Isolated betacoronavirus IRES sequences

Abstract

There are provided isolated Betacoronavirus internal ribosome entry sites (IRESes) and variants thereof comprising 175 nucleic acids or less. These IRESes and variants thereof have exceptionally high translation activity. Expression vectors comprising these IRESes and variants thereof and methods of using such expression vectors are also provided.

Description

ISOLATED BETACORONAVIRUS IRES SEQUENCES FIELD

[0001] There are provided internal ribosome entry site (IRES) sequences isolated from Betacoronaviruses. Their use in a variety of applications, including expression vectors and screening assays, is also provided. CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 584,656, filed September 22, 2023, which is incorporated herein by reference. SEQUENCE LISTING

[0003] This application contains a sequence listing that has been submitted in ASCII format via Patent Center and incorporated herein by reference in its entirety. Said ASCII copy, created on 19 September 2024, is named “3276W01WO_Sequence Listing.xml” and is 27,076 bytes in size. BACKGROUND

[0004] Internal ribosome entry site (IRES) sequences initiate translation of messenger RNA (mRNA) independent of a 5’-cap structure. Encephalomyocarditis virus (EMCV) and coxsackievirus B3 (CVB3) are the most commonly used IRES sequences in molecular biology applications. Each of these IRES sequences comprise approximately 550 nucleotides. These are large IRES sequences that also have low capacity to initiate translation.

[0005] The genome of a Coronaviridae virus is a capped, single molecule, single- stranded RNA, which comprises multiple open reading frames. The capacity of the 5’-UTRs of different open reading frames of the severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) sub-genomic RNA to initiate translation was investigated by Conde et al. (2022) Viruses 14(7):1505. These authors noted that capped and polyadenylated 5’- UTRORF1abpromoted particularly strong protein expression.

[0006] Secondary structures can arise within a single strand of a polynucleic acid when two complementary sequences in the strand base pair to form structures such as a stem. Any intervening nucleic acids between these two complementary sequences that cannot basepair will form a loop at the tip of the stem. The secondary structure of the 5’-UTR and part of open reading frame 1a (ORF1a) of the SARS-CoV-2 genomic RNA has been investigated by Miao et al. (2020) RNA Biology 18(4): 447–456 and Lan et al. (2022) Nature Communications 13:1128. This region is composed of approximately 300 nucleotides and comprises a series of stem-loop (SL) secondary structures, including SL1, SL2, SL3, SL4, SL4.5, and SL5. SL5 branches into three additional stem-loops: SL5a, SL5b and SL5c. The role that each nucleotide sequence capable of forming each stem-loop structure has on regulating IRES function is yet to be elucidated.

[0007] Minimal nucleic acid sequences from SARS-CoV-2 genomic RNA and other Betacoronaviruses that can act as an IRES to initiate translation have not yet been identified. Identifying such sequences is useful inter alia for the identification of compounds that can inhibit translation activity by interacting with the IRES or IRES trans-acting factors. SUMMARY

[0008] The IRESes and variants thereof isolated from Coronaviridae, in particular Betacoronaviruses, provided herein address the need in the art for IRES sequences that can initiate translation of a desired nucleic acid. A 175 nucleic acid-long sequence within the 3’ portion of the 5’-untranslated region (UTR) of the SARS-CoV-2 genomic RNA is identified that is capable of initiating cap-independent, IRES-dependent translation of an operably linked protein coding sequence. This 175 nucleic acid-long sequence comprises stem-loop 4.5 (SL4.5) and stem-loop 5 (SL5) and is present in other Betacoronavirus genomes. It is generically referred to herein as “wild-type Betacoronavirus IRES”.

[0009] Also identified are variants that comprise fewer nucleic acids than the corresponding wild-type Betacoronavirus IRES, making them highly attractive for use in expression cassettes, e.g., in therapeutic RNAs and viral vectors. In addition, these variants have higher translation activity and comprise fewer nucleic acids than the commonly used EMCV and CVB3 IRESes, which makes them even more appealing.

[0010] And so, there is provided an isolated Betacoronavirus internal ribosome entry site (IRES), or a variant thereof, comprising one or more mutations and / or deletions, comprising no more than 175 nucleic acids and including a 3’ portion of the 5’-untranslated region (UTR) of a Betacoronavirus genome, wherein: the IRES or variant thereof is capable of initiating translation when operably linked to a protein coding sequence; and at least 30%of the no more than 175 nucleic acids are one or more nucleic acid sequences capable of forming stem-loop structures in the Betacoronavirus genome 5’-UTR.

[0011] The one or more nucleic acid sequences capable of forming stem-loop structures may comprise stem-loop 4.5 (SL4.5).

[0012] Alternatively or in addition, the one or more nucleic acid sequences capable of forming stem-loop structures may comprise at least a portion of stem-loop 5 (SL5).

[0013] SL5 may branch into one or more stem-loops. For example, in the wild-type Betacoronavirus IRES, SL5a, SL5b and SL5c are comprised within SL5. One or more of the stem-loops (e.g., SL5a, SL5b and SL5c) may be deleted from SL5, e.g., SL5a may be deleted from SL5, SL5b may be deleted from SL5, SL5a and SL5b may be deleted from SL5, SL5c may be deleted from SL5, or SL5a, SL5b and SL5c may be deleted from SL5. The region comprising SL5a, SL5b and SL5c may also be replaced with a sequence capable of forming a loop.

[0014] The isolated Betacoronavirus IRES or variant thereof may comprise a portion of a 5’ terminal nucleic acid sequence of ORF1a of the Betacoronavirus genome.

[0015] The isolated IRES or variant thereof may comprise 170 nucleic acids or less, 160 nucleic acids or less, 145 nucleic acids or less, or 125 nucleic acids or less.

[0016] The isolated IRES or variant thereof may comprise at least about 50 nucleic acids, e.g., the isolated IRES or variant thereof may comprise from about 50 nucleic acids to about 100 nucleic acids, or from about 50 nucleic acids to about 90 nucleic acids, or from about 50 nucleic acids to about 55 nucleic acids.

[0017] The isolated IRES or variant thereof may desirably be capable of improving translation of a nucleic acid sequence operably linked to the IRES or variant thereof as compared to the translation of the same nucleic acid sequence operably linked to a corresponding wild-type IRES by at least about 1.5-fold or more, about 2-fold or more, or about 3-fold or more.

[0018] The Betacoronavirus may comprise any one of an Embecovirus, Sarbecovirus, Merbecovirus, Nobecovirus, or Hibecovirus. For example, the Betacoronavirus may comprise a Sarbecovirus such as a severe acute respiratory syndrome (SARS)-CoV-1 or SARS-CoV-2.

[0019] The full-length SARS-CoV-25’-UTR comprising the IRES and part of the ORF1a has the nucleic acid sequence set forth in SEQ ID NO: 7. Nucleic acids 130-146 of SEQ ID NO: 7 form the SARS-CoV-2 SL4.5. The nucleic acid sequence of the SARS-CoV- 2 SL4.5 is 5’-TAATTAATAACTAATTA-3’, set forth in SEQ ID NO: 1. Nucleic acids 150- 182 of SEQ ID NO: 7 form the 5’ portion of the stem of the SARS-CoV-2 SL5. The nucleic acid sequence of the 5’ portion of the stem of the SARS-CoV-2 SL5 is 5’- TCGTTGACAGGACACGAGTAACTCGTCTATCTT-3’, set forth in SEQ ID NO: 2.

[0020] Accordingly, the Betacoronavirus (e.g., the Sarbecovirus) SL4.5 may comprise or consist of a nucleic acid sequence at least 90% identical to, or at least 95% identical to, or identical to SEQ ID NO: 1.

[0021] The portion of the Betacoronavirus (e.g., the Sarbecovirus) SL5 may comprise or consist of a nucleic acid sequence at least 90% identical to, or at least 95% identical to, or identical to SEQ ID NO: 2.

[0022] SL4.5 may comprise or consist of a nucleic acid sequence at least 90% identical to SEQ ID NO: 1, and the portion of SL5 may comprise or consist of a nucleic acid sequence at least 90% identical to SEQ ID NO: 2. Alternatively, SL4.5 may comprise or consist of a nucleic acid sequence at least 95% identical to SEQ ID NO: 1, and the portion of SL5 may comprise or consist of a nucleic acid sequence at least 95% identical to SEQ ID NO: 2. Or, SL4.5 may comprise or consist of a nucleic acid sequence identical to SEQ ID NO: 1 and the portion of SL5 may comprise or consist of a nucleic acid sequence identical to SEQ ID NO: 2.

[0023] The one or more nucleic acid sequences capable of forming stem-loop structures may comprise or consist of a nucleic acid sequence at least 90% identical to, at least 95% identical to, or identical to SEQ ID NO: 3.

[0024] The one or more nucleic acid sequences may be capable of forming stem-loop structures comprising or consisting of a nucleic acid sequence at least 90% identical to, at least 95% identical to, or identical to SEQ ID NO: 4.

[0025] The one or more nucleic acid sequences capable of forming stem-loop structures may comprise or consist of a nucleic acid sequence at least 90% identical to, at least 95% identical to, or identical to SEQ ID NO: 5.

[0026] The one or more nucleic acid sequences capable of forming stem-loop structures may comprise or consist of a nucleic acid sequence at least 90% identical to, at least 95% identical to, or identical to SEQ ID NO: 6.

[0027] The provided isolated IRESes or variants thereof are highly efficient in driving cap-independent translation of protein-coding sequences. Accordingly, an expression vector comprising the disclosed isolated IRES or variant thereof is also provided, wherein the isolated IRES or variant thereof is operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein. The peptide, polypeptide or protein may be a therapeutic peptide, polypeptide or protein such as an immunogen, or a reporter protein. For example, the reporter protein may be a fluorescent protein, or the reporter protein may be an enzyme such as a luciferase.

[0028] The expression vector may comprise or consist of deoxyribonucleotides.

[0029] Alternatively, the expression vector may comprise or consist of ribonucleotides. At least one, one or more, more than one, or all, of the ribonucleotides may be modified.

[0030] The expression vector may be a plasmid, a viral vector, a circular polyribonucleic acid, or a messenger RNA.

[0031] Cells that comprise an expression vector comprising an isolated IRES or variant thereof find utility in various applications, including reporter assays. Accordingly, a cell comprising such an expression vector is also provided.

[0032] Methods of identifying compounds that can inhibit the activity of an IRES or variant thereof are also provided. These methods can be used to screen for compounds that have antiviral activity against a virus from the Coronaviridae family such as a Betacoronavirus. The method comprises: (a) providing a cell with an expression vector comprising an isolated IRES or variant thereof, operably linked to a nucleic acid sequence encoding a reporter protein; (b) contacting the cell with one or more compounds; and (c) determining whether the one or more compound modulate(s) expression of the reporter protein.

