HIV vaccination and immunotherapy

Abstract

The present invention relates generally to vaccination and immunotherapy for the treatment or prevention of HIV. In particular, the methods include in vivo and / or ex vivo enrichment of HIV-specific CD4+ T cells.

Description

HIV VACCINATION AND IMMUNOTHERAPY CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of priority under 35 U.S.C. § 119(e) of U.S. Provisional Application No.63 / 540,021, filed September 22, 2023. The disclosure of the prior application is incorporated herein by reference in its entirety. FIELD OF THE INVENTION

[0002] The present invention relates generally to the field of vaccination and immunotherapy for the treatment and / or prevention of HIV. In particular, the disclosed methods of treatment and prevention relate to the administration of viral vectors and systems for the delivery of genes and other therapeutic, diagnostic, or research uses with or without a pre-immunization step. BACKGROUND OF THE INVENTION

[0003] Extensive laboratory and clinical research has failed to produce an HIV vaccine with durable protection against the disease. In the course of these studies, nearly all aspects of viral immunity have been studied, including antibody and cytolytic T cell responses, and implicated in the mechanisms for protection. The breadth of protective mechanisms implies that the key impact of HIV and the mechanisms that allows HIV to evade the immune system and establish persistent infection, is largely focused on the destruction of virus-specific, CD4+ helper T cells.

[0004] Upon exposure to HIV, virus-specific helper T cells recognize peptides derived from HIV and these cells become highly activated and begin to proliferate. The activated state, in response to the presence of a pathogen, makes CD4 T cells especially susceptible to HIV attachment and invasion. Activated T cells produce the highest levels of virus after infection and become the major drivers of virus growth and dissemination in the body. The capacity for HIV to both cause CD4 T cell activation and benefit from this response, while killing virus- specific cells and disabling host immunity in the process, is a key mechanism for disease.

[0005] Vaccination is an important public health tool for preventing disease outbreaks, pandemics and epidemics. There has been a substantial international effort focused on HIV preventive vaccines, but so far, this effort has failed to discover products that are sufficiently potent to justify mass immunization programs. In the most successful study to date (known asthe “Thai trial”), a complex vaccine requiring multiple injections provided a level of temporary protection against HIV infection. While this vaccine was not suitable for mass use, the successful clinical trial demonstrated the feasibility of generating preventive HIV vaccines. Most importantly, the Thai trial revealed that qualitative features of the vaccine response, including types of antibodies that were produced, were within the expectations for a successful product. However, the durability of protection was far too short for practical use.

[0006] The concept behind vaccination is that the host gains an advantage over the infecting pathogen because their immune system already has sufficient numbers of virus- specific cells, especially CD4 T cells, ready to respond once exposure occurs. If the virus, in this case HIV, can attack and diminish the levels of virus-specific CD4 T cells, the advantages of vaccination are lost quickly and the infection is not prevented.

[0007] Combination antiretroviral therapy (also known as Highly Active Antiretroviral Therapy or HAART) limits HIV-1 replication and retards disease progression, but drug toxicities and the emergence of drug-resistant viruses are challenges for long-term control in HIV-infected persons. Additionally, traditional anti-retroviral therapy, while successful at delaying the onset of AIDS or death, has yet to provide a functional cure. Alternative treatment strategies are needed.

[0008] Intense interest in immunotherapy for HIV infection has been precipitated by emerging data indicating that the immune system has a major, albeit usually insufficient, role in limiting HIV replication. Virus-specific T-helper cells, which are critical to maintenance of cytolytic T cell (CTL) function, likely play a role. Viremia is also influenced by neutralizing antibodies, but they are generally low in magnitude in HIV infection and do not keep up with evolving viral variants in vivo.

[0009] Together these data indicate that increasing the strength and breadth of HIV- specific cellular immune responses might have a clinical benefit through so-called HIV immunotherapy. Some studies have tested vaccines against HIV, but success has been limited to date. Additionally, there has been interest in augmenting HIV immunotherapy by utilizing gene therapy techniques, but as with other immunotherapy approaches, success has been limited.

[0010] Viral vectors can be used to transduce genes into target cells owing to specific virus envelope-host cell receptor interactions and viral mechanisms for gene expression. As a result, viral vectors have been used as vehicles for the transfer of genes into many different celltypes including whole T cells or other immune cells as well as embryos, fertilized eggs, isolated tissue samples, tissue targets in situ and cultured cells. The ability to introduce and express foreign or altered genes in a cell is useful for therapeutic interventions such as gene therapy, somatic cell reprogramming of induced pluripotent stem cells, and various types of immunotherapy.

[0011] Gene therapy is one of the ripest areas of biomedical research with the potential to create new therapeutics that may involve the use of viral vectors. In view of the wide variety of potential genes available for therapy, an efficient means of delivering these genes is needed to fulfill the promise of gene therapy as a means of treating infectious and non-infectious diseases. Several viral systems including murine retrovirus, adenovirus, parvovirus (adeno- associated virus), vaccinia virus, and herpes virus have been developed as therapeutic gene transfer vectors.

[0012] There are many factors that must be considered when developing viral vectors, including tissue tropism, stability of virus preparations, stability and control of expression, genome packaging capacity, and construct-dependent vector stability. In addition, in vivo application of viral vectors is often limited by host immune responses against viral structural proteins and / or transduced gene products.

[0013] Thus, toxicity and safety are key hurdles that must be overcome for viral vectors to be used in vivo for the treatment of subjects. There are numerous historical examples of gene therapy applications in humans that have met with problems associated with the host immune responses against the gene delivery vehicles or the therapeutic gene products. Viral vectors (e.g., adenovirus) which co-transduce several viral genes together with one or more therapeutic gene(s) are particularly problematic.

[0014] Although lentiviral vectors do not generally induce cytotoxicity and do not elicit strong host immune responses, some lentiviral vectors such as HIV-1, which carry several immunostimulatory gene products, have the potential to cause cytotoxicity and induce strong immune responses in vivo. However, this may not be a concern for lentiviral derived transducing vectors that do not encode multiple viral genes after transduction. Of course, this may not always be the case, as sometimes the purpose of the vector is to encode a protein that will provoke a clinically useful immune response.

[0015] Another important issue related to the use of lentiviral vectors is that of possible cytopathogenicity upon exposure to some cytotoxic viral proteins. Exposure to certain HIV-1proteins may induce cell death or functional unresponsiveness in T cells. Likewise, the possibility of generating replication-competent, virulent virus by recombination is often a concern.

[0016] Clearly, there is a need in the art for improving the potency and durability of vaccine protection against HIV with gene therapy and immunotherapy, and the present disclosure satisfies this need by preventing the rapid depletion of virus-specific CD4 T cells through combining immunization with a gene therapeutic, thus improving the protective effect of vaccines against HIV. In addition, there remains a need for improved treatments of HIV. SUMMARY OF THE INVENTION

[0017] In one aspect, a method of preventing HIV infection in a subject is disclosed. The method variously includes immunizing the subject with an effective amount of a first stimulatory agent. The method further includes contacting PBMC isolated from the subject ex vivo with a therapeutically effective amount of a second stimulatory agent; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element; culturing the transduced PBMC for a sufficient period of time to ensure adequate transduction; and infusing the transduced PBMC into the subject. In embodiments, the transduced PBMC may be cultured from about 1 to about 35 days. The subject may be a human. The first and second stimulatory agents may be the same or different. The stimulatory agents may include any agent suitable for stimulating a T cell response in a subject. In embodiments, at least one of the first and second stimulatory agents is a peptide or mixture of peptides. In embodiments, at least one of the first and second stimulatory agents includes a gag peptide. In embodiments, the at least one of the first and second stimulatory agents may also include a vaccine. The vaccine may be a HIV vaccine, and in embodiments, the HIV vaccine is a MVA / HIV62B vaccine or a variant thereof. In embodiments, the viral delivery system includes a lentiviral particle. In embodiments, the at least one genetic element may include at least one small RNA capable of inhibiting expression of at least one HIV gene. In embodiments, the at least one genetic element further includes a small RNA capable of inhibiting expression of chemokine receptor CCR5. In embodiments, the HIV gene is Vif and / or Tat. The at least one genetic element includes any genetic element capable of being expressed by a viral delivery system. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5,a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In embodiments, the at least one genetic element includes a microRNA or a shRNA. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor CCR5 comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 1-26. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor Vif comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 27-34. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor Tat comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 35-40. In further embodiments, the at least one genetic element comprises a microRNA cluster. In embodiments, the genetic element is under control of a single promoter. In certain embodiments, the promoter is EF-1alpha promoter.

[0018] In one aspect, a method of preventing HIV infection in a subject is disclosed. The method variously includes contacting PBMC isolated from the subject ex vivo with a therapeutically effective amount of a stimulatory agent; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element; culturing the transduced PBMC for a sufficient period of time to ensure adequate transduction; and infusing the transduced PBMC into the subject. In embodiments, the transduced PBMC may be cultured from about 1 to about 35 days. The subject may be a human. The stimulatory agent may include any agent suitable for stimulating a T cell response in a subject. In embodiments, the stimulatory agent is a peptide or mixture of peptides. In embodiments, the stimulatory agent includes a gag peptide. In embodiments, the stimulatory agent may also include a vaccine. The vaccine may be a HIV vaccine, and in embodiments, the HIV vaccine is a MVA / HIV62B vaccine or a variant thereof. In embodiments, the viral delivery system includes a lentiviral particle. In embodiments, the at least one genetic element may include at least one small RNA capable of inhibiting expression of at least one HIV gene. In embodiments, the at least one genetic element further includes a small RNA capable of inhibiting expression of chemokine receptor CCR5. In embodiments, the HIV gene is Vif and / or Tat. The at least one genetic element includes any genetic element capable of being expressed by a viral delivery system. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5,a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In embodiments, the at least one genetic element includes a microRNA or a shRNA. In further embodiments, the at least one genetic element comprises a microRNA cluster. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor CCR5 comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 1-26. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor Vif comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 27-34. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor Tat comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 35-40. In embodiments, the genetic element is under control of a single promoter. In certain embodiments, the promoter is EF-1alpha promoter.

[0019] In another aspect, a method of producing cells that are resistant to HIV is provided. The method variously includes contacting peripheral blood mononuclear cells (PBMC) isolated from a subject that is HIV-negative with a therapeutically effective amount of a stimulatory agent, wherein the contacting is carried out ex vivo; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element; and culturing the transduced PBMC for a sufficient period of time to ensure adequate transduction. In embodiments, the transduced PBMC may be cultured from about 1 to about 35 days. The method may further include infusing the transduced PBMC into a subject. The method may further include administering a stimulatory agent to the subject prior to isolating PBMC. The subject may be a human. The stimulatory agent may include a peptide or mixture of peptides, and in embodiments includes a gag peptide. The stimulatory agent may include a vaccine. The vaccine may be a HIV vaccine, and in embodiments, the HIV vaccine is a MVA / HIV62B vaccine or a variant thereof. In embodiments, the viral delivery system includes a lentiviral particle. In embodiments, the at least one genetic element may include at least one small RNA capable of inhibiting expression of at least one HIV gene. In embodiments, the at least one genetic element further includes a small RNA capable of inhibiting expression of chemokine receptor CCR5. In embodiments, the HIV gene is Vif and / or Tat. The at least one genetic element includes any genetic element capable of being expressed by a viral delivery system. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In someembodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5, a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In embodiments, the at least one genetic element includes a microRNA or a shRNA. In further embodiments, the at least one genetic element comprises a microRNA cluster. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor CCR5 comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 1-26. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor Vif comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 27-34. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor Tat comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 35-40. In embodiments, the genetic element is under control of a single promoter. In certain embodiments, the promoter is EF-1alpha promoter.

[0020] In another aspect, a method of treating HIV infection in a subject is disclosed. The method further includes contacting the PBMC isolated from the subject ex vivo , wherein the subject was administered a therapeutically effective amount of a first stimulatory agent, with a therapeutically effective amount of a second stimulatory agent; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element; and culturing the transduced PBMC for a sufficient period of time to ensure adequate transduction. In embodiments, the transduced PBMC may be cultured from about 1 to about 35 days. In embodiments, the method further involves infusing the transduced PBMC into a subject. In embodiments, the method further includes positively selecting HIV-specific CD4+ T cells from the PBMC. In further embodiments, the HIV-specific CD4+ T cells are positively selected using at least one physical method of selection. The subject may be a human. The first and second stimulatory agents may be the same or different. The first and second stimulatory agents may include one or more of a peptide or mixture of peptides. In embodiments, at least one of the first and second stimulatory agents includes a gag peptide. The at least one of the first and second stimulatory agents may include a vaccine. The vaccine may be a HIV vaccine, and in a preferred embodiment, the HIV vaccine is a MVA / HIV62B vaccine or a variant thereof. In a preferred embodiment, the viral delivery system includes a lentiviral particle. In embodiments, the at least one genetic element may include at least one small RNA capable of inhibitingexpression of at least one HIV gene. In embodiments, the at least one genetic element further includes a small RNA capable of inhibiting expression of chemokine receptor CCR5. In embodiments, the at least one genetic element includes a small RNA capable of inhibiting the expression of chemokine receptor CCR5 and at least one small RNA capable of inhibiting expression of at least one HIV gene. In embodiments, the HIV gene is Vif and / or Tat. The at least one genetic element includes any genetic element capable of being expressed by a viral delivery system. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5, a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In embodiments, the at least one genetic element includes a microRNA or a shRNA. In further embodiments, the at least one genetic element comprises a microRNA cluster. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor CCR5 comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 1-26. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor Vif comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 27-34. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor Tat comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 35-40. In embodiments, the genetic element is under control of a single promoter. In certain embodiments, the promoter is EF-1alpha promoter.

[0021] In another aspect, a method of treating cells is disclosed. The method variously includes immunizing a subject that is HIV-positive with an effective amount of a first stimulatory agent. The method further includes contacting PBMC isolated from a HIV-positive subject ex vivo, wherein the subject is immunized with an effective amount of a first stimulatory agent with a therapeutically effective amount of a second stimulatory agent; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element; and culturing the transduced PBMC for a sufficient period of time to ensure adequate transduction. In embodiments, the transduced PBMC may be cultured from about 1 to about 35 days. In embodiments, the method further involves infusing the transduced PBMC into a subject. In embodiments, the method further includes positively selecting HIV-specific CD4+ T cells fromthe PBMC. In further embodiments, the HIV-specific CD4+ T cells are positively selected using at least one physical method of selection. The subject may be a human. The first and second stimulatory agents may be the same or different. The first and second stimulatory agents may include one or more of a peptide or mixture of peptides. In embodiments, at least one of the first and second stimulatory agents includes a gag peptide. The at least one of the first and second stimulatory agents may include a vaccine. The vaccine may be a HIV vaccine, and in a preferred embodiment, the HIV vaccine is a MVA / HIV62B vaccine or a variant thereof. In a preferred embodiment, the viral delivery system includes a lentiviral particle. In embodiments, the at least one genetic element further includes a small RNA capable of inhibiting expression of chemokine receptor CCR5. In further embodiments, the at least one genetic element includes a small RNA capable of inhibiting expression of chemokine receptor CCR5 and at least one small RNA capable of inhibiting expression of at least one HIV gene. In embodiments, the HIV gene is Vif and / or Tat. The at least one genetic element includes any genetic element capable of being expressed by a viral delivery system. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5, a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In embodiments, the at least one genetic element includes a microRNA or a shRNA. In further embodiments, the at least one genetic element comprises a microRNA cluster. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor CCR5 comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 1-26. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor Vif comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 27-34. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor Tat comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 35-40. In embodiments, the genetic element is under control of a single promoter. In certain embodiments, the promoter is EF-1alpha promoter.

[0022] In another aspect, a method of treating HIV infection in a subject is disclosed. The method contacting PBMC isolated from the subject ex vivo with a therapeutically effective amount of a stimulatory agent; transducing the PBMC ex vivo with a viral delivery systemencoding at least one genetic element; and culturing the transduced PBMC for at least 1 day. The transduced PBMC may be cultured from about 1 to about 35 days. The method may further involve infusing the transduced PBMC into a subject. In embodiments, the method further includes positively selecting HIV-specific CD4+ T cells from the PBMC. In further embodiments, the HIV-specific CD4+ T cells are positively selected using at least one physical method of selection. The subject may be a human. The stimulatory agent may include a peptide or mixture of peptides. In a preferred embodiment, the stimulatory agents include a gag peptide. The stimulatory agent may include a vaccine. The vaccine may be a HIV vaccine, and in a preferred embodiment, the HIV vaccine is a MVA / HIV62B vaccine or a variant thereof. In a preferred embodiment, the viral delivery system includes a lentiviral particle. In embodiments, the at least one genetic element may include at least one small RNA capable of inhibiting expression of at least one HIV gene. In embodiments, the at least one genetic element further includes a small RNA capable of inhibiting expression of chemokine receptor CCR5. In further embodiments, the at least one genetic element includes a small RNA capable of inhibiting expression of chemokine receptor CCR5 and at least one small RNA capable of inhibiting expression of at least one HIV gene. In embodiments, the HIV gene is Vif and / or Tat. The at least one genetic element includes any genetic element capable of being expressed by a viral delivery system. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5, a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In embodiments, the at least one genetic element includes a microRNA or a shRNA. In further embodiments, the at least one genetic element comprises a microRNA cluster. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor CCR5 comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 1-26. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor Vif comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 27-34. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor Tat comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 35-40. In embodiments, the genetic element is under control of a single promoter. In certain embodiments, the promoter is EF-1alpha promoter.

[0023] In another aspect, a method of treating cells is provided. The method includes contacting peripheral blood mononuclear cells (PBMC) isolated from a subject infected with HIV with a therapeutically effective amount of a stimulatory agent, wherein the contacting is carried out ex vivo; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element; and culturing the transduced PBMC for at least 1 day. The transduced PBMC may be cultured from about 1 to about 35 days. The method may further involve infusing the transduced PBMC into a subject. In embodiments, the method further includes positively selecting HIV-specific CD4+ T cells from the PBMC. In further embodiments, the HIV-specific CD4+ T cells are positively selected using at least one physical method of selection. The subject may be a human. The stimulatory agent may include a peptide or mixture of peptides, and in a preferred embodiment includes a gag peptide. The stimulatory agent may include a vaccine. The vaccine may be a HIV vaccine, and in a preferred embodiment, the HIV vaccine is a MVA / HIV62B vaccine or a variant thereof. In a preferred embodiment, the viral delivery system includes a lentiviral particle. In embodiments, the at least one genetic element may include at least one small RNA capable of inhibiting expression of at least one HIV gene. In embodiments, the at least one genetic element further includes a small RNA capable of inhibiting expression of chemokine receptor CCR5. In embodiments, the HIV gene is Vif and / or Tat. The at least one genetic element includes any genetic element capable of being expressed by a viral delivery system. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5, a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In embodiments, the at least one genetic element includes a microRNA or a shRNA. In further embodiments, the at least one genetic element comprises a microRNA cluster. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor CCR5 comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 1-26. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor Vif comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising any of SEQ ID NOs: 27-34. In embodiments, the small RNA capable of inhibiting expression of chemokine receptor Tat comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence comprising anyof SEQ ID NOs: 35-40. In embodiments, the genetic element is under control of a single promoter. In certain embodiments, the promoter is EF-1alpha promoter.

[0024] In embodiments, the small RNA (e.g., microRNA or shRNA) capable of inhibiting expression of chemokine receptor CCR5 comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) CCAATCTATGACATCAATTAT (SEQ ID NO: 1); b) TGGTCATCCTCATCCTGATAA (SEQ ID NO: 2); c) CCCAGTGGGACTTTGGAAATA (SEQ ID NO: 3); d) ACTCTTGACAGGGCTCTATTT (SEQ ID NO: 4); e) TTACACCTGCAGCTCTCATTT (SEQ ID NO: 5); f) TCCATACAGTCAGTATCAATT (SEQ ID NO: 6); g) CGAGCGAGCAAGCTCAGTTTA (SEQ ID NO: 7); h) ACTCACTGGTGTTCATCTTTG (SEQ ID NO: 8); i) ATGGATTATCAAGTGTCAAGT (SEQ ID NO: 9); j) GCTGAAGAGCATGACTGACAT (SEQ ID NO: 10); k) CTGGCCATCTCTGACCTGTTT (SEQ ID NO: 11); l) ATACATCGGAGCCCTGCCAAA(SEQ ID NO: 12); and m) AGGAAATATCTGTGGGCTTGT(SEQ ID NO: 13), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: n) ATAATTGATGTCATAGATTGG (SEQ ID NO: 14); o) TTATCAGGATGAGGATGACCA (SEQ ID NO: 15); p) TATTTCCAAAGTCCCACTGGG (SEQ ID NO: 16); q) AAATAGAGCCCTGTCAAGAGT (SEQ ID NO: 17); r) AAATGAGAGCTGCAGGTGTAA (SEQ ID NO: 18); s) AATTGATACTGACTGTATGGA (SEQ ID NO: 19);t) TAAACTGAGCTTGCTCGCTCG (SEQ ID NO: 20); u) CAAAGATGAACACCAGTGAGT (SEQ ID NO: 21); v) ACTTGACACTTGATAATCCAT (SEQ ID NO: 22); w) ATGTCAGTCATGCTCTTCAGC (SEQ ID NO: 23); x) AAACAGGTCAGAGATGGCCAG (SEQ ID NO: 24); y) TTTGGCAGGGCTCCGATGTAT (SEQ ID NO: 25); and z) ACAAGCCCACAGATATTTCCT (SEQ ID NO: 26).

