentiation ability of iPSC-DKO+MCL1 cells was detected. The specific detection method was as follows: 100 μL containing 5×10 5 iPSC-DKO+MCL1 cell suspension, wait until the teratoma volume is larger than 1.5cm 3 The tissues were then removed, sectioned into paraffin and stained with hematoxylin and eosin.

[0414] The staining results in Figure 19 show that iPSC-DKO+MCL1 cells can form teratomas in vivo and differentiate into cells of the inner, middle and outer germ layers. iPSC-DKO+MCL1 cells have normal differentiation ability into the three germ layers.

[0415] Example 7. Construction and verification of universal NHP cells

[0416] This example describes an in vitro and in vivo study of the immunogenicity of universal simian stem cells (iPSCs) in a non-human primate (NHP) model.

[0417] 1. Construction of Universal NHP Cells

[0418] a) Construction of NHP iPSC-DKO cells

[0419] In this study, monkey iPSC-DKO (monkey iPSC cells, generated by CTS) was generated according to the method described in Example 1. TM CytoTune TM iPSC cells were prepared using the Sendai virus reprogramming kit (Cat. No. A34546). iPSC stemness gene expression and teratoma formation were assayed according to the method described in Example 2. The results are shown in FIG20 .

[0420] NHP-B2M-gRNA1 and NHP-B2M-gRNA2 were used to directly knock out the B2M exon segment at both ends, and then the genomic sequence knockout was verified using a pair of PCR primers NHP-B2M-F / R. NHP-CIITA-gRNA1 and NHP-CIITA-gRNA2 were used to directly knock out the CIITA exon segment at both ends, and the genomic knockout was verified by genomic PCR using a pair of PCR primers NHP-CIITA-F / R. Two NHP iPSC-DKO cell lines were selected for subsequent verification.

[0421] NHP-B2M-gRNA1 (SEQ ID NO:7):CGTGAGTAAACCTGAATCTT

[0422] NHP-B2M-gRNA2 (SEQ ID NO:8): AGTCACATGGTTCACACGGC

[0423] NHP-CIITA-gRNA1 (SEQ ID NO:28):CATCGCTGTTGAGAAGCTCC

[0424] NHP-CIITA-gRNA2 (SEQ ID NO:9): GATATTGGCATAAGCCTCCC

[0425] B2M identification primers

[0426] NHP-B2M-F(SEQ ID NO:29):CATTTGGCCAGAGTGGAAATG

[0427] NHP-B2M-R (SEQ ID NO:30): TGGGACTCATTCAGGGTAGTA

[0428] CIITA identification primers

[0429] NHP-CIITA-F (SEQ ID NO:31):CTGTGAGGTGACTGAGCATATC

[0430] NHP-CIITA-R(SEQ ID NO:32):GGCCAGCAATGAGCATACTA

[0431] NHP iPSC-WT, NHP iPSC-DKO1, and NHP iPSC-DKO2 cells were stimulated with INF-gamma: cells were plated in well plates and medium containing INF-gamma was added to the cells during the next day's medium change. After 48 hours, the cells were digested and HLA-I / II expression was assessed by flow cytometry. As shown in Figure 21, B2M / CIITA biallelic knockout NHP iPSC-DKO1 and NHP iPSC-DKO2 cells did not express HLA-I / II and failed to upregulate HLA-I / II in response to INF-gamma stimulation.

[0432] b) Functional verification of NHP iPSC-DKO cells escaping T cell killing

[0433] T cell killing assay was performed on the XCelligence platform (ACEA BioSciences). NHP iPSC-WT and iPSC-DKO cells were resuspended in 100 μL of cell-specific culture medium and plated on a 96-well E-plate (ACEA BioSciences) coated with Matrigel (Sigma-Aldrich). After the cell index value reached 1, T cells were added at an E:T ratio of 2:1. The data were normalized and analyzed using RTCA software (ACEA). As shown in Figure 22, NHP DKO cells can significantly escape T killing, while NHP iPSC-WT cells are killed.

[0434] 2. In vitro detection of universal NHP cells to escape immune system killing

[0435] NHP iPSC-DKO+MCL1 (the gene sequence of monkey MCL1 is shown as XM_045364359.1) cells were prepared according to the method described above and overexpression was confirmed by rt-qPCR. The results are shown in Figure 23.