[0033] Optionally, the method may further comprise: (d) selecting one or more compounds that inhibit the expression of the reporter protein, and further optionally (e)determining whether the one or more compounds selected in step (d) have antiviral activity against one or more Betacoronavirus(es). BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Further description, by way of example, is provided with reference to the following drawings.

[0035] FIG. 1 shows structural elements of the 5’-untranslated region (UTR) of the genomic RNA of SARS-CoV-2, which are conserved in several Betacoronaviruses including SARS-CoV-1. The depicted nucleic acid sequence is provided in SEQ ID NO: 25.

[0036] FIG.2 schematically illustrates a bicistronic reporter cassette that was used to assess the capability of various truncated versions of the 5’-UTR of the genomic RNA of SARS-CoV-2 to initiate translation.

[0037] FIG.3A is a bar graph illustrating the translation activity of the 5’-UTR of the SARS-CoV-2 genomic RNA of FIG. 1 compared to a commonly used EMCV IRES using the bicistronic reporter cassette of FIG.2. FIG.3B is a bar graph illustrating the ratio of Fluc to Rluc for each construct tested in FIG.3A.

[0038] FIG. 4A is a bar graph illustrating the effect of deleting different nucleotide sequences capable of forming stem-loop structures from the 5’-UTR of the SARS-CoV-2 genomic RNA shown in FIG. 1 on translation activity. Translation activity was assessed using the bicistronic reporter cassette of FIG.2.

[0039] FIG.4B is a bar graph illustrating the ratio of Fluc to Rluc for each construct tested in FIG.4A.

[0040] FIG. 5A is a bar graph illustrating the effect of deleting all or part of the nucleic acid sequence capable of forming stem-loop 5 (SL5) and / or SL5abc from the 5’-UTR of the SARS-CoV-2 genomic RNA shown in FIG. 1 on translation activity. Translation activity was assessed using the bicistronic reporter cassette of FIG.2.

[0041] FIG.5B is a bar graph illustrating the ratio of Fluc to Rluc for each construct tested in FIG.5A.

[0042] FIG.6A is a bar graph illustrating that the nucleic acid sequences capable of forming SL4.5 and SL5, with or without SL5abc can initiate translation. Translation activity was assessed using the bicistronic reporter cassette of FIG.2.

[0043] FIG.6B is a bar graph illustrating the ratio of Fluc to Rluc for each construct tested in FIG.6A.

[0044] FIG. 7A is a bar graph illustrating the effect of replacing the nucleic acid sequence capable of forming the 5’ or 3’ stem portion of SL5 with their respective antisense nucleic acid sequence on IRES function. Translation activity was assessed using the bicistronic reporter cassette of FIG.2.

[0045] FIG.7B is a bar graph illustrating the ratio of Fluc to Rluc for each construct tested in FIG.7A. DETAILED DESCRIPTION

[0046] In order for the following description to be more readily understood, certain terms are first defined below. Additional definitions for the following terms and other terms are set forth throughout the specification.

[0047] Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Thus, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. For example, “a ribonucleotide” is understood to represent one or more ribonucleotides. As such, the terms “a” (or “an”), “one or more”, and “at least one” can be used interchangeably herein.

[0048] The words “have” and “comprise,” or variations such as “has,” “having,” “comprises,” or “comprising,” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.

[0049] “And / or” is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as “A and / or B” herein is intended to include “A and B”, “A or B”, “A” (alone), and “B” (alone). Likewise, the term "and / or" as used in a phrase such as “A, B, and / or C” is intended to include “A and / or B and / or C” and to thus encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0050] It is understood that wherever aspects are described herein with the language “comprising”, otherwise analogous aspects described in terms of “consisting of” and / or “consisting essentially of” are also provided. In other words, if an aspect comprises A, B andC, aspects consisting essentially of A, B and C are also contemplated, as are aspects consisting of A, B and C.

[0051] The term “about” refers to an interval of accuracy that a person skilled in the art will understand to still ensure the technical effect of the feature in question. The term indicates a deviation from the indicated numerical value of ±10%, or ±5%, or ±1% of the indicated numerical value.

[0052] The phrase “capable of forming a stem-loop structure” refers to a single- stranded nucleic acid, a portion of which may form a region comprising a plurality of intra- strand base-pairs (stem) connected by an unpaired single-stranded region (loop). Whether a single-stranded nucleic acid forms a stem-loop structure can depend on various factors, for example pH, ionic strength and / or temperature.

[0053] The term “polyprotein” refers to two or more peptides, polypeptides or proteins that are encoded by a single coding sequence and translated as a single chain of amino acids. The individual peptides, polypeptide, or protein that form the polyprotein are typically linked by amino acid sequences that comprise a self-cleavage site. For example, the self-cleavage site can be a 2A peptide.

[0054] The term “expression cassette” refers to a nucleotide sequence comprising a first nucleic acid sequence capable of initiating translation and a second nucleic acid sequence capable of being translated into a peptide, polypeptide or protein, whereby the first and second nucleic acid sequences are operably linked. The first nucleic acid sequence may comprise one or more of the described IRESes or variants thereof. The second nucleic acid sequence may encode more than one peptide, polypeptide or protein, e.g., in form of a polyprotein. The term “reporter cassette” refers to an expression cassette in which the second nucleic acid sequence encodes a reporter protein.

[0055] The term “IRES tandem repeat” refers to two or more of the IRESes or variants thereof described herein, positioned one after the other to increase initiation of translation of an operably linked nucleic acid sequence encoding a peptide, polypeptide or protein. IRESes or variants thereof positioned in this way are referred to herein as being “in tandem”.

[0056] Nucleic acid sequences described herein are denoted with deoxyribonucleotides, i.e., as present in a vector used as a template for transcription of theencoded RNA or expression of an encoded peptide, polypeptide or protein. The skilled person understands that IRESes occur in mRNA. Accordingly, it will be understood that an IRES sequence denoting thymidines should be read as denoting uracils in the context of the nucleic sequence of an mRNA.

[0057] Unless otherwise defined herein, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs and as commonly used in the art to which this application belongs. In case of conflict, the present specification, including definitions, will control.

[0058] Generally, nomenclature used in connection with, and techniques of, cell and tissue culture, molecular biology, virology, immunology, microbiology, genetics, analytical chemistry, synthetic organic chemistry, medicinal and pharmaceutical chemistry, and protein and nucleic acid chemistry and hybridization used herein is in accordance with the nomenclature well-known and commonly used in the art. Enzymatic reactions and purification techniques are performed according to manufacturer’s specifications, as commonly accomplished in the art or as described herein.

[0059] Internal ribosome entry sites (IRESes) are genetic elements that can initiate translation of mRNAs in a 5’-cap-independent manner. IRES were first discovered in viruses, where they were identified as RNA structural elements present in the 5’ untranslated regions (5’-UTRs) of viral mRNAs.

[0060] Among other things, a no more than 175 nucleic acid-long sequence within the 3’ portion of the 5’-untranslated region (UTR) of the SARS-CoV-2 genomic RNA that is capable of initiating translation of an operably linked protein coding sequence has been discovered and is described herein. This IRES sequence comprises nucleic acid sequences that are i) capable of forming stem-loop structures, and ii) conserved in the genomic RNA of other Betacoronaviruses, including but not limited to severe acute respiratory syndrome coronavirus-1 (SARS-CoV-1) and bat coronavirus (BCoV). This 175 nucleic acid-long sequence is referred to generically as “wild-type Betacoronavirus IRES”.

[0061] Variants have also been generated that have improved translation activity relative to the corresponding wild-type Betacoronavirus IRES when operably linked to a nucleic acid sequence encoding a protein. These variants comprise fewer nucleic acids than the corresponding wild-type Betacoronavirus IRES, making them highly attractive for use inexpression cassettes, e.g., in therapeutic RNAs and viral vectors. In addition, these variants have higher translation activity and comprise fewer nucleic acids than the commonly used EMCV and CVB3 IRESes, which makes them even more appealing.

[0062] IRESes such as those described may be isolated from the genomic RNA of a Coronaviridae virus, where they initiate translation of viral proteins. Variants thereof may be modified as described herein (e.g., by deletion of one or more nucleic acid sequences) to render the isolated IRES more efficient at initiating translation than the corresponding wild- type IRES. The Coronaviridae family comprises Coronavirinae, Letovirinae, Orthocoronavirinae, Pitovirinae, as well as unclassified Coronaviridae. The unclassified Coronaviridae may be a bat coronavirus (BCoV).

[0063] As such, the provided IRESes may be isolated from a Coronaviridae virus such as an Orthocoronavirinae virus. The Orthocoronavirinae virus may be an Alphacoronavirus, a Betacoronavirus, a Deltacoronavirus, or a Gammacoronavirus, or an unclassified Orthocoronavirinae.

[0064] When, e.g., the Coronaviridae virus is an Orthocoronavirinae virus, it may be an isolated Betacoronavirus IRES or variant thereof. The Betacoronavirus may be an Embecovirus, a Hibecovirus, a Merbecovirus, a Nobecovirus, or a Sarbecovirus, or an unclassified Betacoronavirus. In particular, the Betacoronavirus may be a Sarbecovirus or a Merbecovirus, or more particularly, may be a Sarbecovirus. When, e.g., the Coronaviridae virus is a Sarbecovirus, the Sarbecovirus may be a severe acute respiratory syndrome- associated coronavirus (SARS-CoV) such as SARS-CoV-1 or SARS-CoV-2. Alternatively, the Coronaviridae may be a Betacoronavirus such as a Merbecovirus. Isolated IRESes or variants thereof

[0065] Chemical probing and sequence analysis have revealed that the 5’-untranslated region (UTR) of the genomic RNA of viruses in the Coronaviridae family such as Betacoronaviruses comprises a set of conserved RNA structural elements (Sanders et al. (2020) BioRxiv doi: https: / / doi.org / 10.1101 / 2020.06.15.153197; Miao et al. (2020) RNA Biology 18(4): 447–456 and Lan et al. (2022) Nature Communications 13:1128). This region is composed of approximately 300 nucleotides and comprises a series of nucleic acid sequences that are capable of forming stem-loop (SL) structures, which include in the 5’ to3’ direction (5’→3’) SL1, SL2, SL3, SL4, SL4.5 and SL5 (see FIG. 1). As also shown in FIG.1, SL5 branches into three additional stem-loops: SL5a, SL5b and SL5c.

[0066] The highly structured regions of the 5’-UTR have lower nucleotide variance than surrounding regions. Nucleotide variance in the highly structured region is typically confined to unpaired nucleotides, e.g., those in loop regions, suggesting that the stem structures of the stem-loops are highly conserved to preserve functionality associated with the 5’-UTR.

