VLP-scaffold based binding proteins

Abstract

The invention relates to methods and systems for delivering RNA to cells using virus-like particles (VLPs) and scaffold-based binding proteins (SBPs); as well as applications for such methods and systems, for example in therapeutics and diagnostics.

Description

[0001] VLP-scaffold based binding proteins

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to methods and systems for delivering RNA to cells using virus-like particles (VLPs) and scaffold-based binding proteins (SBPs); as well as applications for such methods and systems.

[0004] BACKGROUND TO THE INVENTION

[0005] RNA serves as a crucial molecule in various cellular processes. It plays a pivotal role in protein synthesis through the process of translation, where mRNA is translated into a protein by the ribosome and tRNA. Beyond protein production, other types of RNA such as miRNA are involved in regulating gene expression, cellular communication and catalytic reactions, showcasing the diverse roles RNA has in cellular functions.

[0006] RNA has vast applications in biotechnology and has emerged as a powerful tool for the development of novel therapies. Small molecules and antibody drugs target only 0.05% of the human genome, and most disease targets lack defined active sites for smallmolecule binding. RNAs selectively act on proteins, transcripts and genes, which broadens the range of potential druggable targets. Furthermore, developing an RNA based therapy is much easier and cheaper than developing small molecules and antibodies. There are several approved RNA-based therapies, perhaps most well-known are the mRNA vaccines used to combat the COVID-19 pandemic, and many more RNA based therapeutics are in clinical trials. In particular, mRNA-based therapeutics have the potential to address unmet needs for a wide variety of diseases, including cancer and cardiovascular disease. mRNA can be delivered to cells to trigger the production of a target protein, something that can be difficult to achieve with other approaches.

[0007] However, a barrier for the use of RNA in therapeutics is stability with RNA typically requiring storage at -80°C. In addition to this, there are numerous extracellular and intracellular hurdles that must be overcome for a successful RNA therapeutic. Firstly, large, hydrophilic, negatively-charged properties prevent RNA from passively diffusing across cell lipid bilayers. Beyond the physical barrier, RNA drugs must evade serum nucleases and scavenger macrophages within the reticuloendothelial system. Moreover, RNA therapies must pass through the extracellular matrix and across the cell membrane through receptor-mediated endocytosis. Escaping from the endosome and releasing RNAs into the cytoplasm is a critical technical problem. Therefore, various chemical modifications and the engineering of delivery formulations have been explored to solve challenges related to pharmacodynamics and pharmacokinetics including lipid nanoparticles and cationic polymer-based polyplexes.

[0008] As well as a need to develop RNA based therapeutics, there is a concurrent need to be able to target specific cell types with therapeutics. To date, the majority of targeted therapies have been provided by monoclonal antibodies and their cytotoxic conjugates, targeting cell surface receptors overexpressed on disease cells such as cancer cells compared to their non-cancerous neighbours. However, there is scope for smaller and more easily produced proteins to achieve similar impacts. Indeed, in recent years, a number of non-immunoglobulin scaffolds (or scaffold-based binding proteins - SBPs) have been developed that overcome some of the limitations associated with antibodies, notably their large size which decreases their ability to penetrate solid tumours, slow blood clearance and expense to produce. SBPs have many advantageous features, including small size, high solubility, high stability and lack of disulfide bonds. Examples of SBPs include: Designed Ankyrin Repeat Proteins (DARPins), Affibodies and Affimers. Affimer proteins are novel affinity reagents which mimic the molecular recognition of antibodies, but can be isolated quickly and produced recombinantly. A wide range of Affimer binders have now been identified, making these a promising tool for drug delivery.

[0009] However, issues in biodistribution and pharmacokinetics, which can lead to side-effects including cardiotoxicity and the development of drug resistance need to be overcome. One methodology to overcome these issues is nanoparticle encapsulation. There exist many types of synthetic nanoparticle, however only a few have made it to the clinic due to discrepancies between in vitro characteristics and subsequent in vivo behaviour as well as complex regulatory requirements. Attention has therefore turned to nature’s ready-made delivery system, in the form of viruses, from which virus-like particles (VLPs) have been derived. VLPs are non-infectious, self-assembling viral capsids that can encapsulate cargoes ranging from cytotoxics to proteins. A range of expression platforms have been used for producing VLPs, including bacteria, plants and mammalian cells. Indeed, VLPs have been used successfully as vaccine therapies in pre-clinical studies. However, existing studies have required modification of the VLP capsid to permit targeting to a specific receptor; such modification can be expensive and problematic. There is a need to deliver RNA based therapeutics to specific cell types at a lower cost and in a way which maintains RNA stability. The present invention addresses this need. The inventors show for the first time that RNA can be delivered to a specific cell type by a VLP bound to an SBP. This provides a novel therapeutic approach with applications in treating numerous diseases and vaccine delivery.

[0010] SUMMARY OF THE INVENTION

[0011] The inventors have developed methods and systems for the incorporation of different types of RNA into different types of cell. In particular, the methods and systems developed by the inventors have applications in: delivery of RNA encoding a protein to be expressed by the cell, gene silencing, genome editing, vaccine delivery, therapeutics and diagnostics.

[0012] In one aspect of the invention there is a system for the incorporation of RNA into a cell, comprising:

[0013] RNA encapsulated in a virus like particle (VLP); and a targeting moiety that can associate with a target cell wherein said targeting moiety comprises at least one scaffold based binding protein (SBP) that associates with the VLP.

[0014] The RNA may be mRNA, tRNA, rRNA, miRNA, siRNA, snRNA, IncRNA, shRNA, sgRNA, an aptamer, a probe or dsRNA. Preferably, the RNA is mRNA.

[0015] In a preferred embodiment the RNA is up to 6 kb.

[0016] In some embodiments the VLP is derived from cowpea mosaic virus (CPMV) or is a CPMV VLP. However, the skilled person would be able to select a VLP to suit their specific needs

[0017] In a preferred embodiment, the at least one SBP is bi-specific to the VLP and the target cell. More preferably, the at least one SBP is selected from at least one or any combination of an affimer, an affibody or DARPin. Even more preferably, the at least one SBP is an affimer. In some embodiments, the system further comprises an affibody and / or DARPin. In an embodiment, the VLP comprises a coat protein and said coat protein comprises an L-subunit; wherein the at least one SBP is bound to the L-subunit of the coat protein of the VLP.

[0018] In an embodiment, the system comprises RNA that encodes a protein which is produced after incorporation of the RNA in the cell. In one embodiment, the RNA encodes a protein that is capable of eliciting an immune response.

[0019] In an embodiment, the system comprises RNA that encodes an antigen binding protein.

[0020] In another embodiment, the system comprises RNA that encodes a protein capable of binding to a target receptor. In some embodiments, the RNA encodes a protein that is internalised after binding to its target receptor.

[0021] In an embodiment, the system comprises RNA that encodes a protein which disrupts cell growth and / or causes apoptosis.

[0022] In a preferred embodiment the system comprises an SBP that associates with a target site on a cancer cell. In an alternative embodiment, the SBP associates with a target site on an immune cell.

[0023] In an embodiment the system of the present invention is for use in in vitro diagnostics or in the treatment of disease. Preferably the disease is selected from cancer, neurological diseases, metabolic diseases, cardiovascular diseases, autoimmune diseases, haematological disorders, and ophthalmic disorders.

[0024] In another aspect of the invention there is provided a method for incorporating RNA into a cell, the method comprising delivering to cells, a tissue, an organ or a subject:

[0025] RNA encapsulated in a virus like particle (VLP); and a targeting moiety that can associate with a target cell wherein said targeting moiety comprises at least one SBP that associates with the VLP. In an embodiment the RNA is mRNA, tRNA, rRNA, miRNA, siRNA, snRNA, IncRNA, shRNA, sgRNA, aptamer, probe or dsRNA. Preferably, the RNA is mRNA. In some embodiments the RNA is up to 6 kb.

[0026] In an embodiment the method comprises delivering RNA that encodes a protein that is capable of eliciting an immune response.

[0027] In an embodiment the method comprises delivering a VLP derived from cowpea mosaic virus (CPMV) or a CMPV VLP.

[0028] Preferably, methods of the present invention comprise delivering at least one SBP that is bi-specific to the VLP and the target cell to cells, a tissue, an organ or a subject. More preferably, the at least one SBP is selected from at least one or any combination of an affimer, an affibody or DARPin. Even more preferably, the at least one SBP is an affimer. In an embodiment the method comprises delivering a VLP wherein said VLP comprises a coat protein and said coat protein comprises an L-subunit, wherein the at least one SBP is bound to the L-subunit of the coat protein of the VLP.

[0029] In a preferred embodiment the target cell is a cancer cell. In an alternative embodiment, the target cell is an immune cell.

[0030] In another aspect of the invention there is provided a vaccine comprising a system for the incorporation of RNA into a cell, comprising:

[0031] RNA encapsulated in a virus like particle (VLP); and a targeting moiety that can associate with a target cell wherein said targeting moiety comprises at least one scaffold based binding protein (SBP) that associates with the VLP.

[0032] In another aspect of the invention there is provided a kit for in vitro diagnostics, the kit comprising a system for the incorporation of RNA into a cell, comprising:

[0033] RNA encapsulated in a virus like particle (VLP); and a targeting moiety that can associate with a target cell wherein said targeting moiety comprises at least one scaffold based binding protein (SBP) that associates with the VLP. In another aspect of the invention there is provided a kit for the treatment of a disease wherein said disease is selected from cancer, neurological diseases, metabolic diseases, cardiovascular diseases, infections, respiratory diseases, autoimmune diseases, haematological disorders, and ophthalmic disorders; the kit comprising a system for the incorporation of RNA into a cell, comprising:

[0034] RNA encapsulated in a virus like particle (VLP); and a targeting moiety that can associate with a target cell wherein said targeting moiety comprises at least one scaffold based binding protein (SBP) that associates with the VLP.

[0035] BRIEF DESCRIPTION OF THE FIGURES

[0036] Figure 1 - Identification of affimers that bind cellularly expressed HER2. a) Affinity precipitation of endogenous HER2 from HER2-overexpressing cell lines (AU-565 and BT-474) and the HER2-negative cell line (MDA-MB-231) using HER2-binding Affimers identified by phage screening against the ECD of HER2. (n=3 independent experiments with representative blots shown; white lines delineate individual membranes; all blots were run concurrently), b) Phage ELISA of 48 Affimer-phage identified as preferential binding fixed HER2-expressing cells (MDA-MB-453) compared to HER2 negative cells (MCF7). An arbitrary cut-off (2x the highest value for MCF7 absorbance plus 10%; red line) was used to determine which clones would be taken forward for DNA sequence analysis identifying two unique binding Affimers D11 and H7. WCL- whole cell lysates.

[0037] Figure 2 - Affimers D11 and H7 co-localise with HER2 and show internalisation into HER2-positive cells. AlexaFluor 488™ conjugated Affimers (green) D11 (a) and H7 (b) were incubated with HER2 positive (AU-565 and BT-474) and negative (MDA-MB-231) cell lines for 1 hour before fixation. Cells were stained for HER2 (pink) and with Hoescht (blue). The mechanism of internalisation was assessed with co-staining for EEA1 (pink, c) and d)) and LAMP2 (pink, e) and f)). Co-localisation of Affimers with HER2 / EEA1 / LAMP2 are shown by arrows. Images were taken on a Zeiss confocal microscope with a 40x magnification under the same exposure for AlexaFluor 488™ conjugated Affimers. Images were analysed using ZenLite software. Representative images shown from 3 experiments. Figure 3 - Impact of affimers on the metabolic activity of breast cancer cell lines. A range of breast cancer cell lines All-565, SKBR3, BT-474, MDA-MB-453, MCF-7, MDA-MB-231 and ZR-75-1 were seeded one day prior to the addition of HER2-binding Affimers or HER2-binding Affimer-MMAE conjugates. Cells were incubated for a further 72 hours and metabolic activity was analysed by AlamarBlue™ measurement. HER-2 binding Affimers did not affect metabolic activity in either HER2-positive cell lines AU- 565 and BT474 or the HER-2 negative cell line MDA-MB-231 (a) and b)). HER2-binding Affimers were conjugated with the cytotoxin MMAE via a cathepsin cleavable group and a PABC spacer (c)). Seven breast cancer cell lines with varied with HER2 expression level as measured by immunoblotting (d), representative blot shown; dotted line indicates removal of a lane containing lysates from a non-breast cancer cell line) were treated with the Affimer-MMAE conjugates and showed dose dependent inhibition of metabolic activity (e) and f)), the efficacy of which varied with HER2 expression level. All values were normalised to cells incubated with media alone. Data is mean ± SEM, doseresponse curves were fitted using GraphPad Prism v 9.0, [Inhibitor] vs. response -- Variable slope (four parameters), n = 3 independent experiments for all panels.

[0038] Figure 4 - HER2-binding Affimers mediate targeted delivery of VLPs. Affimer dimer containing HER2-binding Affimer D11 and CPMV VLP binding Affimer were used to target CPMV VLPs containing eGFP RNA to HER2 positive cells (a). Affimer dimer increased cellular uptake of eGFP RNA containing CPMV VLPs to HER2-positive cell lines (AU-565 and SKBR3) in a dose dependent manner whilst uptake was minimal in HER2 negative cell line MDA-MB-231 (b) and c)). Affimer dimerVLP conjugates were non-toxic at doses used (0.07 μM VLP and increasing ratios of Affimer dimer) (d)). Data is mean ± SEM, n = 3 independent experiments, (a) Created with BioRender.com.

[0039] Figure 5 - HER2-binding Affimer D11 bind different epitopes to other HER2-binding SBPs. The Alphafold2 predicted model shows HER2-binding Affimer D11 level binds subdomains II and III of the HER2 ECD. The prediction is colour coded based on pLDDT values which indicate the confidence level of the prediction (a) whilst Affibody ZHER2:342 (yellow; PDB code: 3MZW) binds subdomain III and DARPinG3 (grey; PDB code:4HRN) bind subdomain IV. Affimer D11 is shown in magenta (b). Replacement of HER2-binding Affimer D11 with either Affibody ZHER2:342 or DARPinG3 in Affimer dimer still results in an increased percentage of eGFP positive cells over VLP alone (c), but not to the same magnitude as the Affimer dimer (d). Data is mean ± SEM, n = 3 independent experiments, with representative images shown in (c), scale bar is 50 pm, One-way ANOVA with Dunnett’s post hoc test **** = p<0.0001 (d). Image created with Pymol v2.5.4 (Schrodinger LLC) (b).

[0040] DETAILED DESCRIPTION OF THE INVENTION

[0041] Described herein are methods and systems for delivering and incorporating RNA into a cell. Such methods and systems comprise RNA encapsulated in a virus like particle (VLP) and a targeting moiety that can associate with a target cell wherein said targeting moiety comprises at least one SBP that associates with the VLP.

[0042] In the context of the present invention, the term “system” refers to a biological apparatus designed to deliver RNA into a cell. The system of the present invention comprises two main components; RNA encapsulated in a VLP and a targeting moiety which is associated with said VLP and directs the VLP to a target cell.

[0043] In the context of the present invention, the term “associate with” refers to an interaction between at least two components such as but not limited to molecules (e.g. polypeptides including SBPs) and cells (including molecules on cell surfaces). The components may interact by binding to one another. The term “binding” means a physical or chemical interaction between two components. Binding includes ionic, non-ionic, Van der Waals, hydrophobic interactions, and the like. Physical interactions can be direct or indirect. Indirect interactions may be through or due to the action of another component. Direct binding means an interaction that does not occur through or due to the action of another component, but instead is accompanied by no other substantial chemical inclusions. In preferred embodiments, the components may preferentially associate with one another; for example, the components may bind to one another more strongly than each bind to another component, and / or may specifically bind one another. The term "specifically binds" as used herein means the ability of a component, under specific binding conditions, to bind to a target component such that its affinity or avidity is at least 10 times as great, but optionally 50, 100, 250 or 500 times as great, or even at least 1000 times as great as the average affinity or avidity of the same component to a collection of random components (eg peptides or polypeptides) of sufficient statistical size. A specifically binding component need not bind exclusively to a single target but may specifically bind to a non-target molecule due to similarity in structural conformation between the target and non-target (e.g., paralogs or orthologs).

[0044] VLPs are nanoparticulate structures composed of viral structural proteins similar to a native virion, but are not infectious as they lack the viral genome. VLPs are highly organised and can self-assemble into different geometric symmetry, generally in the form of icosahedral, helical symmetry, rod shape structure, or globular in shape, depending on the VLP’s source.

[0045] In some embodiments, empty or hollow virus-like particles (VLPs) are obtained from CPM V or other plant virus or other non-plant virus. An "empty" or "hollow" VLP comprises a membrane-enclosed vesicle, which can provide a luminal space, which can be filled with a substance or molecule.