[0025] In certain embodiments, the small RNA (e.g., microRNA or shRNA) capable of inhibiting expression of chemokine receptor CCR5 comprises a sequence selected from the group consisting of: a) CCAATCTATGACATCAATTAT (SEQ ID NO: 1); b) TGGTCATCCTCATCCTGATAA (SEQ ID NO: 2); c) CCCAGTGGGACTTTGGAAATA (SEQ ID NO: 3); d) ACTCTTGACAGGGCTCTATTT (SEQ ID NO: 4); e) TTACACCTGCAGCTCTCATTT (SEQ ID NO: 5); f) TCCATACAGTCAGTATCAATT (SEQ ID NO: 6); g) CGAGCGAGCAAGCTCAGTTTA (SEQ ID NO: 7); h) ACTCACTGGTGTTCATCTTTG (SEQ ID NO: 8); i) ATGGATTATCAAGTGTCAAGT (SEQ ID NO: 9); j) GCTGAAGAGCATGACTGACAT (SEQ ID NO: 10); k) CTGGCCATCTCTGACCTGTTT (SEQ ID NO: 11); l) ATACATCGGAGCCCTGCCAAA(SEQ ID NO: 12); and m) AGGAAATATCTGTGGGCTTGT(SEQ ID NO: 13), or comprises a sequence selected from the group consisting of: n) ATAATTGATGTCATAGATTGG (SEQ ID NO: 14); o) TTATCAGGATGAGGATGACCA (SEQ ID NO: 15); p) TATTTCCAAAGTCCCACTGGG (SEQ ID NO: 16);q) AAATAGAGCCCTGTCAAGAGT (SEQ ID NO: 17); r) AAATGAGAGCTGCAGGTGTAA (SEQ ID NO: 18); s) AATTGATACTGACTGTATGGA (SEQ ID NO: 19); t) TAAACTGAGCTTGCTCGCTCG (SEQ ID NO: 20); u) CAAAGATGAACACCAGTGAGT (SEQ ID NO: 21); v) ACTTGACACTTGATAATCCAT (SEQ ID NO: 22); w) ATGTCAGTCATGCTCTTCAGC (SEQ ID NO: 23); x) AAACAGGTCAGAGATGGCCAG (SEQ ID NO: 24); y) TTTGGCAGGGCTCCGATGTAT (SEQ ID NO: 25); and z) ACAAGCCCACAGATATTTCCT (SEQ ID NO: 26).

[0026] In embodiments the small RNA (e.g., microRNA or shRNA) capable of inhibiting expression of Vif comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) ACAGATGGCAGGTGATGATTG (SEQ ID NO: 27); b) AAGGTAGGATCTCTACAGTAC (SEQ ID NO: 28); c) AGCAGGACATAACAAGGTAGG (SEQ ID NO: 29); and d) ATGGAAAACAGATGGCAGGT (SEQ ID NO: 30), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: e) CAATCATCACCTGCCATCTGT (SEQ ID NO: 31); f) GTACTGTAGAGATCCTACCTT (SEQ ID NO: 32); g) CCTACCTTGTTATGTCCTGCT (SEQ ID NO: 33); and h) ACCTGCCATCTGTTTTCCAT (SEQ ID NO: 34)

[0027] In certain embodiments, the small RNA (e.g., microRNA or shRNA) capable of inhibiting expression of Vif comprises a sequence selected from the group consisting of: a) ACAGATGGCAGGTGATGATTG (SEQ ID NO: 27);b) AAGGTAGGATCTCTACAGTAC (SEQ ID NO: 28); c) AGCAGGACATAACAAGGTAGG (SEQ ID NO: 29); and d) ATGGAAAACAGATGGCAGGT (SEQ ID NO: 30), or comprises a sequence selected from the group consisting of: e) CAATCATCACCTGCCATCTGT (SEQ ID NO: 31); f) GTACTGTAGAGATCCTACCTT (SEQ ID NO: 32); g) CCTACCTTGTTATGTCCTGCT (SEQ ID NO: 33); and h) ACCTGCCATCTGTTTTCCAT (SEQ ID NO: 34)

[0028] In embodiments, the small RNA (e.g., microRNA or shRNA) capable of inhibiting expression of Tat comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) GCATCTCCTATGGCAGGAAGA (SEQ ID NO: 35); b) ATGGAGCCAGTAGATCCTAGA (SEQ ID NO: 36); and c) TGGAAGCATCCAGGAAGTCAG (SEQ ID NO: 37), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: d) TCTTCCTGCCATAGGAGATGC (SEQ ID NO: 38); e) TCTAGGATCTACTGGCTCCAT (SEQ ID NO: 39); and f) CTGACTTCCTGGATGCTTCCA (SEQ ID NO: 40).

[0029] In certain embodiments, the small RNA (e.g., microRNA or shRNA) capable of inhibiting expression of Tat comprises a sequence selected from the group consisting of: a) GCATCTCCTATGGCAGGAAGA (SEQ ID NO: 35); b) ATGGAGCCAGTAGATCCTAGA (SEQ ID NO: 36); and c) TGGAAGCATCCAGGAAGTCAG (SEQ ID NO: 37), or comprises a sequence selected from the group consisting of: d) TCTTCCTGCCATAGGAGATGC (SEQ ID NO: 38); e) TCTAGGATCTACTGGCTCCAT (SEQ ID NO: 39); and f) CTGACTTCCTGGATGCTTCCA (SEQ ID NO: 40).

[0030] In another aspect, a lentiviral vector is disclosed. The lentiviral vector includes at least one encoded genetic element as described herein, e.g., wherein the at least one encoded genetic element comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5 or at least one small RNA capable of inhibiting expression of at least one HIV gene. In embodiments, the at least one genetic element includes a small RNA capable of inhibiting expression of chemokine receptor CCR5. In embodiments, the at least one genetic element includes at least one small RNA capable of inhibiting expression of at least one HIV gene. In further embodiments, the at least one genetic element includes a small RNA capable of inhibiting expression of chemokine receptor CCR5 and at least one small RNA capable of inhibiting expression of at least one HIV gene. In embodiments, the HIV gene is Vif and / or Tat. The at least one genetic element includes any genetic element capable of being expressed by a viral delivery system. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5, a small RNA capable of inhibiting expression of Vif, and a small RNA capable of inhibiting expression of Tat. The at least one encoded genetic element may include a microRNA or a shRNA. The at least one encoded genetic element may include a microRNA cluster. In embodiments, the genetic element is under control of a single promoter. In certain embodiments, the promoter is EF- 1alpha promoter.

[0031] In another aspect, a lentiviral vector system for expressing a lentiviral particle is disclosed. The system includes a lentiviral vector as described herein; an envelope plasmid for expressing an envelope protein optimized for infecting a cell; and at least one helper plasmid for expressing gag, pol, and rev genes, wherein when the lentiviral vector, the envelope plasmid, and the at least one helper plasmid are transfected into a packaging cell line, a lentiviral particle is produced by the packaging cell line, wherein the lentiviral particle is capable of inhibiting expression of chemokine receptor CCR5 and / or inhibiting expression of at least one HIV gene. The HIV gene may be Vif and / or Tat. The system may further include a first helper plasmid for expressing the gag and pol genes, and a second plasmid for expressing the rev gene.

[0032] In another aspect, a lentiviral particle capable of infecting a cell is disclosed. The lentiviral particle includes an envelope protein optimized for infecting a cell, and alentiviral vector as described herein. The envelope protein may be optimized for infecting a T cell. In a preferred embodiment, the envelope protein is optimized for infecting a CD4+ T cell.

[0033] In another aspect, a modified cell is disclosed. The modified cell includes a CD4+ T cell, wherein the CD4+ T cell has been infected with a lentiviral particle as described herein. In a preferred embodiment, the CD4+ T cell also recognizes an HIV antigen. In a further preferred embodiment, the HIV antigen includes a gag antigen. In a further preferred embodiment, the CD4+ T cell expresses a decreased level of CCR5 following infection with the lentiviral particle.

[0034] In another aspect, a method of selecting a subject for a therapeutic treatment regimen is disclosed. The method includes isolating peripheral blood mononuclear cells (PBMC) from the subject and determining a first quantifiable measurement associated with at least one factor associated with the PBMC; contacting the PBMC ex vivo with a therapeutically effective amount of a second stimulatory agent, and determining a second measurement associated with the at least one factor associated with the PBMC, whereby when the second quantifiable measurement is higher than the first quantifiable measurement, the subject is selected for the treatment regimen. Optionally, the treatment regimen is a prophylactic treatment regimen. The at least one factor may be T cell proliferation or IFN gamma production.

[0035] In another aspect, the methods disclosed herein include depleting at least one subset of cells from the PBMC. The method includes depleting at least one subset of cells from the PBMC, wherein the at least one subset of cells comprises any one or more of CD8+ T cells, γδ cells, NK cells, B cells, neutrophils, basophils, eosinophils, T regulatory cells, NKT cells, and erythrocytes. In embodiments, the depleting occurs after removing the leukocytes. In embodiments, the depleting occurs at the same time as removing the leukocytes.

[0036] The foregoing general description and following brief description of the drawings and detailed description are exemplary and explanatory and are intended to provide further explanation of the invention as claimed. Other objects, advantages, and novel features will be readily apparent to those skilled in the art from the following brief description of the drawings and detailed description of the invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 depicts a flow chart diagram of a particular clinical therapy strategy.

[0038] Figure 2 depicts diagrammatically how CD4+ T cells may be altered using gene therapy to prevent other cells from becoming infected and / or to prevent viral replication.

[0039] Figure 3 depicts an exemplary lentiviral vector system comprised of a therapeutic vector, a helper plasmid, and an envelope plasmid. The therapeutic vector shown here is a preferred therapeutic vector, which contains miR30CCR5-miR21Vif-miR185-Tat. DETAILED DESCRIPTION Overview

[0040] Disclosed herein are methods and compositions for treating and / or preventing human immunodeficiency virus (HIV) disease to achieve a functional cure. A functional cure is defined as a condition resulting from the disclosed treatments and methods that reduces or eliminates the need for cART and may or may not require supporting adjuvant therapy. The methods of the invention include gene delivery by integrating lentivirus, non-integrating lentivirus, and related viral vector technology as described below.

[0041] Disclosed herein are therapeutic viral vectors (e.g., lentiviral vectors), immunotherapies, and methods for their use for treating or preventing HIV infection or for achieving in a strategy to achieve a functional cure for HIV infection.

[0042] As depicted in Figure 1 herein, a strategy for treating HIV include a first stimulation event, for example a first therapeutic immunization with vaccines intended to produce strong immune responses against HIV in HIV infected patients, for example with stable suppression of viremia due to daily administration of HAART. In embodiments, the first stimulation event enriches the fraction of HIV-specific CD4 T cells. This is followed by (1) isolating peripheral leukocytes by leukapheresis or purifying PBMC from venous blood, (2) a second stimulating event, for example re-stimulating CD4 T cells ex vivo with a suitable stimulatory agent, such as any vaccine or protein, for example, HIV or HIV-related peptides, (3) performing therapeutic lentivirus transduction, ex vivo T cell culture, and (4) re-infusion back into the original patient. The above-described strategy can also be employed in HIV- negative patients to provide a vaccine or prophylactic effect to prevent HIV.

[0043] However, as detailed herein, in some embodiments, the first therapeutic immunization may not be necessary. This is then followed by (1) isolating peripheral leukocytes by leukapheresis or purifying PBMC from venous blood, (2) stimulating CD4 T cells ex vivo with a suitable stimulatory agent, such as any vaccine or protein, for example,HIV or HIV-related peptides, (3) performing therapeutic lentivirus transduction, ex vivo T cell culture, and (4) re-infusion back into the original donor.

[0044] The various methods and compositions can be used to prevent new cells, such as CD4+ T cells, from becoming infected with HIV. For example, as illustrated in Figure 2, to prevent new cells from becoming infected, CCR5 expression can be targeted to prevent virus attachment. Further, destruction of any residual infecting viral RNA can also be targeted. In respect of the foregoing, and in reference to Figure 2 herein, compositions and methods are provided to stop the HIV viral cycle in cells that have already become infected with HIV. To stop the HIV viral cycle, viral RNA produced by latently-infected cells, such as latently- infected CD4+ T cells, is targeted.

[0045] Previous efforts to achieve a cure for HIV have fallen short due to, among others, the failure to obtain sufficient numbers of HIV-specific CD4 T cells with protective genetic modifications. When this number is below a critical threshold, a functional cure as described herein is not achieved. For example, upon termination of antiretroviral therapy HIV re-emergence generally follows. Thereafter, patients often experience rapid destruction of HIV-specific CD4 T cells, and often return to progression of disease despite prior genetic therapy. By employing therapeutic immunization in accordance with the compositions and methods described herein, a HIV treatment regimen has been developed including, in various embodiments, a functional cure. Definitions and Interpretation

[0046] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Generally, nomenclature used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. The methods and techniques of the present disclosure are generally performed according to conventional methods well-known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. See, e.g.: Sambrook J. & Russell D. Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2000); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from CurrentProtocols in Molecular Biology, Wiley, John & Sons, Inc. (2002); Harlow and Lane Using Antibodies: A Laboratory Manual; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1998); and Coligan et al., Short Protocols in Protein Science, Wiley, John & Sons, Inc. (2003). Any enzymatic reactions or purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein. The nomenclature used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art.

[0047] As used herein, the term “about” will be understood by persons of ordinary skill in the art and will vary to some extent depending upon the context in which it is used. If there are uses of the term which are not clear to persons of ordinary skill in the art given the context in which it is used, “about” will mean up to plus or minus 10% of the particular term.

[0048] As used herein, the terms “administration of” or “administering” an active agent means providing an active agent of the invention to the subject in need of treatment in a form that can be introduced into that individual's body in a therapeutically useful form and therapeutically effective amount.

[0049] Throughout this specification and claims, the word “comprise,” or variations such as “comprises” or “comprising,” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. Further, as used herein, the term “includes” means includes without limitation.

[0050] The term “engraftment” refers to the ability for one skilled in the art to determine a quantitative level of sustained engraftment in a subject following infusion of a cellular source (see for e.g.: Rosenberg et al., N. Engl. J. Med.323:570-578 (1990); Dudley et al., J. Immunother. 24:363-373 (2001); Yee et al., Curr. Opin. Immunol. 13:141-146 (2001); Rooney et al., Blood 92:1549-1555 (1998)).

[0051] The terms, “expression,” “expressed,” or “encodes” refer to the process by which polynucleotides are transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently being translated into peptides, polypeptides, or proteins. Expression may include splicing of the mRNA in a eukaryotic cell or other forms of post-transcriptional modification or post-translational modification.

[0052] The term “functional cure” refers to a state or condition wherein HIV+ individuals who previously required cART or HAART, may survive with low or undetectablevirus replication using lower doses, intermittent doses, or discontinued dosing of cART or HAART. An individual may be said to have been “functionally cured” while still requiring adjunct therapy to maintain low level virus replication and slow or eliminate disease progression. A possible outcome of a functional cure is the eventual eradication of HIV to prevent all possibility of recurrence.

[0053] The term “HIV vaccine” encompasses immunogens plus vehicle plus adjuvant intended to elicit HIV-specific immune responses. A “HIV vaccine” may include purified or whole inactivated virus particles that may be HIV or a recombinant virus vectors capable of expressing HIV proteins, protein fragments or peptides, glycoprotein fragments or glycopeptides, in addition to recombinant bacterial vectors, plasmid DNA or RNA capable of directing cells to producing HIV proteins, glycoproteins or protein fragments able to elicit specific immunity. Alternately, specific methods for immune stimulation including anti- CD3 / CD28 beads, T cell receptor-specific antibodies, mitogens, superantigens and other chemical or biological stimuli may be used to activate dendritic, T or B cells for the purposes of enriching HIV-specific CD4 T cells prior to transduction or for in vitro assay of lentivirus- transduced CD4 T cells. Activating substances may be soluble, polymeric assemblies, liposome or endosome-based or linked to beads. Cytokines including interleukin-2, 6, 7, 12, 15, 23 or others may be added to improve cellular responses to stimuli and / or improve the survival of CD4 T cells throughout the culture and transduction intervals. Alternately, and without limiting any of the foregoing, the term “HIV vaccine” encompasses the MVA / HIV62B vaccine and variants thereof. The MVA / HIV62B vaccine is a known highly attenuated double recombinant MVA vaccine. The MVA / HIV62B vaccine was constructed through the insertion of HIV-1 gag-pol and env sequences into the known MVA vector (see: for e.g.: Goepfert et al. (2014) J. Infect. Dis.210(1): 99-110, and see WO2006026667, both of which are incorporated herein by reference). The term “HIV vaccine” also includes any one or more vaccines provided in Table 1, below. Table 1*IAVI is the International AIDS Vaccine Initiative, whose clinical trials database is publicly available at www.iavi.org / trials-database / trials. ** As used herein, the term “Prime” refers to the composition initially used as an immunological inoculant in a given clinical trial as referenced in Table 1 herein.

[0054] The term “in vivo” refers to processes that occur in a living organism. The term “ex vivo” refers to processes that occur outside of a living organism.

[0055] The term “miRNA” refers to a microRNA and also may be referred to as “miR”. The term “microRNA cluster” refers to at least two microRNAs that are situated on a vector in close proximity to each other and are co-expressed.

[0056] The term “packaging cell line” refers to any cell line that can be used to express a lentiviral particle.

[0057] The term “percent identity,” in the context of two or more nucleic acid or polypeptide sequences, refer to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of skill) or by visual inspection. Depending on the application, the “percent identity” can exist over a region of the sequence being compared, e.g., over a functional domain, or, alternatively, existover the full length of the two sequences to be compared. For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.

[0058] Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol.48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see generally Ausubel et al., infra).

[0059] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information website.

[0060] The percent identity between two nucleotide sequences can be determined using the GAP program in the GCG software package (available at www.gcg.com), using a NWSgapdna. CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. The percent identity between two nucleotide or amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (CABIOS, 4:11-17 (1989)) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. In addition, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J. Mol. Biol. (48):444-453 (1970)) algorithm which has been incorporated into the GAP program in the GCG software package (available at www.gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.

[0061] The nucleic acid and protein sequences of the present disclosure can further be used as a “query sequence” to perform a search against public databases to, for example,identify related sequences. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol.215:403-10. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, word length = 12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score = 50, word length = 3 to obtain amino acid sequences homologous to the protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See www.ncbi.nlm.nih.gov.

[0062] As used herein, “pharmaceutically acceptable” refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues, organs, and / or bodily fluids of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit / risk ratio.

[0063] As used herein, a “pharmaceutically acceptable carrier” refers to, and includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. The compositions can include a pharmaceutically acceptable salt, e.g., an acid addition salt or a base addition salt (see, e.g., Berge et al. (1977) J Pharm Sci 66:1-19).

[0064] As used herein, the term “SEQ ID NO” is synonymous with the term “Sequence ID No.”

[0065] As used herein, “small RNA” refers to non-coding RNA that are generally less than about 200 nucleotides or less in length and possess a silencing or interference function. In other embodiments, the small RNA is about 175 nucleotides or less, about 150 nucleotides or less, about 125 nucleotides or less, about 100 nucleotides or less, or about 75 nucleotides or less in length. Such RNAs include microRNA (miRNA), small interfering RNA (siRNA), double stranded RNA (dsRNA), and short hairpin RNA (shRNA). “Small RNA” of the disclosure should be capable of inhibiting or knocking-down gene expression of a target gene, generally through pathways that result in the destruction of the target gene mRNA.

[0066] As used herein, the term “stimulatory agent” refers to any exogenous agent that can be used to stimulate an immune response, and includes, without limitation, a vaccine, aHIV vaccine, and HIV or HIV-related peptides. A stimulatory agent can preferably stimulate a T cell response.

[0067] As used herein, the term “subject” includes a human patient but also includes other mammals. The terms “subject,” “individual,” “host,” and “patient” may be used interchangeably herein.

[0068] As used herein, the term “target cell” generally refers to a CD4+ T cell that responds to stimulation with protein or peptide fragments representing HIV gene sequences and includes a CD4+ T cell that has been transduced with the lentivirus vectors detailed herein rendering it less sensitive to HIV.

[0069] The term “therapeutically effective amount” refers to a sufficient quantity of the active agents of the present invention, in a suitable composition, and in a suitable dosage form to treat or prevent the symptoms, progression, or onset of the complications seen in patients suffering from a given ailment, injury, disease, or condition. The therapeutically effective amount will vary depending on the state of the patient’s condition or its severity, and the age, weight, etc., of the subject to be treated. A therapeutically effective amount can vary, depending on any of a number of factors, including, e.g., the route of administration, the condition of the subject, as well as other factors understood by those in the art.

[0070] As used herein, the term “therapeutic vector” is synonymous with a lentiviral vector.

[0071] The term “treatment” or “treating” generally refers to an intervention in an attempt to alter the natural course of the subject being treated and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects include, but are not limited to, preventing occurrence or recurrence of disease, alleviating symptoms, suppressing, diminishing or inhibiting any direct or indirect pathological consequences of the disease, ameliorating or palliating the disease state, and causing remission or improved prognosis.