[0067] There has now been discovered a minimal region comprising a 3’ portion of the 5’-UTR of the Betacoronavirus genome that can initiate translation when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein. In particular, it has been discovered that the 175 nucleic acids which include the 3’ portion of the 5’-UTR are sufficient for translation activity. Accordingly, an isolated IRES or variant thereof is provided that comprises no more than 175 nucleic acids. At least 30% of the no more than 175 nucleic acids are one or more nucleic acid sequences capable of forming stem-loop structures in the Betacoronavirus genome 5’-UTR. These nucleic acid sequences may include at least a portion of SL4.5, which was previously identified in the Betacoronavirus genome as being capable of forming a stem-loop structure. These nucleic acid sequences may also include at least a portion of SL5, which was similarly identified in the Betacoronavirus genome as being capable of forming a stem-loop structure. Also provided are variants of this minimal Betacoronavirus IRES sequence comprising one or more mutations and / or deletions which are capable of initiating translation when operably linked to a protein coding sequence.

[0068] Specifically, there is provided an isolated Betacoronavirus internal ribosome entry site (IRES), or a variant thereof comprising one or more mutations and / or deletions, comprising no more than 175 nucleic acids and including a 3’ portion of the 5’-untranslated region (UTR) of a Betacoronavirus genome, wherein: the IRES or variant thereof is capable of initiating translation when operably linked to a protein coding sequence; and at least 30% of the no more than 175 nucleic acids are one or more nucleic acid sequences capable of forming stem-loop structures in the Betacoronavirus genome 5’-UTR.

[0069] The one or more nucleic acid sequences capable of forming stem-loop structures may comprise or consist of stem-loop 4.5 (SL4.5), and may further optionally comprise or consist of at least a portion of stem-loop 5 (SL5).

[0070] Surprisingly, it was discovered that the 175 nucleic acid-long isolated wild- type Betacoronavirus IRES contains elements that do not contribute to the translation activity and, that indeed, may have inhibitory activity, e.g., through interactions with IRES-trans- acting factors (ITAFs) or direct structural hindrance. In particular, it was discovered that the nucleic acid sequence that is capable of forming SL5 includes one or more structural elements (e.g., one or more stem-loops, such as SL5a, SL5b and SL5c) which can be deleted from SL5 without diminishing the translation activity of the IRES. In fact, some of the deletion variants were observed to have improved translation activity relative to the corresponding wild-type Betacoronavirus IRES including these structural elements.

[0071] Accordingly, isolated Betacoronavirus IRES variants may comprise one or more mutations and / or deletions relative to a corresponding wild-type IRES, and yet have improved translation activity. Translation activity of an isolated Betacoronavirus IRES variant may be improved compared to a corresponding wild-type Betacoronavirus IRES by at least about 1.5-fold, about 2-fold, or about 3-fold. Improved translation activity can be demonstrated by operably linking i) the isolated wild-type Betacoronavirus IRES and ii) a variant thereof, to a polypeptide (e.g., a reporter protein) and comparing the translation activity of the wild-type Betacoronavirus IRES / polypeptide to the translation activity of the variant Betacoronavirus IRES / polypeptide (e.g., using suitable reporter assays as described herein).

[0072] The isolated Betacoronavirus IRES variants may comprise less than 175 nucleic acids, e.g., 170 nucleic acids or less, 160 nucleic acids or less, 145 nucleic acids or less, 125 nucleic acids or less, or 100 nucleic acids or less.

[0073] For example, variants in which SL5a and / or SL5b had been deleted surprisingly showed increased translation activity compared to a corresponding wild-type Betacoronavirus IRES. Even more surprisingly, a variant in which the entire region comprising SL5a, SL5b and SL5c had been deleted exhibited an about 2-fold increase in translation activity compared to a corresponding wild-type IRES.

[0074] Accordingly, variants of an isolated Betacoronavirus IRES may comprise no more than 160 nucleic acids and include a nucleic acid sequence comprising SL4.5 and a portion of SL5, wherein one or more of SL5a, SL5b and SL5c are deleted, e.g., SL5a may be deleted, SL5b may be deleted, both SL5a and SL5b may be deleted, or SL5a, SL5b and SL5c may be deleted.

[0075] The region comprising or consisting of SL5a, SL5b and SL5c may be replaced with a sequence capable of forming a loop. The sequence capable of forming a loop may comprise about 3-16 nucleic acids, e.g., 5-10 nucleic acids. Alternatively, the region comprising SL5a, SL5b and SL5c may not be replaced with a sequence capable of forming a loop (i.e., the nucleic acids of SL5 remaining after the deletion of the region comprising SL5a, SL5b and SL5c are joined without any linking nucleic acids).

[0076] The IRES variant may comprise about 145 nucleic acids or less, or about 125 nucleic acids or less, or about 100 nucleic acids or less, or about 90 nucleic acids or less.

[0077] For instance, the IRES variant may comprise at least about 50 nucleic acids, from about 50 nucleic acids to about 145 nucleic acids, from about 50 nucleic acids to about 125 nucleic acids, from about 50 nucleic acids to about 90 nucleic acids, or from about 50 nucleic acids to about 70 nucleic acids. For example, the IRES variant may comprise about 100 nucleic acids or about 55 nucleic acids.

[0078] A Betacoronavirus IRES variant may comprise about 50 to about 145 nucleic acids including a nucleic acid sequence comprising SL4.5 and at least a portion of SL5, wherein one or more of SL5a, SL5b and SL5c has / have been deleted and the nucleic acid sequence optionally comprises one or more additional mutations or deletions. Such an IRES variant may have a translation activity about 1.5 to about 3-fold higher than a corresponding wild-type IRES.

[0079] Alterantively, a Betacoronavirus IRES variant may comprise about 50 to about 100 nucleic acids including a nucleic acid sequence comprising SL4.5 and at least a portion of SL5, wherein SL5a, SL5b and SL5c have been deleted. The nucleic acid sequence may comprise one or more additional mutations or deletions. SL5a, SL5b and SL5c may be replaced with a nucleic acid sequence capable of forming a loop, The nucleic acid sequence capable of forming a loop may comprises 3-16 nucleic acids (e.g., 5-10 nucleic acids). Such IRES variants may have a translation activity at least about 2-fold higher than the corresponding wild-type IRES. Exemplary isolated IRESes and variants thereof

[0080] An isolated IRES or variant thereof may comprise a nucleic acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to SEQ IDNO: 1 and may be capable of initiating translation when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein. The isolated IRES or variant thereof may have translation activity comparable to or better (e.g., at least 2-fold higher) than SEQ ID NO: 7 (or a corresponding homologous sequence of a Betacoronavirus genome) when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein.

[0081] For example, the isolated IRES or variant thereof may comprise a nucleic acid sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to, or identical to, SEQ ID NO: 1.

[0082] Alternatively or in addition, an isolated IRES or variant thereof may comprise a nucleic acid sequence that is at least about 60% at least about 65%, at least about 70%, at least about 75%, at least about 85%, at least about 90%, or at least about 95% SEQ ID NO: 2 and may be capable of initiating translation when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein. The isolated IRES or variant thereof may have translation activity comparable to or better (e.g., at least 2-fold higher) than SEQ ID NO: 7 (or a corresponding homologous sequence of a Betacoronavirus genome) when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein.

[0083] For example, the isolated IRES or variant thereof may comprise a nucleic acid sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to, or identical to, SEQ ID NO: 2.

[0084] An isolated IRES or variant thereof may comprise a nucleic acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to SEQ ID NO: 6 and is capable of initiating translation when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein. The isolated IRES or variant thereof may have translation activity comparable to or better (e.g., at least 2-fold higher) than SEQ ID NO: 7 (or a corresponding homologous sequence of a Betacoronavirus genome) when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein.

[0085] The isolated IRES or variant thereof may comprise a nucleic acid sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to, or identical to, SEQ ID NO: 6.

[0086] An isolated IRES or variant thereof may comprise a nucleic acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical to SEQ ID NO: 4 and is capable of initiating translation when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein. The isolated IRES or variant thereof has translation activity comparable to or better (e.g., at least 2-fold higher, for example at least 4-fold higher) than SEQ ID NO: 7 (or a corresponding homologous sequence of a Betacoronavirus genome) when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein. The isolated IRES or variant thereof may have translation activity comparable to or better (e.g., at least 2-fold higher) than SEQ ID NO: 6 (or a corresponding homologous sequence of a Betacoronavirus genome) when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein.

[0087] The isolated IRES or variant thereof may comprise a nucleic acid sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to, or identical to, SEQ ID NO: 4.

[0088] An isolated IRES or variant thereof may comprise a nucleic acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to SEQ ID NO: 5 and is capable of initiating translation when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein. The isolated IRES or variant thereof may have translation activity comparable to or better (e.g., at least 2-fold higher) than SEQ ID NO: 7 (or a corresponding homologous sequence of a Betacoronavirus genome) when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein. The isolated IRES or variant thereof may have translation activity comparable to or better (e.g., at least 2- fold higher) than SEQ ID NO: 6 (or a corresponding homologous sequence of a Betacoronavirus genome) when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein.

[0089] The isolated IRES or variant thereof may comprise a nucleic acid sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to, or identical to, SEQ ID NO: 5.

[0090] Alternatively, an isolated IRES or variant thereof may comprise a nucleic acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to SEQ ID NO: 8 and may be capable of initiating translation when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein. The isolated IRES or variant thereof may have translation activity comparable to or better (e.g., at least 2-fold higher) than SEQ ID NO: 7 (or a corresponding homologous sequence of a Betacoronavirus genome) when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein. The isolated IRES or variant thereof may have translation activity comparable to or better (e.g., at least 2-fold higher) than SEQ ID NO: 6 (or a corresponding homologous sequence of a Betacoronavirus genome) when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein.

[0091] The isolated IRES or variant thereof may comprise a nucleic acid sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to, or identical to, SEQ ID NO: 8.

[0092] An isolated IRES or variant thereof may comprise a nucleic acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to SEQ ID NO: 9 and is capable of initiating translation when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein. The isolated IRES or variant thereof may have translation activity comparable to or better (e.g., at least 2-fold higher) than SEQ ID NO: 7 (or a corresponding homologous sequence of a Betacoronavirus genome) when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein. The isolated IRES or variant thereof may have translation activity comparable to or better (e.g., at least 2- fold higher) than SEQ ID NO: 6 (or a corresponding homologous sequence of a Betacoronavirus genome) when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein.

[0093] The isolated IRES or variant thereof may comprise a nucleic acid sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to, or identical to, SEQ ID NO: 9.

[0094] An isolated IRES or variant thereof may comprise a nucleic acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to SEQ ID NO: 3 and may be capable of initiating translation when operably linked to a nucleic acidsequence encoding a peptide, polypeptide or protein. The isolated IRES or variant thereof may have translation activity comparable to or better (e.g., at least 2-fold higher) than SEQ ID NO: 7 (or a corresponding homologous sequence of a Betacoronavirus genome) when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein. The isolated IRES or variant thereof may have translation activity comparable to or better (e.g., at least 2-fold higher) than SEQ ID NO: 6 (or a corresponding homologous sequence of a Betacoronavirus genome) when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein.