[0436] NHP-MCL1-F (SEQ ID NO:33):GCTGCATCGAACCATTAGCA

[0437] NHP-MCL1-R(SEQ ID NO:34):ATGCCAAACCAGCTCCTACT

[0438] a) Monkey NK killing

[0439] NK cell killing assay was performed on the XCelligence platform (ACEA BioSciences). NHP iPSC-WT, NHP iPSC-DKO, and NHP iPSC-DKO+MCL1 cells were resuspended in 100 μL of cell-specific culture medium and plated on a 96-well E-plate (ACEA BioSciences) coated with Matrigel (Sigma-Aldrich). After the cell index value reached 1, NK cells were added at an E:T ratio of 1:1. The data were normalized and analyzed using RTCA software (ACEA). As shown in Figure 24, NHP-WT and NHP iPSC-DKO+MCL1 cells can significantly escape the killing of monkey NK, and the ability to resist killing is more significant after overexpressing MCL1.

[0440] b) Monkey PBMC killing

[0441] PBMC cell killing assay was performed on the XCelligence platform (ACEA BioSciences). NHP iPSC-WT, NHP iPSC-DKO, and NHP iPSC-DKO+MCL1 cells were resuspended in 100 μL cell-specific culture medium and plated on a 96-well E-plate (ACEA BioSciences) coated with Matrigel (Sigma-Aldrich). After the cell index value reached 1, PBMC cells were added at an E:T ratio of 2:1. The data were standardized and analyzed using RTCA software (ACEA). As shown in Figure 25, NHP iPSC-DKO+MCL1 cells can significantly escape PBMC killing, while NHP-WT and NHP-DKO are killed.

[0442] Sequence Listing

[0443] Although the present invention has been disclosed above with reference to preferred embodiments, this is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A low-immunogenic pluripotent stem cell, characterized in that: The low immunogenic pluripotent stem cells comprise: reduced MHC-I function compared to parental pluripotent stem cells; Reduced MHC-II function compared to the parental pluripotent stem cell; and Reduced sensitivity to T cell and NK cell killing compared to a parental pluripotent stem cell, wherein the reduced sensitivity to T cell and NK cell killing is caused by increased expression of MCL1 protein.

2. The low immunogenic pluripotent stem cell according to claim 1, characterized in that The cells also include modifications to increase expression of one or more of the following polypeptides: DUX4, CD27, CD35, CD200, PD-L1, CD47, CD24, CD26, CCL21, Mfge8, and SerpinB9.

3. The low immunogenic pluripotent stem cell according to claim 1 or 2, characterized in that The MHC-I function is reduced by reducing the activity of MHC-I class proteins or MHC-I transcriptional regulators.

4. The low immunogenic pluripotent stem cell according to claim 3, characterized in that The MHC-I class protein includes HLA-A protein, HLA-B protein or HLA-C protein.

5. The low immunogenic pluripotent stem cell according to claim 3, characterized in that The MHC-I transcriptional regulator comprises B2M protein, TAP1 protein, TAP2 protein, TAP-associated glycoprotein or NLRC5 protein.

6. The low immunogenic pluripotent stem cell according to claim 3, characterized in that The MHC-I function is reduced by decreasing the activity of the B2M protein.

7. The low immunogenic pluripotent stem cell according to claim 6, characterized in that The B2M protein is a human B2M protein, which comprises the amino acid sequence shown in SEQ ID NO: 1 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 1; Alternatively, the B2M protein is a monkey B2M protein, which comprises the amino acid sequence of Accession No. XP_045251305.2 or an amino acid sequence having at least 90% identity with the amino acid sequence of Accession No. XP_045251305.

2.

8. The low immunogenic pluripotent stem cell according to any one of claims 1 to 7, characterized in that The MHC-II function is reduced by reducing the activity of MHC-II class proteins or MHC-II transcriptional regulators.

9. The low immunogenic pluripotent stem cell according to claim 8, characterized in that The MHC-II class protein comprises HLA-DR protein, HLA-DQ protein or HLA-DP protein.

10. The low immunogenic pluripotent stem cell according to claim 8, characterized in that The MHC-II transcription regulatory factor comprises CIITA protein, RFXANK protein, RFX5 protein or RFXAP protein.