[0072] The term “vaccine”, which is used interchangeably with the term “therapeutic vaccine”, refers to an exogenous agent that can elicit an immune response in an individual and includes, without limitation, purified proteins, inactivated viruses, virally vectored proteins, bacterially vectored proteins, peptides or peptide fragments, or virus-like particles (VLPs). Description of Aspects of the Disclosure

[0073] As detailed herein, in one aspect, a method of producing cells that are resistant to HIV infection is provided. The method generally includes contacting peripheral blood mononuclear cells (PBMC) isolated from an HIV-negative subject with a therapeutically effective amount of a stimulatory agent, wherein the contacting step is carried out ex vivo; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element; and culturing the transduced PBMC for a period of time sufficient to achieve such transduction. The method may further include further enrichment of the PBMC, for example, by preferably enriching the PBMC for CD4+ T cells. In embodiments, the transduced PBMC are cultured from about 1 to about 35 days. The method may further include infusing the transduced PBMC into a subject. The subject may be a human. The stimulatory agent may include a peptide or mixture of peptides, and in a preferred embodiment includes a gag peptide. The stimulatory agent may include a vaccine. The vaccine may be a HIV vaccine, and in a preferred embodiment, the HIV vaccine is a MVA / HIV62B vaccine or a variant thereof. In embodiments, the viral delivery system includes a lentiviral particle. In embodiments, the at least one genetic element may include at least one small RNA capable of inhibiting expression of at least one HIV gene. In embodiments, the at least one genetic element further includes a small RNA capable of inhibiting expression of chemokine receptor CCR5. In embodiments, the HIV gene is Vif and / or Tat. The at least one genetic element includes any genetic element capable of being expressed by a viral delivery system. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5, a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In embodiments, the at least one genetic element includes a microRNA or a shRNA. In further embodiments, the at least one genetic element comprises a microRNA cluster. In embodiments, the genetic element is under control of a single promoter. In certain embodiments, the promoter is EF-1alpha promoter.

[0074] In another aspect, a method of preventing HIV infection in a subject is disclosed. The method generally includes immunizing the subject with an effective amount of a first stimulatory agent. The method further includes contacting PBMC isolated from the subject ex vivo with a therapeutically effective amount of a second stimulatory agent; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element; and culturing the transduced PBMC for a period of time sufficient to achieve transduction. The method mayfurther include further enrichment of the PBMC, for example, by preferably enriching the PBMC for CD4+ T cells. In embodiments, the transduced PBMC are cultured from about 1 to about 35 days. The method may further involve infusing the transduced PBMC into a subject. The subject may be a human. The first and second stimulatory agents may be the same or different from each other. The at least one of the first and second stimulatory agents may include a peptide or mixture of peptides. In embodiments, at least one of the first and second stimulatory agents includes a gag peptide. The at least one of the first and second stimulatory agents may include a vaccine. The vaccine may be a HIV vaccine, and in a preferred embodiment, the HIV vaccine is a MVA / HIV62B vaccine or a variant thereof. In embodiments, the first stimulatory agent is a HIV vaccine and the second stimulatory agent is a gag peptide. In embodiments, the at least one genetic element may at least one small RNA capable of inhibiting expression of at least one HIV gene. In embodiments, the at least one genetic element further includes a small RNA capable of inhibiting expression of chemokine receptor CCR5. In embodiments, the HIV gene is Vif and / or Tat. The at least one genetic element includes any genetic element capable of being expressed by a viral delivery system. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5, a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In embodiments, the at least one genetic element includes a microRNA or a shRNA. In further embodiments, the at least one genetic element comprises a microRNA cluster. In embodiments, the genetic element is under control of a single promoter. In certain embodiments, the promoter is EF-1alpha promoter.

[0075] In another aspect, a method of treating cells or preventing cells from being infected with HIV is provided. The method generally includes immunizing a subject that is HIV-positive with an effective amount of a first stimulatory agent. The method further includes contacting PBMC isolated from the subject ex vivo with a therapeutically effective amount of a second stimulatory agent; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element; and culturing the transduced PBMC for a period of time sufficient to achieve transduction. The method may further include further enrichment of the PBMC, for example, by preferably enriching the PBMC for CD4+ T cells. In embodiments, the transduced PBMC are cultured from about 1 to about 35 days. The method may further involve infusing the transduced PBMC into a subject. In embodiments, the method furtherincludes positively selecting HIV-specific CD4+ T cells from the PBMC. In further embodiments, the HIV-specific CD4+ T cells are positively selected using at least one physical method of selection. The subject may be a human. The first and second stimulatory agents may be the same or different from each other. The at least one of the first and second stimulatory agents may include a peptide or mixture of peptides. In embodiments, at least one of the first and second stimulatory agents includes a gag peptide. The at least one of the first and second stimulatory agents may include a vaccine. The vaccine may be a HIV vaccine, and in a preferred embodiment, the HIV vaccine is a MVA / HIV62B vaccine or a variant thereof. In embodiments, the first stimulatory agent is a HIV vaccine and the second stimulatory agent is a gag peptide. In embodiments, the at least one genetic element may include at least one small RNA capable of inhibiting expression of at least one HIV gene. In embodiments, the at least one genetic element further includes a small RNA capable of inhibiting expression of chemokine receptor CCR5. In embodiments, the HIV gene is Vif and / or Tat. The at least one genetic element includes any genetic element capable of being expressed by a viral delivery system. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5, a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In embodiments, the at least one genetic element includes a microRNA or a shRNA. In further embodiments, the at least one genetic element comprises a microRNA cluster. In embodiments, the genetic element is under control of a single promoter. In certain embodiments, the promoter is EF- 1alpha promoter.

[0076] In another aspect, a method of treating HIV infection in a subject is disclosed. The method generally includes immunizing the subject with an effective amount of a first stimulatory agent. The method further includes contacting PBMC isolated from the subject ex vivo with a therapeutically effective amount of a second stimulatory agent; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element; and culturing the transduced PBMC for a period of time sufficient to achieve transduction. The method may further include further enrichment of the PBMC, for example, by preferably enriching the PBMC for CD4+ T cells. In embodiments, the transduced PBMC are cultured from about 1 to about 35 days. The method may further involve infusing the transduced PBMC into a subject. In embodiments, the method further includes positively selecting HIV-specific CD4+ T cellsfrom the PBMC. In further embodiments, the HIV-specific CD4+ T cells are positively selected using at least one physical method of selection. The subject may be a human. The first and second stimulatory agents may be the same or different from each other. The at least one of the first and second stimulatory agents may include a peptide or mixture of peptides. In embodiments, at least one of the first and second stimulatory agents includes a gag peptide. The at least one of the first and second stimulatory agents may include a vaccine. The vaccine may be a HIV vaccine, and in a preferred embodiment, the HIV vaccine is a MVA / HIV62B vaccine or a variant thereof. In embodiments, the first stimulatory agent is a HIV vaccine and the second stimulatory agent is a gag peptide. In embodiments, the at least one genetic element may include at least one small RNA capable of inhibiting expression of at least one HIV gene. In embodiments, the at least one genetic element further includes a small RNA capable of inhibiting expression of chemokine receptor CCR5. In embodiments, the HIV gene is Vif and / or Tat. The at least one genetic element includes any genetic element capable of being expressed by a viral delivery system. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5, a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In embodiments, the at least one genetic element includes a microRNA or a shRNA. In further embodiments, the at least one genetic element comprises a microRNA cluster. In embodiments, the genetic element is under control of a single promoter. In certain embodiments, the promoter is EF-1alpha promoter.

[0077] In another aspect, a method of treating cells or preventing cells from being infected with HIV is provided. The method includes contacting peripheral blood mononuclear cells (PBMC) isolated from a subject infected with HIV with a therapeutically effective amount of a stimulatory agent, wherein the contacting is carried out ex vivo; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element; and culturing the transduced PBMC for a period of time sufficient to achieve transduction. The method may further include further enrichment of the PBMC, for example, by preferably enriching the PBMC for CD4+ T cells. The transduced PBMC may be cultured from about 1 to about 35 days. The method may further involve infusing the transduced PBMC into a subject. In embodiments, the method further includes positively selecting HIV-specific CD4+ T cells from the PBMC. In further embodiments, the HIV-specific CD4+ T cells are positively selectedusing at least one physical method of selection. The subject may be a human. In embodiments, the subject has not been previously immunized with a HIV antibody. The stimulatory agent may include a peptide or mixture of peptides, and in a preferred embodiment includes a gag peptide. The stimulatory agent may include a vaccine. The vaccine may be a HIV vaccine, and in a preferred embodiment, the HIV vaccine is a MVA / HIV62B vaccine or a variant thereof. In a preferred embodiment, the viral delivery system includes a lentiviral particle. In embodiments, the at least one genetic element may include at least one small RNA capable of inhibiting expression of at least one HIV gene. In embodiments, the at least one genetic element further includes a small RNA capable of inhibiting expression of chemokine receptor CCR5. In embodiments, the HIV gene is Vif and / or Tat. The at least one genetic element includes any genetic element capable of being expressed by a viral delivery system. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5, a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In embodiments, the at least one genetic element includes a microRNA or a shRNA. In further embodiments, the at least one genetic element comprises a microRNA cluster. In embodiments, the genetic element is under control of a single promoter. In certain embodiments, the promoter is EF-1alpha promoter.

[0078] In another aspect, a method of treating HIV infection in a subject is disclosed. The method includes contacting PBMC isolated from the subject ex vivo with a therapeutically effective amount of a stimulatory agent; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element; and culturing the transduced PBMC for a period of time sufficient to achieve transduction. The method may further include further enrichment of the PBMC, for example, by preferably enriching the PBMC for CD4+ T cells. The transduced PBMC may be cultured from about 1 to about 35 days. The method may further involve infusing the transduced PBMC into a subject. In embodiments, the method further includes positively selecting HIV-specific CD4+ T cells from the PBMC. In further embodiments, the HIV-specific CD4+ T cells are positively selected using at least one physical method of selection. The subject may be a human. The stimulatory agent may include a peptide or mixture of peptides. In a preferred embodiment, the stimulatory agents include a gag peptide. The stimulatory agent may include a vaccine. The vaccine may be a HIV vaccine, and in a preferred embodiment, the HIV vaccine is a MVA / HIV62B vaccine or a variant thereof. In apreferred embodiment, the viral delivery system includes a lentiviral particle. In embodiments, the at least one genetic element may include at least one small RNA capable of inhibiting expression of at least one HIV gene. In embodiments, the at least one genetic element further includes a small RNA capable of inhibiting expression of chemokine receptor CCR5. In embodiments, the HIV gene is Vif and / or Tat. The at least one genetic element includes any genetic element capable of being expressed by a viral delivery system. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5, a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In embodiments, the at least one genetic element includes a microRNA or a shRNA. In further embodiments, the at least one genetic element comprises a microRNA cluster. In embodiments, the genetic element is under control of a single promoter. In certain embodiments, the promoter is EF-1alpha promoter.

[0079] In embodiments, the small RNA (e.g., microRNA or shRNA) capable of inhibiting expression of chemokine receptor CCR5 comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) CCAATCTATGACATCAATTAT (SEQ ID NO: 1); b) TGGTCATCCTCATCCTGATAA (SEQ ID NO: 2); c) CCCAGTGGGACTTTGGAAATA (SEQ ID NO: 3); d) ACTCTTGACAGGGCTCTATTT (SEQ ID NO: 4); e) TTACACCTGCAGCTCTCATTT (SEQ ID NO: 5); f) TCCATACAGTCAGTATCAATT (SEQ ID NO: 6); g) CGAGCGAGCAAGCTCAGTTTA (SEQ ID NO: 7); h) ACTCACTGGTGTTCATCTTTG (SEQ ID NO: 8); i) ATGGATTATCAAGTGTCAAGT (SEQ ID NO: 9); j) GCTGAAGAGCATGACTGACAT (SEQ ID NO: 10); k) CTGGCCATCTCTGACCTGTTT (SEQ ID NO: 11); l) ATACATCGGAGCCCTGCCAAA(SEQ ID NO: 12); andm) AGGAAATATCTGTGGGCTTGT(SEQ ID NO: 13), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: n) ATAATTGATGTCATAGATTGG (SEQ ID NO: 14); o) TTATCAGGATGAGGATGACCA (SEQ ID NO: 15); p) TATTTCCAAAGTCCCACTGGG (SEQ ID NO: 16); q) AAATAGAGCCCTGTCAAGAGT (SEQ ID NO: 17); r) AAATGAGAGCTGCAGGTGTAA (SEQ ID NO: 18); s) AATTGATACTGACTGTATGGA (SEQ ID NO: 19); t) TAAACTGAGCTTGCTCGCTCG (SEQ ID NO: 20); u) CAAAGATGAACACCAGTGAGT (SEQ ID NO: 21); v) ACTTGACACTTGATAATCCAT (SEQ ID NO: 22); w) ATGTCAGTCATGCTCTTCAGC (SEQ ID NO: 23); x) AAACAGGTCAGAGATGGCCAG (SEQ ID NO: 24); y) TTTGGCAGGGCTCCGATGTAT (SEQ ID NO: 25); and z) ACAAGCCCACAGATATTTCCT (SEQ ID NO: 26).

[0080] In certain embodiments, the small RNA (e.g., microRNA or shRNA) capable of inhibiting expression of chemokine receptor CCR5 comprises a sequence selected from the group consisting of: a) CCAATCTATGACATCAATTAT (SEQ ID NO: 1); b) TGGTCATCCTCATCCTGATAA (SEQ ID NO: 2); c) CCCAGTGGGACTTTGGAAATA (SEQ ID NO: 3); d) ACTCTTGACAGGGCTCTATTT (SEQ ID NO: 4); e) TTACACCTGCAGCTCTCATTT (SEQ ID NO: 5); f) TCCATACAGTCAGTATCAATT (SEQ ID NO: 6); g) CGAGCGAGCAAGCTCAGTTTA (SEQ ID NO: 7); h) ACTCACTGGTGTTCATCTTTG (SEQ ID NO: 8);i) ATGGATTATCAAGTGTCAAGT (SEQ ID NO: 9); j) GCTGAAGAGCATGACTGACAT (SEQ ID NO: 10); k) CTGGCCATCTCTGACCTGTTT (SEQ ID NO: 11); l) ATACATCGGAGCCCTGCCAAA(SEQ ID NO: 12); and m) AGGAAATATCTGTGGGCTTGT(SEQ ID NO: 13), or comprises a sequence selected from the group consisting of: n) ATAATTGATGTCATAGATTGG (SEQ ID NO: 14); o) TTATCAGGATGAGGATGACCA (SEQ ID NO: 15); p) TATTTCCAAAGTCCCACTGGG (SEQ ID NO: 16); q) AAATAGAGCCCTGTCAAGAGT (SEQ ID NO: 17); r) AAATGAGAGCTGCAGGTGTAA (SEQ ID NO: 18); s) AATTGATACTGACTGTATGGA (SEQ ID NO: 19); t) TAAACTGAGCTTGCTCGCTCG (SEQ ID NO: 20); u) CAAAGATGAACACCAGTGAGT (SEQ ID NO: 21); v) ACTTGACACTTGATAATCCAT (SEQ ID NO: 22); w) ATGTCAGTCATGCTCTTCAGC (SEQ ID NO: 23); x) AAACAGGTCAGAGATGGCCAG (SEQ ID NO: 24); y) TTTGGCAGGGCTCCGATGTAT (SEQ ID NO: 25); and z) ACAAGCCCACAGATATTTCCT (SEQ ID NO: 26).

[0081] In embodiments the small RNA (e.g., microRNA or shRNA) capable of inhibiting expression of Vif comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) ACAGATGGCAGGTGATGATTG (SEQ ID NO: 27); b) AAGGTAGGATCTCTACAGTAC (SEQ ID NO: 28); c) AGCAGGACATAACAAGGTAGG (SEQ ID NO: 29); and d) ATGGAAAACAGATGGCAGGT (SEQ ID NO: 30),or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: e) CAATCATCACCTGCCATCTGT (SEQ ID NO: 31); f) GTACTGTAGAGATCCTACCTT (SEQ ID NO: 32); g) CCTACCTTGTTATGTCCTGCT (SEQ ID NO: 33); and h) ACCTGCCATCTGTTTTCCAT (SEQ ID NO: 34)

[0082] In certain embodiments, the small RNA (e.g., microRNA or shRNA) capable of inhibiting expression of Vif comprises a sequence selected from the group consisting of: a) ACAGATGGCAGGTGATGATTG (SEQ ID NO: 27); b) AAGGTAGGATCTCTACAGTAC (SEQ ID NO: 28); c) AGCAGGACATAACAAGGTAGG (SEQ ID NO: 29); and d) ATGGAAAACAGATGGCAGGT (SEQ ID NO: 30), or comprises a sequence selected from the group consisting of: e) CAATCATCACCTGCCATCTGT (SEQ ID NO: 31); f) GTACTGTAGAGATCCTACCTT (SEQ ID NO: 32); g) CCTACCTTGTTATGTCCTGCT (SEQ ID NO: 33); and h) ACCTGCCATCTGTTTTCCAT (SEQ ID NO: 34)

[0083] In embodiments, the small RNA (e.g., microRNA or shRNA) capable of inhibiting expression of Tat comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) GCATCTCCTATGGCAGGAAGA (SEQ ID NO: 35); b) ATGGAGCCAGTAGATCCTAGA (SEQ ID NO: 36); and c) TGGAAGCATCCAGGAAGTCAG (SEQ ID NO: 37), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: d) TCTTCCTGCCATAGGAGATGC (SEQ ID NO: 38); e) TCTAGGATCTACTGGCTCCAT (SEQ ID NO: 39); and f) CTGACTTCCTGGATGCTTCCA (SEQ ID NO: 40).

[0084] In certain embodiments, the small RNA (e.g., microRNA or shRNA) capable of inhibiting expression of Tat comprises a sequence selected from the group consisting of: a) GCATCTCCTATGGCAGGAAGA (SEQ ID NO: 35); b) ATGGAGCCAGTAGATCCTAGA (SEQ ID NO: 36); and c) TGGAAGCATCCAGGAAGTCAG (SEQ ID NO: 37), or comprises a sequence selected from the group consisting of: d) TCTTCCTGCCATAGGAGATGC (SEQ ID NO: 38); e) TCTAGGATCTACTGGCTCCAT (SEQ ID NO: 39); and f) CTGACTTCCTGGATGCTTCCA (SEQ ID NO: 40).

[0085] In another aspect, a lentiviral vector is disclosed. The lentiviral vector includes at least one encoded genetic element as described herein, e.g., wherein the at least one encoded genetic element comprises at least one small RNA capable of inhibiting expression of at least one HIV gene. In embodiments, the at least one genetic element further includes a small RNA capable of inhibiting expression of chemokine receptor CCR5. In embodiments, the HIV gene is Vif and / or Tat. The at least one genetic element includes any genetic element capable of being expressed by a viral delivery system. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of Vif and a small RNA capable of inhibiting expression of Tat. In some embodiments, the at least one genetic element comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5, a small RNA capable of inhibiting expression of Vif, and a small RNA capable of inhibiting expression of Tat. The at least one encoded genetic element may include a microRNA or a shRNA. The at least one encoded genetic element may include a microRNA cluster. In embodiments, the genetic element is under control of a single promoter. In certain embodiments, the promoter is EF-1alpha promoter.

[0086] In another aspect, a lentiviral vector system for expressing a lentiviral particle is provided. The system includes a lentiviral vector as described herein; at least one envelope plasmid for expressing an envelope protein preferably optimized for infecting a cell; and at least one helper plasmid for expressing a gene of interest, for example any of gag, pol, and rev genes, wherein when the lentiviral vector, the at least one envelope plasmid, and the at least one helper plasmid are transfected into a packaging cell, wherein a lentiviral particle is produced by the packaging cell, wherein the lentiviral particle is capable of modulating a targetsequence of interest, for example inhibiting production of chemokine receptor CCR5 or inhibiting expression of at least one HIV gene.

[0087] In another aspect, a lentiviral particle capable of infecting a cell is disclosed. The lentiviral particle includes at least one envelope protein preferably optimized for infecting a cell, and a lentiviral vector as described herein. The envelope protein may be optimized for infecting a T cell. In a preferred embodiment, the envelope protein is optimized for infecting a CD4+ T cell.

[0088] In another aspect, a modified cell is disclosed. In embodiments, the modified cell is a CD4+ T cell. In embodiments, the CD4+ T cell has been infected with a lentiviral particle as described herein. In embodiments, the CD4+ T cell also has been selected to recognize an HIV antigen based on the prior immunization with a stimulatory agent. In a further preferred embodiment, the HIV antigen that is recognized by the CD4+ T cell includes a gag antigen. In a further preferred embodiment, the CD4+ T cell expresses a decreased level of CCR5 following infection with the lentiviral particle.

[0089] In another aspect, a method of selecting a subject for a therapeutic treatment regimen is disclosed. The method generally includes immunizing the subject with an effective amount of a first stimulatory agent; isolating purifying peripheral blood mononuclear cells (PBMC) from the subject and determining a first quantifiable measurement associated with at least one factor associated with the PBMC; contacting the PBMC ex vivo with a therapeutically effective amount of a second stimulatory agent, and determining a second measurement associated with the at least one factor associated with the PBMC, whereby when the second quantifiable measurement is different (e.g., higher) than the first quantifiable measurement, the subject is selected for the treatment regimen. The at least one factor may be T cell proliferation or IFN gamma production.