[0095] The isolated IRES or variant thereof may comprise a nucleic acid sequence at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to, or identical to, SEQ ID NO: 3.

[0096] Exemplary IRESes are shown in Table 1. Table 1. SARS-CoV-2 IRES and variants with deletions of the indicated stem-loop structures

[0097] The isolated IRES sequences may include one or more (e.g., two, three, four, five, six, seven, eight, nine or ten or more ) additional nucleic acids that are not present in the native 5’-UTR of a Betacoronavirus IRES, e.g., to ensure that the IRES is operably linked to a nucleic acid sequence encoding a peptide, polypeptide, or protein, or to link sequence elements that are important for IRES function. For example, the IRES sequences may include one or more (e.g., two, three, four, five, six, seven, eight, nine or ten or more) additional nucleic acids to keep the IRES in-frame with a downstream open reading frame. Similarly, variants in which sequence elements have been deleted may include one or more (e.g., two, three, four, five, six, seven, eight, nine or ten or more) additional nucleic acids to join sequence elements that are important for IRES function. Uses

[0098] The isolated Betacoronavirus IRES or variant thereof can be operably linked to a nucleic acid sequence encoding a peptide, polypeptide, or protein to induce translation of the peptide, polypeptide or protein. This expression cassette may form part of an expression vector, which may include additional elements.

[0099] The variant Betacoronavirus IRESes may provide an additional benefit in applications where the number of nucleic acids in an expression vector is limited, but high translation of an operably linked peptide, polypeptide or protein is desired. Such variants, which comprise fewer nucleic acids than the wild-type Betacoronavirus IRES, while also increasing IRES-dependent translation activity, have been identified. Therapeutic peptides, polypeptides, or proteins

[0100] The peptide, polypeptide or protein may be a therapeutic peptide, polypeptide or protein. The therapeutic peptide, polypeptide or protein may be an immunogen, such as an immunogen from a bacterium, a virus, or a fungus. For example, the immunogen may be a surface glycoprotein, e.g., a viral spike glycoprotein, a bacterial adhesin, or a tumor antigen. The immunogen may be modified relative to a peptide, polypeptide, or protein as it naturally occurs in a bacterium, virus, or fungus, e.g., to improve surface expression or immunogenicity. For example, the immunogen may be a fusion peptide or fusion protein.

[0101] Alternatively, the therapeutic peptide, polypeptide or protein may be a replacement peptide, polypeptide or protein. For example, the therapeutic peptide may be a peptide, polypeptide or protein deficient in a subject receiving an expression vector comprising the nucleic sequence encoding the therapeutic peptide, polypeptide or protein. For example, the peptide, polypeptide or protein may be an enzyme (e.g., a metabolic enzyme) that is deficient in the subject receiving the expression vector. Or the therapeutic peptide, polypeptide or protein may be a hormone (e.g., insulin or a growth factor) that is deficient in the subject receiving the expression vector.

[0102] The therapeutic peptide, polypeptide or protein may alternatively be a cytokine, chimeric T cell receptor or an antibody or fragment thereof, or any other protein that can be used therapeutically.

[0103] Multiple hypoxia-regulated mRNAs are reported to contain an IRES (Young et al.

[2008] Journal of Biological Chemistry 283(24):16309–16319). It is hypothesised that IRESes allow for translation of such mRNAs when cap-dependent translation is diminished, due to a decrease in O2. Therefore, the present expression vector may be used to express a therapeutic polypeptide selectively in cells that are under stress conditions, e.g., hypoxia. For example, an expression vector comprising an isolated IRES or variant thereof described herein operably linked to a nucleic acid sequence encoding a therapeutic peptide, polypeptide, or protein may be used for targeted expression of the therapeutic peptide, polypeptide, or protein in cells in a hypoxic environment (e.g., in a tumor or in ischemic tissue). Polyproteins

[0104] The peptide, polypeptide or protein can be a polyprotein. The polyprotein may comprise two or more (e.g., three, four five, six, seven eight, nine or ten) peptides, polypeptides or proteins. The two or more peptides, polypeptides or proteins may be linked by one or more amino acid sequences comprising a self-cleavage site. The self-cleavage site may be a 2A peptide.

[0105] Accordingly, the IRES or variant thereof can initiate translation of two or more peptides, polypeptides or proteins, when the IRES or variant is operably linked to a nucleic acid sequence encoding a polyprotein.

[0106] The two or more peptides may be cancer neoepitopes. The cancer neoepitopes may bind a major-histocompatibility complex (MHC).

[0107] The two or more polypeptides or proteins can assemble to form a complex (e.g., a heterodimer). The two or more polypeptides or proteins do not assemble to form a complex. Reporter proteins

[0108] The peptide, polypeptide or protein may be a reporter protein. The reporter protein may be a fluorescent protein (e.g., green fluorescent protein [GFP], or red fluorescent protein [RFP]).

[0109] The reporter protein may be an enzyme. The enzyme may be a luciferase. The luciferase may be a firefly luciferase or a Renilla luciferase. The enzyme may be a beta- galactosidase or an alkaline phosphatase. Expression vectors

[0110] Moreover, an expression vector is provided that comprises the isolated IRES or variant thereof, operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein.

[0111] An expression vector can be a DNA molecule composed of deoxyribonucleotides. The DNA molecule can be circular or linear. The expression vector may be a plasmid or viral DNA vector, e.g., a gene therapy vector such as an Adeno- associated virus (AAV) vector.

[0112] Alternatively, the expression vector can be an RNA molecule (i.e., a messenger RNA [mRNA]) composed of ribonucleotides. The ribonucleotides can comprise unmodified and modified ribonucleotides. For example, at least one of the ribonucleotides can be modified. The at least one modified ribonucleotide may be pseudouridine or a variant thereof. For example, the at least one modified ribonucleotide may be N1- methylpseudouridine.

[0113] The RNA molecule may be circular or linear. A linear RNA molecule may comprise a 5’-cap. The RNA may comprise in 5’→3’ direction, a 5’-cap, a 5’-untranslated region (5’-UTR), a first nucleic acid sequence encoding a first peptide, polypeptide, or protein, an isolated IRES or variant, a second nucleic sequence encoding a second peptide,polypeptide, or protein and a 3’ untranslated region (3’-UTR), and a poly-A tail. The 5’-cap drives translation of a first peptide, polypeptide, or protein encoded by the linear RNA molecule (e.g., an mRNA), and the isolated IRES or variant thereof drives translation of a second peptide, polypeptide, or protein encoded by the linear RNA molecule.

[0114] The RNA may be self-amplifying. for example, the first peptide, polypeptide, or protein may be a viral polymerase, e.g., an alpha virus replicase. The second peptide, polypeptide, or protein may be an immunogen.

[0115] The addition of a 5’-cap to a linear RNA molecule during or after in vitro transcription typically requires additional process step and / or reagents and therefore is costly. Moreover, the process can be inefficient resulting in a mixture of capped and uncapped RNA molecules that may require further purification. IRESes can initiate translation in a Cap- independent manner and may therefore obviate the need for a 5’-cap. And so, the RNA molecule may not comprise a 5’-cap. The 5’-cap structure is known to impart stability on linear RNA molecules (e.g., mRNA). Circularization of uncapped RNA molecules improves their stability. Accordingly, the RNA molecule may be circular.

[0116] In addition, a vector (e.g., a DNA plasmid or viral vector) is provided comprising the IRES or variant thereof and a multiple cloning site arranged in such a manner that insertion of a nucleic acid sequence encoding a peptide, polypeptide, or protein operably links the nucleic acid to the IRES or variant.

[0117] The IRES or variant thereof may form part of a 5’-untranslated region (5’- UTR) of a nucleic acid sequence encoding a messenger RNA (mRNA) comprising a coding region for a peptide, polypeptide or protein. Multiple IRESes

[0118] Expression vectors may comprise multiple expression cassettes each comprising an isolated IRES or variant thereof, operably linked to a different nucleic acid sequence encoding a peptide, polypeptide, or protein.

[0119] The expression vector may comprise a first IRES or variant as described herein, operably linked to a first nucleic acid sequence encoding a first peptide, polypeptide or protein, and a second isolated IRES or variant as described herein, operably linked to a second nucleic acid sequence encoding a second peptide, polypeptide or protein. The first and second IRESes or variants may have the same nucleic acid sequence. Or, the first andsecond isolated IRESes or variants may have different nucleic acid sequences. Furthermore, the first and second IRESes or variants may differ in their translation activity. In some instances, it may be desirable to express a first protein (e.g., a first component of a multimeric protein) and a second protein (e.g., a second component of a multimeric protein) in a particular ratio to enhance complex formation between the first and second proteins (e.g., to express the first and second components in the ratio present in the resulting multimeric protein). Accordingly, different IRESes or variants may be used to express the first and second proteins at different molar ratios.

[0120] For example, an isolated Betacoronavirus IRES variant without SL5abc may be used to initiate translation of an operably linked first nucleic acid sequence encoding a first peptide, polypeptide or protein and an isolated Betacoronavirus IRES variant with SL5abc may be used to initiate translation of a second nucleic acid sequence encoding a second peptide, polypeptide or protein, or vice versa.

[0121] The expression vector may comprise three, four, five, six, seven, eight, nine or ten IRESes or variants, wherein each IRES or variant is operably linked to a different nucleic acid sequence encoding a peptide, polypeptide or protein. Each of the three, four, five, six, seven, eight, nine or ten IRESes or variants may have the same nucleic acid sequence. Or, each of the three, four, five, six, seven, eight, nine or ten IRESes or variants may have different nucleic acid sequences. Each of the three, four, five, six, seven, eight, nine or ten nucleic acid sequences may encode a different peptide, polypeptide or protein, e.g., a different immunogenic peptide or T-cell epitope.

[0122] In some instances, it may be desirable to arrange two or more IRESes or variants in tandem operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein to form an expression cassette in order to increase the translation of the nucleic sequence. It may be that the IRESes or variants bind to one or more IRES Trans-Acting Factors (ITAFs) to initiate translation. Therefore, arranging two or more IRESes or variants in tandem may increase translation activity relative to a single IRES by recruiting a plurality of ITAFs to the expression cassette.

[0123] Accordingly, an expression vector may comprise an expression cassette comprising two or more isolated IRESes or variants arranged in tandem (also referred to herein as an “IRES tandem repeat”) operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein. The expression vector may comprise multiple suchexpression cassettes, wherein the nucleic acid sequence in each expression cassette encodes a different peptide, polypeptide or protein.

[0124] The IRES tandem repeats in each of the expression cassettes may have the same nucleic acid sequence. Or, the IRES tandem repeats in one or more of the expression cassettes may have different nucleic acid sequences. The IRES tandem repeats in all expression cassettes may have different nucleic acid sequences.