11. The low immunogenic pluripotent stem cell according to claim 8, characterized in that The MHC-II function is reduced by decreasing the activity of the CIITA protein.

12. The low immunogenic pluripotent stem cell according to claim 11, characterized in that The CIITA protein is a human CIITA protein, which comprises the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2; Alternatively, the CIITA protein is a monkey CIITA protein comprising the amino acid sequence of Accession No. XP_005591301.3 or an amino acid sequence having at least 90% identity with the amino acid sequence of Accession No. XP_005591301.

3.

13. The low immunogenic pluripotent stem cell according to any one of claims 1 to 12, characterized in that The MCL1 protein is a human MCL1 protein, which comprises an amino acid sequence as shown in SEQ ID NO: 3 or an amino acid sequence having at least 90% identity with the amino acid sequence as shown in SEQ ID NO: 3; Or, the MCL1 protein is a monkey MCL1 protein, which comprises the amino acid sequence of Accession No. XP_045220294.2 or an amino acid sequence having at least 90% identity with the amino acid sequence of Accession No. XP_045220294.

2.

14. The low immunogenic pluripotent stem cell according to claim 1, characterized in that The low immunogenic pluripotent stem cells comprise: One or more changes that reduce the activity of endogenous B2M protein; One or more changes that reduce the activity of endogenous CIITA protein; and One or more changes result in increased expression of MCL1 protein in the low immunogenic pluripotent stem cells.

15. The low immunogenic pluripotent stem cell according to claim 14, characterized in that The low immunogenic pluripotent stem cells comprise: one or more alterations that inactivate both alleles of the endogenous B2M gene; one or more alterations that inactivate both alleles of the endogenous CIITA gene; and One or more alterations result in increased MCL1 gene expression in the low immunogenic pluripotent stem cells.

16. A method for producing a low immunogenic pluripotent stem cell according to any one of claims 1 to 15, characterized in that: The method comprises: reducing the MHC-I function in the pluripotent stem cells; reducing MHC-II function in the pluripotent stem cells; and The expression of a protein that reduces the sensitivity of the pluripotent stem cells to killing by NK cells, T cells, macrophages and / or ADCC is increased, wherein the protein is MCL1 protein.

17. The method according to claim 16, characterized in that The method comprises: reducing the activity of B2M protein in the pluripotent stem cells; Reducing the activity of CIITA protein in the pluripotent stem cells; and The expression of MCL1 protein in the pluripotent stem cells is increased.

18. The method according to claim 17, characterized in that The method comprises: Eliminating the activity of two alleles of the B2M gene in the pluripotent stem cells; Eliminating the activity of both alleles of the CIITA gene in the pluripotent stem cells; and The expression of the MCL1 gene in the pluripotent stem cells is increased.

19. The method according to any one of claims 16 to 18, characterized in that: The low immunogenic pluripotent stem cells also express a gene sequence selected from one of DUX4, CD27, CD35, CD200, PD-L1, CD47, CD24, CD26, CCL21, Mfge8 and SerpinB9.

20. The method according to any one of claims 16 to 19, characterized in that: The activity of the B2M protein in the pluripotent stem cells and / or the activity of the CIITA protein in the pluripotent stem cells are reduced by a technique selected from the following: Introduce gene expression modifying molecules, CRISPR technology, transcription activator-like effector nuclease technology, zinc finger nuclease technology or homologous recombination technology; preferably, the gene expression modifying molecules comprise siRNA, shRNA, microRNA, antisense RNA, antisense oligonucleotide ASO or anti-miRNA oligonucleotide AMO.

21. The method of claim 20, wherein: The activity of the B2M protein in the pluripotent stem cells is reduced by CRISPR / Cas9 gene editing technology; and / or the activity of the CIITA protein in the pluripotent stem cells is reduced by CRISPR / Cas9 gene editing technology.

22. The method according to any one of claims 16 to 20, characterized in that Increased expression of MCL1 protein by modification of the endogenous locus.

23. The method according to any one of claims 16 to 20, characterized in that The expression of MCL1 protein is increased by expression of a transgene; preferably, a nucleic acid sequence encoding the MCL1 protein is synthesized to be constructed into a lentiviral vector, and then at least one copy of the MCL1 gene under the control of a promoter is introduced into the pluripotent stem cells through the lentiviral vector to increase the expression of the MCL1 protein.