[0090] In another aspect, a method of selecting a subject for a therapeutic treatment regimen is disclosed. The method includes isolating peripheral blood mononuclear cells (PBMC) from the subject and determining a first quantifiable measurement associated with at least one factor associated with the PBMC; contacting the PBMC ex vivo with a therapeutically effective amount of a stimulatory agent, and determining a second measurement associated with the at least one factor associated with the PBMC, whereby when the second quantifiable measurement is higher than the first quantifiable measurement, the subject is selected for thetreatment regimen. The at least one factor may be T cell proliferation or IFN gamma production.

[0091] In another aspect, any of the methods described herein further include further enrichment of the PBMC, for example, by preferably enriching the PBMC for CD4+ T cells or selecting for antigen-specific cells based on cytokine expression or combinations of selection methods to enrich for the therapeutic fraction of cells.

[0092] In another aspect, any of the methods comprising treating cells infected with HIV or preventing cells from being infected with HIV described herein further comprise depleting at least one subset of cells from the PBMC. In embodiments, the method includes depleting at least one subset of cells from the PBMC, wherein the at least one subset of cells comprises any one or more of CD8+ T cells, γδ cells, NK cells, B cells, neutrophils, basophils, eosinophils, T regulatory cells, NKT cells, and erythrocytes. In embodiments, the depleting occurs after removing the leukocytes. In embodiments, the depleting occurs at the same time as removing the leukocytes.

[0093] In other aspect, any of the methods comprising treating HIV in a subject described herein further comprise depleting at least one subset of cells from the PBMC. In embodiments, the method includes depleting at least one subset of cells from the PBMC, wherein the at least one subset of cells comprises any one or more of CD8+ T cells, γδ cells, NK cells, B cells, neutrophils, basophils, eosinophils, T regulatory cells, NKT cells, and erythrocytes. In embodiments, the depleting occurs after removing the leukocytes. In embodiments, the depleting occurs at the same time as removing the leukocytes.

[0094] In another aspect, any of the methods comprising selected a subject for a therapeutic regimen described herein further comprise depleting at least one subset of cells from the PBMC. In embodiments, the method includes depleting at least one subset of cells from the PBMC, wherein the at least one subset of cells comprises any one or more of CD8+ T cells, γδ cells, NK cells, B cells, neutrophils, basophils, eosinophils, T regulatory cells, NKT cells, and erythrocytes. In embodiments, the depleting occurs after removing the leukocytes. In embodiments, the depleting occurs at the same time as removing the leukocytes.

[0095] In another aspect, any of the methods described herein further comprise depleting at least one subset of immune cells from the PBMC, wherein the at least one subset of cells comprises any one or more of CD8+ T cells, γδ cells, NK cells, B cells, neutrophils, basophils, eosinophils, T regulatory cells, NKT cells, and erythrocytes. In embodiments, thecells depleted from the PBMC are CD8+ T cells. In embodiments, the cells depleted from the PBMC are γδ cells. In embodiments, the cells depleted from the PBMC are NK cells. In embodiments, the cells depleted from the PBMC are B cells. In embodiments, the cells depleted from the PBMC are T regulatory cells. In embodiments, the cells depleted from the PBMC are NKT cells. In embodiments, the cells depleted from the PBMC are erythrocytes. In embodiments, the cells depleted from the PBMC are CD8+ T cells and γδ cells. In embodiments, the cells depleted from the PBMC are CD8+ T cells, γδ cells, and NK cells. In embodiments, the cells depleted from the PBMC are CD8+ T cells, γδ cells, NK cells, and B cells. In embodiments, the cells depleted from the PBMC are CD8+ T cells, γδ cells, NK cells, B cells, and T regulatory cells. In embodiments, the cells depleted from the PBMC are CD8+ T cells, γδ cells, NK cells, B cells, T regulatory cells, and NKT cells. In embodiments, the cells depleted from the PBMC are CD8+ T cells, γδ cells, NK cells, B cells, T regulatory cells, NKT cells, and erythrocytes. In embodiments, the cells depleted from the PBMC are γδ cells and NK cells. In embodiments, the cells depleted from the PBMC are γδ cells, NK cells, and B cells. In embodiments, the cells depleted from the PBMC are γδ cells, NK cells, B cells, and T regulatory cells. In embodiments, the cells depleted from the PBMC are γδ cells, NK cells, B cells, T regulatory cells, and NKT cells. In embodiments, the cells depleted from the PBMC are γδ cells, NK cells, B cells, T regulatory cells, NKT cells, and erythrocytes. In embodiments, the cells depleted from the PBMC are NK cells and B cells. In embodiments, the cells depleted from the PBMC are NK cells, B cells, and T regulatory cells. In embodiments, the cells depleted from the PBMC are NK cells, B cells, T regulatory cells, and NKT cells. In embodiments, the cells depleted from the PBMC are NK cells, B cells, T regulatory cells, NKT cells, and erythrocytes. In embodiments, the cells depleted from the PBMC are B cells and T regulatory cells. In embodiments, the cells depleted from the PBMC are B cells, T regulatory cells, and NKT cells. In embodiments, the cells depleted from the PBMC are B cells, T regulatory cells, NKT cells, and erythrocytes. In embodiments, the cells depleted from the PBMC are T regulatory cells and NKT cells. In embodiments, the cells depleted from the PBMC are T regulatory cells, NKT cells, and erythrocytes. In embodiments, the cells depleted from the PBMC are NKT cells and erythrocytes. In embodiments, the cells depleted from the PBMC are CD8+ T cells and NK cells. In embodiments, the cells depleted from the PBMC are CD8+ T cells, NK cells, and B cells. In embodiments, the cells depleted from the PBMC are CD8+ T cells, NK Cells, B cells, and T regulatory cells. In embodiments, the cells depleted from the PBMC are CD8+ T cells, NK Cells, B cells, T regulatory cells, and NKT cells. In embodiments, the cells depleted from the PBMC are CD8+ T cells, NK Cells, B cells, Tregulatory cells, NKT cells, and erythrocytes. In embodiments, the cells depleted from the PBMC are γδ and B cells. In embodiments, the cells depleted from the PBMC are γδ, B cells, and T regulatory cells. In embodiments, the cells depleted from the PBMC are γδ, B cells, T regulatory cells, and NKT cells. In embodiments, the cells depleted from the PBMC are γδ, B cells, T regulatory cells, NKT cells, and erythrocytes. In embodiments, the cells depleted from the PBMC are NK cells and T regulatory cells. In embodiments, the cells depleted from the PBMC are NK cells, T regulatory cells, and NKT cells. In embodiments, the cells depleted from the PBMC are NK cells, T regulatory cells, NKT cells, and erythrocytes. In embodiments, the cells depleted from the PBMC are B cells and NKT cells. In embodiments, the cells depleted from the PBMC are B cells, NKT cells, and erythrocytes. In embodiments, the cells depleted from the PBMC are T regulatory cells and erythrocytes. In embodiments, the cells depleted from the PBMC, as described herein, include any one or any combination of neutrophils, basophils, and eosinophils.

[0096] In another aspect, CD8+ T cells are depleted at the beginning of cell expansion to improve CD4+ T cell expansion. In embodiments, the cell depletion is performed after peptide stimulation and before lentivirus transduction, when cells are better able to withstand mechanical stress. In embodiments, after CD8+ T cell depletion, the cells are placed in culture medium for approximately 24 hours. In embodiments, after CD8+ cell depletion, the cells are placed in culture for less than 24 hours, for example, less than 20 hours, less than 16 hours, less than 8 hours, or less than 4 hours. In embodiments, after CD8+ T cell depletion, the cells are placed in culture for greater than 24 hours, for example, greater than 30 hours, greater than 36 hours, greater than 42 hours, or greater than 48 hours. In embodiments, the culture medium comprises IL-7. In embodiments, the culture medium comprises IL-15. In embodiments, the culture medium comprises IL-7 and IL-15. In embodiments, the cell depletion is performed before peptide stimulation. In embodiments, a gag protein is used to cause peptide stimulation. In embodiments, a HIV vaccine is used to cause peptide stimulation. In embodiments, the vaccine is a MVA / HIV62B vaccine, which is used to cause peptide stimulation. In embodiments, CD8+ T cells are depleted with a PE anti-human CD8 antibody and anti-PE microbeads. In embodiments, the CD8 antibody is an anti-rat antibody. In embodiments, the CD8 antibody is an anti-mouse antibody. In embodiments, the CD8 antibody is an anti-rabbit antibody. In embodiments, the CD8 antibody is an anti-goat antibody. In embodiments, after cell depletion and peptide stimulation, the cells are transduced. In embodiments, the cells are transduced with a lentivirus. In embodiments, the lentivirus carries GFP. In embodiments, thelentivirus carries RFP. In embodiments, the lentivirus carries EGFP. In embodiments, the cells are placed in culture after transduction. In embodiments, the culture medium comprises IL-7. In embodiments, the culture medium comprises IL-15. In embodiments, the culture medium comprises IL-7 and IL-15. In embodiments, the cells are cultured for approximately 2 days to allow for CD4+ T cell expansion. In embodiments, the cells are cultured approximately 3 days to allow for CD4+ T cell expansion. In embodiments, the cells are cultured for less than 2 days, for example, less than 42 hours, less than 36 hours, less than 30 hours, less than 24 hours, less than 18 hours, less than 12 hours, or less than 6 hours. In embodiments. the cells are cultured for greater than 3 days, for example, greater than 4 days, greater than 5 days, greater than 6 days, greater than 7 days, greater than 8 days, greater than 9 days, or greater than 10 days. In embodiments, the cells are cultured between 2 and 3 days, for example, approximately 30 hours, approximately 36 hours, or approximately 42 hours.

[0097] In another aspect, CD8+, γδ, NK, or B cells are depleted to improve CD4+ T cell expansion. In embodiments, any two or more of CD8+, γδ, NK, and B cells are depleted to improve CD4+ T cell expansion. In embodiments, CD8+, γδ, NK, B, T regulatory, NKT, or erythrocyte cells are depleted to improve CD4+ T cell expansion. In embodiments any two or more of CD8+, γδ, NK, B, T regulatory, NKT, and erythrocyte cells are depleted to improve CD4+ T cell expansion. In embodiments, cell depletion is performed after peptide stimulation and before lentivirus transduction. In embodiments, after cell depletion, the cells are placed in culture medium for ~24 hours. In embodiments, after cell depletion, the cells are placed in culture for less than 24 hours, for example, less than 20 hours, less than 16 hours, less than 8 hours, or less than 4 hours. In embodiments, after CD8+ T cell depletion, the cells are placed in culture for greater than 24 hours, for example, greater than 30 hours, greater than 36 hours, greater than 42 hours, or greater than 48 hours. In embodiments, the culture medium comprises IL-7. In embodiments, the culture medium comprises IL-15. In embodiments, the culture medium comprises IL-7 and IL-15. In embodiments, cell depletion is performed before peptide stimulation. In embodiments, a gag protein is used to cause peptide stimulation. In embodiments, a HIV vaccine is used to cause peptide stimulation. In embodiments, the MVA / HIV62B vaccine is used to cause peptide stimulation. In embodiments, CD8+ T, γδ, NK, and / or B cells are depleted with PE labeled specific antibodies and anti-PE microbeads. In embodiments, the antibody used is an anti-human antibody. In embodiments, the antibody used was an anti-rat antibody. In embodiments, the antibody used is an anti-mouse antibody. In embodiments, the antibody used is an anti-goat antibody. In embodiments, after celldepletion and peptide stimulation, the cells are transduced. In embodiments, the cells are transduced with a lentivirus. In embodiments, the lentivirus carries GFP. In embodiments, the lentivirus carries RFP. In embodiments, the lentivirus carries EGFP. In embodiments, the cells are placed in culture after transduction. In embodiments, the culture medium comprises IL-7. In embodiments, the culture medium comprises IL-15. In embodiments, the culture medium comprises IL-7 and IL-15. In embodiments, the cells are cultured for approximately 2 days to allow for CD4+ T cell expansion. In embodiments, the cells are cultured ~3 days to allow for CD4+ T cell expansion. In embodiments, the cells are cultured for less than 2 days, for example, less than 42 hours, less than 36 hours, less than 30 hours, less than 24 hours, less than 18 hours, less than 12 hours, or less than 6 hours. In embodiments, the cells are cultured for greater than 3 days, for example, greater than 4 days, greater than 5 days, greater than 6 days, greater than 7 days, greater than 8 days, greater than 9 days, or greater than 10 days. In embodiments, the cells are cultured between 2 and 3 days, for example, ~30 hours, ~36 hours, or ~42 hours.

[0098] In another aspect, a lentivirus includes GFP, which is used to measure transduction efficiency. In embodiments, the lentivirus includes RFP. In embodiments, the lentivirus is carrying EGFP. In embodiments, a cytokine capture system is used to identify antigen-specific CD4+ T cells with GFP positive cells. In embodiments, GFP is used to identify the transduced cell subsets. In embodiments, RFP is used to identify the transduced cell subsets. In embodiments, EGFP is used to identify the transduced cell subsets. In embodiments, any of the transduction methods described herein can be used to measure transduction efficiency. In embodiments, prior to lentiviral transduction, any of the depletion methods described herein can be used to deplete any one or more of CD8+ T, γδ, NK, B, neutrophils, basophils, eosinophils, T regulatory, NKT, and erythrocyte cells.

[0099] In other aspect, transduction efficiency is measured by detecting vector copy number (VCN) by qPCR. In embodiments, the percentage of transduced cells based on VCN in the final cell product can be estimated by establishing the relationship between transduced cells and VCN. In embodiments, a lentivirus carrying GFP is used to determine the percentage of the cells transduced. In embodiments, a lentivirus carrying RFP is used to determine the percentage of cells transduced. In embodiments, a lentivirus carrying EGFP is used to determine the percentage of cells transduced. In embodiments, any of the transduction methods described herein can be used to measure transduction efficiency. In embodiments, prior tolentiviral transduction, any of the depletion methods described herein can be used to deplete any one or more of CD8+ T, γδ, NK, B cells. Human Immunodeficiency Virus (HIV)

[0100] Human Immunodeficiency Virus, which is also commonly referred to as “HIV”, is a retrovirus that causes acquired immunodeficiency syndrome (AIDS) in humans. AIDS is a condition in which progressive failure of the immune system allows life-threatening opportunistic infections and cancers to thrive. Without treatment, average survival time after infection with HIV is estimated to be 9 to 11 years, depending upon the HIV subtype. Infection with HIV occurs by the transfer of bodily fluids, including but not limited to blood, semen, vaginal fluid, pre-ejaculate, saliva, tears, lymph or cerebro-spinal fluid, or breast milk. HIV may be present in an infected individual as both free virus particles and within infected immune cells.

[0101] HIV infects vital cells in the human immune system such as helper T cells, although tropism can vary among HIV subtypes. Immune cells that may be specifically susceptible to HIV infection include but are not limited to CD4+ T cells, macrophages, and dendritic cells. HIV infection leads to low levels of CD4+ T cells through a number of mechanisms, including but not limited to apoptosis of uninfected bystander cells, direct viral killing of infected cells, and killing of infected CD4+ T cells by CD8 cytotoxic lymphocytes that recognize infected cells. When CD4+ T cell numbers decline below a critical level, cell- mediated immunity is lost, and the body becomes progressively more susceptible to opportunistic infections and cancer.

[0102] Structurally, HIV is distinct from many other retroviruses. The RNA genome consists of at least seven structural landmarks (LTR, TAR, RRE, PE, SLIP, CRS, and INS), and at least nine genes (gag, pol, env, tat, rev, nef, vif, vpr, vpu, and sometimes a tenth tev, which is a fusion of tat, env and rev), encoding 19 proteins. Three of these genes, gag, pol, and env, contain information needed to make the structural proteins for new virus particles.

[0103] HIV replicates primarily in CD4 T cells, and causes cellular destruction or dysregulation to reduce host immunity. Because HIV establishes infection as an integrated provirus and may enter a state of latency wherein virus expression in a particular cell decreases below the level for cytopathology affecting that cell or detection by the host immune system, HIV is difficult to treat and has not been eradicated even after prolonged intervals of highly active antiretroviral therapy (HAART). HIV is also difficult to prevent in HIV-negativeindividuals. In the vast majority of cases, HIV infection causes fatal disease although survival may be prolonged by HAART.

[0104] Major goals in the fight against HIV are to develop strategies for curing and / or preventing the disease. Prolonged HAART has not accomplished this goal, so investigators have turned to alternative procedures. Early efforts to improve host immunity by therapeutic immunization (e.g., using a vaccine after infection has occurred) had marginal or no impact. Likewise, treatment intensification had moderate or no impact.

[0105] Some progress has been made using genetic therapy, but positive results are sporadic and found only among rare human beings carrying defects in one or both alleles of the gene encoding CCR5 (chemokine receptor), which plays a critical role in viral penetration of host cells. However, many investigators are optimistic that genetic therapy holds the best promise for eventually achieving an HIV cure.

[0106] As disclosed herein, the methods and compositions of the invention are able to achieve a functional cure that may or may not include complete eradication of all HIV from the body. As mentioned above, a functional cure is defined as a state or condition wherein HIV+ individuals who previously required HAART, may survive with low or undetectable virus replication and using lower or intermittent doses of HAART, or are potentially able to discontinue HAART altogether. As used herein, a functional cure may still possibly require adjunct therapy to maintain low level virus replication and slow or eliminate disease progression. A possible outcome of a functional cure is the eventual eradication of HIV to prevent all possibility of recurrence. Moreover, the methods and compositions of the disclosure are able to prevent HIV infection in HIV-negative individuals.

[0107] The primary obstacles to achieving a functional cure lie in the basic biology of HIV itself. Virus infection deletes CD4 T cells that are critical for nearly all immune functions. Most importantly, HIV infection and depletion of CD4 T cells requires activation of individual cells. Activation is a specific mechanism for individual CD4 T cell clones that recognize pathogens or other molecules, using a rearranged T cell receptor.

[0108] In the case of HIV, infection activates a population of HIV-specific T cells that become infected and are consequently depleted before other T cells that are less specific for the virus, which effectively cripples the immune system’s defense against the virus. The capacity for HIV-specific T cell responses is rebuilt during prolonged HAART; however, whenHAART is interrupted the rebounding virus infection repeats the process and again deletes the virus-specific cells, resetting the clock on disease progression.

[0109] Clearly, a functional cure is only possible if enough HIV-specific CD4 T cells are protected to allow for a host’s native immunity to confront and control HIV once HAART is interrupted. Similarly, a successful vaccine or prophylactic strategy also requires sufficient HIV-specific CD4 T cells to be present to confront and kill HIV when a HIV-negative individual first encounters the virus. In one embodiment, the present disclosure provides methods and compositions for improving the effectiveness of genetic therapy to provide a functional cure of HIV disease. In another embodiment, the present disclosure provides methods and compositions for enhancing host immunity against HIV to provide a functional cure. In another embodiment, the present disclosure provides methods and compositions for enhancing host immunity against HIV to provide a functional cure without the need for prior immunization. In yet another embodiment, the present disclosure provides methods and compositions for enriching HIV-specific CD4 T cells in a patient to achieve a functional cure.

[0110] In one embodiment of the invention, treatment results in enriching a subject’s HIV-specific CD4 T cells by about 100%, about 200%, about 300%, about 400%, about 500%, about 600%, about 700%, about 800%, about 900%, or about 1000%. Gene Therapy

[0111] Viral vectors are used to deliver genetic constructs to host cells for the purposes of disease therapy or prevention.

[0112] Genetic constructs can include, but are not limited to, functional genes or portions of genes to correct or complement existing defects, DNA sequences encoding regulatory proteins, DNA sequences encoding regulatory RNA molecules including antisense, short homology RNA, long non-coding RNA, small interfering RNA or others, and decoy sequences encoding either RNA or proteins designed to compete for critical cellular factors to alter a disease state. Gene therapy involves delivering these therapeutic genetic constructs to target cells to provide treatment or alleviation of a particular disease.

[0113] There are multiple ongoing efforts to utilize genetic therapy in the treatment of HIV disease, but thus far, the results have been poor. A small number of treatment successes were obtained in rare HIV patients carrying a spontaneous deletion of the CCR5 gene (an allele known as CCR5delta32).

[0114] Lentivirus-delivered nucleases or other mechanisms for gene deletion / modification may be used to lower the overall expression of CCR5 and / or help to lower HIV replication. At least one study has reported having success in treating the disease when lentivirus was administered in patients with a genetic background of CCR5delta32. However, this was only one example of success, and many other patients without the CCR5delta32 genotype have not been treated as successfully. Consequently, there is a substantial need to improve the performance of viral genetic therapy against HIV, both in terms of performance for the individual viral vector construct and for improved use of the vector through a strategy for achieving functional HIV cure.

[0115] For example, some existing therapies rely on zinc finger nucleases to delete a portion of CCR5 in an attempt to render cells resistant to HIV infection. However, even after optimal treatment, only 30% of T cells had been modified by the nuclease at all, and of those that were modified, only 10% of the total CD4 T cell population had been modified in a way that would prevent HIV infection. In contrast, the disclosed methods result in virtually every cell carrying a lentivirus transgene having a reduction in CCR5 expression below the level needed to allow HIV infection. This can result in successful treatment of HIV even without a prior immunization step to increase the number of the initial CD4+ T cell pool.