[0125] The different peptides, polypeptides or proteins may be different immunogenic peptides or different T-cell epitopes. The different peptides, polypeptides or proteins may be different reporter peptides, polypeptides or proteins. Host cells

[0126] A host cell comprising an expression cassette or vector including an isolated IRES or variant is also provided. The host cell may be a bacterial cell. Or, the cell may be an animal cell. The animal cell may be an insect cell or a mammalian cell. The mammalian cell may be a human cell. Compositions and kits

[0127] An isolated IRES or variant, an expression cassette or vector comprising the IRES or variant, or a cell comprising the expression cassette or vector are provided in a composition with one or more excipients (e.g., water, a buffering agent or a salt). Kits

[0128] A kit is also provided that comprises a vector (e.g., a DNA plasmid or viral vector) comprising the isolated IRES or variant thereof and a multiple cloning site arranged in such a manner that insertion of a nucleic acid sequence encoding a peptide, polypeptide, or protein operably links the nucleic acid to the IRES or variant. The kit may further comprise one or more reagents (e.g., restriction enzymes, ligases or polymerases) for forming a vector comprising the IRES or variant operably linked to the nucleic acid sequence.

[0129] A kit may comprise a vector (e.g., a DNA plasmid or viral vector) comprising an isolated IRES or variant operably linked to a reporter protein (e.g., a luciferase). The kit may further comprises one or more reagents (e.g., luciferin) to detect the activity of the reporter protein.

[0130] The vector may comprise a dual-luciferase expression cassette as in the Examples that can distinguish between Cap-dependent and Cap-independent reporter expression. An exemplary vector comprises a first nucleic acid sequence encoding a 5’-UTR, a second nucleic acid sequence encoding a first reporter protein (e.g., firefly luciferase), a third nucleic acid sequence encoding an isolated IRES or variant, a fourth nucleic acid sequence encoding a second reporter protein (e.g., Renilla luciferase), and a fifth nucleic acid sequence encoding a 3’-UTR. Compositions

[0131] An expression vector comprising the IRES or variant thereof may be provided with a vehicle that enhances delivery of the expression vector to a cell of interest. Suitable delivery vectors include transfection agents (including cationic liposomes), lipid nanoparticles, viral or virus-like particles etc. The expression vector may be encapsulated in a lipid nanoparticle. A composition comprising the expression vector and a delivery vehicle may further comprise one or more pharmaceutically acceptable excipients, e.g., a buffering agent, salt, sugar etc.

[0132] A composition comprising the expression vector and a delivery vehicle (e.g., a vaccine comprising the expression vector encapsulated in a lipid nanoparticle) may be provided in a syringe for administration of the composition to a subject. Screening methods

[0133] The expression vectors, in particular the reporter cassettes, additionally find utility in methods to identify compounds or other factors that modulate the translation activity of Betacoronavirus IRESes. Such compounds may be useful as therapeutic agents, e.g., because they inhibit initiation of translation of the proteins encoded by the Betacoronavirus genome. Because of their greater translation activity, the IRES variants may be particularly useful in screening assays since they provide greater sensitivity due to greater signal to noise ratio. Of course, candidate compounds that modulate the translation activity against a variant IRES require further validation using a wild-type virus with a corresponding wild-type IRES.

[0134] Accordingly, a method is provided that comprises: (a) providing a cell with an expression vector comprising an IRES or variant, operably linked to a nucleic acid sequence encoding a reporter protein; (b) contacting the cell with one or more compound(s); and (c) determining whether the one or more compound(s) modulate(s) expression of thereporter protein. The method may further comprise (d) selecting one or more compound(s) that inhibit the expression of the reporter protein; and (e) determining whether the one or more compound(s) selected in step (d) has / have antiviral activity against one or more Betacoronavirus(es). Compounds that have antiviral activity against one or more Betacoronavirus(es) may be used in a method of treating a subject with a Betacoronavirus infection.

[0135] A further method is provided that comprises: (a) providing a cell with an expression vector comprising an IRES or variant, operably linked to a nucleic acid sequence encoding a reporter protein; (b) contacting the cell with one or more factor(s) suspected of having IRES trans-acting activity; and (c) determining whether the one or more factor (s) modulate(s) expression of the reporter protein.

[0136] The reporter protein may be a fluorescent protein (e.g., GFP or RFP). The reporter protein may comprise an enzyme. The enzyme may be a beta-galactosidase or alkaline phosphatase.

[0137] The enzyme may be a luciferase. The luciferase may be a firefly luciferase such as a Renilla luciferase.

[0138] The expression vector may comprise a dual-luciferase expression cassette as described herein. Numbered embodiments

[0139] The following numbered embodiments are provided: 1. An isolated Betacoronavirus internal ribosome entry site (IRES), or a variant thereof comprising one or more mutations and / or deletions, comprising no more than 175 nucleic acids and including a 3’ portion of the 5’-untranslated region (UTR) of a Betacoronavirus genome, wherein: (i) the IRES or variant thereof is capable of initiating translation when operably linked to a protein coding sequence; and (ii) at least 30% of the no more than 175 nucleic acids are one or more nucleic acid sequences capable of forming stem-loop structures in the Betacoronavirus genome 5’-UTR.The isolated Betacoronavirus IRES or variant thereof according to embodiment 1, wherein the one or more nucleic acid sequences capable of forming stem-loop structures comprise(s) stem-loop 4.5 (SL4.5). The isolated Betacoronavirus IRES or variant thereof according to embodiments 1 or 2, wherein the one or more nucleic acid sequences capable of forming stem-loop structures comprise(s) at least a portion of stem-loop 5 (SL5). The isolated IRES or variant thereof according to embodiment 3, wherein one or more of SL5a, SL5b and SL5c is / are deleted from SL5. The isolated Betacoronavirus IRES or variant thereof according to embodiment 4, wherein SL5a and SL5b are deleted from SL5. The isolated Betacoronavirus IRES or variant thereof according to embodiments 4 or 5, wherein SL5c is deleted from SL5. The isolated Betacoronavirus IRES or variant thereof according to embodiment 4, wherein SL5a, SL5b and SL5c are deleted from SL5. The isolated Betacoronavirus IRES or variant thereof according to embodiment 7, wherein the region comprising SL5a, SL5b and SL5c is replaced with a nucleic acid sequence capable of forming a loop. The isolated Betacoronavirus IRES or variant thereof according to any preceding embodiment, comprising a portion of a 5’ terminal nucleic acid sequence of open reading frame 1a (ORF1a) of the Betacoronavirus genome. The isolated Betacoronavirus IRES or variant thereof according to any preceding embodiment, comprising 170 nucleic acids or less, 160 nucleic acids or less, 145 nucleic acids or less, or 125 nucleic acids or less.The isolated Betacoronavirus IRES or variant thereof according to any preceding embodiment, comprising at least about 50 nucleic acids. The isolated Betacoronavirus IRES or variant thereof according to any preceding embodiment, comprising about 50 nucleic acids to about 100 nucleic acids, about 50 nucleic acids to about 90 nucleic acids, or about 50 nucleic acids to about 55 nucleic acids. The isolated Betacoronavirus IRES or variant thereof according to any preceding embodiment, wherein the IRES or variant thereof is capable of improving translation compared to a corresponding wild-type IRES by at least about 1.5-fold, about 2-fold, or about 3-fold. The isolated Betacoronavirus IRES or variant thereof according to any preceding embodiment, wherein the Betacoronavirus comprises any one of an Embecovirus, Sarbecovirus, Merbecovirus, Nobecovirus, or Hibecovirus. The isolated Betacoronavirus IRES or variant thereof according to embodiment 14, wherein the Sarbecovirus comprises SARS-CoV or SARS-CoV-2. The isolated Betacoronavirus IRES or variant thereof according to any preceding embodiment, wherein SL4.5 comprises a nucleic acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 1. The isolated Betacoronavirus IRES or variant thereof according to any preceding embodiment, wherein the portion of SL5 comprise a nucleic acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 2. The isolated Betacoronavirus IRES or variant thereof according to any preceding embodiment, wherein the one or more nucleic acid sequences capable of forming stem-loop structures comprise(s), or consist(s) of, a nucleic acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 3.The isolated Betacoronavirus IRES or variant thereof according to any preceding embodiment, wherein the one or more nucleic acid sequences capable of forming stem-loop structures comprise(s), or consist(s) of, a nucleic acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 4. The isolated Betacoronavirus IRES or variant thereof according to any preceding embodiment, wherein the one or more nucleic acid sequences capable of forming stem-loop structures comprise(s), or consist(s) of, a nucleic acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 5. The isolated Betacoronavirus IRES or variant thereof according to any preceding embodiment, wherein the one or more nucleic acid sequences capable of forming stem-loop structures comprise(s), or consist(s) of, a nucleic acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 6. An expression vector comprising the isolated Betacoronavirus IRES or variant thereof according to any preceding embodiment, operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein. The expression vector of embodiment 22, wherein the peptide, polypeptide or protein is a therapeutic peptide, polypeptide or protein. The expression vector of embodiment 23, wherein the therapeutic peptide, polypeptide or protein is an immunogen or an enzyme. The expression vector of embodiment 22, wherein the peptide, polypeptide or protein is a reporter protein. The expression vector of embodiment 25, wherein the reporter protein is a fluorescent protein. The expression vector of embodiment 26, wherein the reporter protein is an enzyme.The expression vector of embodiment 27, wherein the enzyme is a luciferase. The expression vector of any one of embodiments 22-28, composed of deoxyribonucleotides. The expression vector of any one of embodiments 22-28, composed of ribonucleotides. The expression vector of embodiment 30, wherein at least one of the ribonucleotides is modified. The expression vector of any one of embodiments 22-31, wherein the expression vector is a plasmid, a viral vector, a circular polyribonucleic acid, or a messenger RNA. A cell comprising the expression vector of any one of embodiments 22-32. A composition comprising the isolated Betacoronavirus IRES or variant thereof according to any one of embodiments 1-21, and one or more excipients. The composition of embodiment 34, wherein the one or more excipients is one or more of water, a buffering agent and a salt. A method comprising: (a) providing a cell with an expression vector comprising the isolated Betacoronavirus IRES or variant thereof according to any one of embodiments 1-21 operably linked to a nucleic acid sequence encoding a reporter protein; (b) contacting the cell with one or more compounds; and (c) determining whether the one or more compound modulate(s) expression of the reporter protein. The method of embodiment 36, further comprising:(d) selecting one or more compounds that inhibit the expression of the reporter protein; (e) determining whether the one or more compounds selected in step (d) have antiviral activity against one or more Betacoronavirus(es). EXAMPLES

[0140] Although methods and materials similar or equivalent to those described herein can be used, suitable methods and materials are described below. The following examples are included for illustrative purposes only and are not intended to be limiting.