[0046] VLPs have been produced from a wide variety of virus families including but not limited to: Parvoviridae, Retroviridae, Flaviviridae, Paramyxoxviridae. Examples of viruses that VLPs may be derived from include but are not limited to: Cowpea mosaic virus (CPMV), Turnip crinkle virus (TCV), Tomato bushy stunt virus (TBSV), Southern bean mosaic virus (SBMV), Broad bean mottle virus, Brome mosaic virus, Cassia yellow blotch virus, Cowpea chlorotic mottle virus (CCMV), Melandrium yellow fleck virus, and Spring beauty latent virus.

[0047] In a preferred embodiment the VLP is derived from cowpea mosaic virus (CPMV).

[0048] The structure of the CPMV VLP is well understood with crystallographic structures available. Together, the L and S subunits comprise three p-barrel domains (two from L, one from S) each of which contains a ‘jelly roll’ topology. The ‘jelly roll’ is common in many virus structures and contains two twisted anti-parallel p sheets, each of which contains four p strands.

[0049] In certain embodiments, VLPs comprising encapsulated RNA enter cells via active cellular transport, such as receptor-mediated endocytosis or other vesicular traffic mechanisms. RNA molecules can be naturally occurring or synthetic. RNA may be single stranded or double stranded. There are several types of RNA including but not limited to: messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), micro-RNA (miRNA), short interfering RNA (siRNA), small nuclear RNA (snRNA), long noncoding RNA (IncRNA), small hairpin RNA (shRNA), single guide RNA (sgRNA) and double-stranded (dsRNA). mRNA is a type of single-stranded RNA involved in protein synthesis. mRNA is made from a DNA template during the process of transcription. The role of mRNA is to carry codons that can be translated into their corresponding amino acids for protein synthesis. tRNA is a small RNA molecule that plays a key role in protein synthesis. tRNA serves as a link (or adaptor) between mRNA and the growing chain of amino acids that make up a protein. Each time an amino acid is added to the chain, a specific tRNA pairs with its complementary sequence on the mRNA molecule, ensuring that the appropriate amino acid is inserted into the protein being synthesised. rRNA is the major structural component of the ribosome and has sequence complementarity to regions of mRNA with which it can interact. miRNAs are small, highly conserved single stranded non-coding RNA molecules of ~22 nucleotides involved in the regulation of gene expression. siRNA is a class of double-stranded synthetic RNA typically 20-24 (normally 21) nucleotides in length, similar to miRNA, and operating within the RNA interference (RNAi) pathway. snRNAs are critical components of the spliceosome that catalyze the splicing of pre- mRNA. snRNAs are each complexed with many proteins to form RNA-protein complexes, termed as small nuclear ribonucleoproteins.

[0050] IncRNA is a large class of RNA molecules with size larger than 200 nucleotides. They exhibit cellular functions although have no protein-coding capability, with involvement in cell survival and growth and invasion. shRNAs are sequences of RNA, typically about 80 base pairs in length, that include a region of internal hybridisation that creates a hairpin structure. shRNA molecules are processed within the cell to form siRNA which in turn knock down gene expression. sgRNA is a single RNA molecule used in genome editing that contains both a custom- designed short crRNA sequence fused to a scaffold tracrRNA sequence. sgRNA can be synthetically generated or made in vitro or in vivo from a DNA template. dsRNA is associated with many viral infections - either constituting the viral genome (in the case of dsRNA viruses) or is generated in host cells during viral replication.

[0051] In an embodiment at least one type of RNA selected from mRNA, tRNA, rRNA, miRNA, siRNA, snRNA, IncRNA, shRNA, sgRNA or dsRNA is encapsulated in a VLP. Preferably, mRNA is encapsulated in a VLP.

[0052] In another embodiment, the RNA encapsulated in the VLP is up to 1 kb, 2 kb, 3 kb, 4 kb, 5, kb, 6 kb, 7kb, 8 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, 16 kb, 17 kb, 18 kb, 19 kb, 20 kb or more. Preferably the RNA is up to 6 kb.

[0053] In an embodiment the RNA of the present invention may be optionally chemically modified and / or conjugated to another molecule such as a drug, lipid, peptide, carbohydrate, or any other molecule required by the skilled person.

[0054] RNA sequences used in the context of the present invention can be naturally occurring, produced by chemical synthetic methods or by recombinant nucleic acid techniques. Endogenous RNA polymerase of a cell may mediate transcription in vivo, or cloned RNA polymerase can be used for transcription in vitro. In certain embodiments, RNA molecules that modulate target gene activity may include modifications to either the phosphate-sugar backbone or the nucleoside, e.g., to reduce susceptibility to cellular nucleases, improve bioavailability, improve formulation characteristics, and / or change other pharmacokinetic properties. For example, the phosphodiester linkages of natural RNA may be modified to include at least one of a nitrogen or sulfur heteroatom. Modifications in RNA structure may be tailored to allow specific genetic inhibition while avoiding a general response to dsRNA. Likewise, bases may be modified to block the activity of adenosine deaminase. In certain embodiments, the RNA polynucleotides may be produced enzymatically or by partial / total organic synthesis, any modified ribonucleotide can be introduced by in vitro enzymatic or organic synthesis. The invention is not limited to these modifications and the skilled person would be able to introduce any known modification to suit their specific use case.

[0055] Methods of chemically modifying RNA molecules can be adapted for the users’ needs and the particular RNA being used (see, for example, Heidenreich et al. (1997) Nucleic Acids Res, 25:776-780; Wilson et al. (1994) J Mol Recog 7:89-98; Chen et al. (1995) Nucleic Acids Res 23:2661-2668; Hirschbein et al. (1997) Antisense Nucleic Acid Drug Dev 7:55-61). These publications illustrate that the backbone of an RNAi construct can be modified with phosphorothioates, phosphoramidate, phosphodithioates, chimeric methylphosphonate-phosphodiesters, peptide nucleic acids, 5-propynyl-pyrimidine containing oligomers or sugar modifications (e.g., 2'-substituted ribonucleosides).

[0056] Tools for design and quality of different types of RNA are known in the art. For example, web-based online software systems for designing siRNA and shRNA sequences are widely available such as siRNA Wizard (InvivoGen) https: / / www.invivoqen.com / sirnawizard / .

[0057] In an embodiment the RNA is mRNA that encodes a protein which is produced after incorporation of the RNA in the cell.

[0058] The skilled person would be able to select an RNA sequence encoding any protein of choice. The skilled person may select an RNA encoding a protein that is not normally expressed by the target cell. Alternatively, the skilled person may select an RNA encoding a protein that the target cell already has to increase its abundance.

[0059] In an embodiment, the RNA encodes at least one protein selected from an: antibody, enzyme, hormone, structural protein, storage protein, transport protein, contractile protein, or antigen.

[0060] In some embodiments the RNA encodes a protein that is capable of eliciting an immune response. In some embodiments the protein is an antigen. An antigen is a molecule that is capable of eliciting an immune response. In one embodiment the target cell is a cancerous cell and the RNA encodes at least one tumour antigen. Cytotoxic T lymphocytes are able to recognise tumour antigens, activating said cytotoxic T lymphocytes and triggering an immune response, targeting cells presenting tumour antigens for destruction. The RNA may encode a tumour specific antigen (TSA) or a tumour associated antigen (TAA). A tumour specific antigen is presented by tumour cells only and not normal cells. A tumour associated antigen is presented by tumour cells as well as some normal cells. Preferably, the RNA encodes a tumour specific antigen. Preferably, after the RNA encoding a tumour antigen is incorporated into the target cell, the tumour antigen is produced and expressed by the target cell. In an embodiment, expression of the tumour antigen by the target cell triggers an immune response leading to the destruction of said target cell.

[0061] In another aspect of the invention, the RNA is an mRNA that encodes a protein derived from a pathogen. Preferably the protein derived from a pathogen is not pathogenic i.e. will not cause disease. Preferably, the protein derived from a pathogen is a viral protein or a bacterial protein. More preferably, the protein derived from a pathogen is a viral surface protein or a bacterial surface protein.

[0062] The pathogen derived protein is produced once the RNA encoding said pathogen derived protein is incorporated in the target cell. Production of the pathogen derived protein will lead to the production of antibodies against said pathogen derived protein.

[0063] In one aspect of the invention there is a vaccine comprising RNA encapsulated in a virus like particle (VLP) and a targeting moiety that can associate with a target cell wherein said targeting moiety comprises at least one SBP that associates with the VLP.

[0064] In another aspect of the invention the RNA is an mRNA that encodes an antigen binding protein. Examples of antigen binding proteins include but are not limited to antibodies and antibody fragments.

[0065] In an embodiment the RNA encodes at least one antibody or antibody fragment and said antibody or antibody fragment is produced after incorporation of the RNA into a target cell. Preferably the RNA encodes at least one antibody or antibody fragment that targets a disease cell such as a cancer cell or a pathogen. The terms “cancer” or “tumour” refer to any neoplastic growth in a subject, including an initial tumour and any metastases. The cancer can be of the liquid or solid tumour type. Liquid tumours include tumours of hematological origin, including, e.g., myelomas (e.g., multiple myeloma), leukemias (e.g., Waldenstrom's syndrome, chronic lymphocytic leukemia, other leukemias), and lymphomas (e.g., B-cell lymphomas, non-Hodgkin's lymphoma). Solid tumours can originate in organs and include cancers of the lungs, brain, breasts, prostate, ovaries, colon, kidneys and liver.

[0066] The terms “cancer cell” or “tumour cell” can refer to cells that divide at an abnormal (i.e., increased) rate. Cancer cells include, but are not limited to, carcinomas, such as squamous cell carcinoma, non-small cell carcinoma (e.g., non-small cell lung carcinoma), small cell carcinoma (e.g., small cell lung carcinoma), basal cell carcinoma, sweat gland carcinoma, sebaceous gland carcinoma, adenocarcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, undifferentiated carcinoma, bronchogenic carcinoma, melanoma, renal cell carcinoma, hepatoma-liver cell carcinoma, bile duct carcinoma, cholangiocarcinoma, papillary carcinoma, transitional cell carcinoma, choriocarcinoma, semonoma, embryonal carcinoma, mammary carcinomas, gastrointestinal carcinoma, colonic carcinomas, bladder carcinoma, prostate carcinoma, and squamous cell carcinoma of the neck and head region; sarcomas, such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordosarcoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, synoviosarcoma and mesotheliosarcoma; hematologic cancers, such as myelomas, leukemias (e.g., acute myelogenous leukemia, chronic lymphocytic leukemia, granulocytic leukemia, monocytic leukemia, lymphocytic leukemia), lymphomas (e.g., follicular lymphoma, mantle cell lymphoma, diffuse large 13- cell lymphoma, malignant lymphoma, plasmocytoma, reticulum cell sarcoma, or Hodgkin's disease), and tumours of the nervous system including glioma, glioblastoma multiform, meningoma, medulloblastoma, schwannoma and epidymoma.

[0067] In another aspect of the invention the RNA is mRNA that encodes a protein that is capable of binding to a receptor, and said receptor binding protein is produced after incorporation of the RNA into the target cell. Preferably, binding of the protein to its receptor leads to downstream signalling cascades. The receptor binding protein may bind to a cell surface receptor or an intracellular receptor. In some embodiments, when the receptor is an intracellular receptor the receptor may be located on the nucleus or in the cytoplasm. In some embodiments the receptor binding protein encoded by the RNA is internalised after binding its target receptor.

[0068] In one aspect of the invention the RNA is mRNA that encodes a protein that disrupts cell growth. Cell growth refers to an increase in cell number driven by cell proliferation or cell division. The terms cell growth, cell division and cell proliferation are used interchangeably herein. In some embodiments, the protein that disrupts cell growth stops or interrupts the cell cycle.

[0069] The cell cycle is the series of events that take place in a cell that cause it to divide into two daughter cells. The cell cycle comprises several phases:

[0070] • G1 Phase: Metabolic changes prepare the cell for division; the cell grows physically larger and organelles are copied.

[0071] • S Phase: DNA is replicated.

[0072] • G2 Phase: The cell grows more, makes proteins and organelles, and begins to reorganise its contents in preparation for mitosis.

[0073] • M Phase: Nuclear DNA of the cell condenses into visible chromosomes and is pulled apart by the mitotic spindle, a specialised structure made out of microtubules. Mitosis takes place in five stages: prophase, prometaphase, metaphase, anaphase, and telophase.

[0074] • Cytokinesis: The cytoplasm is split in two, resulting in two individual cells.

[0075] Cyclins and cyclin-dependent kinases (CDKs) are regulatory molecules that determine a cells progress through the cell cycle. When activated by a bound cyclin, CDKs phosphorylate target proteins to activate or deactivate them leading to coordinated progression through the cell cycle.

[0076] When the RNA encodes a protein that interrupts or stops the cell cycle, the cell cycle may be stopped or interrupted at any phase.

[0077] In some embodiments the protein disrupts or abolishes DNA synthesis.

[0078] In alternative embodiments the protein inhibits CDKs. In another embodiment, the protein sequesters cyclins to prevent their binding to CDKs. In some embodiments when the RNA encodes a protein that disrupts cell growth the target cell is a cancer cell. Preferably, growth of said cancer cell is stopped.

[0079] In some aspects of the invention the RNA is mRNA that encodes a protein that causes apoptosis.

[0080] Apoptosis refers to programmed cell death and is a highly regulated process and may be activated via either an intrinsic or extrinsic pathway.

[0081] The intrinsic pathway is activated by intracellular signalling triggered by the release of proteins from the intermembrane space of the mitochondria. In the intrinsic pathway cytochrome c is released from the mitochondria through the actions of Bax and Bak. Once released, cytochrome c binds to Apaf-1 and ATP which then binds to pro-caspase- 9 to create a protein complex known as the apoptosome. The apoptosome cleaves the pro-caspase to its active form of caspase-9, which in turn cleaves and activates pro- caspase-3 into the effector caspase-3. In the intrinsic pathway, proteins known as SMACs (second mitochondria-derived activator of caspases) are released into the cytosol. SMACs bind to proteins that inhibit apoptosis (lAPs), deactivating them and preventing lAPs from arresting the process.

[0082] The extrinsic pathway is activated by extracellular receptors binding to cell-surface death receptors, leading to the formation of the death-inducing signalling complex (DISC). One mode of action for the extrinsic pathway is induced by the binding of TNF-a to its receptor, leading to caspase activation via the intermediate membrane proteins TNF receptor associated death domain (TRADD) and FAS-associated death domain protein (FADD). Another mode of action for the extrinsic pathway is induced by binding of the FAS ligand (FASL) to the FAS receptor. The interaction between the FAS receptor and FASL results in the formation of the DISC which contains the FADD, caspase-8 and caspase-10. In some cells, caspase-8 directly activates other caspases leading to execution of apoptosis. In other cells. The FAS-DISC starts a feedback loop that leads to an increasing release of pro-apoptotic factors from the mitochondria and amplified activation of caspase-8; ultimately leading to apoptosis.

[0083] There is also a caspase independent apoptotic pathway that is mediated by apoptosis- inducing-factor (AIF). Apoptosis is inhibited by anti-apoptotic factors, such anti-apoptotic factors include but are not limited to lAPs, Bcl-2 and prosurvival factors like cFLIP, BNIP3, FADD, Akt and NF-kB. The ratio of anti-apoptotic factors to pro-apoptotic factors determines whether a cell will enter apoptosis.

[0084] When the RNA encodes a protein that causes apoptosis, said protein may lead to either the intrinsic, extrinsic or caspase independent pathway of apoptosis.

[0085] In some embodiments the RNA encodes a pro-apoptotic factor.

[0086] In some embodiments the RNA encodes cytochrome c.

[0087] In some embodiments the RNA encodes a protein that is a caspase activator.

[0088] In some embodiments the RNA encodes TNF-a.

[0089] In some embodiments the RNA encodes FAS-L.

[0090] In some embodiments the RNA encodes a protein that sequesters or degrades anti- apoptotic factors.

[0091] In an embodiment when the RNA encodes a protein that causes apoptosis the target cell is a cancer cell.

[0092] In some embodiments when the RNA encodes a protein that causes apoptosis and the target cell is a cancer cell, delivery of such an RNA can be used in the treatment of cancer.

[0093] In another aspect of the invention the RNA is tRNA. In an embodiment the tRNA is a suppressor-tRNA. A suppressor-tRNA is a tRNA with a mutation (usually) in the anticodon that allows it to recognise a stop codon and insert an amino acid in its place. The suppressor-tRNA approach makes use of anticodon-engineered suppressor-tRNAs (ACE-tRNAs) designed to cross-react with endogenous aminoacyl-tRNA synthetases (aaRSs) for charging with the correct amino acid, while altering the anticodon for therapeutic suppression of premature stop codons and rescuing full-length protein expression. Suppressor-tRNAs have applications in treating diseases associated with a premature stop codon, including but not limited to: p-thalassemia, xeroderma pigmentosa, duchenne muscular dystrophy, ullrich disease and cystic fibrosis. Development of suppressor-tRNA therapeutics has been limited by lack of suitable delivery systems, however, the present invention provides a solution to this by providing a stable and highly specific RNA delivery system.