[0116] For the purposes of the disclosed methods, gene therapy can include, but is not limited to, affinity-enhanced T cell receptors, chimeric antigen receptors on CD4 T cells (or alternatively on CD8 T cells), modification of signal transduction pathways to avoid cell death cause by viral proteins, increased expression of HIV restriction elements including TREX, SAMHD1, MxA or MxB proteins, APOBEC complexes, TRIM5-alpha complexes, tetherin (BST2), and similar proteins identified as being capable of reducing HIV replication in mammalian cells. Immunotherapy

[0117] Historically, vaccines have been a go-to weapon against deadly infectious diseases, including smallpox, polio, measles, and yellow fever. Unfortunately, there is no currently approved vaccine for HIV. The HIV virus has unique ways of evading the immune system, and the human body seems incapable of mounting an effective immune response against it. As a result, scientists do not have a clear picture of what is needed to provide protection against HIV.

[0118] However, immunotherapy may provide a solution that was previously unaddressed by conventional vaccine approaches. Immunotherapy, also called biologic therapy, is a type of treatment designed to boost the body’s natural defenses to fight infections or cancer. It uses materials either made by the body or in a laboratory to improve, target, or restore immune system function.

[0119] In certain aspects of the present disclosure, immunotherapeutic approaches may be used to enrich a population of HIV-specific CD4 T cells for the purpose of increasing the host’s anti-HIV immunity. This is beneficial for both HIV-negative and HIV-positive individuals. In other aspects of the disclosed invention, integrating or non-integrating lentivirus vectors may be used to transduce a host’s immune cells for the purposes of increasing the host’s anti-HIV immunity. In other aspects of the disclosure, a vaccine comprising HIV proteins including but not limited to a killed particle, a virus-like particle, HIV peptides or peptide fragments, a recombinant viral vector, a recombinant bacterial vector, a purified subunit or plasmid DNA combined with a suitable vehicle and / or biological or chemical adjuvants to increase a host’s immune responses may be used to enrich the population of virus-specific T cells or antibodies, and these methods may be further enhanced through the use of HIV-targeted genetic therapy using lentivirus or other viral vector. Methods

[0120] In one aspect, the disclosure provides methods for using viral vectors to achieve a functional cure for HIV disease. The methods may include immunotherapy to enrich the proportion of HIV-specific CD4 T cells, followed by lentivirus transduction to deliver inhibitors of HIV and CCR5 and CXCR4 as required. These methods can be used in association with both HIV-negative and HIV-positive individuals.

[0121] In one embodiment, the methods include a first stimulation event to enrich a proportion of HIV-specific CD4 T cells. The first stimulation can include administration of one or more of any agent suitable for enriching a patient’s HIV-specific CD4+ T cells including but not limited to a vaccine. Importantly, enrichment for HIV-specific CD4 T cells and lentiviral transduction can be effective even without a prior immunization step.

[0122] Therapeutic vaccines can include one or more HIV protein with protein sequences representing the predominant viral types of the geographic region where treatment is occurring. Therapeutic vaccines will include purified proteins, inactivated viruses, virally vectored proteins, bacterially vectored proteins, peptides or peptide fragments, virus-likeparticles (VLPs), biological or chemical adjuvants including cytokines and / or chemokines, vehicles, and methods for immunization. Vaccinations may be administered according to standard methods known in the art and HIV patients may continue antiretroviral therapy during the interval of immunization and subsequent ex vivo lymphocyte culture including lentivirus transduction.

[0123] In certain embodiments, HIV- or HIV+ patients are immunized with an HIV vaccine, increasing the frequency of HIV-specific CD4 T cells by about 2, about 25, about 250, about 500, about 750, about 1000, about 1250, or about 1500-fold (or any amount in between these values). The vaccine may be any clinically utilized or experimental HIV vaccine, including the disclosed lentiviral, other viral vectors or other bacterial vectors used as vaccine delivery systems. In another embodiment, the vectors encode virus-like particles (VLPs) to induce higher titers of neutralizing antibodies and stronger HIV-specific T cell responses. In another embodiment, the vectors encode peptides or peptide fragments associated with HIV including but not limited to gag, pol, and env, tat, rev, nef, vif, vpr, vpu, and tev, as well as LTR, TAR, RRE, PE, SLIP, CRS, and INS. Alternatively, the HIV vaccine used in the disclosed methods may comprise purified proteins, inactivated viruses, virally vectored proteins, bacterially vectored proteins, peptides or peptide fragments, virus-like particles (VLPs), or biological or chemical adjuvants including cytokines and / or chemokines.

[0124] In one embodiment, the methods include ex vivo re-stimulation of CD4 T cells from persons or patients previously immunized by therapeutic vaccination, using purified proteins, inactivated viruses, virally vectored proteins, bacterially vectored proteins, biological or chemical adjuvants including cytokines and / or chemokines, vehicles, and methods for re- stimulation. Ex vivo re-stimulation may be performed using the same vaccine or immune stimulating compound used for in vivo immunization, or it may be performed using a different vaccine or immune stimulating compound than those used for in vivo immunization. Moreover, in some embodiments, the patient does not require prior therapeutic vaccination or re-stimulation of CD4 T cells if the individual has sufficiently high antigen-specific CD4 T cell responses to HIV proteins. In these embodiments, such a patient may only require administration of the disclosed viral vectors to achieve a functional cure.

[0125] In embodiments, peripheral blood mononuclear cells (PBMCs) are obtained by leukapheresis and treated ex vivo to obtain about 1x1010CD4 T cells of which about 0.1%, about 1%, about 5% or about 10% or about 30% are both HIV-specific in terms of antigen responses, and HIV-resistant by virtue of carrying the therapeutic transgene delivered by thedisclosed lentivirus vector. Alternatively, about 1x107, about 1x108, about 1x109, about 1 x1010, about 1x1011, or about 1x1012CD4 T cells may be isolated for re-stimulation. Importantly, any suitable amount of CD4 T cells can be isolated for ex vivo re-stimulation.

[0126] The isolated CD4 T cells can be cultured in appropriate medium throughout re- stimulation with HIV vaccine antigens, which may or may not include antigens present in the prior therapeutic vaccination. Antiretroviral therapeutic drugs including inhibitors of reverse transcriptase, protease or integrase may be added to prevent virus re-emergence during prolonged ex vivo culture. CD4 T cell re-stimulation can be used to enrich the proportion of HIV-specific CD4 T cells in culture. The same procedure may also be used for analytical objectives wherein smaller blood volumes with peripheral blood mononuclear cells obtained by purification, are used to identify HIV-specific T cells and measure the frequency of this sub- population.

[0127] The PBMC fraction may be enriched for HIV-specific CD4 T cells by contacting the cells with HIV proteins matching or complementary to the components of the vaccine previously used for in vivo immunization. Ex vivo re-stimulation can increase the relative frequency of HIV-specific CD4 T cells by about 5, about 10, about 25, about 50, about 75, about 100, about 125, about 150, about 175, or about 200-fold. Ex vivo re-stimulation can increase the relative frequency of HIV-specific CD4 T cells regardless of whether there has been a pre-immunization step.

[0128] The methods detailed herein can include ex vivo re-stimulation of CD4 T cells with ex vivo lentiviral transduction and culturing. The methods detailed herein can also include ex vivo re-stimulation of CD4 T cells with ex vivo lentiviral transduction and culturing without a pre-immunization step. As detailed herein, these methods can be used to vaccinate or provide a prophylactic (i.e., preventative) treatment to HIV-negative individuals.

[0129] Thus, in one embodiment, the re-stimulated PBMC fraction that has been enriched for HIV-specific CD4 T cells can be transduced with therapeutic anti-HIV lentivirus or other vectors and maintained in culture for a sufficient period of time for such transduction, for example from about 1 to about 21 days or up to about 35 days. Alternatively, the cells may be cultured for about 1- about 18 days, about 1- about 15 days, about 1- about 12 days, about 1- about 9 days, or about 3- about 7 days. Thus, the transduced cells may be cultured for about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, or about 35 days.

[0130] Once the transduced cells have been sufficiently cultured, transduced CD4 T cells are infused back into the original patient. Infusion can be performed using various machines and methods known in the art. In some embodiments, infusion may be accompanied by pre-treatment with cyclophosphamide or similar compounds to increase the efficiency of re- engraftment.

[0131] In some embodiments, a CCR5-targeted therapy may be added to a subject’s antiretroviral therapy regimen, which was continued throughout the treatment process. Examples of CCR5-targeted therapies include but are not limited to Maraviroc (a CCR5 antagonist) or Rapamycin (immunosuppressive agent that lowers CCR5). In some embodiments, the antiretroviral therapy may be ceased and the subject can be tested for virus rebound. If no rebound occurs, adjuvant therapy can also be removed and the subject can be tested again for virus rebound.

[0132] Continued virus suppression with reduced or no antiretroviral therapy including cART or HAART, and reduced or no adjuvant therapy for about 26 weeks can be considered a functional cure for HIV. Other definitions of a functional cure are described herein.

[0133] The lentiviral and other vectors used in the disclosed methods may encode at least one, at least two, at least three, at least four, or at least five genes, or at least six genes, or at least seven genes, or at least eight genes, or at least nine genes, or at least ten genes, or at least eleven genes, or at least twelve genes of interest. Given the versatility and therapeutic potential of HIV-targeted gene therapy, a viral vector of the invention may encode genes or nucleic acid sequences that include but are not limited to (i) an antibody directed to an antigen associated with an infectious disease or a toxin produced by the infectious pathogen, (ii) cytokines including interleukins that are required for immune cell growth or function and may be therapeutic for immune dysregulation encountered in HIV and other chronic or acute human viral or bacterial pathogens, (iii) factors that suppress the growth of HIV in vivo including CD8 suppressor factors, (iv) mutations or deletions of chemokine receptor CCR5, mutations or deletions of chemokine receptor CXCR4, or mutations or deletions of chemokine receptor CXCR5, (v) antisense DNA or RNA against specific receptors or peptides associated with HIV or host protein associated with HIV, (vi) small interfering RNA against specific receptors orpeptides associated with HIV or host protein associated with HIV, or (vii) a variety of other therapeutically useful sequences that may be used to treat HIV or AIDS.

[0134] Additional examples of HIV-targeted gene therapy that can be used in the disclosed methods include, but are not limited to, affinity-enhanced T cell receptors, chimeric antigen receptors on CD4 T cells (or alternatively on CD8 T cells), modification of signal transduction pathways to avoid cell death cause by viral proteins, increased expression of HIV restriction elements including TREX, SAMHD1, MxA or MxB proteins, APOBEC complexes, TRIM5-alpha complexes, tetherin (BST2), and similar proteins identified as being capable of reducing HIV replication in mammalian cells.

[0135] In some embodiments, a patient may be undergoing cART or HAART concurrently while being treated according to the methods of the invention. In other embodiments, a patient may undergo cART or HAART before or after being treated according to the methods of the invention. In some embodiments, cART or HAART is maintained throughout treatment according to the methods of the invention and the patient may be monitored for HIV viral burden in blood and frequency of lentivirus-transduced CD4 T cells in blood. Preferably, a patient receiving cART or HAART prior to being treated according to the methods of the invention is able to discontinue or reduce cART or HAART following treatment according to the methods of the invention. In other embodiments, the patient is HIV- negative and has not yet encountered the HIV-virus.

[0136] For the purpose of assessing efficacy, the frequency of transduced, HIV-specific CD4 T cells, which is a novel surrogate marker for gene therapy effects, may be determined, as discussed in more detail herein. Compositions

[0137] In one aspect, the disclosed invention provides lentiviral vectors capable of delivering genetic constructs to inhibit HIV penetration of susceptible cells. For instance, one mechanism of action is to reduce mRNA levels for CCR5 and / or CXCR4 chemokine receptors and thus reduce the rates for viral entry into susceptible cells.

[0138] Alternatively, the disclosed lentiviral vectors may be capable of inhibiting the formation of HIV-infected cells by reducing the stability of incoming HIV genomic RNA. And in yet another embodiment, the disclosed lentivirus vectors are capable of preventing HIV production from a latently infected cell, wherein the mechanism of action is to cause instabilityof viral RNA sequences through the action of inhibitory RNA including short-homology, small-interfering or other regulatory RNA species.

[0139] The therapeutic lentiviruses disclosed in this application generally comprise at least one of two types of genetic cargo. First, the lentiviruses may encode genetic elements that direct expression of small RNA capable of inhibiting the production of chemokine receptors CCR5 and / or CXCR4 that are important for HIV penetration of susceptible cells. The second type of genetic cargo includes constructs capable of expressing small RNA molecules targeting HIV RNA sequences for the purpose of preventing reverse transcription, RNA splicing, RNA translation to produce proteins, or packaging of viral genomic RNA for particle production and spreading infection. An exemplary structure is diagrammed in Figure 3.

[0140] As shown in Figure 3 (top panel), an exemplary construct may comprise numerous sections or components. For example, in one embodiment, an exemplary LV construct may comprise the following sections or components: ° RSV - a Rous Sarcoma virus long terminal repeat; ° 5’LTR - a portion of an HIV long terminal repeat that can be truncated to prevent replication of the vector after chromosomal integration; ° Psi - a packaging signal that allows for incorporation of the vector RNA genome into viral particles during packaging; ° RRE - a Rev Responsive element can be added to improve expression from the transgene by mobilizing RNA out of the nucleus and into the cytoplasm of cells; ° cPPT - a Poly purine tract that facilitates second strand DNA synthesis prior to integration of the transgene into the host cell chromosome; ° Promoter - a promoter initiates RNA transcription from the integrated transgene to express micro-RNA clusters (or other genetic elements of the construct), and in some embodiments, the vectors may use an EF-1 promoter; ° Anti-CCR5 - a micro RNA targeting messenger RNA for the host cell factor CCR5 to reduce its expression on the cell surface; ° Anti-Rev / Tat - a micro RNA targeting HIV genomic or messenger RNA at the junction between HIV Rev and Tat coding regions, which is sometimes designated miRNA Tat or given a similar description in this application; ° Anti-Vif - a micro RNA targeting HIV genomic or messenger RNA within the Vif coding region;° WPRE - a woodchuck hepatitis virus post-transcriptional regulatory element is an additional vector component that can be used to facilitate RNA transport of the nucleus; and ° deltaU33’LTR - a modified version of a HIV 3’ long terminal repeat where a portion of the U3 region has been deleted to improve safety of the vector.

[0141] One of ordinary skill in the art will recognize that the above components are merely examples, and that such components may be reorganized, substituted with other elements, or otherwise changed, including but not limited to making nucleotide substitutions, deletions, additions, or mutations, so long as the construct is able to prevent expression of HIV genes and decrease the spread of infection.

[0142] Vectors of the invention may include either or both of the types of genetic cargo discussed above (i.e., genetic elements that direct expression of a gene or small RNAs, such as siRNA, shRNA, or miRNA that can prevent translation or transcription), and the vectors of the invention may also encode additionally useful products for the purpose of treatment or diagnosis of HIV. For instance, in some embodiments, these vectors may also encode green fluorescent protein (GFP) for the purpose of tracking the vectors or antibiotic resistance genes for the purposes of selectively maintaining genetically-modified cells in vivo.

[0143] The combination of genetic elements incorporated into the disclosed vectors is not particularly limited. For example, a vector may encode a single small RNA, two small RNAs, three small RNA, four small RNAs, five small RNAs, six small RNAs, seven small RNAs, eight small RNAs, nine small RNAs, or ten small RNAs, or eleven small RNAs, or twelve small RNAs. Such vectors may additionally encode other genetic elements to function in concert with the small RNAs to prevent expression and infection of HIV.

[0144] Those of skill in the art will understand that the therapeutic lentivirus may substitute alternate sequences for the promoter region, targeting of regulatory RNA, and types of regulatory RNA. Further, the therapeutic lentivirus of the disclosure may comprise changes in the plasmids used for packaging the lentivirus particles; these changes are required to increase levels of production in vitro. Lentiviral Vector System

[0145] A lentiviral virion (particle) in accordance with various aspects and embodiments herein is expressed by a vector system encoding the necessary viral proteins to produce a virion (viral particle). There is at least one vector containing a nucleic acid sequenceencoding the lentiviral pol proteins necessary for reverse transcription and integration, operably linked to a promoter. In another embodiment, the pol proteins are expressed by multiple vectors. There is also a vector containing a nucleic acid sequence encoding the lentiviral gag proteins necessary for forming a viral capsid operably linked to a promoter. In an embodiment, this gag nucleic acid sequence is on a separate vector than at least some of the pol nucleic acid sequence. In another embodiment, the gag nucleic acid is on a separate vector from all the pol nucleic acid sequences that encode pol proteins.

[0146] Numerous modifications can be made to the vectors, which are used to create the particles to further minimize the chance of obtaining wild type revertants. These include, but are not limited to, deletions of the U3 region of the LTR, tat deletions and matrix (MA) deletions.

[0147] The gag, pol and env vector(s) do not contain nucleotides from the lentiviral genome that package lentiviral RNA, referred to as the lentiviral packaging sequence.

[0148] The vector(s) forming the particle preferably do not contain a nucleic acid sequence from the lentiviral genome that expresses an envelope protein. Preferably, a separate vector that contains a nucleic acid sequence encoding an envelope protein operably linked to a promoter is used. This env vector also does not contain a lentiviral packaging sequence. In one embodiment the env nucleic acid sequence encodes a lentiviral envelope protein.

[0149] In another embodiment the envelope protein is not from the lentivirus, but from a different virus. The resultant particle is referred to as a pseudotyped particle. By appropriate selection of envelopes one can "infect" virtxally any cell. For example, one can use an env gene that encodes an envelope protein that targets an endocytic compartment such as that of the influenza virus, VSV-G, alpha viruses (Semliki forest virus, Sindbis virus), arenaviruses (lymphocytic choriomeningitis virus), flaviviruses (tick-borne encephalitis virus, Dengue virus, hepatitis C virus, GB virus), rhabdoviruses (vesicular stomatitis virus, rabies virus), paramyxoviruses (mumps or measles) and orthomyxoviruses (influenza virus). Other envelopes that can preferably be used include those from Moloney Leukemia Virus such as MLV-E, MLV- A and GALV. These latter envelopes are particularly preferred where the host cell is a primary cell. Other envelope proteins can be selected depending upon the desired host cell. For example, targeting specific receptors such as a dopamine receptor can be used for brain delivery. Another target can be vascular endothelium. These cells can be targeted using a filovirus envelope. For example, the GP of Ebola, which by post-transcriptional modificationbecome the GP, and GP2glycoproteins. In another embodiment, one can use different lentiviral capsids with a pseudotyped envelope. For example, FIV or SHIV (U.S. Patent No.5,654,195). A SHIV pseudotyped vector can readily be used in animal models such as monkeys.

[0150] As detailed herein, a lentiviral vector system typically includes at least one helper plasmid comprising at least one of a gag, pol, or rev gene. Each of the gag, pol and rev genes may be provided on individual plasmids, or one or more genes may be provided together on the same plasmid. In one embodiment, the gag, pol, and rev genes are provided on the same plasmid (e.g., Figure 4). In another embodiment, the gag and pol genes are provided on a first plasmid and the rev gene is provided on a second plasmid (e.g., Figure 5). Accordingly, both 3-vector and 4-vector systems can be used to produce a lentivirus as described in the Examples section and elsewhere herein. The therapeutic vector, the envelope plasmid and at least one helper plasmid are transfected into a packaging cell line. A non-limiting example of a packaging cell line is the 293T / 17 HEK cell line. When the therapeutic vector, the envelope plasmid, and at least one helper plasmid are transfected into the packaging cell line, a lentiviral particle is ultimately produced.

[0151] In another aspect, a lentiviral vector system for expressing a lentiviral particle is disclosed. The system includes a lentiviral vector as described herein; an envelope plasmid for expressing an envelope protein optimized for infecting a cell; and at least one helper plasmid for expressing gag, pol, and rev genes, wherein when the lentiviral vector, the envelope plasmid, and the at least one helper plasmid are transfected into a packaging cell line, a lentiviral particle is produced by the packaging cell line, wherein the lentiviral particle is capable of inhibiting production of chemokine receptor CCR5 or targeting an HIV RNA sequence.

[0152] In another aspect, and as detailed herein, the lentiviral vector, which is also referred to herein as a therapeutic vector, can include the following elements: hybrid 5’ long terminal repeat (RSV / 5’ LTR) (SEQ ID NOS: 43-44), Psi sequence (RNA packaging site) (SEQ ID NO: 45), RRE (Rev-response element) (SEQ ID NO: 46), cPPT (polypurine tract) (SEQ ID NO: 47), EF-1α promoter (SEQ ID NO:41), small RNAs capable of targeting CCR5, Vif and Tat , Woodchuck Post-Transcriptional Regulatory Element (WPRE) (SEQ ID NOS: 42 or 89), and ΔU33’ LTR (SEQ ID NO: 48). In another aspect, sequence variation, by way of substitution, deletion, or addition can be used to modify the above-referenced sequences.

[0153] In another aspect, and as detailed herein, a helper plasmid has been designed to include the following elements: CAG promoter (SEQ ID NO: 50); HIV component gag (SEQ ID NO: 52); HIV component pol (SEQ ID NO: 53); HIV Int (SEQ ID NO: 54); HIV RRE (SEQ ID NO: 55); and HIV Rev (SEQ ID NO: 56). In another aspect, the helper plasmid may be modified to include a first helper plasmid for expressing the gag and pol genes, and a second and separate plasmid for expressing the rev gene. In another aspect, sequence variation, by way of substitution, deletion, or addition can be used to modify the above-referenced sequences.