[0141] Figure 1 shows structural elements of the 5’-untranslated region (UTR) of the genomic RNA of SARS-CoV-2, which are conserved in several Betacoronaviruses including SARS-CoV-1. The depicted region is composed of approximately 300 nucleotides and comprises a series of stem-loop (SL)-forming nucleic acid sequences. These are indicated in 5’→3’ direction as SL1, SL2, SL3, SL4, SL4.5, and SL5. SL5 further branches into three additional stem-loops: SL5a, SL5b and SL5c.

[0142] Figure 2 schematically illustrates a bicistronic reporter cassette that was used in the Examples to identify the isolated IRESes and variants thereof. 5’ cap-dependent translation drives Renilla luciferase (Rluc) expression. Stop codon readthrough is prevented with a highly structured encephalomyocarditis non-functional IRES sequence (∆EMCV). Firefly luciferase (Fluc) expression is driven by EMCV IRES translation or SARS-CoV-2 IRES translation. Relative lengths are approximate and not to scale.

[0143] Figure 3 illustrates translation activity of a SARS-CoV-25’-UTR sequence with the nucleic acid sequence of SEQ ID NO: 7 compared to an EMCV IRES. Translation activity was determined using a bicistronic reporter cassette as shown in Figure 2. A bicistronic reporter cassette without an IRES (null) served as a control. The data in Figure 3A show the amount of Fluc activity and Rluc activity (A.U. = arbitrary units), each separately scaled to EMCV = 100. The EMCV IRES drives Cap-independent translation activity (positive control). The ΔCMV data show that no promoter is present in the intercistronic region (negative control). Overall, the data demonstrate the greater translation activity of the SARS-CoV-25’-UTR sequence compared to the EMCV IRES. Figure 3B shows the ratio of the Fluc value to the Rluc value for each of the constructs, which wereshown in Figure 3A. The greater the ratio of Fluc to Rluc, the greater the non-cap mediated translation activity compared to cap mediated translation activity.

[0144] Figure 4 illustrates the effect of deleting different nucleotide sequences capable of forming stem-loop structures from the 5’-UTR of a SARS-CoV-2 genomic RNA on translation activity. Translation activity was assessed using bicistronic reporter cassettes as shown in Figure 2. Bicistronic reporter cassettes comprising (1) a non-functional EMCV IRES sequence (null), (2) an EMCV IRES (EMCV), and (3) the full-length SARS-CoV-25’- UTR (SARS-CoV-2) served as controls. The data in Figure 4A show the amount of Fluc activity and Rluc activity (A.U. = arbitrary units), each separately scaled to EMCV = 100. The Fluc activity is indicative of Cap-independent translation of the firefly luciferase reporter gene. Cap-dependent translation of the Renilla luciferase gene is shown as a control. Deletion of SL1 (SEQ ID NO: 11), SL2 (SEQ ID NO: 12), or SL3 (SEQ ID NO: 13), respectively, did not change translation activity. Deletion of SL4 (SEQ ID NO: 14) increased translation activity by about 2-fold. Deletion of SL4.5 (SEQ ID NO: 15) almost completely abolished translation activity. Figure 4B shows the ratio of the Fluc value to the Rluc value for each of the constructs, which were shown in Figure 4A. The greater the ratio of Fluc to Rluc, the greater the non-cap mediated translation activity compared to cap mediated translation activity.

[0145] Figure 5 illustrates the effect of deleting different nucleotide sequences capable of forming stem-loop structures from the SARS-CoV-2 5’-UTR sequence on translation activity. Translation activity was assessed using bicistronic reporter cassettes as shown in Figure 2. Bicistronic reporter cassettes comprising (1) a non-functional EMCV IRES sequence (null), (2) an EMCV IRES (EMCV), and (3) the full-length SARS-CoV-25’- UTR (SARS-CoV-2) served as controls. The data in Figure 5A show the amount of Fluc activity and Rluc activity (A.U. = arbitrary units), each separately scaled to EMCV = 100. The Fluc activity is indicative of Cap-independent translation of the firefly luciferase reporter gene. Cap-dependent translation of the Renilla luciferase gene is shown as a control. Deletion of SL5 (SEQ ID NO: 16) almost completely abolished translation activity of the SARS-CoV- 25’-UTR sequence. In contrast, deletion of SL5a (SEQ ID NO: 17), SL5b (SEQ ID NO: 18), or SL5abc (SEQ ID NO: 19) increased translation activity. Deletion of SL5c (SEQ ID NO: 20) did not change the translation activity. Figure 5B shows the ratio of the Fluc value to the Rluc value for each of the constructs, which were shown in Figure 5A. The greater the ratioof Fluc to Rluc, the greater the non-cap mediated translation activity compared to cap mediated translation activity.

[0146] Figure 6 illustrates the isolation of nucleic acid sequences of the SARS-CoV- 2 5’-UTR important for initiating translation. Translation activity was assessed using bicistronic reporter cassettes as shown in Figure 2. Bicistronic reporter cassettes comprising (a) the nucleotide sequences capable of forming SL4.5 and SL5 (SL4.5+5), and (b) the nucleotide sequences capable of forming SL4.5 and SL5 without SL5abc (SL4.5+5Δabc) were tested. Bicistronic reporter cassettes comprising (1) a non-functional EMCV IRES sequence (null), (2) an EMCV IRES (EMCV), and (3) the full-length SARS-CoV-25’-UTR (SARS-CoV-2) served as controls. The data in Figure 6A show the amount of Fluc activity and Rluc activity (A.U. = arbitrary units), each separately scaled to EMCV = 100. The Fluc activity is indicative of Cap-independent translation of the firefly luciferase reporter gene. Cap-dependent translation of the Renilla luciferase gene is shown as a control. The 3’ portion of the SARS-CoV-25’-UTR comprising the nucleotide sequences capable of forming SL4.5 and SL5 had improved IRES function compared to the full-length wild-type SARS-CoV-2 5’-UTR sequence, as indicated by greater Fluc activity and lower Rluc activity. Deletion of SL5abc from SL5 further improved the IRES function as indicated by the even greater Fluc activity and even lower Rluc activity. Figure 6B shows the ratio of the Fluc value to the Rluc value for each of the constructs, which are shown in Figure 6A. The greater the ratio of Fluc to Rluc, the greater the non-cap mediated translation activity compared to cap mediated translation activity.

[0147] Figure 7 illustrates the identification of nucleic acid sequences of the SARS- CoV-25’-UTR responsible for inducing translation. Translation activity was assessed using bicistronic reporter cassettes as shown in Figure 2. A bicistronic reporter cassette comprising the nucleotide sequences capable of forming SL4.5 and SL5 without SL5abc (SL4.5+5Δabc) was modified to replace either the 5’ region or the 3’ region of the stem portion of SL5 with the respective antisense nucleic acid sequences. The resulting bicistronic reporter cassettes (referred to as SL4.5+5Δabc-anti5’hp and SL4.5+5Δabc-anti3’hp)., respectively, were tested for reporter gene expression. Bicistronic reporter cassettes comprising (1) a non-functional EMCV IRES sequence (null), (2) an EMCV IRES (EMCV), and (3) the full-length SARS- CoV-25’-UTR (SARS-CoV-2) served as controls. The data in Figure 7A show the amount of Fluc activity and Rluc activity (A.U. = arbitrary units), each separately scaled to EMCV =100. Figure 7B is a bar graph illustrating the ratio of Fluc to Rluc for each construct tested in Figure 7A. The greater the ratio of Fluc to Rluc, the greater the non-cap mediated translation activity compared to cap mediated translation activity. Example 1. Construction of bicistronic reporter cassette

[0148] This example describes a bicistronic reporter cassette that can be used to assess Cap-independent, IRES-dependent translational activity relative to Cap-dependent, IRES-independent translational activity.

[0149] A general schematic of the bicistronic reporter cassette is shown in FIG.2. It contained the following elements, in 5’ to 3’ direction: (1) a 5’ untranslated region (UTR) operable linked to a Renilla luciferase coding sequence; (2) a non-functional EMCV IRES sequence (∆EMCV); (3) an insertion site for a test or control IRES sequence; and (4) a firefly luciferase coding sequence. The ∆EMCV IRES sequence prevents stop codon readthrough (see Carter and Sarnow, 2000, Journal of Biological Chemistry 8;275(36):28301-7). An EMCV IRES was placed at the insertion site to serve as a positive control of IRES function. A bicistronic reporter without a test or control IRES sequence was used as a negative control. The bicistronic reporter cassette was operably linked to a CMV promoter sequence in a pcDNA3-based plasmid backbone.

[0150] To construct lentivirus expression vectors, the bicistronic reporter cassette (RLuc-∆EMcV-IRES-FLuc) was amplified by PCR and inserted into pLX313 vector at the NheI and EcoRV cut sites using Gibson cloning. This vector includes long terminal repeats and a hygromycin resistance gene which are operably linked to an EF1α promoter sequence. RNA transcribed from this promoter can be packaged into lentiviral particles as described in Example 2. Assembled plasmids were transformed into Stbl3 cells (catalog #C737303, Invitrogen) or DH5α cells (catalog #C3040H, New England Biolabs). Example 2. Production of cells stably expressing reporter constructs

[0151] This example describes the production of cells that stably express the bicistronic reporter cassettes generated in Example 1.

[0152] Lentivirus was produced for pLX313 with the desired reporter insert. 293T cells were plated onto a 6-well plate (900,000 cells / well) and allowed to recover overnight. Subsequently, 1 µg of pLX313-based plasmid, 1 µg of ∆8.9, and 100 ng of VSV-G plasmidswere transiently transfected into cells using Lipofectamine 3000 per the manufacturer’s instructions. Medium was changed the following day to DMEM with 20% FBS. Media were serially harvested 24 and 48 hours later and passed through a 0.4 µm filter. The presence of lentivirus antigen was confirmed with Lenti-X GoStix Plus (catalog #631280, Takara Bio, Kusatsu, Japan).

[0153] In order to stably express reporters in 293T cells, 500,000 cells were plated in a single well of a 6-well plate. Immediately after plating, 500 µL – 1 mL of lentivirus- containing medium was added to medium containing cells for a total of 2 mL. Polybrene (catalog #sc-134220, Santa Cruz Biotechnology, Dallas, TX) was used at a final concentration of 10 µg / mL. Cells were allowed to adhere overnight before being selected with hygromycin (500 µg / mL) for 5 days. The resulting stably transfected cells are referred to as 293T-SC2 cells. Example 3. Splicing of reporter mRNA

[0154] This example demonstrates that mRNA expressed by cells stably transfected with the reporter cassettes generated in Example 2 do not undergo splicing.

[0155] 293T-SC2 cells produced as described in Example 2 were harvested. RNA extraction was performed using RNeasy columns (Qiagen) per the manufacturer’s instructions. One µg of total RNA was used for each reverse transcription reaction, which was performed using SuperScript IV kit (catalog #18091050, Invitrogen, Carlsbad, California) with either oligodT or random primers per the manufacturer’s instructions.