[0094] In another aspect of the invention the RNA is a miRNA. In an embodiment the RNA encodes a miRNA that can restore cell functions that are altered as part of a disease phenotype. The miRNA may regulate the expression of one or more genes in a given pathway by binding to one or more mRNA transcripts. Diseases that can be treated with miRNA include but are not limited to: alport syndrome, cancer and keloid disorder. To date, miRNA therapies have been limited in their development due to difficulties in ensuring the therapy only affects the intended target cell. The present invention provides a highly specific RNA delivery system that is suitable for such therapies.

[0095] In another aspect of the invention the RNA is an siRNA. In an embodiment the siRNA is directed to a specific gene for downregulation. In a preferred embodiment the siRNA is directed to a gene, wherein the expression of said gene is associated with a disease. Diseases that may be treated with siRNA therapies include but are not limited to: cancer, haemophilia A and B, ocular pain, dry eye disease, neurodegenerative, musculoskeletal, heart, lung, liver, skin and ocular degenerative diseases.

[0096] In an alternative embodiment, the RNA is an amiRNA. amiRNAs are a combination of siRNA sequences and scaffolds of primary miRNA transcripts. Their siRNA based design provides high target specificity while cellular processing is ensured by their miRNA based structure. Such a therapy has applications in the treatment of diseases such as Huntington’s.

[0097] In another aspect of the invention, the RNA is an snRNA designed to enable desired splicing of a gene wherein multiple splice variants exist.

[0098] In another aspect of the invention the RNA is a IncRNA. Said IncRNA may be designed for transcriptional inhibition, post-transcriptional inhibition, steric hindrance of secondary structure formation or protein interactions. The large size of IncRNAs has previously made delivery challenging.

[0099] In another aspect of the invention the RNA is a shRNA, wherein said shRNA is designed to knockdown a target gene. In an embodiment the shRNA is designed to target a gene where expression of said gene is associated with a disease; for example, cancer or neurodegenerative diseases. The skilled person would be able to design an shRNA that can target their specific gene of interest to meet their specific requirements.

[0100] In another aspect of the invention the RNA is an sgRNA, wherein said sgRNA is designed to target a gene of interest for genome editing. In an embodiment the sgRNA is designed for genome editing of a gene associated with a disease. The skilled person would be able to design an sgRNA to target their gene of interest and introduce the desired edit.

[0101] In an embodiment methods and systems of the present invention are used for in vitro diagnostics. In an embodiment, the RNA delivered to a target cell for in vitro diagnostics is a probe. RNA probes are stretches of single-stranded RNA used to detect the presence of complementary nucleic acid sequences (target sequences) by hybridization. Preferably, the RNA probe comprises a label to enable visualisation upon binding to the target sequence. Non-limiting examples of such labels include non-hybridizing biotin- or digoxigenin-labelled regions of an RNA probe that enable the associated target to be visualized in a specific colour after chromogenic development. Methods and systems of the present invention may be used to detect any nucleic acid sequence of interest in a target cell; in particular, a nucleic acid associated with disease.

[0102] In another embodiment the RNA is an aptamer. Aptamers are short, single-stranded DNA or RNA (ssDNA or ssRNA) molecules that can selectively bind to a specific target, including, but not limited to: proteins, peptides, carbohydrates, small molecules and toxins. Aptamers can detect small differences between very similar molecules. They can be used to differentiate between similar bacterial strains and between cancerous and non-cancerous cells. Aptamers can be conjugated to a wide range of detection molecules without loss of affinity or selectivity, enabling enhanced in vitro and in vivo imaging. Certain aptamers are able to change conformation upon binding to their target, such aptamers are referred to as structure-switching aptamers. Structure-switching aptamers can be designed to generate a detectable signal (fluorescent, electrochemical, etc.) upon binding to their target. This self-signalling ability enables fast, selective detection in complex samples. Structure-switching aptamers can be used as selective biosensors, in detection assays and diagnostics. Aptamer-based biosensors, or “aptasensors”, have been used for detection of circulating cancer biomarkers including VEGF165, for direct detection of cancer cells. Structure-switching apatmers also have applications in detecting drugs, hormones, metabolites, and many other molecules.

[0103] RNA can be encapsulated in a VLP using techniques known in the art. Such methods are disclosed in Peyret, H., Lomonossoff, G.P. (2022). Specific Packaging of Custom RNA Molecules into Cowpea Mosaic Virus-like Particles. In: Schillberg, S., Spiegel, H. (eds) Recombinant Proteins in Plants. Methods in Molecular Biology, vol 2480. Humana, New York, NY. https: / / doi.org / 10.1007 / 978-1-0716-2241-4 7 and Hadrien Peyret, Elisabetta Grappelli, David Clark, Nicholas Eckersley, Tim Planche, Julian Ma, George P. Lomonossoff, Production and use of encapsidated RNA mimics as positive control reagents for SARS-CoV-2 RT-qPCR diagnostics, Journal of Virological Methods, Volume 300, 2022, 114372, ISSN 0166-0934, https: / / doi.Org / 10.1016 / j.jviromet.2021.114372. In short, VLP replication machinery is coexpressed with the VLP coat protein precursor together with the RNA sequence of choice. This co-expression results in large quantity of VLPs containing the desired RNA sequence. Preparing VLPs using this method results in RNA containing VLPs that are stable for a period of months in refrigerated conditions.

[0104] Scaffold based binding proteins (SBPs) are proteins that are designed to bind to a specific target molecule by incorporating a pre-existing protein scaffold into its structure. The scaffold provides the protein with a stable framework, while the binding domains are specifically designed to interact with the target molecule. SBPs have several advantages over traditional antibodies. They are typically smaller, easier to produce, can be more specific and have a higher affinity for their target molecules as well as being less likely to elicit an immune response. Additionally, they can be designed to bind to a wider range of target molecules than antibodies. The versatility of SBPs allows for SBPs to be engineered that can bind to any given molecule.

[0105] Scaffold based binding proteins typically fall in the size range of 2-50 kDa, 2-40 kDa, 2- 30 kDa, 2-20 kDa, or preferably 4-20 kDa. Examples of SBPs include but are not limited to: affimers, affibodies, DARPins, anticalins, kunitz domain inhibitor scaffolds, avimers, knottins, fynomers, atrimers, CTLA4-based binders, affilins and armadillo repeat proteins. Affimers are generally in the size range 12-14kDa, affibodies 6-7kDa, and DARPins 14-18kDa.

[0106] In an embodiment methods and systems of the present invention comprise at least one SBP, wherein said SBP is selected from at least one or any combination of an affimer, affibody, DARPin, anticalin, kunitz domain inhibitor scaffolds, avimer, knottin, fynomer, atrimer, CTLA4-based binder, affilin or armadillo repeat protein.

[0107] Preferably, the at least one SBP is selected from at least one or any combination of an affimer, an affibody or DARPin.

[0108] More preferably the at least one SBP is an affimer.

[0109] Affimers are small recombinant proteins that are based on a stable protein scaffold, derived from the cysteine protease inhibitor family of cystatins. The scaffold contains a four-stranded β sheet and an a helix containing two variable binding loops each containing nine amino acids that can be replaced with alternative randomized sequences which are used to generate affimer libraries. This allows screening of large quantities of protein-binding molecules for specific selection of high affinity binders of the target protein. Affimer proteins are smaller than antibodies meaning that they tend to have better tissue penetration advantages in solid tumours. Affimer proteins can also be fused to each other to form multi-specific therapies, or to other proteins, such as the C-terminus of an antibody, to generate bispecific formats.

[0110] DARPins (designed ankyrin repeat proteins) are artificial scaffolds based on human ankyrin repeat domain proteins which are abundant intracellular adaptor molecules binding to various proteins with different biological consequences, such as inhibition of complex formation. DARPins are composed of two to four randomized, genetically fused repeats which are flanked by N- and C-terminal-capping repeats which are essential for efficient folding and for avoiding aggregation. Because of their large surface area, DARPins have a potentially larger binding area than typical globular proteins. DARPins are very stable proteins, the midpoints of denaturation range between 66°C and 95°C, depending on the number of repeats. They can be labeled radioactively, conjugated with small molecule toxins, or fused to cytokines or cytotoxic proteins. A single DARPin can be directed against different epitopes on the same target, or against several targets, i.e. a DARPin can have multiple specificities.

[0111] The scaffold for affibodies is derived from the B-domain in the Ig-binding region of Staphylococcus aureus protein A. It is based on a non-cysteine three-helix bundle domain. A single mutation was introduced into helix 2 to obtain increased chemical stability and loss of Fab binding activity. The surface interacting with antigen is made up by two randomized a-helices, and differs significantly from the corresponding surface in immunoglobulins which is generated by six variable peptide loops. Diversity is created by randomization of solvent accessible residues in helices 1 and 2. Due to the small size, functional affibody proteins can also be produced by chemical synthesis. Affibodies are highly soluble, stable, rapidly removed from the circulation, and can be conjugated with toxins and fluorophores, radioactive labels, or chemical groups for immobilization. Due to their small size, effective tissue penetration is expected. Affibodies may have multiple specificities i.e. a binding affinity for multiple targets.

[0112] In one embodiment the SBP has multiple specificities. An SBP with multiple specificities can simultaneously bind multiple different targets. Preferably, the SBP is bispecific; a bispecific SBP can simultaneously bind two different targets.

[0113] In certain embodiments, the SBP directs the VLP encapsulated RNA to a disease site, such as, a tumour, a site of inflammation, a site of wound healing, a site of infection, a site of soft tissue damage, a site of bone or cartilage damage, a site of immune cell regeneration, across the blood-brain barrier, or a site of fat cell deposition.

[0114] In the context of the present invention the VLP encapsulated RNA is delivered to a target cell. Said VLP encapsulated RNA may be delivered to a target cell in vivo or in vitro.

[0115] The term “cell” as used herein is intended to refer to any known cell type. Such cells may be eukaryotic, prokaryotic, immortalised cell lines or primary cells. In some embodiments, the target cell comprises stem cells, committed stem cells, differentiated cells, primary cells, and tumour cells. Examples of stem cells include, but are not limited to, embryonic stem cells, bone marrow stem cells and umbilical cord stem cells. Other examples of cells used in various embodiments include, but are not limited to, osteoblasts, myoblasts, neuroblasts, fibroblasts, glioblasts, germ cells, hepatocytes, chondrocytes, keratinocytes, smooth muscle cells, cardiac muscle cells, connective tissue cells, glial cells, epithelial cells, endothelial cells, hormone-secreting cells, cells of the immune system, and neurons.

[0116] In an embodiment the target cell is an immune cell. Non limiting examples of immune cells that may be the target cell of the present invention include: dendritic cells, natural killer (NK) cells, macrophages, B lymphocytes and T lymphocytes. Methods and systems of the present invention can be used to deliver RNA to an immune cell to change its function and generate a therapeutic immune response to treat a disease. The costimulatory molecules CD40, CD80 and CD86 are crucial for efficiently activating T cells by dendritic cells. Methods and systems of the present invention may be used to disrupt the expression of these co-stimulatory molecules, or to induce their expression.

[0117] Macrophages can eliminate pathogens and abnormal cells through phagocytosis. Methods and systems of the present invention can be used to intervene in phagocytosis. For example, encoding a specific ligand or a single-chain variable fragment (scFv) that can block the “do not eat me” signal (CD47-SIRPa) can be used to encourage phagocytosis of cells such as cancer cells which evade phagocytosis by expressing such signals. Macrophages are highly heterogeneous and are usually categorized into classically activated proinflammatory M1 macrophages and alternatively activated antiinflammatory M2 macrophages. In another example, methods and systems of the present invention may be used to deliver mRNAs encoding interferon regulatory factor 5 (IRF5) and inhibitor kappa B kinase (IKK ) to M2 macrophages to reprogram immunosuppressive M2 macrophages into antitumor M1 macrophages. In a further example, methods and systems of the present invention may be used to deliver mRNA encoding anti-inflammatory glucocorticoid-induced leucine zipper to macrophages in the treatment of autoimmune diseases.

[0118] NK cells are cytotoxic lymphocytes of the innate immune system with the ability of eliminating harmful cells including malignant cancer cells. However, the immunosuppressive tumour microenvironment inhibits their cytotoxic function, limiting the clinical application of NK cell therapy. Methods and systems of the present invention can be used to knock down inhibitory receptors of NK cells, such as programmed cell death 1 (PD1) and transforming growth factor beta receptor 2 (TGFBR2), which is a promising solution for enhancing the antitumor functions of NK cells. In addition, chimeric antigen receptor-NK (CAR-NK) cell therapy has been shown to efficiently eliminate cancer cells with minimal side effects by using CAR structures to redirect NK cells to specifically recognize and attack cancer cells. Methods and systems of the present invention can be used to deliver mRNA encoding CAR molecules to engineer NK cells into CAR-NK cells as a cancer therapy.

[0119] T lymphocytes can recognize pMHC I and pMHC II of DCs, and develop into different subtypes, including effector or regulatory T cells. CAR structures equip T cells with cytotoxic function without the help of MHC molecules. Methods and systems of the present invention can be used to deliver mRNA to express CAR molecules on T lymphocytes to generate CAR-T cells. In addition to this, methods and systems of the present invention can be used to knockdown inhibitory immune checkpoint PD1 , or deliver PD1-scFv-encoding mRNA to block PD1 to enhance the antitumor functions of CAR-T cells.

[0120] B cells can recognize antigens and develop into plasma cells to produce antigen-specific antibodies, which is also an important target cells for mRNA vaccines. Methods and systems of the present invention can be used to deliver mRNA to express the transcriptional repressors B cell lymphoma 6 and B-lymphocyte induced maturation protein-1 , or transcription factors paired box 5 and X-box-binding protein-1 to regulate the formation of plasma cells. In addition, B cells participate in many autoimmune diseases, such as systemic lupus erythematosus and rheumatoid arthritis. Methods and systems of the present invention can be used to knock down B-cell activating factor receptor (BAFFR), CD20 or CD19 for treating autoimmune diseases by interfering with the survival of B cells.

[0121] In an alternative embodiment the target cell is a cancer cell. Examples of cancer cells and non-limiting applications of the invention are described above.

[0122] Methods and systems of the present invention can be used to treat disease. Examples of such diseases include but are not limited to: cancer, neurodegenerative disease, autoimmune disease, heart disease, metabolic diseases, respiratory disease, infection, haematological disorders, and ophthalmic disorders. As used herein, the terms "treat," "treated," or "treating" when used with respect to an adverse condition, such as a disorder or disease (e.g., cancer, infection, neurodegenerative disorder, or any other disease or disorder) may refer to prophylaxis, amelioration, prevention and / or cure of the condition. Treatment after a condition (e.g., disease or disorder) has started aims to reduce, ameliorate or altogether eliminate the condition, and / or its associated symptoms, or prevent it from becoming worse. Treatment of subjects before a condition has started (e.g., prophylactic treatment) aims to reduce the risk of developing the condition and / or lessen its severity if the condition does develop. As used herein, the term "prevent" refers to the prophylactic treatment of a subject who is at risk of developing a condition resulting in a decrease in the probability that the subject will develop the disorder, and / or to the inhibition of further development of an already established disorder. Desired outcomes may include a stabilization of the condition, a slowdown in progression of the disease or a full disease-free recovery of the subject. The VLP encapsulated RNA described herein may be administered per se (neat) or in the form of a pharmaceutically acceptable formulation. If the VLPs are administered in pharmaceutically acceptable solutions, they may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients. The solutions used preferably are sterile. The pharmaceutical compositions contain an effective amount of VLPs optionally included in a pharmaceutically-acceptable carrier.

[0123] Methods and systems of the present invention may be used for any suitable application. Non limiting examples of such applications are given below:

[0124] • To deliver the RNA of a therapeutic protein which can then be expressed by the target cell.

[0125] • Silence a gene.

[0126] • Downregulate expression of a gene.

[0127] • Genome editing, for example, to correct a gene mutation.

[0128] • Deliver a vaccine.

[0129] • Diagnostics, for example, by delivering a probe or an RNA aptamer to a cell.

[0130] While the foregoing disclosure provides a general description of the subject matter encompassed within the scope of the present invention, including methods as well as the best mode of making and using this invention, the following examples are provided to further enable those skilled in the art to practice this invention and to provide a complete written description thereof. However, those skilled in the art will appreciate that the specifics of these examples should not be read as limiting on the invention, the scope of which should be apprehended from the claims and equivalents thereof appended to this disclosure. Various further aspects and embodiments of the present invention will be apparent to those skilled in the art in view of the present disclosure.

[0131] "and / or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" is to be taken as specific disclosure of each of (i) A, (ii) B and (iii) A and B, just as if each is set out individually herein.

[0132] Unless context dictates otherwise, the descriptions and definitions of the features set out above are not limited to any particular aspect or embodiment of the invention and apply equally to all aspects and embodiments which are described.

[0133] The invention is now described in the following non-limiting examples.