[0154] In another aspect, and as detailed herein, an envelope plasmid has been designed to include the following elements being from left to right: RNA polymerase II promoter (CMV) (SEQ ID NO: 69) and vesicular stomatitis virus G glycoprotein (VSV-G) (SEQ ID NO: 71). In another aspect, sequence variation, by way of substitution, deletion, or addition can be used to modify the above-referenced sequences.

[0155] In another aspect, the plasmids used for lentiviral packaging can be modified with similar elements and the intron sequences could potentially be removed without loss of vector function. For example, the following elements can replace similar elements in the plasmids that comprise the packaging system: Elongation Factor-1 (EF-1), phosphoglycerate kinase (PGK), and ubiquitin C (UbC) promoters can replace the CMV or CAG promoter. SV40 poly A and bGH poly A can replace the rabbit beta globin poly A. The HIV sequences in the helper plasmid can be constructed from different HIV strains or clades. The VSV-G glycoprotein can be substituted with membrane glycoproteins from feline endogenous virus (RD114), gibbon ape leukemia virus (GALV), Rabies (FUG), lymphocytic choriomeningitis virus (LCMV), influenza A fowl plague virus (FPV), Ross River alphavirus (RRV), murine leukemia virus 10A1 (MLV), or Ebola virus (EboV).

[0156] Of note, lentiviral packaging systems can be acquired commercially (e.g., Lenti- vpak packaging kit from OriGene Technologies, Inc., Rockville, MD), and can also be designed as described herein. Moreover, it is within the skill of a person skilled in the art to substitute or modify aspects of a lentiviral packaging system to improve any number of relevant factors, including the production efficiency of a lentiviral particle. Bioassays

[0157] In one aspect, the present invention includes bioassays for determining the success of HIV treatment for achieving a functional cure. These assays will provide a method for measuring the efficacy of the disclosed methods by measuring the frequency of transduced,HIV specific CD4 T cells in a patient. HIV-specific CD4 T cells are recognizable because, among others, they proliferate, change the composition of cell surface markers, induce signaling pathways including phosphorylation, and / or express specific marker proteins that may be cytokines, chemokines, caspases, phosphorylated signaling molecules or other cytoplasmic and / or nuclear components. Specific responding CD4 T cells are recognized for example, using labeled monoclonal antibodies or specific in situ amplification of mRNA sequences, that allow sorting of HIV-specific cells using flow cytometry sorting, magnetic bead separation or other recognized methods for antigen-specific CD4 T cell isolation. The isolated CD4 T cells are tested to determine the frequency of cells carrying integrated therapeutic lentivirus. Single cell testing methods may also be used including microfluidic separation of individual cells that are coupled with mass spectrometry, PCR, ELISA or antibody staining to confirm responsiveness to HIV and presence of integrated therapeutic lentivirus.

[0158] Thus, in certain embodiments, following application of a treatment according to the invention (e.g., (a) immunization or no immunization, (b) ex vivo lymphocyte culture; (c) re-stimulation with purified proteins, inactivated viruses, virally vectored proteins, bacterially vectored proteins, biological or chemical adjuvants including cytokines and / or chemokines, vehicles; and (d) infusion of the enriched, transduced T cells), a patient may be subsequently assayed to determine the efficacy of the treatment. A threshold value of target T cells in the cell product for infusion may be established to measure a functional cure at a determined value, for example, at about 1x108HIV-specific CD4 T cells bearing genetic modification from therapeutic lentivirus. Alternatively, the threshold value may be about 1x105, about 1x106, about 1x107, about 1x108, about 1x109, or about 1x1010CD4 T cells in the body of the patient.

[0159] HIV-specific CD4 T cells bearing genetic modification from therapeutic lentivirus can be determined using any suitable method, such as but not limited to flow cytometry, cell sorting, FACS analysis, DNA cloning, PCR, RT-PCR or Q-PCR, ELISA, FISH, western blotting, southern blotting, high throughput sequencing, RNA sequencing, oligonucleotide primer extension, or other methods known in the art. Doses and Dosage Forms

[0160] The disclosed methods and compositions can be used for treating HIV+ patients during various stages of their disease. Accordingly, dosing regimens may vary based upon the condition of the patient and the method of administration.

[0161] In various embodiments, HIV-specific vaccines for the initial in vivo immunization may be administered to a subject in need in varying doses. In general, vaccines delivered by intramuscular injection include about 10 µg to about 300 µg, about 25 µg to about 275 µg, about 50 µg to about 250 µg, about 75 µg to about 225, or about 100 µg to about 200 µg of HIV protein, either total virus protein prepared from inactivated virus particles, virus- like particles or purified virus protein from recombinant systems or purified from virus preparations. Recombinant viral or bacterial vectors may be administered by any and all of the routes described. Intramuscular vaccines will include about 1 µg to about 100 µg, about 10 µg to about 90 µg, about 20 µg to about 80 µg, about 30 µg to about 70 µg, about 40 µg to about 60 µg, or about 50 µg of suitable adjuvant molecules and be suspended in oil, saline, buffer or water in volumes of 0.1 to 5 ml per injection dose, and may be soluble or emulsion preparations. Vaccines delivered orally, rectally, buccally, at genital mucosal or intranasally, including some virally-vectored or bacterially-vectored vaccines, fusion proteins, liposome formulations or similar preparations, may contain higher amounts of virus protein and adjuvant. Dermal, sub- dermal or subcutaneous vaccines utilize protein and adjuvant amounts more similar to oral, rectal or intranasal-delivered vaccines. Depending on responses to the initial immunization, vaccination may be repeated 1-5 times using the same or alternate routes for delivery. Intervals may be of 2-24 weeks between immunizations. Immune responses to vaccination are measured by testing HIV-specific antibodies in serum, plasma, vaginal secretions, rectal secretions, saliva or bronchoalveolar lavage fluids, using ELISA or similar methodology. Cellular immune responses are tested by in vitro stimulation with vaccine antigens followed by staining for intracellular cytokine accumulation followed by flow cytometry or similar methods including lymphoproliferation, expression of phosphorylated signaling proteins or changes in cell surface activation markers. Upper limits of dosing may be determined based on the individual patient and will depend on toxicity / safety profiles for each individual product or product lot.

[0162] Immunization may occur once, twice, three times, or repeatedly. For instance, an agent for HIV immunization may be administered to a subject in need once a week, once every other week, once every three weeks, once a month, every other month, every three months, every six months, every nine months, once a year, every eighteen months, every two years, every 36 months, or every three years.

[0163] Immunization will generally occur at least once before ex vivo expansion and enrichment of CD4 T cells, and immunization may occur once, twice, three times, or more after ex vivo lymphocyte culture / re-stimulation and infusion.

[0164] In one embodiment, HIV-vaccines for immunization are administered as a pharmaceutical composition. In one embodiment, the pharmaceutical composition comprising an HIV vaccine can be formulated in a wide variety of nasal, pulmonary, oral, topical, or parenteral dosage forms for clinical application. Each of the dosage forms can comprise various disintegrating agents, surfactants, fillers, thickeners, binders, diluents such as wetting agents or other pharmaceutically acceptable excipients. The pharmaceutical composition comprising an HIV vaccine can also be formulated for injection.

[0165] HIV vaccine compositions for the purpose of immunization can be administered using any pharmaceutically acceptable method, such as intranasal, buccal, sublingual, oral, rectal, ocular, parenteral (intravenously, intradermally, intramuscularly, subcutaneously, intracisternally, intraperitoneally), pulmonary, intravaginal, locally administered, topically administered, topically administered after scarification, mucosally administered, via an aerosol, or via a buccal or nasal spray formulation.

[0166] Further, the HIV vaccine compositions can be formulated into any pharmaceutically acceptable dosage form, such as a solid dosage form, tablet, pill, lozenge, capsule, liquid dispersion, gel, aerosol, pulmonary aerosol, nasal aerosol, ointment, cream, semi-solid dosage form, and a suspension. Further, the composition may be a controlled release formulation, sustained release formulation, immediate release formulation, or any combination thereof. Further, the composition may be a transdermal delivery system.

[0167] In another embodiment, the pharmaceutical composition comprising an HIV vaccine may be formulated in a solid dosage form for oral administration, and the solid dosage form can be powders, granules, capsules, tablets or pills. In yet another embodiment, the solid dosage form may include one or more excipients such as calcium carbonate, starch, sucrose, lactose, microcrystalline cellulose or gelatin. In addition, the solid dosage form can include, in addition to the excipients, a lubricant such as talc or magnesium stearate. In some embodiments, the oral dosage form may be immediate release or a modified release form. Modified release dosage forms include controlled or extended release, enteric release, and the like. The excipients used in the modified release dosage forms are commonly known to a person of ordinary skill in the art.

[0168] In a further embodiment, the pharmaceutical composition comprising a HIV vaccine may be formulated as a sublingual or buccal dosage form. Such dosage forms comprisesublingual tablets or solution compositions that are administered under the tongue and buccal tablets that are placed between the cheek and gum.

[0169] In yet a further embodiment, the pharmaceutical composition comprising an HIV vaccine may be formulated as a nasal dosage form. Such dosage forms of the present invention comprise solution, suspension, and gel compositions for nasal delivery.

[0170] In one embodiment, the pharmaceutical composition may be formulated in a liquid dosage form for oral administration, such as suspensions, emulsions or syrups. In other embodiments, the liquid dosage form can include, in addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as humectants, sweeteners, aromatics or preservatives. In particular embodiments, the composition comprising HIV vaccine or a pharmaceutically acceptable salt thereof may be formulated to be suitable for administration to a pediatric patient.

[0171] In one embodiment, the pharmaceutical composition may be formulated in a dosage form for parenteral administration, such as sterile aqueous solutions, suspensions, emulsions, non-aqueous solutions or suppositories. In other embodiments, the non-aqueous solutions or suspensions may include propyleneglycol, polyethyleneglycol, vegetable oils such as olive oil or injectable esters such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao oil, laurin oil or glycerinated gelatin can be used.

[0172] The dosage of the pharmaceutical composition can vary depending on the patient's weight, age, gender, administration time and mode, excretion rate, and the severity of disease.

[0173] For the purposes of re-stimulation, lymphocytes, PBMC, and / or CD4 T cells are removed from a patient and isolated for stimulation and culturing. The isolated cells may be contacted with the same HIV vaccine or activating agent used for immunization or a different HIV vaccine or activating agent. In one embodiment, the isolated cells are contacted with about 10 ng to 5 µg of an HIV vaccine or activating agent per about 106cells in culture (or any other suitable amount). More specifically, the isolated cells may be contacted with about 50 ng, about 100 ng, about 200 ng, about 300 ng, about 400 ng, about 500 ng, about 600 ng, about 700 ng, about 800 ng, about 900 ng, about 1 µg, about 1.5 µg, about 2 µg, about 2.5 µg, about 3 µg, about 3.5 µg, about 4 µg, about 4.5 µg, or about 5 µg of an HIV vaccine or activating agent per about 106cells in culture.

[0174] Activating agents or vaccines are generally used once for each in vitro cell culture but may be repeated after intervals of about 15 to about 35 days. For example, a repeat dosing could occur at about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, or about 35 days.

[0175] For transduction of the enriched, re-stimulated cells, the cells may be transduced with lentiviral vectors or with other known vector systems as disclosed herein. The cells being transduced may be contacted with about 1-1,000 viral genomes (measured by RT-PCR assay of culture fluids containing lentivirus vector) per target cell in culture (or any other suitable amount). Lentivirus transduction may be repeated 1-5 times using the same range of 1-1,000 viral genomes per target cell in culture. Cellular Enrichment

[0176] In one approach, cells such as T cells may be obtained from an HIV infected patient and cultured in multi-well plates in a culture medium comprising conditioned media (“CM”). The levels of supernatant p24gag(“p24”) and viral RNA levels may be assessed by standard means. Those patients whose CM-cultured cells have peak p24 supernatant levels of less than 1 ng / ml may be suitable patients for large-scale T-cell expansion in CM with or without the use of additional anti-viral agents. Additionally, different drugs or drug combinations of interest may be added to different wells and the impact on virus levels in the sample may be assessed by standard means. Those drug combinations providing adequate viral suppression are therapeutically useful combinations. It is within the capacity of a competent technician to determine what constitutes adequate viral suppression in relation to a particular subject. In order to test the effectiveness of drugs of interest in limiting viral expansion, additional factors such as anti-CD3 antibodies may be added to the culture to stimulate viral production. Unlike culture methods for HIV infected cell samples known in the art, CM allows the culture of T cells for periods of over two months, thereby providing an effective system in which to assay long term drug effectiveness.

[0177] This approach allows the inhibition of gene expression driven by the HIV LTR promoter region in a cell population by the culture of cells in a medium comprising the CM. Culture in CM4 likely inhibits HIV LTR driven gene expression by altering one or more interactions between transcription mediating proteins and HIV gene expression regulatory elements. Transcription-mediating proteins of interest include host cell encoded proteins suchas AP-1, NFkappaB, NF-AT, IRF, LEF-1 and Sp1, and the HIV encoded protein Tat. HIV gene expression regulatory elements of interest include binding sites for AP-1, NFkappaB, NF-AT, IRF, LEF-1 and Sp1, as well as the transacting responsive element (“TAR”) which interacts with Tat.

[0178] In a preferred embodiment, the HIV infected cells are obtained from a subject with susceptible transcription mediating protein sequences and susceptible HIV regulatory element sequences. In a more preferred embodiment, the HIV infected cells are obtained from a subject having wild-type transcription-mediating protein sequences and wild-type HIV regulatory sequences.

[0179] Another method of enriching T cells utilizes immunoaffinity-based selection. This approach may involve the simultaneous enrichment or selection of a first and second population of cells, such as a CD4+ and CD8+ cell population. Cells containing primary human T cells are contacted with a first immunoaffinity reagent that specifically binds to CD4 and a second immunoaffinity reagent that specifically binds to CD8 in an incubation composition, under conditions whereby the immunoaffinity reagents specifically bind to CD4 and CD8 molecules, respectively, on the surface of cells in the sample. Cells bound to the first and / or the second immunoaffinity reagent are recovered, thereby generating an enriched composition comprising CD4+ cells and CD8+ cells. This approach may include incubation of the composition with a concentration of the first and / or second immunoaffinity reagent that is at a sub-optimal yield concentration. Notably, in some embodiments, transduced cells are a mixed T cell population, and in other embodiments transduced cells are not a mixed T cell population.

[0180] In some embodiments, immunoaffinity-based selection is used where the solid support is a sphere, such as a bead, such as a microbead or nanobead. In other embodiments, the bead can be a magnetic bead. In another embodiment, the antibody contains one or more binding partners capable of forming a reversible bond with a binding reagent immobilized on the solid surface, such as a sphere or chromatography matrix, wherein the antibody is reversibly mobilized to the solid surface. In some embodiments, cells expressing a cell surface marker bound by the antibody on said solid surface are capable of being recovered from the matrix by disruption of the reversible binding between the binding reagent and binding partner. In some embodiments, the binding reagent is streptavidin or is a streptavidin analog or mutant.

[0181] Stable transduction of primary cells of the hematopoietic system and / or hematopoietic stem cells may be obtained by contacting, in vitro or ex vivo, the surface of thecells with both a lentiviral vector and at least one molecule which binds the cell surface. The cells may be cultured in a ventilated vessel comprising two or more layers under conditions conducive to growth and / or proliferation. In some embodiments, this approach may be used in conjunction with non-CD4+ T cell depletion and / or broad polyclonal expansion.

[0182] In another approach to T cell enrichment, PBMC are stimulated with a peptide and enriched for cells secreting a cytokine, such as interferon-gamma. This approach generally involves stimulating a mixture of cells containing T cells with antigen, and effecting a separation of antigen-stimulated cells according to the degree to which they are labeled with the product. Antigen stimulation is achieved by exposing the cells to at least one antigen under conditions effective to elicit antigen-specific stimulation of at least one T cell. Labeling with the product is achieved by modifying the surface of the cells to contain at least one capture moiety, culturing the cells under conditions in which the product is secreted, released and specifically bound (“captured” or “entrapped”) to said capture moiety; and labeling the captured product with a label moiety, where the labeled cells are not lysed as part of the labeling procedure or as part of the separation procedure. The capture moiety may incorporate detection of cell surface glycoproteins CD3 or CD4 to refine the enrichment step and increase the proportion of antigen-specific T cells in general, of CD4+ T cells in specific. Examples Example 1: Development of a Lentiviral Vector System

[0183] A lentiviral vector system was developed as summarized in Figure 3 (linear form). A representative therapeutic vector has been designed and produced with the following elements being from left to right: hybrid 5’ long terminal repeat (RSV / 5’ LTR) (SEQ ID NOS: 43-44), Psi sequence (RNA packaging site) (SEQ ID NO: 45), RRE (Rev-response element) (SEQ ID NO: 46), cPPT (polypurine tract) (SEQ ID NO: 47), EF-1α promoter (SEQ ID NO:41), miR30CCR5, miR21Vif, miR185Tat, Woodchuck Post-Transcriptional Regulatory Element (WPRE) (SEQ ID NOS: 42 or 89), and ΔU33’ LTR (SEQ ID NO: 48).

[0184] Referring next to the middle portion of Figure 3, a helper plasmid has been designed and produced with the following elements being from left to right: CAG promoter (SEQ ID NO: 50); HIV component gag (SEQ ID NO: 52); HIV component pol (SEQ ID NO: 53); HIV Int (SEQ ID NO: 54); HIV RRE (SEQ ID NO: 55); and HIV Rev (SEQ ID NO: 56).

[0185] Referring next to the lower portion of Figure 3, an envelope plasmid has been designed and produced with the following elements being from left to right: RNA polymeraseII promoter (CMV) (SEQ ID NO: 69) and vesicular stomatitis virus G glycoprotein (VSV-G) (SEQ ID NO: 71).

[0186] Lentiviral particles were produced in 293T / 17 HEK cells (purchased from American Type Culture Collection, Manassas, VA) following transfection with the therapeutic vector, the envelope plasmid, and the helper plasmid (as shown in Figure 3). The transfection of 293T / 17 HEK cells, which produced functional viral particles, employed the reagent Poly(ethylenimine) (PEI) to increase the efficiency of plasmid DNA uptake. The plasmids and DNA were initially added separately in culture medium without serum in a ratio of 3:1 (mass ratio of PEI to DNA). After 2-3 days, cell medium was collected and lentiviral particles were purified by high-speed centrifugation and / or filtration followed by anion-exchange chromatography. The concentration of lentiviral particles can be expressed in terms of transducing units / ml (TU / ml). The determination of TU was accomplished by measuring HIV p24 levels in culture fluids (p24 protein is incorporated into lentiviral particles), measuring the number of viral DNA copies per cell by quantitative PCR, or by infecting cells and using light (if the vectors encode luciferase or fluorescent protein markers).

[0187] As mentioned above, a 3-vector system (i.e., a 2-vector lentiviral packaging system) was designed for the production of lentiviral particles. Briefly, the Helper plus Rev plasmid includes a CAG enhancer (SEQ ID NO: 49); a CAG promoter (SEQ ID NO: 50); a chicken beta actin intron (SEQ ID NO: 51); a HIV gag (SEQ ID NO: 52); a HIV Pol (SEQ ID NO: 53); a HIV Int (SEQ ID NO: 54); a HIV RRE (SEQ ID NO: 55); a HIV Rev (SEQ ID NO: 56); and a rabbit beta globin poly A (SEQ ID NO: 57). The Envelope plasmid includes a CMV promoter (SEQ ID NO: 69); a beta globin intron (SEQ ID NO: 70); a VSV-G (SEQ ID NO: 71); and a rabbit beta globin poly A (SEQ ID NO: 72). Synthesis of a 2-vector lentiviral packaging system including Helper (plus Rev) and Envelope plasmids. Materials and Methods:

[0188] Construction of the helper plasmid: The helper plasmid was constructed by initial PCR amplification of a DNA fragment from the pNL4-3 HIV plasmid (NIH Aids Reagent Program) containing Gag, Pol, and Integrase genes. Primers were designed to amplify the fragment with EcoRI and NotI restriction sites which could be used to insert at the same sites in the pCDNA3 plasmid (Invitrogen). The forward primer was (5’-TAAGCAGAATTC ATGAATTTGCCAGGAAGAT-3’) (SEQ ID NO: 90) and reverse primer was (5’-. Thesequence for the Gag, Pol, Integrase fragment was as follows:

[0189] Next, a DNA fragment containing the Rev, RRE, and rabbit beta globin poly A sequence with XbaI and XmaI flanking restriction sites was synthesized by MWG Operon. The DNA fragment was then inserted into the plasmid at the XbaI and XmaI restriction sites The DNA sequence was as follows: T C C C G G C T CNO: 93)

[0190] Finally, the CMV promoter of pCDNA3.1 was replaced with the CAG enhancer / promoter plus a chicken beta actin intron sequence. A DNA fragment containing the CAG enhancer / promoter / intron sequence with MluI and EcoRI flanking restriction sites was synthesized by MWG Operon. The DNA fragment was then inserted into the plasmid at the MluI and EcoRI restriction sites. The DNA sequence was as follows: A A A A G G T( Q ) Construction of the VSV-G Envelope plasmid:

[0191] The vesicular stomatitis Indiana virus glycoprotein (VSV-G) sequence was synthesized by MWG Operon with flanking EcoRI restriction sites. The DNA fragment was then inserted into the pCDNA3.1 plasmid (Invitrogen) at the EcoRI restriction site and the correct orientation was determined by sequencing using a CMV specific primer. The DNA sequence was as follows:ID NO: 95)

[0192] A 4-vector system (i.e., a 3-vector lentiviral packaging system) has also been designed and produced using the methods and materials described herein. A helper plasmid, in this case, does not include Rev. There is a separate Rev plasmid in this case. Briefly, the Helper plasmid includes a CAG enhancer (SEQ ID NO: 58); a CAG promoter (SEQ ID NO: 59); a chicken beta actin intron (SEQ ID NO: 60); a HIV gag (SEQ ID NO: 61); a HIV Pol (SEQ ID NO: 62); a HIV Int (SEQ ID NO: 63); a HIV RRE (SEQ ID NO: 64); and a rabbit beta globin poly A (SEQ ID NO: 65). The Rev plasmid includes a RSV promoter (SEQ ID NO: 66); a HIV Rev (SEQ ID NO: 67); and a rabbit beta globin poly A (SEQ ID NO: 68). TheEnvelope plasmid includes a CMV promoter (SEQ ID NO: 69); a beta globin intron (SEQ ID NO: 70); a VSV-G (SEQ ID NO: 71); and a rabbit beta globin poly A (SEQ ID NO: 72). Synthesis of a 3-vector lentiviral packaging system including Helper, Rev, and Envelope plasmids. Materials and Methods: Construction of the Helper plasmid without Rev:

[0193] The Helper plasmid without Rev was constructed by inserting a DNA fragment containing the RRE and rabbit beta globin poly A sequence. This sequence was synthesized by MWG Operon with flanking XbaI and XmaI restriction sites. The RRE / rabbit poly A beta globin sequence was then inserted into the Helper plasmid at the XbaI and XmaI restriction sites. The DNA sequence is as follows:TTATCACCCGGG (SEQ ID NO: 96) Construction of the Rev plasmid:

[0194] The RSV promoter and HIV Rev sequence was synthesized as a single DNA fragment by MWG Operon with flanking MfeI and XbaI restriction sites. The DNA fragment was then inserted into the pCDNA3.1 plasmid (Invitrogen) at the MfeI and XbaI restriction sites in which the CMV promoter is replaced with the RSV promoter. The DNA sequence was as follows: C A T G G A G A C A A G G G G G G

[0195] The plasmids for the 2-vector and 3-vector packaging systems could be modified with similar elements and the intron sequences could potentially be removed without loss of vector function. For example, the following elements could replace similar elements in the 2-vector and 3-vector packaging system:

[0196] Promoters: Elongation Factor-1 (EF-1) (SEQ ID NO: 73), phosphoglycerate kinase (PGK) (SEQ ID NO: 74), and ubiquitin C (UbC) (SEQ ID NO: 75) can replace the CMV (SEQ ID NO: 69) or CAG promoter (SEQ ID NO: 98).