[0156] To evaluate for possible splicing of the reporter mRNAs, separate PCR reactions were performed with primers designed to produce multiple overlapping amplicons encompassing the entirety of Renilla luciferase coding sequence, the ∆EMCV sequence, and the 5’ end of firefly luciferase. Primers amplifying the entirety of the reporter (RLuc- ∆EMcV-IRES-FLuc) were also used to verify the absence of aberrant splice products for the tested SARS-CoV-2 5’-UTR sequences. PCR was performed using Q5 Hot Start High- Fidelity 2x Master Mix (catalog #M0494L, New England Biolabs). Amplification products were run on a 0.9% agarose gel with densitometric quantification of band intensity and / or evaluation of product size, depending on the experiment.

[0157] The experiment described in Example 3 shows that the mRNA transcribed from the bicistronic reporter cassettes are not spliced to allow Cap-dependent expression ofthe firefly luciferase coding sequence, i.e., that all expression is due to cap-independent expression. Example 4. Transient transfection of reporter cassette mRNAs

[0158] This example describes the production of in vitro transcribed mRNAs comprising the bicistronic reporter cassettes generated in Example 1.

[0159] DNA templates for in vitro transcription were created by cleavage of circular reporter plasmid DNA at the 5’ and 3’ ends at BtgZI restriction sites followed by gel purification of the digested product. In vitro transcription was performed with the HiScribe T7 ARCA mRNA kit (New England Biolabs catalog #E2060S) followed by poly(A) tail addition per the manufacturer’s instructions. Either methylated (functional in cap-dependent translation, catalog #S1411S, New England Biolabs) or unmethylated (nonfunctional in cap- dependent translation, catalog #S1407S, New England Biolabs) cap structures were added to evaluate cap independence of each reporter translation activity. RNA cleanup was performed using the Monarch RNA Cleanup kit (catalog #T2040L, New England Biolabs). A portion of each reaction was analyzed via agarose gel to ensure the product was of the appropriate size. RNA was stored at -800C until transfection.

[0160] Transient transfection of in vitro transcribed RNA was performed by adding 100 ng RNA to 293T cells using Lipofectamine MessengerMAX (catalog #LMRNA003, Invitrogen) per the manufacturer’s instructions. Cells were then incubated for 24 hours prior to reading luciferase activities. The SARS-CoV-25’-UTR sequences were compared to a negative control without an IRES. Data are represented as Renilla or firefly luciferase activities (arbitrary units) and scaled to EMCV = 100. Example 5. Assessing reporter protein activity after transient plasmid transfection

[0161] This example describes how Cap-dependent and Cap-independent IRES- driven reporter gene expression can be assessed using the bicistronic reporter cassettes produced in Example 1.

[0162] 293T cells (25,000 cells / well) were seeded onto 96-well plates and allowed to adhere overnight. Plasmid encoding bicistronic reporter cassettes were prepared as described in Example 1. pcDNA3-based plasmid DNA (25 or 50 ng) was transiently transfected into the cells using Lipofectamine 3000 (catalog #L3000015, Invitrogen) per the manufacturer’s instructions. As described in Example 1, a plasmid with a bicistronic reporter cassette lackinga functional IRES served as a negative control, and a plasmid with a bicistronic reporter cassette comprising the EMCV IRES served as a positive control.

[0163] To determine IRES-driven cap-independent translation activity, Renilla and firefly luciferase activities were performed using the Dual-Glo Luciferase Assay system (catalog #E2920, Promega, Madison, WI). Media in the 96-well plates were removed. This was followed by the addition of 25 µL of Dual-Glo Luciferase Reagent directly to cells. Reactions were incubated for 10 minutes at room temperature before reading firefly luciferase activity with an EnVision 2103 Multilabel Reader (PerkinElmer, Waltham, MA). An equal volume of Stop & Glo Reagent was then added to each well, mixed by pipetting, and allowed to incubate at room temperature for 10 minutes, after which Renilla luciferase activities were read. Data are presented as either individual Renilla or firefly luciferase activities (arbitrary units) or as a ratio of firefly to Renilla activities, which represents a metric of relative IRES- vs. cap-dependent translation.

[0164] Data were scaled to experiment-appropriate controls. Pairwise comparisons were made between control and experimental groups using Students t-test. Multigroup comparisons were made with ANOVA with Tukey post hoc analysis. All significance levels were set at the α = 0.05 level. Example 6. SARS-CoV-2 IRES is more active than EMCV IRES

[0165] This example demonstrates that the IRES located in the 5’-UTR of the SARS- CoV-2 genomic RNA induces higher translation activity than the EMCV IRES.

[0166] The first 301 nucleotides (SEQ ID NO: 7) of the SARS-CoV-2 genomic RNA (GenBank Accession number MN908947.3) were placed into the insertion site of the bicistronic reporter cassette described in Example 1.

[0167] This nucleotide sequence comprises the 5’-UTR and a 5’-terminal region of ORF1a encoding the twelve N-terminal codons of NSP1. The underlined nucleic acid sequences correspond to the previously identified stem-loop (SL) structures that are conserved across several Betacoronavirus genomes (Miao et al. (2020) RNA Biology 18(4): 447–456). Consistent with the nomenclature used in Figure 1, they are referred to as SL1, SL2, SL3, SL4, SL4.5 and SL5, respectively.

[0168] Using the assay described in Example 5, the resulting SARS-CoV-2 plasmid was compared to a corresponding plasmid that contained the full-length EMCV IRES instead.A plasmid without an IRES insert served as a control. The greater the translation activity, the greater is the ratio of Firefly luciferase (Fluc) to Renilla luciferase (Rluc). FIG.3 shows the results of Example 6.

[0169] The EMCV IRES is commonly used in research application because of its Cap-independent translation activity, which is high relative to other IRESes known in the state of the art. Surprisingly, the SARS-CoV-25’-UTR sequence (SEQ ID NO: 7) was found to induce about 2.5-fold greater Cap-independent translation activity than the EMCV IRES. Example 7. Sequence elements important for SARS-CoV-2 IRES function

[0170] This example demonstrates that the 175 nucleic acids of the SARS-CoV-2 genomic RNA that comprise the 3’ portion of the 5’-UTR include the sequence elements important for IRES function.

[0171] Example 6 demonstrates that a nucleic acid sequence of the SARS-CoV-2 genome comprising the 3’ portion of the 5’-UTR includes an IRES that is capable of initiating translation when operably linked to a protein coding sequence such as a reporter gene. To determine the nucleic acid sequence responsible for inducing translation, bicistronic reporter cassettes including variants of the 301-nucleotide long wild-type 5’-UTR sequence (SEQ ID NO: 7) comprising one or more deletions were prepared as described in Example 1 and tested in the assay described in Example 5.

[0172] The nucleic acid sequences of the deletion variants placed at the insertion site of the bicistronic reporter cassette are listed in Table 2. Each of the deleted nucleic acid sequences correspond to one of the previously identified stem-loop (SL) structures that are conserved across several Betacoronavirus genomes (see FIG.1). Table 2.5’-UTR variants with deletions of the indicated stem-loop structures

[0173] The results of the experiment in this example are summarized in FIG. 4. Reporter cassettes comprising variants of the SARS-CoV-25’-UTR in which SL1, SL2, or SL3 had been deleted showed similar IRES-initiated translation activity to a corresponding reporter cassette with the full-length SARS-CoV-2 5’-UTR of Example 6. These results indicated that the presence of neither SL1, SL2, nor SL3 are required for IRES function.

[0174] Surprisingly, the reporter cassette in which SL4 was deleted showed a 2-fold increase in IRES-initiated translation activity compared to the full-length SARS-CoV-25’- UTR of Example 6. This result indicates that SL4 has translation inhibitory activity.

[0175] Interestingly, deletion of SL4.5 almost completely abolished translation activity compared to the full-length SARS-CoV-2 5’-UTR of Example 6. This result indicates that the 175 nucleic acids comprising the 3’ portion of the 5’-UTR comprise the sequence elements important for SARS-CoV-2 IRES function. Example 8. Deletion variants with increased translation activity

[0176] This example demonstrates that variants of the SARS-CoV-2 5’-UTR comprising one or more deletions can have up to 2-fold higher translation activity compared to the corresponding wild-type 5’-UTR. In particular, deletions of stem-loops (SL) 5a, 5b and / or 5c result in increased translation activity.

[0177] To determine whether all of the 175 nucleic acids identified in Example 7 are required for SARS-CoV-2 IRES function, additional deletion variants were prepared. In particular, it was investigated whether all elements of SL5 were required for translation activity. To this end, SL5a, SL5b and SL5c (see Figure 1) were deleted individually. Two additional deletion variants were prepared. One variant lacked the entire region comprising SL5a, SL5b and SL5c. This region was replaced with a short loop-forming sequence to ensure that the remaining nucleic acids were capable of forming a stem-loop structure. The other variant completely lacked SL5 (including SL5abc). The resulting deletion variants were based on the 301-nucleotide long wild-type 5’-UTR sequence (SEQ ID NO: 7). Their nucleotide sequences are shown in Table 3.

[0178] Each deletion variant was placed in the insertion site of the bicistronic reporter cassette described in Example 1 and tested in the assay described in Example 5. The full- length construct described in Example 6 served as a control. Table 3.5’-UTR variants with deletions of the indicated stem-loop structures

[0179] The results of the experiment described in this example are summarized in FIG.5A and FIG. 5B. The reporter cassette comprising a variant of the SARS-CoV-25’- UTR in which SL5 (including SL5abc) was deleted showed almost no IRES-initiated translation activity compared to the full-length SARS-CoV-25’-UTR of Example 6. This indicates that SL5 comprises the sequence elements important for SARS-CoV-2 IRES function.

[0180] To identify the sequence within SL5 that is important for SARS-CoV-2 IRES function, further deletion experiments were performed, in which SL5a, SL5b, SL5c were removed either individually or together. Surprisingly, the reporter cassettes comprising variants of the SARS-CoV-25’-UTR in which SL5a and SL5b had been deleted showed increased IRES-initiated translation activity compared to the full-length SARS-CoV-25’- UTR. Even more surprisingly, the reporter cassette in which the entire region comprisingSL5a, SL5b and SL5c had been deleted was found to exhibit an about 2-fold increase in IRES-initiated translation activity compared to the full-length SARS-CoV-2 5’-UTR of Example 6. The reporter cassette in which only SL5c had been deleted showed IRES-initiated translation activity that was comparable to that of the full-length SARS-CoV-25’-UTR.

[0181] These results indicate that translation activity can be increased by deletion of part or all of the extended loop region of SL5 comprising SL5a, SL5b and SL5c. IRES- initiated translation activity was retained or enhanced in deletion variants capable of forming a stem-loop structure and comprising at least 30% of the 175 nucleic acids that had been identified in Example 7 as being important for IRES function. Example 9. Sequences of the SARS-CoV-25’-UTR important for initiating translation

[0182] This example confirms that a 3’ portion of the full-length SARS-CoV-25’- UTR comprising the nucleic acid sequences capable of forming SL4.5 and SL5 is sufficient to initiate translation of a protein coding sequence located downstream.