[0134] Example 1 : Identification of Affimers which Bind Cellularly Expressed HER2

[0135] Initially eight affimers that bind to the extracellular domain (ECD) of HER2 (amino acids 1-652) were isolated using phage display [7, 8], The ability of these Affimers to bind native HER2 expressed by breast cancer cells, as opposed to the Fc conjugated version used in phage screening, was assessed by affinity precipitation. Six Affimers; H7, H8, H9, D7, D11 and E8, precipitated HER2 from lysates of HER2 overexpressing cell lines, AU-565 and BT-474, but not from the HER2 negative cell line MDA-MB-231 (Figure 1a). This demonstrates the ability of HER2-binding affimers to recognise HER2-expressing breast cancer cells. In parallel, affimers with high affinity for cellularly expressed HER2 were isolated. To do this, we screened the enriched phage pool from the protein screen against monolayers of fixed cancer cells expressing moderate levels of HER2 with a HER2-negative cell line (MCF-7) as negative-selection pan. From 20 clones sequenced following phage ELISA two Affimers (D11 and H7) were isolated which had been previously identified by our standard approach (Figure 1 b). These two Affimers were then taken forward for subsequent characterisation as they showed the most promise for successful binding to HER2 on live cells. Example 2: HER2-binding Affimers are Internalised by Breast Cancer Cell Lines Expressing Native HER2

[0136] For use as a delivery mechanism it is necessary for relevant binding affimers to be internalised by the relevant target cell. In this case, it is necessary for the HER2-binding Affimers to be selectively internalised by HER2-positive breast cancer cell lines, as seen with other SBPs [11 , 13, 14, 20, 21] and antibody-drug conjugates such as Trastuzumab- emtansine

[0022] , To visualise internalisation AlexaFluor 488TM-was conjugated to a C- terminal cysteine on the HER2-binding Affimers D11 and H7 via a maleimide linker, and conjugation verified by mass-spectrometry (data not shown). After 1 hour treatment of HER2-positive breast cancer cell lines with 25 μg / mL AlexaFluor 488TM-conjugated HER2-binding Affimers showed a clear association with both the membrane and the cytosol demonstrating internalisation, whilst no association or internalisation was seen in the HER2-negative MDA-MB-231 cells (Figure 2a and b). The internalisation process was determined, in part, to be via receptor-mediated endocytosis as HER2-binding affimers co-localised with markers of the early endosome EEA1 ; (Figure 2c) and d)) and, to a small degree with, the lysosome marker LAMP2 (Figure 2e and f). The timepoint used may be too early to see considerable co-localisation with the latter, especially as not all affimer appears to be internalised by this pathway. This method of internalisation, via receptor-mediated endocytosis, has been seen for Trastuzumab

[0023] (and its derivatives

[0024] ) as well as the targeted phototoxin DARPin-miniSOG fusion protein

[0025] , and is frequently accompanied by recycling of HER2 to the membrane [24, 25],

[0137] This data shows that affimers are internalised by their relevant target cells and thus are suitable to be used as part of a delivery mechanism.

[0138] Example 3: Affimer Drug Conjugates Selectively Reduce Cell Viability in HER2- Expressing Cell Lines in a Dose-Dependent Manner

[0139] Interestingly, although the HER2-binding affimers clearly bind HER2 they did not affect cell viability directly (Figure 3a and b). This phenomenon has been seen with other SBPs, notably the HER2-binding Affibody (ZHER2:342) that alone was non-toxic towards both SKBR3 breast cancer cells and SKOV3 ovarian cancer cells

[0021] , and also with monovalent HER2-binding DARPins and BT474 cells

[0026] , As the affimers alone were not cytotoxic, we used a similar approach to Sochaj-Gregorczyk et al.

[0013] and conjugated the HER2-binding affimers to monomethyl auristatin E (MMAE) via cathepsin cleavable linker, to determine their ability to delivery this cytotoxic moiety into cells (Figure 3c). The cytotoxic effects of the conjugates on a range of cancer cell lines with varying HER2 expression levels (Figure 3d) were determined by AlamarBlueTM measurement of cell metabolic activity 72 hours after treatment. In HER2-expressing breast cancer cell lines affimer-MMAE conjugates reduced metabolic activity between 90 and 30% at the top dose of 36 nM depending on the level of HER2 expression with low nanomolar IC50 values (Figure 3e and f; Table 1). Interestingly, the affimer-MMAE conjugates had a considerable cytotoxic effect in the MCF-7 cell line despite this cell line showing minimal HER2 expression as assessed by immunoblotting (Figure 3d). However, this result is in line with previous studies using trastuzumab-MMAE conjugates [27, 28] which also showed that the dosing strategy is important as to whether MCF-7 cells are responsive to trastuzumab-MMAE

[0028] , Thus HER2-binding affimers can deliver cytotoxic moieties to cells in similar fashion to antibody drug conjugates and as seen previously with other SBPs, notably affibodies where ZHER2:2891-DCS-MMAE showed IC50 values of 5.2 nM against SKBR3 cells and 24.8 nM against MDA-MB-453 cells, with IC50 values against the HER2 negative line MDA-MB-231 of 161.5 nM

[0013] , The ability of the affimer-MMAE conjugates to induce cytotoxicity adds support for their internalisation via receptor-mediated endocytosis as endosomes / lysosomes are a major cellular location of the cathepsin enzyme

[0029] required to cleave MMAE from the Affimers to provide its cytotoxic effects. These results show that affimers are suitable for use as delivery systems for cytotoxic substances into cells.

[0140] Table 1. Cytotoxicity of HER2-binding Affimer MMAE conjugates. IC50 values calculated from Almar Blue™ measurements of cell metabolic activity (Figure 3e) and f)) using GraphPad Prism v 9.0, [Inhibitor] vs. response -- Variable slope (four parameters). Data is mean ± SEM, n = 3 independent experiments.

[0141] Cell line IC50D11-MMAE (nM) IC50H7-MMAE (nM) Example 4: Affimer-MMAE Conjugates Bind to Recombinant HER2 but not HER3 with nM affinity

[0142] The small variations in efficacy of the two Affimer-MMAE conjugates may arise from differing affinities for HER2 and / or targeting of the structurally similar HER3. To investigate these possibilities, we utilised surface plasmon resonance (SPR). Neither of the Affimer-MMAE conjugates bound the ECD of HER3 (amino acids 1-643) whilst as expected both D11-MMAE and H7-MMAE bound the ECD of HER2 (amino acids 1-652). The KD values were calculated using a 1 :1 Langmuir binding model with AfD11-MMAE binding HER2 ECD with a KD of 12.0 ± 0.64 nM whilst AfH7-MMAE bound with a KD of 76.5 ± 3.56 nM, thus the lower affinity of AfH7-MMAE may underlie its lower potency when compared to AfD11-MMAE. These affinities are in a comparable range with other HER2-targeting SBPs as HER2-binding DARPins showed KD values in the range of 7.3- 28 nM when first isolated

[0030] , which has subsequently been improved by error-prone PCR to 91 pM

[0031] , whilst HER2-binding Affibodies had KD values of 50 nM

[0032] that were improved to 22 pM [11 , 12], Thus, demonstrating our HER2-binding affimers have the scope to perform as well as other SBPs as they have not undergone any maturation processing. These results show that affimers are highly specific, thus making them ideal for use as a delivery system to specific cell types without off-target effects.

[0143] Example 5: HER2-bindinq Affimers can be used to Deliver Large Payloads

[0144] Having demonstrated the ability of affimers to deliver small cytotoxic payloads with comparable efficacy to other such systems [12, 13, 20, 26, 30-32], the assessment of their suitability to deliver larger cargos was explored. The ability to deliver larger cargos may help to overcome issues of renal clearance that occur with SBPs as unmodified SBPs are typically cleared in a single pass as they are below the 60kDa threshold

[0033] , Rather than select a specific molecule we opted to use affimers to deliver virus-like particles (VLPs), the advantage of which is the contents of the VLP may be varied; to date VLPs have been loaded with cytotoxics, siRNAs and proteins

[0018] , Also, VLPs are known to result in an immune response which may help cancer treatments or vaccine efficacy [34-37], To achieve this, we utilised the ability of affimers to bind to the L subunit of the coat protein of VLPs from cowpea mosaic virus (CPM V)

[0019] and created an affimer dimer consisting of the higher affinity HER2-binding Affimer - D11 and the CPMV VLP binding affimer

[0019] , This affimer dimer was then incubated with VLPs produced from Nicotiana benthamiana leaves which were infiltrated with agrobacterial suspensions containing plasmids encoding CPMV RNA-1 , VP60 and eGFP RNA

[0038] , The composition of this VLP population was 5% containing eGFP RNA, 5% RNA-1 containing and 90% empty VLPs as measured by isopynic centrifugation over caesium chloride gradients. The uptake of these affimer dimer-VLP conjugates by HER2-overexpressing and HER2-negative cell lines was analysed by microscopy, the percentage of cells positive for eGFP expression after 72 hour treatment (Figure 4a)). The CPMV VLPs display 20 potential binding sites for the affimer dimer

[0019] , so we tested a variety of VLP to affimer dimer ratios including in excess. Uptake of VLPs without affimer dimer conjugation was minimal (0.5% or less for all cell lines tested). In HER2-overexpressing cell lines, eGFP expression increased in a dose dependent manner as the ratio of affimer dimer to VLPs increased, which was not seen in the HER2-negative, MDA-MB-231 , cell line when corrected for the differential levels of auto-fluorescence in each cell line (Figure 4b and c). None of the affimer dimer VLP ratios were toxic to cells at the 0.07μM concentration of VLP used in these experiments (Figure 4d).

[0145] Thus, we have shown that dimeric affimers can be used to for targeted delivery of VLPs to cancer cells. We then determined the versatility of this approach by replacing the HER2-binding affimer with a HER2-binding Affibody ZHER2:342

[0012] or a HER2-binding DARPinG3

[0031] , Alphafold2 modelling

[0039] shows the predicted binding site of HER2- binding Affimer D11 to be distinct from both Affibody ZHER2:342and DARPinG3 binding across subdomains II and III in a similar position to pertuzumab (Figure 5a and b). Both the Affibody-Affimer and DARPin-Affimer SBP dimers were still capable of delivering VLPs to SKBR3 HER2-positive cells as measured by eGFP fluorescence (Figure 5c). Intriguingly, however both the Affibody-Affimer dimer and the DARPin-Affimer dimer were less effective at delivering VLPs to HER2 positive cell lines than the dimeric Affimer (One-way ANOVA with Dunnett’s post hoc test p<0.0001 for both Affibody and DARPin vs Affimer; Figure 5d) despite both these SBPs have a higher affinity for HER2 than the HER2-binding Affimer used in the Affimer dimer [12, 31], The decreased VLP uptake seen may result from altered biophysical properties of the affibody and DARPin by the addition of the C terminal VLP-binding affimer or vice versa. Further studies are required to explore this phenomenon and the precise mechanism of VLP uptake.

[0146] Utilising SBPs to deliver nanoparticle cargoes, in this case VLPs, has major advantages over antibodies, predominantly that of size. The smaller size of SBPs mean a greater number of SBPs can bind to the nanoparticle surface

[0040] and thus greater delivery capacity and tumour penetrations

[0041] , However, Elias et al.,

[0042] showed that the optimal number of SBPs per particle for efficacious deliver of superparamagnetic iron oxide nanoparticles to cells for MRI applications is sub-maximal, whether this applies to VLPs will require further investigation. Our dimeric affimer utilises the native L subunit found on CPMV VLPs so functionalisation is not required. Additionally, we delivered RNA rather than protein, which directly overcome the limitations associated with protein loading of VLPs that include amount of cargo, cellular localisation of cargo and release of cargo

[0048] , It will be interesting to explore the loading of other cargoes into the CPMV VLPs and determine their cellular effects.

[0147] CPMV VLPs may not even require cargo loading when used in a cancer situation in vivo as it has been reported that both wild-type VLPs and empty capsids are immunostimulatory in mice when injected intratumorally

[0049] , The former had greater immunostimulatory properties and thus greater impacts on tumour growth, the authors attributed this to the presence of RNA within the wild-type VLPs that was lacking for the empty capsids. Thus, loading RNA for marker proteins such as the eGFP used in this study, prodrugs or other cargoes capable of inducing cell death could enhance these effects by providing a dual approach in a single therapeutic.

[0148] In this study we have isolated affimers that bind the extracellular domain of HER2 with nanomolar affinity. We have demonstrated that these affimers recognise and bind HER2 when present on breast cancer cells resulting in internalisation. This was then utilised to deliver the cytotoxic MMAE with clear impacts on cell viability in a HER2 dependent manner. HER2-binding affimers are comparable to other HER2-binding SBPs, notably Affibody ZHER2:342

[0012] and HER2-binding DARPinG3

[0031] , in these attributes. The ability of all these SBPs to permit targeted delivery of nanocargos to HER2 positive cells was then demonstrated by the expression of eGFP from RNA encapsulated in CPMV VLPs by utilising an affimer that binds L subunit of the VLP coat protein. Thus, we have demonstrated that easily producible, low cost affimers can be used to specifically target VLPs to cells. The work here shows affimers provide easily produced, low-cost targeted therapeutic alternatives to current monoclonal antibody-based treatments. This has applications in the treatment of cancer, neurological diseases, metabolic diseases, cardiovascular diseases, autoimmune diseases, haematological disorders, ophthalmic disorders and vaccine delivery. Example 6: Expression of proteins using a modified vector.

[0149] The below vectors have been successfully used by the inventors to load bespoke RNA molecules into VLPs for delivery to mammalian cells.

[0150] • pHREAC-VP60 - which enables expression of the CPMV coat protein in-planta.

[0151] • pEAQ-RNA1-WT - which allows for the in-planta production of the CPMV RNA1 components required for processing of the coat protein and packaging of RNA1 and RNA 2 into the CPMV particles.

[0152] • pEAQ-NonHT-RNA2 - which allows for the in-planta production of modified CPMV RNA2 containing bespoke RNA that can be packaged into the CPMV particles. The sequence of this vector is given in SEQ ID NO: 1.

[0153] The inventors made modifications to the pEAQ-RNA2 vector to facilitate the expression of recombinant proteins from the packaged RNA2 molecules upon their successful delivery into mammalian cells. The modifications in question were the introduction of the Poliovirus IRES (internal ribosome entry site) upstream of the gene of interest (in this case, GFP) to allow for initiation of the translation of that RNA into protein in a capindependent manner. The second part of the modification was to include part of the Poliovirus 3’ NTR (non-translated region) after the gene of interest as an enhancer of translation and to increase RNA stability. These additions were inserted internally to the CPMV RNA2 sequences that were present in the vector; the full modified vector sequence, including the target gene (GFP) is given in SEQ ID NO: 2.

[0154] The inclusion of two or more IRES elements allows for the expression of multiple target proteins / antigens from the RNA2 molecule e.g. facilitating multi-valency antigen production.

[0155] Two batches of CPMV molecules (RCO 22-012 and RCO 22-013) were produced using the modified RNA2 vector and used for CPMV uptake experiments. These batches achieved successful RNA delivery and GFP expression as evidenced by positive results in fluorescence microscopy and western blot analysis.

[0156] Materials and Methods

[0157] Culture of cell lines

[0158] AU-565, SKBR3 BT-474, MDA-MB-453, MCF-7, MDA-MB-231 and ZR-75-1 were purchased from ATCC. AU-565, BT-474, MCF-7, MDA-MB-453 and ZR-75-1 cell lines were maintained in RPMI-1640 (Gibco, Paisley, UK) supplemented with 10% foetal bovine serum (FBS; Gibco), whilst SKBR3 and MDA-MB-231 cell lines were maintained in Dulbecco's Modified Eagle's Medium (Gibco) supplemented with 10% FBS, at 37°C and 5% CO2. All cell lines used in this study were mycoplasma free and their identities were confirmed by STR profiling.

[0159] Isolation of HER2-binding Affimers

[0160] Target biotinylation, selection of Affimers by phage display and phage ELISA against the ECD of HER2 was as previously described [8, 9], Briefly, biotinylated HER-2 ECD-FC tagged (Sino Biologicals, Eschborn, Germany; EZ-Link® NHS-Biotin, Thermo Scientific, Waltham, MA; five-fold molar excess) was immobilised on blocked (2x blocking buffer, Sigma) streptavidin wells. The Affimer phage library was applied for 2 hours and unbound phage removed by PBS-T washes (27 times). Bound phage were eluted in a two-phase step, firstly with 0.2 M Glycine pH 2.2 neutralised with 15 mL of 1 M Tris-HCI, pH 9.1 and then 7.18 M Triethylamine, pH 11 neutralised with 1 M Tris-HCI, pH 7. Three panning rounds were undertaken and after the final panning round 48 randomly picked colonies were used in phage ELISA with positive clones sent for sequencing [7-9],

[0161] Three additional panning rounds were performed on a 6-well plate contained a monolayer of fixed-cells. Approximately 1.2x106of MCF-7 (non-target cells) and MDA- MB-453 (target cells) cells were fixed with 4% paraformaldehyde (SigmaAldrich, Gillingham, UK) for 15 min at room temperature. Prior to overnight blocking with 2X casein buffer at 4°C, fixed cells were washed three times with PBS solution supplemented with 0.1% sodium Azide. Following overnight blocking, 100 mL of eluted phage from the third panning round (1 :10 dilution prepared with 10X casein blocking solution) were pre-panned on a blocked well containing no cells followed by another 40 min on fixed MCF-7 cells at room temperature. Then, an equal volume of pre-panned phage were added on target and non-target fixed-cells and incubated for 2 hours at 50 rpm shaking speed. Prior to elution, wells were washed 10 times (5 min each) with 1 ml of PBS, pH 7.4. Cell-bound phage were then eluted as detailed above, after the final panning round 48 randomly picked colonies were used in phage ELISA [7-9] against approximately 8 x103fixed MCF-7 or MDA-MB-453 cells in 96 well plates with positive clones sent for sequencing identifying 2 unique sequences.