[0197] Poly A sequences: SV40 poly A (SEQ ID NO: 76) and bGH poly A (SEQ ID NO: 77) can replace the rabbit beta globin poly A (SEQ ID NO: 57).

[0198] HIV Gag, Pol, and Integrase sequences: The HIV sequences in the Helper plasmid can be constructed from different HIV strains or clades. For example, HIV Gag (SEQ ID NO: 78); HIV Pol (SEQ ID NO: 79); and HIV Int (SEQ ID NO: 80) from the Bal strain can be interchanged with the gag, pol, and int sequences contained in the helper / helper plus Rev plasmids as outlined herein.

[0199] Envelope: The VSV-G glycoprotein can be substituted with membrane glycoproteins from feline endogenous virus (RD114) (SEQ ID NO: 81), gibbon ape leukemia virus (GALV) (SEQ ID NO: 82), Rabies (FUG) (SEQ ID NO: 83), lymphocytic choriomeningitis virus (LCMV) (SEQ ID NO: 84), influenza A fowl plague virus (FPV) (SEQ ID NO: 85), Ross River alphavirus (RRV) (SEQ ID NO: 86), murine leukemia virus 10A1 (MLV) (SEQ ID NO: 87), or Ebola virus (EboV) (SEQ ID NO: 88). Sequences for these envelopes are identified in the sequence portion herein.

[0200] In summary, the 3-vector versus 4-vector systems can be compared and contrasted, in part, as follows. The 3-vector lentiviral vector system contains: 1. Helper plasmid: HIV Gag, Pol, Integrase, and Rev / Tat; 2. Envelope plasmid: VSV-G / FUG envelope; and 3. Therapeutic vector: RSV 5’LTR, Psi Packaging Signal, Gag fragment, RRE, Env fragment, cPPT, WPRE, and 3’delta LTR. The 4-vector lentiviral vector system contains: 1. Helper plasmid: HIV Gag, Pol, and Integrase; 2. Rev plasmid: Rev; 3. Envelope plasmid: VSV-G / FUG envelope; and 4. Therapeutic vector: RSV 5’LTR, Psi Packaging Signal, Gag fragment, RRE, Env fragment, cPPT, WPRE, and 3’delta LTR. Sequences corresponding with the above elements are identified in the sequence listings portion herein. Example 2: Development of an Anti-HIV Lentivirus Vector

[0201] The purpose of this example was to develop an anti-HIV lentivirus vector.

[0202] Inhibitory RNA Designs. The sequence of Homo sapiens chemokine C-C motif receptor 5 (CCR5) (GC03P046377) mRNA was used to search for potential siRNA or shRNA candidates to knockdown CCR5 levels in human cells. Potential RNA interference sequences were chosen from candidates selected by siRNA or shRNA design programs such as from the Broad Institute or the BLOCK-iT RNAi Designer from Thermo Scientific. Individual selected shRNA sequences were inserted into lentiviral vectors immediately 3’ to a RNA polymerase III promoter such as H1, U6, or 7SK to regulate shRNA expression. These lentivirus-shRNA constructs were used to transduce cells and measure the change in specific mRNA levels. The shRNA most potent for reducing mRNA levels were embedded individually within amicroRNA backbone to allow for expression by either the CMV or EF-1alpha RNA polymerase II promoters. The microRNA backbone was selected from mirbase.org. RNA sequences were also synthesized as synthetic siRNA oligonucleotides and introduced directly into cells without using a lentiviral vector.

[0203] The genomic sequence of Bal strain of human immunodeficiency virus type 1 (HIV-185US_ BaL, accession number AY713409) was used to search for potential siRNA or shRNA candidates to knockdown HIV replication levels in human cells. Based on sequence homology and experience, the search focused on regions of the Tat and Vif genes of HIV although an individual of skill in the art will understand that use of these regions is non-limiting and other potential targets might be selected. Importantly, highly conserved regions of gag or pol genes could not be targeted by shRNA because these same sequences were present in the packaging system complementation plasmids needed for vector manufacturing. As with the CCR5 (NM 000579.3, NM 001100168.1-specific) RNAs, potential HIV-specific RNA interference sequences were chosen from candidates selected by siRNA or shRNA design programs such as from the Gene-E Software Suite hosted by the Broad Institute (broadinstitute.org / mai / public) or the BLOCK-iT RNAi Designer from Thermo Scientific (rnadesigner.thermofisher.com / rnaiexpress / setOption.do?designOption=shrna&pid=6712627 360706061801). Individual selected shRNA sequences were inserted into lentiviral vectors immediately 3’ to a RNA polymerase III promoter such as H1, U6, or 7SK to regulate shRNA expression. These lentivirus-shRNA constructs were used to transduce cells and measure the change in specific mRNA levels. The shRNA most potent for reducing mRNA levels were embedded individually within a microRNA backbone to allow for expression by either the CMV or EF-1alpha RNA polymerase II promoters Development of Vectors

[0204] A lentivirus vector against HIV might include three main components: 1) inhibitory RNA to reduce the level of HIV binding proteins (receptors) on the target cell surface to block initial virus attachment and penetration; 2) overexpression of the HIV TAR sequence that will sequester viral Tat protein and decrease its ability to transactivate viral gene expression; and 3) inhibitory RNA that attack important and conserved sequences within the HIV genome.

[0205] With respect to the first point above, a key cell surface HIV binding protein is the chemokine receptor CCR5. HIV particles attach to susceptible T cells by binding to the CD4 and CCR5 cell surface proteins. Because CD4 is an essential glycoprotein on the cellsurface that is important for the immunological function of T cells, this was not chosen as a target to manipulate its expression levels. However, people born homozygous for null mutations in the CCR5 gene and completely lacking receptor expression, live normal lives save for enhanced susceptibility to a few infectious diseases and the possibility of developing rare autoimmunity. Thus, modulating CCR5 was determined to be a relatively safe approach and was a primary target in the development of anti-HIV lentivirus vectors.

[0206] With respect to the second point above, the viral TAR sequence is a highly structured region of HIV genomic RNA that binds tightly to viral Tat protein. The Tat:TAR complex is important for efficient generation of viral RNA. Over-expression of the TAR region was envisioned as a decoy molecule that would sequester Tat protein and decrease the levels of viral RNA. However, TAR proved toxic to most mammalian cells including cells used for manufacturing lentivirus particles. Further, TAR was inefficient for inhibiting viral gene expression in other laboratories and has been discarded as a viable component in HIV gene therapy.

[0207] In various embodiments, viral gene sequences have been identified that meet 3 criteria: i) Sequences that are reasonably conserved across a range of HIV isolates representative of the epidemic in a geographic region of interest; ii) reduction in RNA levels due to the activity of an inhibitory RNA in a viral vector will reduce the corresponding protein levels by an amount sufficient to meaningfully reduce HIV replication; and iii) the viral gene sequence(s) targeted by inhibitory RNA are not present in the genes required for packaging and assembling viral vector particles during manufacturing. In various embodiments, a sequence at the junction of HIV Tat and Rev genes and a second sequence within the HIV Vif gene have been targeted by inhibitory RNA. The Tat / Rev targeting has an additional benefit of reducing HIV envelope glycoprotein expression because this region overlaps with the envelope gene in the HIV genome.

[0208] Various methods for vector development and testing relies first on identifying suitable targets (as described herein) followed by constructing plasmid DNAs expressing individual or multiple inhibitory RNA species for testing in cell models, and finally constructing lentivirus vectors containing inhibitory RNA with proven anti-HIV function. The lentivirus vectors are tested for toxicity, yield during in vitro production, and effectiveness against HIV in terms of reducing CCR5 expression levels or lowering viral gene products to inhibit virus replication.Sequences The following sequences are referred to herein:

Claims

WHAT IS CLAIMED IS:

1. A method of producing cells that are resistant to HIV infection, the method comprising: (a) contacting peripheral blood mononuclear cells (PBMC) isolated from a subject that is HIV-negative with a therapeutically effective amount of a stimulatory agent, wherein the contacting is carried out ex vivo; (b) transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element, wherein the at least one genetic element comprises at least one small RNA capable of inhibiting expression of at least one HIV gene; and (c) culturing the transduced PBMC for at least 1 day.

2. The method of claim 1, further comprising infusing the transduced PBMC into a subject.

3. The method of claim 1 or 2, wherein the subject is a human.

4. The method of any one of claims 1-3, wherein the stimulatory agent comprises a peptide.

5. The method of claim 4, wherein the peptide comprises a gag peptide.

6. The method of any one of claims 1-3, wherein the stimulatory agent comprises a vaccine.

7. The method of claim 6, wherein the vaccine comprises a HIV vaccine.

8. The method of claim 7, wherein the HIV vaccine comprises a MVA / HIV62B vaccine or a variant thereof.

9. The method of any one of claims 1-8, wherein the viral delivery system comprises a lentiviral particle.

10. The method of claim any one of claims 1-9, wherein the at least one genetic element further comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5.

11. The method of any one of claims 1-10, wherein the HIV gene is HIV Vif or HIV Tat.

12. The method of any one of claims 1-10, wherein the HIV gene is HIV Vif and HIV Tat.

13. The method of any one of claims 1-12, wherein the at least one genetic element comprises a microRNA or a shRNA.

14. The method of claim 13, wherein the at least one genetic element comprises a microRNA cluster.

15. The method of any one of claims 10-14, wherein the small capable of inhibiting expression of chemokine receptor CCR5 comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) CCAATCTATGACATCAATTAT (SEQ ID NO: 1); b) TGGTCATCCTCATCCTGATAA (SEQ ID NO: 2); c) CCCAGTGGGACTTTGGAAATA (SEQ ID NO: 3); d) ACTCTTGACAGGGCTCTATTT (SEQ ID NO: 4); e) TTACACCTGCAGCTCTCATTT (SEQ ID NO: 5); f) TCCATACAGTCAGTATCAATT (SEQ ID NO: 6); g) CGAGCGAGCAAGCTCAGTTTA (SEQ ID NO: 7); h) ACTCACTGGTGTTCATCTTTG (SEQ ID NO: 8); i) ATGGATTATCAAGTGTCAAGT (SEQ ID NO: 9); j) GCTGAAGAGCATGACTGACAT (SEQ ID NO: 10); k) CTGGCCATCTCTGACCTGTTT (SEQ ID NO: 11); l) ATACATCGGAGCCCTGCCAAA(SEQ ID NO: 12); and m) AGGAAATATCTGTGGGCTTGT(SEQ ID NO: 13), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: n) ATAATTGATGTCATAGATTGG (SEQ ID NO: 14); o) TTATCAGGATGAGGATGACCA (SEQ ID NO: 15);p) TATTTCCAAAGTCCCACTGGG (SEQ ID NO: 16); q) AAATAGAGCCCTGTCAAGAGT (SEQ ID NO: 17); r) AAATGAGAGCTGCAGGTGTAA (SEQ ID NO: 18); s) AATTGATACTGACTGTATGGA (SEQ ID NO: 19); t) TAAACTGAGCTTGCTCGCTCG (SEQ ID NO: 20); u) CAAAGATGAACACCAGTGAGT (SEQ ID NO: 21); v) ACTTGACACTTGATAATCCAT (SEQ ID NO: 22); w) ATGTCAGTCATGCTCTTCAGC (SEQ ID NO: 23); x) AAACAGGTCAGAGATGGCCAG (SEQ ID NO: 24); y) TTTGGCAGGGCTCCGATGTAT (SEQ ID NO: 25); and z) ACAAGCCCACAGATATTTCCT (SEQ ID NO: 26).

16. The method of any one of claims 1-15, wherein the small RNA capable of inhibiting expression of Vif comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) ACAGATGGCAGGTGATGATTG (SEQ ID NO: 27); b) AAGGTAGGATCTCTACAGTAC (SEQ ID NO: 28); c) AGCAGGACATAACAAGGTAGG (SEQ ID NO: 29); and d) ATGGAAAACAGATGGCAGGT (SEQ ID NO: 30), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: e) CAATCATCACCTGCCATCTGT (SEQ ID NO: 31); f) GTACTGTAGAGATCCTACCTT (SEQ ID NO: 32); g) CCTACCTTGTTATGTCCTGCT (SEQ ID NO: 33); and h) ACCTGCCATCTGTTTTCCAT (SEQ ID NO: 34).

17. The method of any one of claims 1-15, wherein the small RNA capable of inhibiting expression of Tat comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of:a) GCATCTCCTATGGCAGGAAGA (SEQ ID NO: 35); b) ATGGAGCCAGTAGATCCTAGA (SEQ ID NO: 36); and c) TGGAAGCATCCAGGAAGTCAG (SEQ ID NO: 37), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: d) TCTTCCTGCCATAGGAGATGC (SEQ ID NO: 38); e) TCTAGGATCTACTGGCTCCAT (SEQ ID NO: 39); and f) CTGACTTCCTGGATGCTTCCA (SEQ ID NO: 40).

18. The method of any one of claims 1-17, wherein the genetic element is under control of a single promoter, optionally wherein the promoter is EF-1alpha promoter.

19. A method of preventing HIV infection in a subject, the method comprising: (a) ex vivo contacting PBMC isolated from the subject, wherein the subject was immunized with an effective amount of a first stimulatory agent, with a therapeutically effective amount of a second stimulatory agent; (b) transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element, wherein the at least one genetic element comprises at least one small RNA capable of inhibiting expression of at least one HIV gene; (d) culturing the transduced PBMC for at least 1 day; and (e) infusing the transduced PBMC into the subject.

20. The method of claim 19, wherein at least one of the first and second stimulatory agents comprise a gag peptide.

21. The method of claim 19, wherein at least one of the first and second stimulatory agents comprise a HIV vaccine.

22. The method of claim 21, wherein the HIV vaccine comprises a MVA / HIV62B vaccine or a variant thereof.

23. The method of claim any one of claims 19-22, wherein the at least one genetic element further comprises a small RNA capable of inhibiting production of chemokine receptor CCR5.

24. The method of any one of claims 19-23, wherein the HIV gene is HIV Vif or HIV Tat.

25. The method of any one of claims 19-23, wherein the HIV gene is HIV Vif and HIV Tat.

26. The method of any one of claims 19-26, wherein the at least one genetic element comprises a microRNA or a shRNA.

27. The method of claim 26, wherein the at least one genetic element comprises a microRNA cluster.

28. The method of any one of claims 23-27, wherein the small capable of inhibiting expression of chemokine receptor CCR5 comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) CCAATCTATGACATCAATTAT (SEQ ID NO: 1); b) TGGTCATCCTCATCCTGATAA (SEQ ID NO: 2); c) CCCAGTGGGACTTTGGAAATA (SEQ ID NO: 3); d) ACTCTTGACAGGGCTCTATTT (SEQ ID NO: 4); e) TTACACCTGCAGCTCTCATTT (SEQ ID NO: 5); f) TCCATACAGTCAGTATCAATT (SEQ ID NO: 6); g) CGAGCGAGCAAGCTCAGTTTA (SEQ ID NO: 7); h) ACTCACTGGTGTTCATCTTTG (SEQ ID NO: 8); i) ATGGATTATCAAGTGTCAAGT (SEQ ID NO: 9); j) GCTGAAGAGCATGACTGACAT (SEQ ID NO: 10); k) CTGGCCATCTCTGACCTGTTT (SEQ ID NO: 11); l) ATACATCGGAGCCCTGCCAAA(SEQ ID NO: 12); and m) AGGAAATATCTGTGGGCTTGT(SEQ ID NO: 13), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of:n) ATAATTGATGTCATAGATTGG (SEQ ID NO: 14); o) TTATCAGGATGAGGATGACCA (SEQ ID NO: 15); p) TATTTCCAAAGTCCCACTGGG (SEQ ID NO: 16); q) AAATAGAGCCCTGTCAAGAGT (SEQ ID NO: 17); r) AAATGAGAGCTGCAGGTGTAA (SEQ ID NO: 18); s) AATTGATACTGACTGTATGGA (SEQ ID NO: 19); t) TAAACTGAGCTTGCTCGCTCG (SEQ ID NO: 20); u) CAAAGATGAACACCAGTGAGT (SEQ ID NO: 21); v) ACTTGACACTTGATAATCCAT (SEQ ID NO: 22); w) ATGTCAGTCATGCTCTTCAGC (SEQ ID NO: 23); x) AAACAGGTCAGAGATGGCCAG (SEQ ID NO: 24); y) TTTGGCAGGGCTCCGATGTAT (SEQ ID NO: 25); and z) ACAAGCCCACAGATATTTCCT (SEQ ID NO: 26).

29. The method of any one of claims 19-28, wherein the small RNA capable of inhibiting expression of Vif comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) ACAGATGGCAGGTGATGATTG (SEQ ID NO: 27); b) AAGGTAGGATCTCTACAGTAC (SEQ ID NO: 28); c) AGCAGGACATAACAAGGTAGG (SEQ ID NO: 29); and d) ATGGAAAACAGATGGCAGGT (SEQ ID NO: 30), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: e) CAATCATCACCTGCCATCTGT (SEQ ID NO: 31); f) GTACTGTAGAGATCCTACCTT (SEQ ID NO: 32); g) CCTACCTTGTTATGTCCTGCT (SEQ ID NO: 33); and h) ACCTGCCATCTGTTTTCCAT (SEQ ID NO: 34).

30. The method of any one of claims 19-28, wherein the small RNA capable of inhibitingexpression of Tat comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) GCATCTCCTATGGCAGGAAGA (SEQ ID NO: 35); b) ATGGAGCCAGTAGATCCTAGA (SEQ ID NO: 36); and c) TGGAAGCATCCAGGAAGTCAG (SEQ ID NO: 37), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: d) TCTTCCTGCCATAGGAGATGC (SEQ ID NO: 38); e) TCTAGGATCTACTGGCTCCAT (SEQ ID NO: 39); and f) CTGACTTCCTGGATGCTTCCA (SEQ ID NO: 40).

31. The method of any one of claims 19-30, wherein the genetic element is under control of a single promoter, optionally wherein the promoter is EF-1alpha promoter.

32. A method of treating cells, the method comprising: (a) contacting peripheral blood mononuclear cells (PBMC) isolated from a subject infected with HIV with a therapeutically effective amount of a stimulatory agent, wherein the contacting is carried out ex vivo; (b) transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element, wherein the at least one genetic element comprises at least one small RNA capable of inhibiting expression of at least one HIV gene; and (c) culturing the transduced PBMC for at least 1 day.

33. The method of claim 32, further comprising infusing the transduced PBMC into a subject.

34. The method of claim 32 or 33, wherein the subject is a human.

35. The method of any one of claims 32-26, wherein the subject has not been previously immunized with a HIV antibody.

36. The method of any one of claims 32-35, wherein the stimulatory agent comprises a peptide.

37. The method of claim 36, wherein the peptide comprises a gag peptide.

38. The method of any one of claims 32-37, wherein the stimulatory agent comprises a vaccine.

39. The method of claim 38, wherein the vaccine comprises a HIV vaccine.

40. The method of claim 39, wherein the HIV vaccine comprises a MVA / HIV62B vaccine or a variant thereof.

41. The method of claim any one of claims 32-40, wherein the at least one genetic element further comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5.