[0183] The experimental results described in Examples 7 and 8 show that the nucleic acid sequences capable of forming SL4.5 and SL5, respectively, in the full-length SARS- CoV-2 5’-UTR comprise sequence elements that are important for initiating Cap- independent translation of protein-encoding sequences located downstream. Therefore, to determine whether these nucleic acid sequences in isolation were capable of initiating translation to the same, or an improved, degree as the full-length SARS-CoV-25’-UTR, these sequences were tested in the bicistronic reporter cassette described in Example 1. Since the results summarized in Example 8 indicated that deletion of the extended loop region of SL5 comprising SL5a, SL5b and SL5c could improve translation activity, a variant lacking this sequence was also tested. The nucleic acid sequences inserted in the bicistronic reporter cassette are shown in Table 4. Table 4.5’-UTR variants comprising SL4.5 and SL5, with or without SL5abc

[0184] Each nucleic acid sequence shown in Table 4 was placed in the insertion site of the bicistronic reporter cassette described in Example 1 and tested in the assay described in Example 5. The full-length SARS-CoV-25’-UTR described in Example 6 (SEQ ID NO: 7) served as a control.

[0185] The results of the experiment described in Example 9 are summarized in FIG.6A and FIG.6B. FIG.6A shows that the reporter cassettes comprising the nucleic acid sequence of Table 4 exhibited increased IRES-initiated translation activity compared to the full-length SARS-CoV-25’-UTR, which served as a positive control. Specifically, IRES- initiated translation activity was approximately 1.5-fold higher than the control when the reporter cassette comprised the nucleic acid sequences capable of forming SL4.5 and SL5. The variant lacking SL5abc had approximately 3-fold higher translation activity than the control.

[0186] The data summarized in FIG.6A also shows that, surprisingly, cap-dependent translation was reduced in the reporter cassettes comprising the nucleic acid sequences of Table 4 compared to the reporter cassette comprising the full-length SARS-CoV-25’-UTR.

[0187] FIG.6B shows the ratio of Fluc activity to Rluc activity, i.e., the ratio of cap- independent, IRES-dependent and cap-dependent, IRES-independent translation activity, respectively. The ratios were calculated using the values from FIG.6A. As expected, each of the tested reporter cassettes with an insert showed an increased ratio of cap-independent, IRES-dependent to cap-dependent, IRES-independent translation activity. Relative to the full-length SARS-CoV-25’-UTR, this ratio increased by approximately 2-fold in the reporter cassette comprising the nucleic acid sequences capable of forming SL4.5 and SL5and by approximately 6-fold in the reporter cassette comprising the variant lacking SL5abc.

[0188] This example confirms that a region of about 175 nucleic acids comprising the nucleic acid sequences capable of forming SL4.5 and SL5, respectively, in the full-length SARS CoV-2 5’-UTR include the sequence elements that are important for initiating translation of protein coding sequences located downstream. IRES-initiated translationactivity can be increased by deleting the nucleic acid sequence forming the extended loop region of SL5 comprising SL5a, SL5b and SL5c. Example 10. Identification of minimal sequence for IRES function

[0189] This example identifies the minimal sequence elements of the SARS CoV-2 5’-UTR that can initiate translation activity.

[0190] Example 9 demonstrates that a 3’ portion of the full-length SARS-CoV-25’- UTR comprising the nucleic acid sequences capable of forming SL4.5 and SL5 without SL5abc is sufficient to initiate translation of a protein coding sequence located downstream. To determine the minimal nucleic acid sequence responsible for initiating translation, the bicistronic reporter cassette comprising the nucleotide sequences capable of forming SL4.5 and SL5 without SL5abc (SL4.5+5Δabc) was modified to replace either the 5’ region or the 3’ region of the remaining stem portion of SL5 with the respective antisense nucleic acid sequences. The resulting modified insert sequences (referred to as SL4.5+5Δabc-anti5’hp (SEQ ID NO: 23) and SL4.5+5Δabc-anti3’hp (SEQ ID NO: 24)) are shown in Table 5. Table 5. Further 5’-UTR variants comprising SL4.5 and SL5 without SL5abc

[0191] The bicistronic reporter cassette with the nucleic acid inserts shown in Table 5 were tested for reporter gene expression. Bicistronic reporter cassettes comprising (1) a non-functional EMCV IRES sequence (null), (2) an EMCV IRES (EMCV), and (3) the full- length SARS-CoV-25’-UTR (SARS-CoV-2) served as controls (see Example 1). The results of this experiment are summarized in Figures 7A and 7B.

[0192] Surprisingly, replacement of the 5’ region of the stem portion of SL5 with its antisense nucleic acid sequence reduced Cap-independent, IRES-dependent translation of the reporter protein to levels similar to those observed with the negative control (null). Incontrast, replacement of the 3’ region of the stem portion of SL5 with its antisense nucleic acid sequence reduced Cap-independent, IRES-dependent translation of the reporter protein only slightly. These results indicate that only the 5’ region of the stem portion is important for IRES function and that the 3’ region of the stem portion of SL5 may be deleted without significant impact on translation initiation of protein coding sequences located downstream.

[0193] This example therefore indicates that a nucleic acid sequence comprising as few as about 50 nucleic acids and including the nucleic acid sequence capable of forming SL4.5 and the nucleic acid sequence capable of forming the 5’ portion of the stem of SL5 is sufficient for initiating translation. Example 11. Conserved regions of the 5’-UTR of the Betacoronavirus genome

[0194] This example shows that related Betacoronaviruses share conserved regions in the 175 nucleic acids comprising the 3’ portion of the 5’-UTR.

[0195] The nucleic acid sequences of the RNA genomes of SARS-CoV-2 [GenBank MN908947.3] and SARS-CoV-1 [NC_004718.3] were retrieved from GenBank. From each genome sequence, a region comprising the 150 nucleic acids upstream and 30 nucleic acids downstream of the ORF1a start codon were extracted. Multiple sequence alignment was performed using CLUSTAL multiple sequence alignment by MUSCLE (version 3.8). The result is shown below, where the ORF1a start codon is underlined: SARS-CoV-2 GCACUCACGCAGUAUAAUUAAUAACUAA--UUACUGUCGUUGACAGGACACGAGUAACUC SARS-CoV-1 --ACCUACGCAGUAUAAACAAUAAUAAAUUUUACUGUCGUUGACAAGAAACGAGUAACUC ** *********** ***** ** *************** ** *********** SARS-CoV-2 GUCUAUCUUCUGCAGGCUGCUUACGGUUUCGUCCGUGUUGCAGCCGAUCAUCAGCACAUC SARS-CoV-1 GUCCCUCUUCUGCAGACUGCUUACGGUUUCGUCCGUGUUGCAGUCGAUCAUCAGCAUACC *** ********** *************************** ************ * * SARS-CoV-2 UAGGUUUCGUCCGGGUGUGACCGAAAGGUAAGAUGGAGAGCCUUGUCCCUGGUUUCAACG SARS-CoV-1SARS-CoV-2 AGAAA SARS-CoV-1 AGAAA *****

[0196] The alignment shows that this region of the genome is highly conserved between the closely related SARS-CoV-1 and SARS-CoV-2 viruses. These findings indicate a selective pressure on Betacoronavirus genomes to conserve regions capable of forming stem-loop structures required for IRES function.

[0197] All publications and other reference materials referenced herein are hereby incorporated by reference in their entirety. Although a number of documents are cited herein, this citation does not constitute an admission that any of these documents forms part of the common general knowledge in the art.

[0198] It should be understood that the particular embodiments described herein are given by way of illustration only, not limitation. Other features, objects, and advantages are apparent from the above detailed description, drawings and examples. Various changes and modifications will be apparent to those skilled in the art.

Claims

CLAIMS 1. An isolated Betacoronavirus internal ribosome entry site (IRES), or a variant thereof comprising one or more mutations and / or deletions, comprising no more than 175 nucleic acids and including a 3’ portion of the 5’-untranslated region (UTR) of a Betacoronavirus genome, wherein: (i) the IRES or variant thereof is capable of initiating translation when operably linked to a protein coding sequence; and (ii) at least 30% of the no more than 175 nucleic acids are one or more nucleic acid sequences capable of forming stem-loop structures in the Betacoronavirus genome 5’-UTR.

2. The isolated Betacoronavirus IRES or variant thereof according to claim 1, wherein the one or more nucleic acid sequences capable of forming stem-loop structures comprise(s) stem-loop 4.5 (SL4.5).

3. The isolated Betacoronavirus IRES or variant thereof according to claim 1 or 2, wherein the one or more nucleic acid sequences capable of forming stem-loop structures comprise(s) at least a portion of stem-loop 5 (SL5).

4. The isolated Betacoronavirus IRES or variant thereof according to any preceding claim, comprising a portion of a 5’ terminal nucleic acid sequence of open reading frame 1a (ORF1a) of the Betacoronavirus genome.

5. The isolated Betacoronavirus IRES or variant thereof according to any preceding claim, comprising about 50 nucleic acids to about 100 nucleic acids, about 50 nucleic acids to about 90 nucleic acids, or about 50 nucleic acids to about 55 nucleic acids.

6. The isolated Betacoronavirus IRES or variant thereof according to any preceding claim, wherein the IRES or variant thereof is capable of improving translationcompared to a corresponding wild-type IRES by at least about 1.5-fold, about 2- fold, or about 3-fold.

7. The isolated Betacoronavirus IRES or variant thereof according to any preceding claim, wherein the Betacoronavirus comprises SARS-CoV or SARS-CoV-2.

8. The isolated Betacoronavirus IRES or variant thereof according to any preceding claim, wherein SL4.5 comprises a nucleic acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:

1.

9. The isolated Betacoronavirus IRES or variant thereof according to any preceding claim, wherein the portion of SL5 comprise a nucleic acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:

2.

10. The isolated Betacoronavirus IRES or variant thereof according to any preceding claim, wherein the one or more nucleic acid sequences capable of forming stem- loop structures comprise(s), or consist(s) of, a nucleic acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 3; a nucleic acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 4; a nucleic acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 5; or a nucleic acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:

6.

11. An expression vector comprising the isolated Betacoronavirus IRES or variant thereof according to any preceding claim, operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein.

12. A cell comprising the expression vector of claim 11.

13. A composition comprising the isolated Betacoronavirus IRES or variant thereof according to any one of claims 1-10, and one or more excipients.

14. A method comprising: (a) providing a cell with an expression vector comprising the isolated Betacoronavirus IRES or variant thereof according to any one of claims 1-10 operably linked to a nucleic acid sequence encoding a reporter protein; (b) contacting the cell with one or more compounds; and (c) determining whether the one or more compound modulate(s) expression of the reporter protein.

Images