[0162] Production of HER2-binding Affimers

[0163] The eight unique sequences were cloned into pET11a, with or without a C terminal cysteine, using the Nhel and Notl sites. The SBP dimer coding sequences were designed with a GSGGSGGSGG linker sequence separating the HER2 -binding SBP sequences from the VLP binding Affimer sequence, and differed in codon usage for each Affimer scaffold sequence. The sequences were synthesised by GenScript Biotech (Piscataway, NJ) and inserted between the Ndel / BamHI sites of pET-11a. HER2-binding Affimers and SBP dimers were produced in BL21 STAR™ (DE3) E. coli (Life Technologies, Invitrogen) and affinity purified using Ni-NTA resin as previously described [7-9],

[0164] Protein extraction, affinity precipitation and immunoblotting

[0165] Mammalian cell lines were expanded to 80% confluency and pelleted by centrifugation at 1000 x g for 5 min. Pellets were lysed in with 1 mL mammalian cell lysis buffer (25 mM Tris-HCI, 150 mM NaCI, 5% glycerol (v / v), 1 % NP-40 (v / v), pH 7.0) supplemented with Pierce Halt™ EDTA free protease inhibitor cocktail (ThermoFisher) and incubated at 4°C with rotation for 35 min, followed by centrifugation at 12,000 x g for 20 min. Protein concentration was determined using a Pierce BCA Protein Assay Kit (ThermoFisher) as per manufacturer’s instructions.

[0166] For affinity precipitation 2 mg / mL mammalian lysates were mixed with 0.65 mg / mL Affimers in mammalian lysis buffer and incubated overnight at 4°C with rotation. Affimer- HER2 complexes were isolated using Ni-NTA chromatography. Briefly, the overnight mixtures of Affimer and cell lysate were incubated with Ni-NTA slurry (Abeam, Cambridge, UK) for 90 min at 4°C with rotation. Saturated slurry was then washed 5 times (50 mM NaH2PO4, 500 mM NaCI, 20 mM Imidazole, 0.1% Tween 20 (v / v) pH 7.4) and eluted in 50 μL elution buffer (50 mM NaH2PO4, 500 mM NaCI, 300 mM Imidazole, 20% glycerol, pH 7.4) at 4°C. Samples were mixed with 4 x loading buffer (200 mM Tris- HCI, pH 6.8, 20% (v / v) glycerol, 8% (w / v) SDS, 0.4% (w / v) bromophenol blue, 20% (v / v) P-mercaptoethanol (Fisher Scientific, Loughborough, UK) and heat denatured at 95°C for 5 minand run on 8 or 15% SDS-PAGE gels as detailed below.

[0167] For immunoblotting 10-15 pg of lysates were heated with 4x loading buffer for 5 min at 95°C, loaded onto 8 or 15% SDS-PAGE gels and run at 150 V before transfer to nitrocellulose membrane using the BioRad Transblot Turbo (BioRad, Hercules, CA). Membranes were blocked in 5% (w / v) milk (SigmaAldrich) in TBS-T (0.1 % v / v) for 1 hour room temperature and incubated with primary antibody rabbit anti-HER2 (2165S, Cell Signalling Technology, Danvers, MA; 1 :10,000; overnight at 4°C), rabbit anti-6xHisTag HRP (ab1187, Abeam; 1 :10,000; 1 hour at room temperature) or rat anti-a-tubulin (MCA78G, BioRad; 1 :3000), in 5% (w / v) milk. Membranes were washed 3 times in TBS- T and incubated with secondary antibody goat anti-rabbit HRP (ab97051 , Abeam; 1 :10,000) or goat anti-rat HRP (ab97057, Abeam; 1 :10,000) in 5% (w / v) milk for 1 hour at room temperature if required. Membranes were washed 3 times in TBS-T and developed with Immobilon® Forte Western HRP Substrate (Millipore, Burlington, MA). Membranes were imaged on an Amersham Imager 600 (GE Healthcare, Chicago, IL) and images analysed with ImageQuant TL v8.1.0.0 (GE Healthcare).

[0168] Conjugation of Affimers

[0169] Affimers were conjugated to AlexaFluor 488™ C 5 malemide (A10254, ThermoFisher), or monomethyl auristatin E (MMAE) malemide with a cathespin cleavable linker and p- aminobenzyloxycarbonyl spacer (Broadpharm Therapeutics) via C terminal cysteine. Purified Affimers were diluted to 0.5 mg / mL in PBS and incubated with washed immobilised TCEP disulphide-reducing gel (ThermoFisher) for 1 hour at room temperature. Affimers were then incubated with AlexaFluor 488™ or MMAE respectively for a further 2 hours at room temperature. Affimer-MMAE conjugates were quenched with β-mercaptoethanol (FisherScientific). All conjugates were desalted using 7 MWCO 0.5 mL Zeba spin columns (ThermoFisher) as per manufacturer’s instructions and stored at 4°C. Conjugation was confirmed by mass spectrometry. Protein desalting and mass analysis was performed by liquid chromatography mass spectrometry (LC-MS) using an M-class ACQUITY UPLC (Waters UK, Manchester, UK) interfaced to a Xevo QToF G2- XS mass spectrometer (Waters UK, Manchester). Samples were diluted to 5 μM using 0.1 % TFA. 1 μL of the 5 μM sample was loaded onto a MassPREP protein desalting column (Waters UK, Manchester) washed with 10% solvent B in A for 5 min at 25 μL min-1. After valve switching, the bound protein was eluted by a gradient of 2-40%

[0170] Immunofluorescence using confocal microscopy

[0171] Cells were seeded onto coverslips in a 24 well plate at 3 x 104cells / mL. The following day coverslips were washed once in 1 x DPBS and incubated with 25 pg / mL Affimer- AlexaFluor 488™ conjugate in OptiMEM (Gibco) for 1 hour. Cells were washed 3 x in PBS prior to fixing in 4% paraformaldehyde for 15 min followed by permabilisation with 0.1% Triton-X100 in PBS for 5 min. Cells were washed in PBS and blocked with 1 % milk (Sigma Aldrich) overnight at 4 °C. Cells were incubated with primary antibodies rabbit anti-HER2 (2156S, Cell Signalling Technology; 1 :2000), mouse anti-EEA1 (610456, BD Bioscience, Wokingham, UK; 1 :200) or rabbit anti-LAMP2 (GTX103214, GeneTex, Irvine, CA; 1 :200) in 1% milk for 1 hour at room temperature followed by 3 x PBS washes and 1 hour incubation with AlexaFluor™ 594 goat anti-rabbit (A11012, Invitrogen; 1 :1000) or AlexaFluor™ 594 goat anti-mouse (A11005, Invitrogen; 1 :1000) in 1 % milk for 1 hour at room temperature. Cells were washes 3 x PBS and mounted using Prolong™ Gold antifade reagent and DAPI (Invitrogen, Cat. No. P36935). Cells were imaged using a Zeiss LSM880 confocal microscope.

[0172] Surface Plasmon Resonance

[0173] Affimer-MMAE conjugate affinities for HER2 and HER3 ECD were determined by surface plasmon resonance (SPR) using a BIAcore T200 (GE Healthcare Europe GmbH). Recombinant HER2 and HER3 ECD protein (Sino Biologicals) immobilised by amine coupling onto CM5 chip (BIAcore). Biacore experiments were performed at 25°C in PBS pH 7.4 supplemented with 0.1% Tween-20 (v / v). Affimer-MMAE conjugates were injected at 0.78, 1.56, 3.13, 6.25, 12.5, 25, 50, 100 and 200 nM at a flow rate of 30 pl min-1, followed by 3 min stabilization and 10 min dissociation. The on- and off- rates and KD parameters were obtained from a global fit to the SPR curves using a 1 :1 Langmuir model, using the BIAevaluation software v 3.1 (GE Healthcare). Quoted KD values are the mean ± SEM of three replicate measurements.

[0174] Cell viability

[0175] Cells were seeded in a 96 well plate on day 0 for an intended 40% coverage of the plate on day 1. Affimer-MMAE conjugates were added at the indicated concentrations. Cells were incubated for a further 72 hours. Media was removed and prewarmed media containing 10% AlamarBlue™ was added and incubated on cells at 37°C, 5% CO2 with humidity for approximately 2-4 hour until a colour change was visible. Fluorescence was measured on a Tecan Spark® microplate reader (Tecan Trading AG) with an excitation wavelength of 570 nm and emission wavelength of 590 nm on a Tecan Spark® microplate reader (Tecan Trading AG).

[0176] VLP production

[0177] CPMV- like particles containing RNA encoding eGFP were produced using a modified purification procedure, adapted from the protocols described by Peyret et al. ,[38, 50], Briefly, Nicotiana benthamiana leaves were infiltrated with a mixture of agrobacterial suspensions containing plasmids encoding CPMV RNA-1 and VP60 (pEAQ-RNA1-lnt and pHREAC-VP60, respectively) together with plasmid (pEAQ-eGFP), a slightly modified version of pEAQ-GFP encoding eGFP in place of wild-type GFP. Freshly harvested leaf tissue was mechanically homogenised using a preparative blender in TBS containing 10 mM sodium metabisulfite. The homogenate was clarified by filtration using a 1 pm Polypropylene bag filter (Fileder Filter Systems Ltd, UK), followed by centrifugation at 11 ,000 x g for 15 min. The supernatant was removed and further clarified by depth filtration using a 0.45 / 0.65 pm Whatman® Polycap filter (Cytiva) followed by ultrafiltration in retentate mode using a 100 kDa PES filter (Repligen). The clarified plant extract was passed through a 0.45 pm PES bottle top filter (Thermo Fisher Scientific) before being treated with ice cold 5% PEG6000 and 0.25 M NaCI for 1 hour to precipitate the RNA-containing VLPs. Following centrifugation at 11 ,000 x g for 1 hour, the supernatant was removed, and the pellets resuspended in 20 mM Sodium Phosphate pH7.0. The purified VLPs were further clarified by centrifugation at 20,000 x g for 1 hour prior to filter sterilisation using a 0.22 pm PES filter and storage at +4°C.VLP content distribution was measured with 12 ml self-forming 41% (w / v) CsCI gradients buffered with 10mM sodium phosphate pH 7.0, centrifuged at 40,000 rpm in a TH641 rotor at 18°C for 24 hours. The gradients were fractionated using a BioComp fractionator with a Triax flow-cell to monitor A280.

[0178] VLP Uptake Assay

[0179] AU-565, SKBR3 or MDA-MB-231 cells were plated at 5 x 104cell / mL in 96 well plates (Viewpoint, PerkinElmer, Waltham, MA). Twenty-four hours later VLPs were diluted to a concentration of 0.7 μM in DPBS and mixed at a variety of ratios with HER2-binding Affimer D11-VLP binding Affimer dimer in DPBS and incubated at room temperature for 10 min with agitation. Affimer-dimer VLP mixtures were then added to AU-565, SKBR3 or MDA-MB-231 cells at a 1 :10 dilution and incubated for 72 hours. Cells were then rinsed with DPBS before fixation in 4% paraformaldehyde, washed 3 times with PBS and imaged on ImageXpress Pico (Molecular Devices) and analysed in CellReporterXpress v.2.8.2 (Molecular Devices). For Affibody- and DARPin-Affimer dimers, SKBR3 cells were plated as detailed above and SBP-dimers incubated with VLPs at a 1 :32 ratio only and treated as detailed for Affimer-dimers above.

[0180] Alphafold2 structure prediction

[0181] The sequences of truncated HER2 (DII / DIII) and Affimer D11 were submitted to AlphaFold2 w / MMseq2 (ColabFold v1.5.2)

[0182] (https: / / colab.research.google.com / github / sokrypton / ColabFold / blob / main / AlphaFold2.ipnyb). The DII / DIII:Affimer D11 complex was modelled using a pipeline adapted to run 24 recycles with a recycle early stop tolerance of 0.0. The model superimposed on experimentally determined structures of HER2 to evaluate the accuracy of model.

[0183] Statistical Analysis

[0184] Statistical analyses were carried out in GraphPad Prism 8.00 software (GraphPad Software, La Jolla, CA).

[0185] References

[0186] 1. IARC, World Cancer Report 2020. World Health Organisation: 2020.

[0187] 2. Furr, B. J. A.; Jordan, V. C., Pharmacology & Therapeutics 1984, 25 (2), 127- 205. DOI https: / / doi.org / 10.1016 / 0163-7258(84)90043-3.

[0188] 3. Gianni, L.; Pienkowski, T.; Im, Y. H.; Roman, L.; Tseng, L. M.; Liu, M. C.; Lluch, A.; Staroslawska, E.; de la Haba-Rodriguez, J.; Im, S. A.; Pedrini, J. L.; Poirier, B.; Morandi, P.; Semiglazov, V.; Srimuninnimit, V.; Bianchi, G.; Szado, T.; Ratnayake, J.; Ross, G.; Valagussa, P., The Lancet. Oncology 2012, 13 (1), 25-32. DOI

[0189] 10.1016 / s1470-2045(11 )70336-9.

[0190] 4. Jordan, V. C., Breast Cancer Research and Treatment 1988, 11 (3), 197-209. DOI 10.1007 / BF01807278.

[0191] 5. Leyland-Jones, B., The Lancet. Oncology 2002, 3 (3), 137-44. DOI 10.1016 / s1470-2045(02)00676-9.

[0192] 6. Fu, Z.; Li, S.; Han, S.; Shi, C.; Zhang, Y., Signal Transduction and Targeted Therapy 2022, 7 (1), 93. DOI 10.1038 / s41392-022-00947-7.

[0193] 7. Tang, A. A. S.; Tiede, C.; McPherson, M. J.; Tomlinson, D. C., Methods in molecular biology (Clifton, N.J.) 2021, 2247, 105-121. DOI 10.1007 / 978-1-0716-1126- 5_6.

[0194] 8. Tiede, C.; Bedford, R.; Heseltine, S. J.; Smith, G.; Wijetunga, I.; Ross, R.; AIQallaf, D.; Roberts, A. P. E.; Balls, A.; Curd, A.; Hughes, R. E.; Martin, H.; Needham, S. R.; Zanetti-Domingues, L. C.; Sadigh, Y.; Peacock, T. P.; Tang, A. A.; Gibson, N.; Kyle, H.; Platt, G. W.; Ingram, N.; Taylor, T.; Coletta, L. P.; Manfield, I.; Knowles, M.; Bell, S.; Esteves, F.; Maqbool, A.; Prasad, R. K.; Drinkhill, M.; Bon, R. S.; Patel, V.; Goodchild, S. A.; Martin-Fernandez, M.; Owens, R. J.; Nettleship, J. E.; Webb, M. E.; Harrison, M.; Lippiat, J. D.; Ponnambalam, S.; Peckham, M.; Smith, A.; Ferrigno, P. K.; Johnson, M.; McPherson, M. J.; Tomlinson, D. C., eLife 2017, 6, e24903. DOI 10.7554 / eLife.24903.

[0195] 9. Tiede, C.; Tang, A. A. S.; Deacon, S. E.; Mandal, U.; Nettleship, J. E.; Owen, R. L.; George, S. E.; Harrison, D. J.; Owens, R. J.; Tomlinson, D. C.; McPherson, M. J., Protein Engineering, Design and Selection 2014, 27 (5), 145-155. DOI

[0196] 10.1093 / protein / gzu007.

[0197] 10. Skrlec, K.; Strukelj, B.; Berlec, A., Trends in biotechnology 2015, 33 (7), 408-18. DOI 10.1016 / j.tibtech.2O15.03.012. 11. Eigenbrot, C.; llltsch, M.; Dubnovitsky, A.; Abrahmsen, L.; Hard, T., Proceedings of the National Academy of Sciences of the United States of America 2010, 707 (34), 15039-44. DOI 10.1073 / pnas.1005025107.

[0198] 12. Orlova, A.; Magnusson, M.; Eriksson, T. L. J.; Nilsson, M.; Larsson, B.; Hbiden- Guthenberg, I.; Widström, C.; Carlsson, J. r.; Tolmachev, V.; Stahl, S.; Nilsson, F. Y., Cancer Research 2006, 66 (8), 4339-4348. DOI 10.1158 / 0008-5472.CAN-05-3521.

[0199] 13. Sochaj-Gregorczyk, A. M.; Serwotka-Suszczak, A. M.; Otlewski, J., Journal of Immunotherapy 2016, 39 (6).