24. The method of claim 23, wherein: The nucleic acid sequence encoding the MCL1 protein comprises the nucleic acid sequence shown in SEQ ID NO: 4 or a nucleic acid sequence having at least 80% identity with the nucleic acid sequence shown in SEQ ID NO: 4; Or, the nucleic acid sequence encoding the MCL1 protein comprises the nucleic acid sequence with accession number XM_045364359.1 or a nucleic acid sequence having at least 90% identity with the nucleic acid sequence with accession number XM_045364359.

1.

25. A composition, characterized in that The composition comprises the low immunogenic pluripotent stem cells according to any one of claims 1 to 15 or the low immunogenic pluripotent stem cells prepared by the method according to any one of claims 16 to 24; preferably, the composition further comprises a pharmaceutically acceptable carrier.

26. Use of the low immunogenic pluripotent stem cells according to any one of claims 1 to 15, the low immunogenic pluripotent stem cells prepared by the method according to any one of claims 16 to 24, or the composition according to claim 25 in the preparation of a medicament for preventing or treating a disease requiring cell transplantation; preferably, the disease comprises acute leukemia, chronic leukemia, lymphoma, myelodysplastic syndrome, multiple myeloma, small cell lung cancer, breast cancer, testicular cancer, neuroblastoma, ovarian cancer, melanoma, aplastic disorder anemia, congenital immunodeficiency, systemic lupus erythematosus, rheumatoid arthritis, ankylosing spondylitis, type I diabetes, Parkinson's disease, Alzheimer's disease, spinal cord injury, retinal degeneration, stroke, Huntington's disease, amyotrophic lateral sclerosis, atherosclerosis, hypertension, rheumatic heart disease, cardiomyopathy, arrhythmia, congenital heart disease, valvular heart disease, carditis, myocardial infarction, heart failure, aortic aneurysm, peripheral arterial disease, type II diabetes, scurvy, hypoglycemia, hyperlipidemia or osteoporosis.

27. Use of the low immunogenic pluripotent stem cells according to any one of claims 1 to 15, or the low immunogenic pluripotent stem cells prepared by the method according to any one of claims 16 to 24, or the composition according to claim 25 in preventing or treating diseases requiring cell transplantation; preferably, the diseases include acute leukemia, chronic leukemia, lymphoma, myelodysplastic syndrome, multiple myeloma, small cell lung cancer, breast cancer, testicular cancer, neuroblastoma, ovarian cancer, melanoma, aplastic anemia, blood, congenital immunodeficiency, systemic lupus erythematosus, rheumatoid arthritis, ankylosing spondylitis, type I diabetes, Parkinson's disease, Alzheimer's disease, spinal cord injury, retinal degeneration, stroke, Huntington's disease, amyotrophic lateral sclerosis, atherosclerosis, hypertension, rheumatic heart disease, cardiomyopathy, arrhythmia, congenital heart disease, valvular heart disease, carditis, myocardial infarction, heart failure, aortic aneurysm, peripheral arterial disease, type II diabetes, scurvy, hypoglycemia, hyperlipidemia or osteoporosis.

28. A method of preventing or treating a disease requiring cell transplantation, comprising: a low immunogenic pluripotent stem cell according to any one of claims 1 to 15, a low immunogenic pluripotent stem cell prepared by the method according to any one of claims 16 to 24, or a composition according to claim 25; preferably, the disease comprises acute leukemia, chronic leukemia, lymphoma, myelodysplastic syndrome, multiple myeloma, small cell lung cancer, breast cancer, testicular cancer, neuroblastoma, ovarian cancer, melanoma, aplastic anemia, congenital immunodeficiency, systemic lupus erythematosus, rheumatoid arthritis, ankylosing spondylitis, type I diabetes, Parkinson's disease, Alzheimer's disease, spinal cord injury, retinal degeneration, stroke, Huntington's disease, amyotrophic lateral sclerosis, atherosclerosis, hypertension, rheumatic heart disease, cardiomyopathy, arrhythmia, congenital heart disease, valvular heart disease, carditis, myocardial infarction, heart failure, aortic aneurysm, peripheral arterial disease, type II diabetes, scurvy, hypoglycemia, hyperlipidemia or osteoporosis.

Images