42. The method of any one of claims 32-41, wherein the HIV gene is HIV Vif or HIV Tat.

43. The method of any one of claims 32-41, wherein the HIV gene is HIV Vif and HIV Tat.

44. The method of any one of claims 32-43, wherein the at least one genetic element comprises a microRNA or a shRNA.

45. The method of claim 44, wherein the at least one genetic element comprises a microRNA cluster.

46. The method of any one of claims 41-45, wherein the small capable of inhibiting expression of chemokine receptor CCR5 comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) CCAATCTATGACATCAATTAT (SEQ ID NO: 1); b) TGGTCATCCTCATCCTGATAA (SEQ ID NO: 2); c) CCCAGTGGGACTTTGGAAATA (SEQ ID NO: 3); d) ACTCTTGACAGGGCTCTATTT (SEQ ID NO: 4); e) TTACACCTGCAGCTCTCATTT (SEQ ID NO: 5); f) TCCATACAGTCAGTATCAATT (SEQ ID NO: 6); g) CGAGCGAGCAAGCTCAGTTTA (SEQ ID NO: 7);h) ACTCACTGGTGTTCATCTTTG (SEQ ID NO: 8); i) ATGGATTATCAAGTGTCAAGT (SEQ ID NO: 9); j) GCTGAAGAGCATGACTGACAT (SEQ ID NO: 10); k) CTGGCCATCTCTGACCTGTTT (SEQ ID NO: 11); l) ATACATCGGAGCCCTGCCAAA(SEQ ID NO: 12); and m) AGGAAATATCTGTGGGCTTGT(SEQ ID NO: 13), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: n) ATAATTGATGTCATAGATTGG (SEQ ID NO: 14); o) TTATCAGGATGAGGATGACCA (SEQ ID NO: 15); p) TATTTCCAAAGTCCCACTGGG (SEQ ID NO: 16); q) AAATAGAGCCCTGTCAAGAGT (SEQ ID NO: 17); r) AAATGAGAGCTGCAGGTGTAA (SEQ ID NO: 18); s) AATTGATACTGACTGTATGGA (SEQ ID NO: 19); t) TAAACTGAGCTTGCTCGCTCG (SEQ ID NO: 20); u) CAAAGATGAACACCAGTGAGT (SEQ ID NO: 21); v) ACTTGACACTTGATAATCCAT (SEQ ID NO: 22); w) ATGTCAGTCATGCTCTTCAGC (SEQ ID NO: 23); x) AAACAGGTCAGAGATGGCCAG (SEQ ID NO: 24); y) TTTGGCAGGGCTCCGATGTAT (SEQ ID NO: 25); and z) ACAAGCCCACAGATATTTCCT (SEQ ID NO: 26).

47. The method of any one of claims 32-46, wherein the small RNA capable of inhibiting expression of Vif comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) ACAGATGGCAGGTGATGATTG (SEQ ID NO: 27); b) AAGGTAGGATCTCTACAGTAC (SEQ ID NO: 28); c) AGCAGGACATAACAAGGTAGG (SEQ ID NO: 29); andd) ATGGAAAACAGATGGCAGGT (SEQ ID NO: 30), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: e) CAATCATCACCTGCCATCTGT (SEQ ID NO: 31); f) GTACTGTAGAGATCCTACCTT (SEQ ID NO: 32); g) CCTACCTTGTTATGTCCTGCT (SEQ ID NO: 33); and h) ACCTGCCATCTGTTTTCCAT (SEQ ID NO: 34).

48. The method of any one of claims 32-46, wherein the small RNA capable of inhibiting expression of Tat comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) GCATCTCCTATGGCAGGAAGA (SEQ ID NO: 35); b) ATGGAGCCAGTAGATCCTAGA (SEQ ID NO: 36); and c) TGGAAGCATCCAGGAAGTCAG (SEQ ID NO: 37), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: d) TCTTCCTGCCATAGGAGATGC (SEQ ID NO: 38); e) TCTAGGATCTACTGGCTCCAT (SEQ ID NO: 39); and f) CTGACTTCCTGGATGCTTCCA (SEQ ID NO: 40).

49. The method of any one of claims 32-48, wherein the genetic element is under control of a single promoter, optionally wherein the promoter is EF-1alpha promoter.

50. A method of treating HIV infection in a subject, the method comprising: (a) ex vivo contacting PBMC isolated from the subject, wherein the subject was immunized with an effective amount of a first stimulatory agent, with a therapeutically effective amount of a second stimulatory agent; (b) transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element, wherein the at least one genetic element comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5 or at least one small RNA capable of inhibiting expression of at least one HIV gene; and (c) culturing the transduced PBMC for at least 1 day.

51. The method of claim 50, further comprising infusing the transduced PBMC into a subject.

52. The method of claim 50 or 51, wherein the stimulatory agent comprises a peptide.

53. The method of claim 52, wherein the peptide comprises a gag peptide.

54. The method of claim 50 or 51, wherein the stimulatory agent comprises a vaccine.

55. The method of claim 54, wherein the vaccine comprises a HIV vaccine.

56. The method of claim 55, wherein the HIV vaccine comprises a MVA / HIV62B vaccine or a variant thereof.

57. The method of claim any one of claims 50-56, wherein the at least one genetic element further comprising a small RNA capable of inhibiting expression of chemokine receptor CCR5.

58. The method of any one of claims 50-57, wherein the HIV gene is HIV Vif or HIV Tat.

59. The method of any one of claims 50-57, wherein the HIV gene is HIV Vif and HIV Tat.

60. The method of any one of claims 50-59, wherein the at least one genetic element comprises a microRNA or a shRNA.

61. The method of claim 60, wherein the at least one genetic element comprises a microRNA cluster.

62. The method of any one of claims 57-61, wherein the small capable of inhibiting expression of chemokine receptor CCR5 comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) CCAATCTATGACATCAATTAT (SEQ ID NO: 1); b) TGGTCATCCTCATCCTGATAA (SEQ ID NO: 2); c) CCCAGTGGGACTTTGGAAATA (SEQ ID NO: 3);d) ACTCTTGACAGGGCTCTATTT (SEQ ID NO: 4); e) TTACACCTGCAGCTCTCATTT (SEQ ID NO: 5); f) TCCATACAGTCAGTATCAATT (SEQ ID NO: 6); g) CGAGCGAGCAAGCTCAGTTTA (SEQ ID NO: 7); h) ACTCACTGGTGTTCATCTTTG (SEQ ID NO: 8); i) ATGGATTATCAAGTGTCAAGT (SEQ ID NO: 9); j) GCTGAAGAGCATGACTGACAT (SEQ ID NO: 10); k) CTGGCCATCTCTGACCTGTTT (SEQ ID NO: 11); l) ATACATCGGAGCCCTGCCAAA(SEQ ID NO: 12); and m) AGGAAATATCTGTGGGCTTGT(SEQ ID NO: 13), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: n) ATAATTGATGTCATAGATTGG (SEQ ID NO: 14); o) TTATCAGGATGAGGATGACCA (SEQ ID NO: 15); p) TATTTCCAAAGTCCCACTGGG (SEQ ID NO: 16); q) AAATAGAGCCCTGTCAAGAGT (SEQ ID NO: 17); r) AAATGAGAGCTGCAGGTGTAA (SEQ ID NO: 18); s) AATTGATACTGACTGTATGGA (SEQ ID NO: 19); t) TAAACTGAGCTTGCTCGCTCG (SEQ ID NO: 20); u) CAAAGATGAACACCAGTGAGT (SEQ ID NO: 21); v) ACTTGACACTTGATAATCCAT (SEQ ID NO: 22); w) ATGTCAGTCATGCTCTTCAGC (SEQ ID NO: 23); x) AAACAGGTCAGAGATGGCCAG (SEQ ID NO: 24); y) TTTGGCAGGGCTCCGATGTAT (SEQ ID NO: 25); and z) ACAAGCCCACAGATATTTCCT (SEQ ID NO: 26).

63. The method of any one of claims 50-62, wherein the small RNA capable of inhibitingexpression of Vif comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) ACAGATGGCAGGTGATGATTG (SEQ ID NO: 27); b) AAGGTAGGATCTCTACAGTAC (SEQ ID NO: 28); c) AGCAGGACATAACAAGGTAGG (SEQ ID NO: 29); and d) ATGGAAAACAGATGGCAGGT (SEQ ID NO: 30), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: e) CAATCATCACCTGCCATCTGT (SEQ ID NO: 31); f) GTACTGTAGAGATCCTACCTT (SEQ ID NO: 32); g) CCTACCTTGTTATGTCCTGCT (SEQ ID NO: 33); and h) ACCTGCCATCTGTTTTCCAT (SEQ ID NO: 34).

64. The method of any one of claims 50-62, wherein the small RNA capable of inhibiting expression of Tat comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) GCATCTCCTATGGCAGGAAGA (SEQ ID NO: 35); b) ATGGAGCCAGTAGATCCTAGA (SEQ ID NO: 36); and c) TGGAAGCATCCAGGAAGTCAG (SEQ ID NO: 37), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: d) TCTTCCTGCCATAGGAGATGC (SEQ ID NO: 38); e) TCTAGGATCTACTGGCTCCAT (SEQ ID NO: 39); and f) CTGACTTCCTGGATGCTTCCA (SEQ ID NO: 40).

65. The method of any one of claims 50-64, wherein the genetic element is under control of a single promoter, optionally wherein the promoter is EF-1alpha promoter.

66. A method of treating HIV infection in a subject, the method comprising: (a) contacting PBMC isolated from the subject ex vivo with a therapeutically effective amount of a stimulatory agent;(b) transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element, wherein the at least one genetic element comprises at least one small RNA capable of inhibiting expression of at least one HIV gene; and (c) culturing the transduced PBMC for at least 1 day.

67. The method of claim 66, further comprising infusing the transduced PBMC into the subject.

68. The method of claim 66 or 67, wherein the stimulatory agent comprises a peptide.

69. The method of claim 68, wherein the stimulatory agent comprises a gag peptide.

70. The method of claim 66 or 67, wherein the stimulatory agent comprises a vaccine.

71. The method of claim 70, wherein the vaccine comprises a HIV vaccine.

72. The method of claim 71, wherein the HIV vaccine comprises a MVA / HIV62B vaccine or a variant thereof.

73. The method of claim any one of claims 66-72, wherein the at least one genetic element further comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5.

74. The method of any one of claims 66-73, wherein the HIV gene is HIV Vif or HIV Tat.

75. The method of any one of claims 66-73, wherein the HIV gene is HIV Vif and HIV Tat.

76. The method of any one of claims 66-75, wherein the at least one genetic element comprises a microRNA or a shRNA.

77. The method of claim 76, wherein the at least one genetic element comprises a microRNA cluster.

78. The method of any one of claims 73-77, wherein the small capable of inhibiting expression of chemokine receptor CCR5 comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of:a) CCAATCTATGACATCAATTAT (SEQ ID NO: 1); b) TGGTCATCCTCATCCTGATAA (SEQ ID NO: 2); c) CCCAGTGGGACTTTGGAAATA (SEQ ID NO: 3); d) ACTCTTGACAGGGCTCTATTT (SEQ ID NO: 4); e) TTACACCTGCAGCTCTCATTT (SEQ ID NO: 5); f) TCCATACAGTCAGTATCAATT (SEQ ID NO: 6); g) CGAGCGAGCAAGCTCAGTTTA (SEQ ID NO: 7); h) ACTCACTGGTGTTCATCTTTG (SEQ ID NO: 8); i) ATGGATTATCAAGTGTCAAGT (SEQ ID NO: 9); j) GCTGAAGAGCATGACTGACAT (SEQ ID NO: 10); k) CTGGCCATCTCTGACCTGTTT (SEQ ID NO: 11); l) ATACATCGGAGCCCTGCCAAA(SEQ ID NO: 12); and m) AGGAAATATCTGTGGGCTTGT(SEQ ID NO: 13), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: n) ATAATTGATGTCATAGATTGG (SEQ ID NO: 14); o) TTATCAGGATGAGGATGACCA (SEQ ID NO: 15); p) TATTTCCAAAGTCCCACTGGG (SEQ ID NO: 16); q) AAATAGAGCCCTGTCAAGAGT (SEQ ID NO: 17); r) AAATGAGAGCTGCAGGTGTAA (SEQ ID NO: 18); s) AATTGATACTGACTGTATGGA (SEQ ID NO: 19); t) TAAACTGAGCTTGCTCGCTCG (SEQ ID NO: 20); u) CAAAGATGAACACCAGTGAGT (SEQ ID NO: 21); v) ACTTGACACTTGATAATCCAT (SEQ ID NO: 22); w) ATGTCAGTCATGCTCTTCAGC (SEQ ID NO: 23); x) AAACAGGTCAGAGATGGCCAG (SEQ ID NO: 24);y) TTTGGCAGGGCTCCGATGTAT (SEQ ID NO: 25); and z) ACAAGCCCACAGATATTTCCT (SEQ ID NO: 26).

79. The method of any one of claims 66-78, wherein the small RNA capable of inhibiting expression of Vif comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) ACAGATGGCAGGTGATGATTG (SEQ ID NO: 27); b) AAGGTAGGATCTCTACAGTAC (SEQ ID NO: 28); c) AGCAGGACATAACAAGGTAGG (SEQ ID NO: 29); and d) ATGGAAAACAGATGGCAGGT (SEQ ID NO: 30), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: e) CAATCATCACCTGCCATCTGT (SEQ ID NO: 31); f) GTACTGTAGAGATCCTACCTT (SEQ ID NO: 32); g) CCTACCTTGTTATGTCCTGCT (SEQ ID NO: 33); and h) ACCTGCCATCTGTTTTCCAT (SEQ ID NO: 34).

80. The method of any one of claims 66-78, wherein the small RNA capable of inhibiting expression of Tat comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) GCATCTCCTATGGCAGGAAGA (SEQ ID NO: 35); b) ATGGAGCCAGTAGATCCTAGA (SEQ ID NO: 36); and c) TGGAAGCATCCAGGAAGTCAG (SEQ ID NO: 37), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: d) TCTTCCTGCCATAGGAGATGC (SEQ ID NO: 38); e) TCTAGGATCTACTGGCTCCAT (SEQ ID NO: 39); and f) CTGACTTCCTGGATGCTTCCA (SEQ ID NO: 40).

81. The method of any one of claims 66-80, wherein the genetic element is under control of a single promoter, optionally wherein the promoter is EF-1alpha promoter.

82. A lentiviral vector comprising at least one encoded genetic element, wherein the at least one genetic element comprises at least one small RNA capable of inhibiting expression of at least one HIV gene, and wherein the HIV gene is Vif or Tat sequence.

83. The lentiviral vector of claim 82, wherein the at least on encoded genetic element further comprises a small RNA capable of inhibiting expression of chemokine receptor CCR5.

84. The lentiviral vector of claim 82 or 83, wherein the HIV gene is Vif and Tat.

85. The lentiviral vector of any one of claims 82-84, wherein the at least one encoded genetic element comprises a microRNA or a shRNA.

86. The lentiviral vector of claim 85, wherein the at least one encoded genetic element comprises a microRNA cluster.

87. The lentiviral vector of any one of claims 83-86, wherein the small capable of inhibiting expression of chemokine receptor CCR5 comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) CCAATCTATGACATCAATTAT (SEQ ID NO: 1); b) TGGTCATCCTCATCCTGATAA (SEQ ID NO: 2); c) CCCAGTGGGACTTTGGAAATA (SEQ ID NO: 3); d) ACTCTTGACAGGGCTCTATTT (SEQ ID NO: 4); e) TTACACCTGCAGCTCTCATTT (SEQ ID NO: 5); f) TCCATACAGTCAGTATCAATT (SEQ ID NO: 6); g) CGAGCGAGCAAGCTCAGTTTA (SEQ ID NO: 7); h) ACTCACTGGTGTTCATCTTTG (SEQ ID NO: 8); i) ATGGATTATCAAGTGTCAAGT (SEQ ID NO: 9); j) GCTGAAGAGCATGACTGACAT (SEQ ID NO: 10); k) CTGGCCATCTCTGACCTGTTT (SEQ ID NO: 11); l) ATACATCGGAGCCCTGCCAAA(SEQ ID NO: 12); andm) AGGAAATATCTGTGGGCTTGT(SEQ ID NO: 13), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: n) ATAATTGATGTCATAGATTGG (SEQ ID NO: 14); o) TTATCAGGATGAGGATGACCA (SEQ ID NO: 15); p) TATTTCCAAAGTCCCACTGGG (SEQ ID NO: 16); q) AAATAGAGCCCTGTCAAGAGT (SEQ ID NO: 17); r) AAATGAGAGCTGCAGGTGTAA (SEQ ID NO: 18); s) AATTGATACTGACTGTATGGA (SEQ ID NO: 19); t) TAAACTGAGCTTGCTCGCTCG (SEQ ID NO: 20); u) CAAAGATGAACACCAGTGAGT (SEQ ID NO: 21); v) ACTTGACACTTGATAATCCAT (SEQ ID NO: 22); w) ATGTCAGTCATGCTCTTCAGC (SEQ ID NO: 23); x) AAACAGGTCAGAGATGGCCAG (SEQ ID NO: 24); y) TTTGGCAGGGCTCCGATGTAT (SEQ ID NO: 25); and z) ACAAGCCCACAGATATTTCCT (SEQ ID NO: 26).

88. The lentiviral vector of any one of claims 82-87, wherein the small RNA capable of inhibiting expression of Vif comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) ACAGATGGCAGGTGATGATTG (SEQ ID NO: 27); b) AAGGTAGGATCTCTACAGTAC (SEQ ID NO: 28); c) AGCAGGACATAACAAGGTAGG (SEQ ID NO: 29); and d) ATGGAAAACAGATGGCAGGT (SEQ ID NO: 30), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: e) CAATCATCACCTGCCATCTGT (SEQ ID NO: 31);f) GTACTGTAGAGATCCTACCTT (SEQ ID NO: 32); g) CCTACCTTGTTATGTCCTGCT (SEQ ID NO: 33); and h) ACCTGCCATCTGTTTTCCAT (SEQ ID NO: 34).

89. The lentiviral vector of any one of claims 82-87, wherein the small RNA capable of inhibiting expression of Tat comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: a) GCATCTCCTATGGCAGGAAGA (SEQ ID NO: 35); b) ATGGAGCCAGTAGATCCTAGA (SEQ ID NO: 36); and c) TGGAAGCATCCAGGAAGTCAG (SEQ ID NO: 37), or comprises a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with a sequence selected from the group consisting of: d) TCTTCCTGCCATAGGAGATGC (SEQ ID NO: 38); e) TCTAGGATCTACTGGCTCCAT (SEQ ID NO: 39); and f) CTGACTTCCTGGATGCTTCCA (SEQ ID NO: 40).

90. The lentiviral vector of any one of claims 82-89, wherein the genetic element is under control of a single promoter, optionally wherein the promoter is EF-1alpha promoter.

91. A lentiviral vector system for expressing a lentiviral particle, the system comprising: a. a lentiviral vector according to any one of claims 82-90; b. an envelope plasmid for expressing an envelope protein optimized for infecting a cell; and c. at least one helper plasmid for expressing gag, pol, and rev genes, wherein when the lentiviral vector, the envelope plasmid, and the at least one helper plasmid are transfected into a packaging cell line, a lentiviral particle is produced by the packaging cell line, wherein the lentiviral particle is capable of inhibiting production of chemokine receptor CCR5 or targeting an HIV RNA sequence.

92. The lentiviral vector system of claim 91, wherein the system comprises a first helper plasmid for expressing the gag and pol genes, and a second plasmid for expressing the rev gene.

93. A lentiviral particle capable of infecting a cell, the lentiviral particle comprising an envelope protein optimized for infecting a cell, and a lentiviral vector according to any one of claims 82-90.

94. The lentiviral particle of claim 93, wherein the envelope protein is optimized for infecting a T cell.

95. The lentiviral particle of claim 94, wherein the envelope protein is optimized for infecting a CD4+ T cell.

96. A modified cell comprising a CD4+ T cell, wherein the CD4+ T cell has been infected with a lentiviral particle according to any one of claims 93-95.

97. The modified cell of claim 96, wherein the CD4+ T cell also recognizes an HIV antigen.

98. The modified cell of claim 97, wherein the HIV antigen comprises a gag antigen.

99. The modified cell of any one of claims 95-98, wherein the CD4+ T cell expresses a decreased level of CCR5 following infection with the lentiviral particle.

100. The method of any one of claims 1-81, further comprising depleting at least one subset of cells from the PBMC, wherein the at least one subset of cells comprises any one or more of CD8+ T cells, γδ cells, NK cells, B cells, neutrophils, basophils, eosinophils, T regulatory cells, NKT cells, and erythrocytes.

101. The method of claim 100, wherein the depleting occurs after removing the leukocytes.

102. The method of claim 100, wherein the depleting occurs at the same time as removing the leukocytes.

103. The method of any one of claims 32-81, further comprising positively selecting HIV- specific CD4+ T cells from the PBMC.

104. The method of claim 103, wherein the HIV-specific CD4+ T cells are positively selected using at least one physical method of selection.

Images