[0200] 14. Carter, P.; Presta, L.; Gorman, C. M.; Ridgway, J. B.; Henner, D.; Wong, W. L.; Rowland, A. M.; Kotts, C.; Carver, M. E.; Shepard, H. M., Proceedings of the National Academy of Sciences of the United States of America 1992, 89 (10), 4285-9. DOI 10.1073 / pnas.89.10.4285.

[0201] 15. Shah, D. K., Journal of Pharmacokinetics and Pharmacodynamics 2015, 42 (5), 553-571. DOI 10.1007 / sl 0928-015-9447-8.

[0202] 16. Tornesello, A. L.; Tagliamonte, M.; Buonaguro, F. M.; Tornesello, M. L.; Buonaguro, L., Vaccines 2022, 70 (2). DOI 10.3390 / vaccinesl 0020227.

[0203] 17. Jain, A. K.; Thareja, S., Artificial Cells, Nanomedicine, and Biotechnology 2019, 47 (1), 524-539. DOI 10.1080 / 21691401.2018.1561457.

[0204] 18. Nooraei, S.; Bahrulolum, H.; Hoseini, Z. S.; Katalani, C.; Hajizade, A.; Easton, A. J.; Ahmadian, G., Journal of Nanobiotechnology 2021, 79 (1), 59. DOI

[0205] 10.1186 / s 12951-021 -00806-7.

[0206] 19. Hesketh, E. L.; Tiede, C.; Adamson, H.; Adams, T. L.; Byrne, M. J.; Meshcheriakova, Y.; Kruse, I.; McPherson, M. J.; Lomonossoff, G. P.; Tomlinson, D. C.; Ranson, N. A., Scientific Reports 2019, 9 (1), 7524. DOI 10.1038 / s41598-019- 43945-6.

[0207] 20. Sokolova, E.; Proshkina, G.; Kutova, O.; Shilova, O.; Ryabova, A.; Schulga, A.; Stremovskiy, O.; Zdobnova, T.; Balalaeva, I.; Deyev, S., Journal of Controlled Release 2016, 233, 48-56. DOI https: / / doi.Org / 10.1016 / j.iconrel.2016.05.020.

[0208] 21. Lee, S. B.; Hassan, M.; Fisher, R.; Chertov, O.; Chernomordik, V.; Kramer- Marek, G.; Gandjbakhche, A.; Capala, J., Clinical cancer research : an official journal of the American Association for Cancer Research 2008, 74 (12), 3840-9. DOI

[0209] 10.1158 / 1078-0432. Ccr-07-4076.

[0210] 22. Barok, M.; Joensuu, H.; Isola, J., Breast Cancer Research 2014, 76 (2), 209. DOI 10.1186 / bcr3621.

[0211] 23. Chalouni, C.; Doll, S., Journal of experimental & clinical cancer research : CR 2018, 37 (1), 20. DOI 10.1186 / s13046-017-0667-1.

[0212] 24. Liang, K.; Mei, S.; Gao, X.; Peng, S.; Zhan, J., Drug design, development and therapy 2021, 15, 5135-5150. DOI 10.2147 / dddt.S344052.

[0213] 25. Shilova, O. N.; Proshkina, G. M.; Lebedenko, E. N.; Deyev, S. M., ActaNaturae 2015, 7 (3), 126-32.

[0214] 26. Jost, C.; Schilling, J.; Tamaskovic, R.; Schwill, M.; Honegger, A.; Pluckthun, A., Structure 2013, 27 (11), 1979-1991. DOI https: / / doi.Org / 10.1016 / i.str.2013.08.020.

[0215] 27. Sharma, S.; Li, Z.; Bussing, D.; Shah, D. K., Drug metabolism and disposition: the biological fate of chemicals 2020, 48 (5), 368-377. DOI 10.1124 / dmd.119.089276.

[0216] 28. Singh, A. P.; Shah, D. K., Drug metabolism and disposition: the biological fate of chemicals 2017 , 45 (11), 1120-1132. DOI 10.1124 / dmd.117.076414.

[0217] 29. Yadati, T.; Houben, T.; Bitorina, A.; Shiri-Sverdlov, R., Cells 2020, 9 (7). DOI 10.3390 / cells9071679.

[0218] 30. Zahnd, C.; Pecorari, F.; Straumann, N.; Wyler, E.; Pluckthun, A., Journal of Biological Chemistry 2006, 287 (46), 35167-35175. DOI https: / / doi.org / 10.1074 / ibc.M60254720Q. 31. Zahnd, C.; Wyler, E.; Schwenk, J. M.; Steiner, D.; Lawrence, M. C.; McKern, N. M.; Pecorari, F.; Ward, C. W.; Joos, T. O.; Pluckthun, A., Journal of Molecular Biology 2007, 369 (4), 1015-1028. DOI htps: / / doi.Org / 10.1016 / i.jmb.2007.03.028.

[0219] 32. Wikman, M.; Steffen, A. C.; Gunneriusson, E.; Tolmachev, V.; Adams, G. P.; Carlsson, J.; Stahl, S., Protein engineering, design & selection : PEDS 2004, 77 (5), 455-62. DOI 10.1093 / protein / gzh053.

[0220] 33. Vazquez-Lombardi, R.; Phan, T. G.; Zimmermann, C.; Lowe, D.; Jermutus, L.; Christ, D., Drug Discovery Today 2015, 20 (10), 1271-1283. DOI htps: / / doi.Org / 10.1016 / j.drudis.2015.09.004.

[0221] 34. Hu, H.; Steinmetz, N. F., Cancers (Basel) 2021, 13 (12). DOI 10.3390 / cancersl 3122909.

[0222] 35. Beiss, V.; Mao, C.; Fiering, S. N.; Steinmetz, N. F., Mol Pharm 2022, 19 (5), 1573-1585. DOI 10.1021 / acs.molpharmaceut.2c00058.

[0223] 36. Chariou, P. L.; Ortega-Rivera, O. A.; Steinmetz, N. F., ACS Nano 2020, 14 (3), 2678-2701. DOI 10.1021 / acsnano.0c00173.

[0224] 37. Steele, J. F. C.; Peyret, H.; Saunders, K.; Castells-Graells, R.; Marsian, J.; Meshcheriakova, Y.; Lomonossoff, G. P., Wiley Interdiscip Rev Nanomed Nanobiotechnol 2017 , 9 (4). DOI 10.1002 / wnan.1447.

[0225] 38. Peyret, H.; Lomonossoff, G. P., Methods in molecular biology (Clifton, N.J.) 2022, 2480, 103-111. DOI 10.1007 / 978-1-0716-2241-4_7.

[0226] 39. van Breugel, M.; Rosa, E. S. I.; Andreeva, A., Commun Biol 2022, 5 (1), 312. DOI 10.1038 / S42003-022-03269-0.

[0227] 40. Shipunova, V. O.; Kolesnikova, O. A.; Kotelnikova, P. A.; Soloviev, V. D.; Popov, A. A.; Proshkina, G. M.; Nikitin, M. P.; Deyev, S. M., ACS Omega 2021, 6 (24), 16000-16008. DOI 10.1021 / acsomega.1c01811 .

[0228] 41. Shipunova, V. O.; Deyev, S. M., ActaNaturae 2022, 14 (1), 54-72. DOI 10.32607 / actanaturae.11545.

[0229] 42. Elias, D. R.; Poloukhtine, A.; Popik, V.; Tsourkas, A., Nanomedicine: Nanotechnology, Biology and Medicine 2013, 9 (2), 194-201. DOI https: / / doi.Org / 10.1016 / j. nano.2012.05.015.

[0230] 43. Hatlem, D.; Trunk, T.; Linke, D.; Leo, J. C., International journal of molecular sciences 2019, 20 (9). DOI 10.3390 / ijms20092129.

[0231] 44. Marini, A.; Zhou, Y.; Li, Y.; Taylor, I. J.; Leneghan, D. B.; Jin, J.; Zaric, M.; Mekhaiel, D.; Long, C. A.; Miura, K.; Biswas, S., 2019, 10. DOI 10.3389 / fimmu.2019.02931.

[0232] 45. Yang, J. I.; Sepulveda, D.; Vardia, I.; Skov, J.; Goksoyr, L.; Sander, A. F.; Lorenzen, N., 2023, 14. DOI 10.3389 / fimmu.2023.1139206.

[0233] 46. Yur, D.; Sullivan, M. O.; Chen, W., Journal of Materials Chemistry B 2023, 11 (18), 3985-3993. DOI 10.1039 / D3TB00445G.

[0234] 47. Mohamed Suffian, I. F. B.; Wang, J. T.; Hodgins, N. O.; Klippstein, R.; Garcia- Maya, M.; Brown, P.; Nishimura, Y.; Heidari, H.; Bals, S.; Sosabowski, J. K.; Ogino, C.; Kondo, A.; Al-Jamal, K. T., Biomaterials 2017, 120, 126-138. DOI

[0235] 10.1016 / j. biomaterials.2016.12.012.

[0236] 48. He, J.; Yu, L.; Lin, X.; Liu, X.; Zhang, Y.; Yang, F.; Deng, W., Viruses 2022, 14 (9). DOI 10.3390 / V14091905.

[0237] 49. Mao, C.; Beiss, V.; Fields, J.; Steinmetz, N. F.; Fiering, S., Biomaterials 2021 , 275, 120914. DOI htps: / / doi.Org / 10.1016 / i.biomaterials.2021.120914.

[0238] 50. Peyret, H.; Groppelli, E.; Clark, D.; Eckersley, N.; Planche, T.; Ma, J.; Lomonossoff, G. P., Journal of virological methods 2022, 300, 114372. DOI 10.1016 / j.jviromet.2021.114372. Sequence Listing

[0239] SEQ ID NO: 1 - pEAQ_nonHT_RNA2

[0240] TCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCG

[0241] GGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGC

[0242] GGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACG

[0243] TACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCC

[0244] GAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGATGATCTCGTCGTGACCCATGGCGATGCCT

[0245] GCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGC

[0246] GGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGAC

[0247] CGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACG

[0248] AGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGAT

[0249] TTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGA

[0250] TCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACGGGATCTCTGCGGAACAGGCGGTCGAAGG

[0251] TGCCGATATCATTACGACAGCAACGGCCGACAAGCACAACGCCACGATCCTGAGCGACAATATGATCGCG

[0252] GCGTCCACATCAACGGCGTCGGCGGCGACTGCCCAGGCAAGACCGAGATGCACCGCGATATCTTGCTGCG

[0253] TTCGGATATTTTCGTGGAGTTCCCGCCACAGACCCGGATGATCCCCGATCGTTCAAACATTTGGCAATAA

[0254] AGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTA

[0255] AGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCA

[0256] ATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTG

[0257] TCATCTATGTTACTAGATCGGGGGCCGGCCCTCACTGGTGAAAAGAAAAACCACCCCAGTACATTAAAAA

[0258] CGTCCGCAATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCCTGCCACCAGCC

[0259] AGCCAACAGCTCCCCGACCGGCAGCTCGGCACAAAATCACCACTCGATACAGGCAGCCCATCAGTCCGGG

[0260] ACGGCGTCAGCGGGAGAGCCGTTGTAAGGCGGCAGACTTTGCTCATGTTACCGATGCTATTCGGAAGAAC

[0261] GGCAACTAAGCTGCCGGGTTTGAAACACGGATGATCTCGCGGAGGGTAGCATGTTGATTGTAACGATGAC

[0262] AGAGCGTTGCTGCCTGTGATCAAATATCATCTCCCTCGCAGAGATCCGAATTATCAGCCTTCTTATTCAT

[0263] TTCTCGCTTAACCGTGACAGAGTAGACAGGCTGTCTCGCGGCCGAGGGGCGCAGCCCCTGGGGGGATGGG

[0264] AGGCCCGCGTTAGCGGGCCGGGAGGGTTCGAGAAGGGGGGGCACCCCCCTTCGGCGTGCGCGGTCACGCG

[0265] CACAGGGCGCAGCCCTGGTTAAAAACAAGGTTTATAAATATTGGTTTAAAAGCAGGTTAAAAGACAGGTT

[0266] AGCGGTGGCCGAAAAACGGGCGGAAACCCTTGCAAATGCTGGATTTTCTGCCTGTGGACAGCCCCTCAAA

[0267] TGTCAATAGGTGCGCCCCTCATCTGTCAGCACTCTGCCCCTCAAGTGTCAAGGATCGCGCCCCTCATCTG

[0268] TCAGTAGTCGCGCCCCTCAAGTGTCAATACCGCAGGGCACTTATCCCCAGGCTTGTCCACATCATCTGTG

[0269] GGAAACTCGCGTAAAATCAGGCGTTTTCGCCGATTTGCGAGGCTGGCCAGCTCCACGTCGCCGGCCGAAA

[0270] TCGAGCCTGCCCCTCATCTGTCAACGCCGCGCCGGGTGAGTCGGCCCCTCAAGTGTCAACGTCCGCCCCT

[0271] CATCTGTCAGTGAGGGCCAAGTTTTCCGCGAGGTATCCACAACGCCGGCGGCCGCGGTGTCTCGCACACG

[0272] GCTTCGACGGCGTTTCTGGCGCGTTTGCAGGGCCATAGACGGCCGCCAGCCCAGCGGCGAGGGCAACCAG

[0273] CCCGGTGAGCGTCGGAAAGGCGCTCGGTCTTGCCTTGCTCGTCGGTGATGTACACTAGTCGCTGGCTGCT

[0274] GAACCCCCAGCCGGAACTGACCCCACAAGGCCCTAGCGTTTGCAATGCACCAGGTCATCATTGACCCAGG

[0275] CGTGTTCCACCAGGCCGCTGCCTCGCAACTCTTCGCAGGCTTCGCCGACCTGCTCGCGCCACTTCTTCAC

[0276] GCGGGTGGAATCCGATCCGCACATGAGGCGGAAGGTTTCCAGCTTGAGCGGGTACGGCTCCCGGTGCGAG CTGAAATAGTCGAACATCCGTCGGGCCGTCGGCGACAGCTTGCGGTACTTCTCCCATATGAATTTCGTGT

[0277] AGTGGTCGCCAGCAAACAGCACGACGATTTCCTCGTCGATCAGGACCTGGCAACGGGACGTTTTCTTGCC

[0278] ACGGTCCAGGACGCGGAAGCGGTGCAGCAGCGACACCGATTCCAGGTGCCCAACGCGGTCGGACGTGAAG

[0279] CCCATCGCCGTCGCCTGTAGGCGCGACAGGCATTCCTCGGCCTTCGTGTAATACCGGCCATTGATCGACC

[0280] AGCCCAGGTCCTGGCAAAGCTCGTAGAACGTGAAGGTGATCGGCTCGCCGATAGGGGTGCGCTTCGCGTA

[0281] CTCCAACACCTGCTGCCACACCAGTTCGTCATCGTCGGCCCGCAGCTCGACGCCGGTGTAGGTGATCTTC

[0282] ACGTCCTTGTTGACGTGGAAAATGACCTTGTTTTGCAGCGCCTCGCGCGGGATTTTCTTGTTGCGCGTGG

[0283] TGAACAGGGCAGAGCGGGCCGTGTCGTTTGGCATCGCTCGCATCGTGTCCGGCCACGGCGCAATATCGAA

[0284] CAAGGAAAGCTGCATTTCCTTGATCTGCTGCTTCGTGTGTTTCAGCAACGCGGCCTGCTTGGCCTCGCTG

[0285] ACCTGTTTTGCCAGGTCCTCGCCGGCGGTTTTTCGCTTCTTGGTCGTCATAGTTCCTCGCGTGTCGATGG

[0286] TCATCGACTTCGCCAAACCTGCCGCCTCCTGTTCGAGACGACGCGAACGCTCCACGGCGGCCGATGGCGC

[0287] GGGCAGGGCAGGGGGAGCCAGTTGCACGCTGTCGCGCTCGATCTTGGCCGTAGCTTGCTGGACCATCGAG

[0288] CCGACGGACTGGAAGGTTTCGCGGGGCGCACGCATGACGGTGCGGCTTGCGATGGTTTCGGCATCCTCGG

[0289] CGGAAAACCCCGCGTCGATCAGTTCTTGCCTGTATGCCTTCCGGTCAAACGTCCGATTCATTCACCCTCC

[0290] TTGCGGGATTGCCCCGACTCACGCCGGGGCAATGTGCCCTTATTCCTGATTTGACCCGCCTGGTGCCTTG

[0291] GTGTCCAGATAATCCACCTTATCGGCAATGAAGTCGGTCCCGTAGACCGTCTGGCCGTCCTTCTCGTACT

[0292] TGGTATTCCGAATCTTGCCCTGCACGAATACCAGCGACCCCTTGCCCAAATACTTGCCGTGGGCCTCGGC

[0293] CTGAGAGCCAAAACACTTGATGCGGAAGAAGTCGGTGCGCTCCTGCTTGTCGCCGGCATCGTTGCGCCAC

[0294] ATCTAGGTACTAAAACAATTCATCCAGTAAAATATAATATTTTATTTTCTCCCAATCAGGCTTGATCCCC

[0295] AGTAAGTCAAAAAATAGCTCGACATACTGTTCTTCCCCGATATCCTCCCTGATCGACCGGACGCAGAAGG

[0296] CAATGTCATACCACTTGTCCGCCCTGCCGCTTCTCCCAAGATCAATAAAGCCACTTACTTTGCCATCTTT

[0297] CACAAAGATGTTGCTGTCTCCCAGGTCGCCGTGGGAAAAGACAAGTTCCTCTTCGGGCTTTTCCGTCTTT

[0298] AAAAAATCATACAGCTCGCGCGGATCTTTAAATGGAGTGTCTTCTTCCCAGTTTTCGCAATCCACATCGG

[0299] CCAGATCGTTATTCAGTAAGTAATCCAATTCGGCTAAGCGGCTGTCTAAGCTATTCGTATAGGGACAATC

[0300] CGATATGTCGATGGAGTGAAAGAGCCTGATGCACTCCGCATACAGCTCGATAATCTTTTCAGGGCTTTGT

[0301] TCATCTTCATACTCTTCCGAGCAAAGGACGCCATCGGCCTCACTCATGAGCAGATTGCTCCAGCCATCAT

[0302] GCCGTTCAAAGTGCAGGACCTTTGGAACAGGCAGCTTTCCTTCCAGCCATAGCATCATGTCCTTTTCCCG

[0303] TTCCACATCATAGGTGGTCCCTTTATACCGGCTGTCCGTCATTTTTAAATATAGGTTTTCATTTTCTCCC

[0304] ACCAGCTTATATACCTTAGCAGGAGACATTCCTTCCGTATCTTTTACGCAGCGGTATTTTTCGATCAGTT

[0305] TTTTCAATTCCGGTGATATTCTCATTTTAGCCATTTATTATTTCCTTCCTCTTTTCTACAGTATTTAAAG

[0306] ATACCCCAAGAAGCTAATTATAACAAGACGAACTCCAATTCACTGTTCCTTGCATTCTAAAACCTTAAAT

[0307] ACCAGAAAACAGCTTTTTCAAAGTTGTTTTCAAAGTTGGCGTATAACATAGTATCGACGGAGCCGATTTT

[0308] GAAACCACAATTATGGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCA

[0309] GTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCA

[0310] CCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGC

[0311] TTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACAGCC

[0312] CGCATTATGGGCGTTGGCCTCAACACGATTTTACGTCACTTAAAAAACTCAGGCCGCAGTCGGTAACTAT

[0313] GCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTC

[0314] ACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGT

[0315] TATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCG TAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC

[0316] TCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG

[0317] TGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC

[0318] GCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG

[0319] CACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA

[0320] GACACGACTTATCGCCACTGGCAGCAGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCG

[0321] CGGAAATGGACGGGCCCCCGGCGCCAGATCTGGGGAACCCTGTGGTTGGCATGCACATACAAATGGACGA

[0322] ACGGATAAACCTTTTCACGCCCTTTTAAATATCCGATTATTCTAATAAACGCTCTTTTCTCTTAGGTTTA

[0323] CCCGCCAATATATCCTGTCAAACACTGATAGTTTGTGAACCATCACCCAAATCAAGTTTTTTGGGGTCGA

[0324] GGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGC

[0325] GAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCCATTCAGGCTGCGCAACTGTTGGGA

[0326] AGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTA

[0327] AGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTTAATTAAGA

[0328] ATTCGAGCTCCACCGCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGAGAAGATA

[0329] GTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCT

[0330] CTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAAC

[0331] CACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTAT

[0332] CCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGTATTAAAATCTTAATAGGT

[0333] TTTGATAAAAGCGAACGTGGGGAAACCCGAACCAAACCTTCTTCTAAACTCTCTCTCATCTCTCTTAAAG

[0334] CAAACTTCTCTCTTGTCTTTCTTGCATGAGCGATCTTCAACGTTGTCAGATCGTGCTTCGGCACCAGTAC

[0335] AATGTTTTCTTTCACTGAAGCGAAATCAAAGATCTCTTTGTGGACACGTAGTGCGGCGCCATTAAATAAC

[0336] GTGTACTTGTCCTATTCTTGTCGGTGTGGTCTTGGGAAAAGAAAGCTTGCTGGAGGCTGCTGTTCAGCCC

[0337] CATACATTACTTGTTACGATTCTGCTGACTTTCGGCGGGTGCAATATCTCTACTTCTGCTTGACGAGGTA

[0338] TTGTTGCCTGTACTTCTTTCTTCTTCTTCTTGCTGATTGGTTCTATAAGAAATCTAGTATTTTCTTTGAA

[0339] ACAGAGTTTTCCCGTGGTTTTCGAACTTGGAGAAAGATTGTTAAGCTTCTGTATATTCTGCCCAAATTCG

[0340] ACCGGTTCGCGACTCGAGGCCTTTAACTCTGGTTTCATTAAATTTTCTTTAGTTTGAATTTACTGTTATT

[0341] CGGTGTGCATTTCTATGTTTGGTGAGCGGTTTTCTGTGCTCAGAGTGTGTTTATTTTATGTAATTTAATT

[0342] TCTTTGTGAGCTCCTGTTTAGCAGGTCGTCCCTTCAGCAAGGACACAAAAAGATTTTAATTTTATTAAAA

[0343] AAAAAAAAAAAGACCGGGAATTCGATATCAAGCTTATCGACCTGCAGATCGTTCAAACATTTGGCAATAA

[0344] AGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTA

[0345] AGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCA

[0346] ATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTG

[0347] TCATCTATGTTACTAGATCTCTAGAGTCTCAAGCTTGGCGCGCCAGCTTGGCGTAATCATGGTCATAGCT

[0348] GTTGCGATTAAGAATTCGAGCTCGGTACCCCCCTACTCCAAAAATGTCAAAGATACAGTCTCAGAAGACC

[0349] AAAGGGCTATTGAGACTTTTCAACAAAGGGTAATTTCGGGAAACCTCCTCGGATTCCATTGCCCAGCTAT

[0350] CTGTCACTTCATCGAAAGGACAGTAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGA

[0351] AAGGCTATCATTCAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCG

[0352] TGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGACATCTCCACTGACGTAAG

[0353] GGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAG

[0354] AGGACAGCCCAAGCTTCGACTCTAGAGGATCCCCTTAAATCGATATGGAACGAGCTATACAAGGAAACGA CGCTAGGGAACAAGCTAACAGTGAACGTTGGGATGGAGGATCAGGAGGTACCACTTCTCCCTTCAAACTT CCTGACGAAAGTCCGAGTTGGACTGAGTGGCGGCTACATAACGATGAGACGAATTCGAATCAAGATAATC CCCTTGGTTTCAAGGAAAGCTGGGGTTTCGGGAAAGTTGTATTTAAGAGATATCTCAGATACGACAGGAC GGAAGCTTCACTGCACAGAGTCCTTGGATCTTGGACGGGAGATTCGGTTAACTATGCAGCATCTCGATTT TTCGGTTTCGACCAGATCGGATGTACCTATAGTATTCGGTTTCGAGGAGTTAGTATCACCGTTTCTGGAG GGTCTCGAACTCTTCAGCATCTCTGTGAGATGGCAATTCGGTCTAAGCAAGAACTGCTACAGCTTGCCCC AATCGAAGTGGAAAGTAATGTATCAAGAGGATGCCCTGAAGGTACTCAAACCTTCGAAAAAGAAAGCGAG TAAGTCGAGGGCGAGCTCGAATTCGGTACGCTGAAATCACCAGTCTCTCTCTACAAATCTATCTCTCTCT ATTTTCTCCATAAATAATGTGTGAGTAGTTTCCCGATAAGGGAAATTAGGGTTCTTATAGGGTTTCGCTC ATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTATTTGTAAAATACTTCTATCAATAAAATTTC TAATTCCTAAAACCAAAATCCAGTACTAAAATCCAGATCTCCTAAAGTCCCTATAGATCTTTGTCGTGAA TATAAACCAGACACGAGACGACTAAACCTGGAGCCCAGACGCCGTTCGAAGCTAGAAGTACCGCTTAGGC AGGAGGCCGTTAGGGAAAAGATGCTAAGGCAGGGTTGGTTACGTTGACTCCCCCGTAGGTTTGGTTTAAA TATGATGAAGTGGACGGAAGGAAGGAGGAAGACAAGGAAGGATAAGGTTGCAGGCCCTGTGCAAGGTAAG AAGATGGAAATTTGATAGAGGTACGCTACTATACTTATACTATACGCTAAGGGAATGCTTGTATTTATAC CCTATACCCCCTAATAACCCCTTATCAATTTAAGAAATAATCCGCATAAGCCCCCGCTTAAAAATTGGTA TCAGAGCCATGAATAGGTCTATGACCAAAACTCAAGAGGATAAAACCTCACCAAAATACGAAAGAGTTCT TAACTCTAAAGATAAAAGATGGCGCGTGGCCGGCCATGAGCGGAGAATTAAGGGAGTCACGTTATGACCC CCGCCGATGACGCGGGACAAGCCGTTTTACGTTTGGAACTGACAGAACCGCAACGTTGAAGGAGCCACTC AGCCGCGGGTTTCTGGAGTTTAATGAGCTAAGCACATACGTCAGAAACCATTATTGCGCGTTCAAAAGTC GCCTAAGGTCACTATCAGCTAGCAAATATTTCTTGTCAAAAATGCTCCACTGACGTTCCATAAATTCCCC TCGGTATCCAATTAGAGTCTCATATTCACTCTCAATCCAAATAATCTGCACCGGATCTGGATCGTTTCGC ATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACT GGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCT TTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTG GCCACGACGGGCGT

[0355] Underlined nucleotides represent the CPMV 5 ' UTR at nucleotide 6632- 7070 .

[0356] Italicised nucleotides represen t the CPMV 3 ' UTR a t nucleotide 71 63- 7346.

[0357] Bold nucleotides represent the nucleotides removed during vector modification at nucleotide 7142-7162 .

[0358] SEQ ID NO: 2 - pEAQ_nonHT-PolioGFP

[0359] TCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCG GGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGC GGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACG TACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCC GAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGATGATCTCGTCGTGACCCATGGCGATGCCT GCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGC GGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGAC CGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACG

[0360] AGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGAT

[0361] TTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGA

[0362] TCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACGGGATCTCTGCGGAACAGGCGGTCGAAGG

[0363] TGCCGATATCATTACGACAGCAACGGCCGACAAGCACAACGCCACGATCCTGAGCGACAATATGATCGCG

[0364] GCGTCCACATCAACGGCGTCGGCGGCGACTGCCCAGGCAAGACCGAGATGCACCGCGATATCTTGCTGCG

[0365] TTCGGATATTTTCGTGGAGTTCCCGCCACAGACCCGGATGATCCCCGATCGTTCAAACATTTGGCAATAA

[0366] AGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTA

[0367] AGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCA

[0368] ATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTG

[0369] TCATCTATGTTACTAGATCGGGGGCCGGCCCTCACTGGTGAAAAGAAAAACCACCCCAGTACATTAAAAA

[0370] CGTCCGCAATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCCTGCCACCAGCC

[0371] AGCCAACAGCTCCCCGACCGGCAGCTCGGCACAAAATCACCACTCGATACAGGCAGCCCATCAGTCCGGG

[0372] ACGGCGTCAGCGGGAGAGCCGTTGTAAGGCGGCAGACTTTGCTCATGTTACCGATGCTATTCGGAAGAAC

[0373] GGCAACTAAGCTGCCGGGTTTGAAACACGGATGATCTCGCGGAGGGTAGCATGTTGATTGTAACGATGAC

[0374] AGAGCGTTGCTGCCTGTGATCAAATATCATCTCCCTCGCAGAGATCCGAATTATCAGCCTTCTTATTCAT

[0375] TTCTCGCTTAACCGTGACAGAGTAGACAGGCTGTCTCGCGGCCGAGGGGCGCAGCCCCTGGGGGGATGGG

[0376] AGGCCCGCGTTAGCGGGCCGGGAGGGTTCGAGAAGGGGGGGCACCCCCCTTCGGCGTGCGCGGTCACGCG

[0377] CACAGGGCGCAGCCCTGGTTAAAAACAAGGTTTATAAATATTGGTTTAAAAGCAGGTTAAAAGACAGGTT

[0378] AGCGGTGGCCGAAAAACGGGCGGAAACCCTTGCAAATGCTGGATTTTCTGCCTGTGGACAGCCCCTCAAA

[0379] TGTCAATAGGTGCGCCCCTCATCTGTCAGCACTCTGCCCCTCAAGTGTCAAGGATCGCGCCCCTCATCTG

[0380] TCAGTAGTCGCGCCCCTCAAGTGTCAATACCGCAGGGCACTTATCCCCAGGCTTGTCCACATCATCTGTG

[0381] GGAAACTCGCGTAAAATCAGGCGTTTTCGCCGATTTGCGAGGCTGGCCAGCTCCACGTCGCCGGCCGAAA

[0382] TCGAGCCTGCCCCTCATCTGTCAACGCCGCGCCGGGTGAGTCGGCCCCTCAAGTGTCAACGTCCGCCCCT

[0383] CATCTGTCAGTGAGGGCCAAGTTTTCCGCGAGGTATCCACAACGCCGGCGGCCGCGGTGTCTCGCACACG

[0384] GCTTCGACGGCGTTTCTGGCGCGTTTGCAGGGCCATAGACGGCCGCCAGCCCAGCGGCGAGGGCAACCAG

[0385] CCCGGTGAGCGTCGGAAAGGCGCTCGGTCTTGCCTTGCTCGTCGGTGATGTACACTAGTCGCTGGCTGCT

[0386] GAACCCCCAGCCGGAACTGACCCCACAAGGCCCTAGCGTTTGCAATGCACCAGGTCATCATTGACCCAGG

[0387] CGTGTTCCACCAGGCCGCTGCCTCGCAACTCTTCGCAGGCTTCGCCGACCTGCTCGCGCCACTTCTTCAC

[0388] GCGGGTGGAATCCGATCCGCACATGAGGCGGAAGGTTTCCAGCTTGAGCGGGTACGGCTCCCGGTGCGAG

[0389] CTGAAATAGTCGAACATCCGTCGGGCCGTCGGCGACAGCTTGCGGTACTTCTCCCATATGAATTTCGTGT

[0390] AGTGGTCGCCAGCAAACAGCACGACGATTTCCTCGTCGATCAGGACCTGGCAACGGGACGTTTTCTTGCC

[0391] ACGGTCCAGGACGCGGAAGCGGTGCAGCAGCGACACCGATTCCAGGTGCCCAACGCGGTCGGACGTGAAG

[0392] CCCATCGCCGTCGCCTGTAGGCGCGACAGGCATTCCTCGGCCTTCGTGTAATACCGGCCATTGATCGACC

[0393] AGCCCAGGTCCTGGCAAAGCTCGTAGAACGTGAAGGTGATCGGCTCGCCGATAGGGGTGCGCTTCGCGTA

[0394] CTCCAACACCTGCTGCCACACCAGTTCGTCATCGTCGGCCCGCAGCTCGACGCCGGTGTAGGTGATCTTC

[0395] ACGTCCTTGTTGACGTGGAAAATGACCTTGTTTTGCAGCGCCTCGCGCGGGATTTTCTTGTTGCGCGTGG

[0396] TGAACAGGGCAGAGCGGGCCGTGTCGTTTGGCATCGCTCGCATCGTGTCCGGCCACGGCGCAATATCGAA

[0397] CAAGGAAAGCTGCATTTCCTTGATCTGCTGCTTCGTGTGTTTCAGCAACGCGGCCTGCTTGGCCTCGCTG

[0398] ACCTGTTTTGCCAGGTCCTCGCCGGCGGTTTTTCGCTTCTTGGTCGTCATAGTTCCTCGCGTGTCGATGG TCATCGACTTCGCCAAACCTGCCGCCTCCTGTTCGAGACGACGCGAACGCTCCACGGCGGCCGATGGCGC

[0399] GGGCAGGGCAGGGGGAGCCAGTTGCACGCTGTCGCGCTCGATCTTGGCCGTAGCTTGCTGGACCATCGAG

[0400] CCGACGGACTGGAAGGTTTCGCGGGGCGCACGCATGACGGTGCGGCTTGCGATGGTTTCGGCATCCTCGG

[0401] CGGAAAACCCCGCGTCGATCAGTTCTTGCCTGTATGCCTTCCGGTCAAACGTCCGATTCATTCACCCTCC

[0402] TTGCGGGATTGCCCCGACTCACGCCGGGGCAATGTGCCCTTATTCCTGATTTGACCCGCCTGGTGCCTTG

[0403] GTGTCCAGATAATCCACCTTATCGGCAATGAAGTCGGTCCCGTAGACCGTCTGGCCGTCCTTCTCGTACT

[0404] TGGTATTCCGAATCTTGCCCTGCACGAATACCAGCGACCCCTTGCCCAAATACTTGCCGTGGGCCTCGGC

[0405] CTGAGAGCCAAAACACTTGATGCGGAAGAAGTCGGTGCGCTCCTGCTTGTCGCCGGCATCGTTGCGCCAC

[0406] ATCTAGGTACTAAAACAATTCATCCAGTAAAATATAATATTTTATTTTCTCCCAATCAGGCTTGATCCCC

[0407] AGTAAGTCAAAAAATAGCTCGACATACTGTTCTTCCCCGATATCCTCCCTGATCGACCGGACGCAGAAGG

[0408] CAATGTCATACCACTTGTCCGCCCTGCCGCTTCTCCCAAGATCAATAAAGCCACTTACTTTGCCATCTTT

[0409] CACAAAGATGTTGCTGTCTCCCAGGTCGCCGTGGGAAAAGACAAGTTCCTCTTCGGGCTTTTCCGTCTTT

[0410] AAAAAATCATACAGCTCGCGCGGATCTTTAAATGGAGTGTCTTCTTCCCAGTTTTCGCAATCCACATCGG

[0411] CCAGATCGTTATTCAGTAAGTAATCCAATTCGGCTAAGCGGCTGTCTAAGCTATTCGTATAGGGACAATC

[0412] CGATATGTCGATGGAGTGAAAGAGCCTGATGCACTCCGCATACAGCTCGATAATCTTTTCAGGGCTTTGT

[0413] TCATCTTCATACTCTTCCGAGCAAAGGACGCCATCGGCCTCACTCATGAGCAGATTGCTCCAGCCATCAT

[0414] GCCGTTCAAAGTGCAGGACCTTTGGAACAGGCAGCTTTCCTTCCAGCCATAGCATCATGTCCTTTTCCCG

[0415] TTCCACATCATAGGTGGTCCCTTTATACCGGCTGTCCGTCATTTTTAAATATAGGTTTTCATTTTCTCCC

[0416] ACCAGCTTATATACCTTAGCAGGAGACATTCCTTCCGTATCTTTTACGCAGCGGTATTTTTCGATCAGTT

[0417] TTTTCAATTCCGGTGATATTCTCATTTTAGCCATTTATTATTTCCTTCCTCTTTTCTACAGTATTTAAAG

[0418] ATACCCCAAGAAGCTAATTATAACAAGACGAACTCCAATTCACTGTTCCTTGCATTCTAAAACCTTAAAT

[0419] ACCAGAAAACAGCTTTTTCAAAGTTGTTTTCAAAGTTGGCGTATAACATAGTATCGACGGAGCCGATTTT

[0420] GAAACCACAATTATGGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCA

[0421] GTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCA

[0422] CCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGC

[0423] TTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACAGCC

[0424] CGCATTATGGGCGTTGGCCTCAACACGATTTTACGTCACTTAAAAAACTCAGGCCGCAGTCGGTAACTAT

[0425] GCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTC

[0426] ACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGT

[0427] TATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCG

[0428] TAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC

[0429] TCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG

[0430] TGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC

[0431] GCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG

[0432] CACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA

[0433] GACACGACTTATCGCCACTGGCAGCAGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCG

[0434] CGGAAATGGACGGGCCCCCGGCGCCAGATCTGGGGAACCCTGTGGTTGGCATGCACATACAAATGGACGA

[0435] ACGGATAAACCTTTTCACGCCCTTTTAAATATCCGATTATTCTAATAAACGCTCTTTTCTCTTAGGTTTA

[0436] CCCGCCAATATATCCTGTCAAACACTGATAGTTTGTGAACCATCACCCAAATCAAGTTTTTTGGGGTCGA

[0437] GGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGC GAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCCATTCAGGCTGCGCAACTGTTGGGA

[0438] AGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTA

[0439] AGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTTAATTAAGA

[0440] ATTCGAGCTCCACCGCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGAGAAGATA

[0441] GTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCT

[0442] CTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAAC

[0443] CACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTAT

[0444] CCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGTATTAAAATCTTAATAGGT

[0445] TTTGATAAAAGCGAACGTGGGGAAACCCGAACCAAACCTTCTTCTAAACTCTCTCTCATCTCTCTTAAAG

[0446] CAAACTTCTCTCTTGTCTTTCTTGCATGAGCGATCTTCAACGTTGTCAGATCGTGCTTCGGCACCAGTAC

[0447] AATGTTTTCTTTCACTGAAGCGAAATCAAAGATCTCTTTGTGGACACGTAGTGCGGCGCCATTAAATAAC

[0448] GTGTACTTGTCCTATTCTTGTCGGTGTGGTCTTGGGAAAAGAAAGCTTGCTGGAGGCTGCTGTTCAGCCC

[0449] CATACATTACTTGTTACGATTCTGCTGACTTTCGGCGGGTGCAATATCTCTACTTCTGCTTGACGAGGTA

[0450] TTGTTGCCTGTACTTCTTTCTTCTTCTTCTTGCTGATTGGTTCTATAAGAAATCTAGTATTTTCTTTGAA

[0451] ACAGAGTTTTCCCGTGGTTTTCGAACTTGGAGAAAGATTGTTAAGCTTCTGTATATTCTGCCCAAATTCG

[0452] CGATTAAAACAGCTCTGGGGTTGTACCCACCCCAGAGGCCCACGTGGCGGCTAGTACTCCGGTATTGCGG

[0453] TACCCTTGTACGCCTGTTTTATACTCCCTTCCCGTAACTTAGACGCACAAAACCAAGTTCAATAGAAGGG

[0454] GGTACAAACCAGTACCACCACGAACAAGCACTTCTGTTTCCCCGGTGATGTCGTATAGACTGCTTGCGTG

[0455] GTTGAAAGCGACGGATCCGTTATCCGCTTATGTACTTCGAGAAGCCCAGTACCACCTCGGAATCTTCGAT

[0456] GCGTTGCGCTCAGCACTCAACCCCAGAGTGTAGCTTAGGCTGATGAGTCTGGACATCCCTCACCGGTGAC

[0457] GGTGGTCCAGGCTGCGTTGGCGGCCTACCTATGGCTAACGCCATGGGACGCTAGTTGTGAACAAGGTGTG

[0458] AAGAGCCTATTGAGCTACATAAGAATCCTCCGGCCCCTGAATGCGGCTAATCCCAACCTCGGAGCAGGTG

[0459] GTCACAAACCAGTGATTGGCCTGTCGTAACGCGCAAGTCCGTGGCGGAACCGACTACTTTGGGTGTCCGT

[0460] GTTTCCTTTTATTTTATTGTGGCTGCTTATGGTGACAATCACAGATTGTTATCATAAAGCGAATTGGATT

[0461] GGCCATCCGGTGAAAGTGAGACTCATTATCTATCTGTTTGCTGGATCCGCTCCATTGAGTGTGTTTACTC

[0462] TAAGTACAATTTCAACAGTTATTTCAATCAGACAATTGTATCATACTCGAGATGGTGAGCAAGGGCGAGG

[0463] AGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGT

[0464] GTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAG

[0465] CTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCG

[0466] ACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTT

[0467] CTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGC

[0468] ATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACA

[0469] ACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCA

[0470] CAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCC

[0471] GTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCG

[0472] ATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTA

[0473] ACTCGAGTAGTAACCCTACCTCAGTCGAATTGGATTGGGTCATACTGTTGTAGGGGTAAATTTTTCTTTA

[0474] ATTCGGAGGGCCTTTAACTCTGGTTTCA

[0475] TTAAATTTTCTTTAGTTTGAATTTACTGTTATTCGGTGTGCATTTCTATGTTTGGTGAGCGGTTTTCTGT

[0476] GCTCAGAGTGTGTTTATTTTATGTAATTTAATTTCTTTGTGAGCTCCTGTTTAGCAGGTCGTCCCTTCAG CAAGGACACAAAAAGATTTTAATTTTATTAAAAAAAAAAAAAAAGACCGGGAATTCGATATCAAGCTTAT

[0477] CGACCTGCAGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGA

[0478] TGATTATCATATAATTTCTGTTGAATTAGGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATT

[0479] TATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAG

[0480] CGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCTCTAGAGTCTCAAGCTTG

[0481] GCGCGCCAGCTTGGCGTAATCATGGTCATAGCTGTTGCGATTAAGAATTCGAGCTCGGTACCCCCCTACT

[0482] CCAAAAATGTCAAAGATACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAACAAAGGGTAATTTC

[0483] GGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCGAAAGGACAGTAGAAAAGGAAGGT

[0484] GGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCATTCAAGATGCCTCTGCCGACAGTGGTC

[0485] CCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCA

[0486] AGTGGATTGATGTGACATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCT

[0487] TCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACAGCCCAAGCTTCGACTCTAGAGGATCCCCTTA

[0488] AATCGATATGGAACGAGCTATACAAGGAAACGACGCTAGGGAACAAGCTAACAGTGAACGTTGGGATGGA

[0489] GGATCAGGAGGTACCACTTCTCCCTTCAAACTTCCTGACGAAAGTCCGAGTTGGACTGAGTGGCGGCTAC

[0490] ATAACGATGAGACGAATTCGAATCAAGATAATCCCCTTGGTTTCAAGGAAAGCTGGGGTTTCGGGAAAGT

[0491] TGTATTTAAGAGATATCTCAGATACGACAGGACGGAAGCTTCACTGCACAGAGTCCTTGGATCTTGGACG

[0492] GGAGATTCGGTTAACTATGCAGCATCTCGATTTTTCGGTTTCGACCAGATCGGATGTACCTATAGTATTC

[0493] GGTTTCGAGGAGTTAGTATCACCGTTTCTGGAGGGTCTCGAACTCTTCAGCATCTCTGTGAGATGGCAAT

[0494] TCGGTCTAAGCAAGAACTGCTACAGCTTGCCCCAATCGAAGTGGAAAGTAATGTATCAAGAGGATGCCCT

[0495] GAAGGTACTCAAACCTTCGAAAAAGAAAGCGAGTAAGTCGAGGGCGAGCTCGAATTCGGTACGCTGAAAT

[0496] CACCAGTCTCTCTCTACAAATCTATCTCTCTCTATTTTCTCCATAAATAATGTGTGAGTAGTTTCCCGAT

[0497] AAGGGAAATTAGGGTTCTTATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTT

[0498] GTATTTGTAAAATACTTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCCAGTACTAAAATCCAGA

[0499] TCTCCTAAAGTCCCTATAGATCTTTGTCGTGAATATAAACCAGACACGAGACGACTAAACCTGGAGCCCA

[0500] GACGCCGTTCGAAGCTAGAAGTACCGCTTAGGCAGGAGGCCGTTAGGGAAAAGATGCTAAGGCAGGGTTG

[0501] GTTACGTTGACTCCCCCGTAGGTTTGGTTTAAATATGATGAAGTGGACGGAAGGAAGGAGGAAGACAAGG

[0502] AAGGATAAGGTTGCAGGCCCTGTGCAAGGTAAGAAGATGGAAATTTGATAGAGGTACGCTACTATACTTA

[0503] TACTATACGCTAAGGGAATGCTTGTATTTATACCCTATACCCCCTAATAACCCCTTATCAATTTAAGAAA

[0504] TAATCCGCATAAGCCCCCGCTTAAAAATTGGTATCAGAGCCATGAATAGGTCTATGACCAAAACTCAAGA

[0505] GGATAAAACCTCACCAAAATACGAAAGAGTTCTTAACTCTAAAGATAAAAGATGGCGCGTGGCCGGCCAT

[0506] GAGCGGAGAATTAAGGGAGTCACGTTATGACCCCCGCCGATGACGCGGGACAAGCCGTTTTACGTTTGGA

[0507] ACTGACAGAACCGCAACGTTGAAGGAGCCACTCAGCCGCGGGTTTCTGGAGTTTAATGAGCTAAGCACAT

[0508] ACGTCAGAAACCATTATTGCGCGTTCAAAAGTCGCCTAAGGTCACTATCAGCTAGCAAATATTTCTTGTC

[0509] AAAAATGCTCCACTGACGTTCCATAAATTCCCCTCGGTATCCAATTAGAGTCTCATATTCACTCTCAATC

[0510] CAAATAATCTGCACCGGATCTGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGG

[0511] CCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGT

[0512] GTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAA

[0513] CTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGT

[0514] Underlined nucleotides show the CPMV 5 ' UTR at nucleotides 6632-7070 . Underlined, bold and italicised nucleotides show the poliovirus IRES is at nucleotides 7144- 7885.

[0515] Bold and italicised nucleotides show the eGFP TARGET GENE SEQUENCE at nucleotide 7892-8611 . Bold nucleotides show the poliovirus 3 ' at nucleotide 8618-8688 .

[0516] Italic nucleotides show the CPMV 3 ' UTR a t nucleotide 8709-8877 .

Claims

CLAIMS:

1. A system for the incorporation of RNA into a cell, comprising:RNA encapsulated in a virus like particle (VLP); and a targeting moiety that can associate with a target cell wherein said targeting moiety comprises at least one scaffold based binding protein (SBP) that associates with the VLP.

2. A system according to claim 1 wherein the RNA is mRNA, tRNA, rRNA, miRNA, siRNA, snRNA, IncRNA, shRNA, sgRNA, an aptamer, a probe or dsRNA.

3. A system according to claim 1 wherein the RNA is mRNA.

4. A system according to any preceding claim wherein the RNA is up to 6 kb.

5. A system according to any preceding claim wherein the VLP is derived from cowpea mosaic virus (CPMV) or is a CPMV VLP.

6. A system according to any preceding claim wherein the at least one SBP is bispecific to the VLP and the target cell.

7. A system according to any preceding claim wherein the at least one SBP is selected from at least one or any combination of an affimer, an affibody or DARPin.

8. A system according to claim 7wherein the at least one SBP is an affimer.

9. A system according to any preceding claim wherein the system further comprises an affibody and / or DARPin.

10. A system according to any preceding claim wherein the VLP comprises a coat protein and said coat protein comprises an L-subunit; wherein the at least one SBP is associated with the L-subunit of the coat protein of the VLP.

11. A system according to any preceding claim wherein the RNA encodes a protein which is produced after incorporation of the RNA in the cell.

12. A system according to any preceding claim wherein the RNA encodes a protein that is capable of eliciting an immune response.

13. A system according to any preceding claim wherein the RNA encodes an antigen binding protein.

14. A system according to any preceding claim wherein the RNA encodes a protein capable of binding to a target receptor.

15. A system according to any preceding claim wherein the RNA encodes a protein that is internalised after binding to its target receptor.

16. A system according to any preceding claim wherein the RNA encodes a protein that disrupts cell growth and / or causes apoptosis.

17. A system according to any preceding claim wherein the SBP associates with a target site on a cancer cell.

18. A system according to any preceding claim wherein the SBP associates with a target site on an immune cell.

19. A system according to any of claims 1 to 18 for use in in vitro diagnostics.

20. A system according to any of claims 1 to 18 for use in the treatment of disease.

21. A system according to claim 20 wherein the disease is selected from cancer, neurological diseases, metabolic diseases, cardiovascular diseases, autoimmune diseases, haematological disorders, and ophthalmic disorders.

22. A method for incorporating RNA into a cell, the method comprising delivering to cells, a tissue, an organ or a subject:RNA encapsulated in a virus like particle (VLP); and a targeting moiety that can associate with a target cell wherein said targeting moiety comprises at least one SBP that associates with the VLP.

23. A method according to claim 22 wherein the RNA is mRNA, tRNA, rRNA, miRNA, siRNA, snRNA, IncRNA, shRNA, sgRNA, an aptamer, a probe or dsRNA.

24. A method according to claim 23 wherein the RNA is mRNA.

25. A method according to any of claims 22 to 24 wherein the RNA is up to 6 kb.

26. A method according to any of claims 22 to 25 wherein the RNA encodes a protein that is capable of eliciting an immune response.

27. A method according to any of claims 22 to 26 wherein the VLP is derived from cowpea mosaic virus (CPMV) or is a CMPV VLP.

28. A method according to any of claims 22 to 27 wherein the at least one SBP is bi-specific to the VLP and the target cell.

29. A method according to any of claims 22 to 28 wherein the at least one SBP is selected from at least one or any combination of an affimer, an affibody or DARPin.

30. A method according to claim 29 wherein the at least one SBP is an affimer.

31. A method according to any of claims 22 to 30 wherein the VLP comprises a coat protein and said coat protein comprises an L-subunit, wherein the at least one SBP is associated with the L-subunit of the coat protein of the VLP.

32. A method according to any of claims 22 to 31 wherein the target cell is a cancer cell.

33. A method according to any of claims 22 to 32 wherein the target cell is an immune cell.

34. A vaccine comprising the system of any of claims 1 to 21.

35. A kit for in vitro diagnostics, the kit comprising the system of any of claims 1 to21.

36. A kit for the treatment of a disease wherein said disease is selected from cancer, neurological diseases, metabolic diseases, cardiovascular diseases, infections, respiratory diseases, autoimmune diseases, haematological disorders, and ophthalmic disorders; the kit comprising the system of any of claims 1 to 21.

Images