Gene therapy for diabetic retinopathy

Abstract

Described herein are compositions and methods useful in treating endothelial cells of the retina in a patient suffering from or at risk developing a condition related to retinal deterioration. In some embodiments, the condition may be diabetes, diabetic retinopathy, or ischemia / reperfusion injury. In some embodiments, the endothelial cells may be capillary' cells. In many embodiments, the composition and methods may result in increased expression of DJ-1 in the endothelial cells.

Description

GENE THERAPY FOR DIABETIC RETINOPATHYCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of priority pursuant to 35 U.S.C. § 1 19(e) of U.S. provisional patent application No. 63 / 584,674 entitled “Gene Therapy for Diabetic Retinopathy,” filed on 22 September 2023, which is hereby incorporated by reference in its entirety.BACKGROUND

[0002] Retinal ischemia is a secondary complication caused by a reduced blood supply to the retina. The common causes include central retinal vein occlusion, branch artery or vein occlusions, and diabetes mellitus. Diabetes mellitus (DM) is a chronic metabolic disease caused by abnormalities in the secretion and action of insulin. It affected 366 million in 2011 and is estimated to rise to 500 million by 2030. Diabetic Retinopathy (DR) is a major complication of both T1 and T2 diabetes, causing nearly 50% of cases of blindness worldwide. It is the primary cause of acquired blindness in working-age adults, affecting 12% of blind individuals. In T1 diabetes, 5% of the patient population develops DR after 5 years, rising to 60% and 97% after 10 and 25 years, respectively. Over 60% of T2 diabetes patients develop DR within 15-20 years of diagnosis. With 79 million Americans having prediabetes, DR prevalence is expected to increase. Hallmark features of the early stages of DR include the loss of permeability of capillary endothelial cells and the early demise of retinal endothelial cells and pericytes, which can lead to increased vascular permeability, macular edema, and angiogenesis. Hyperglycemia can mediate caspase-dependent apoptosis in capillary cells, as shown in cultured cells and animals. Similarly, ROS, TNF-a, IL- 10 and IFN-y can induce caspase-mediated apoptosis in capillary cells.However, there is no clear understanding of the mechanisms underlying capillary cell death and BRB breakdown in DR.

[0003] Accordingly, there is an urgent need for therapeutic treatments that address retinal cell death, especially in DR.SUMMARY

[0004] Disclosed herein are methods and compositions for treating various retina-associated disease and conditions. In many aspects the disclosed composition for use in treating retinopathy in a patient in need thereof, the composition comprising: a nucleic acid coding sequence for a DJ-1 gene; a nucleic acid sequence comprising a promoter for regulating expression of the DJ-1sequence; a nucleic acid sequence comprising a poly adenylation site. In many embodiments the composition may be comprised in an adeno-associated virus (AAV) vector, for one example AAV seroty pe 2, and / or the polyadenylation site may be an SV40 poly adenylation site and / or the promoter may be a Tie-2 promoter. In most embodiments, the nucleic acid coding sequence for the DJ-1 gene may be more than 80% identical to human DJ-1, for example Sequence 1. In many embodiments, the composition is a liquid composition, and the composition may comprise between IxlO8and IxlO12copies of the DJ-1 gene per milliliter, and the composition may be useful in treating retinopathy, for example diabetic retinopathy.

[0005] In another aspect, method for treating retinopathy are disclosed, the methods comprising steps of administering a therapeutic composition to a patient having or at risk of developing a disease associated with retinal degeneration, for example the composition as described above, wherein the patient may be administered between about 10 and 100 pl of the therapeutic composition per eye. In many embodiments, the patient may be administered more than one dose of the composition and / or the patient may be examined before and after the administration to determine whether the retinas have undergone an increase or decrease in morphological abnormalities as a result of the administration. In many embodiments, the administration may prevent or slow accumulation of morphological abnormalities and / or stabilize or slow degradation of visual acuity.BRIEF DESCRIPTION OF THE DRAWINGS

[0006] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0007] Figs. 1 A-1C presents experimental results showing that DJ-1 levels are reduced in human diabetic retina and retinal endothelial cells cultured with high glucose. Cross-sections of human retinas were stained for DJ-1 (green) and vWF (red) (Fig. 1A). Retinal homogenates from non-diabetic (ND), diabetic (DB), and diabetic with retinopathy (DR) donors were separated on a 12% SDS-PAGE gel, and DJ-1 was detected by western blotting (Fig. IB). DJ-1 in HRECs cultured with normal glucose (5 mM, CON) or high glucose (25 mM, HG) for 96 h (Fig. 1C). GAPDH or (3-Actin were used as a loading control. The graph (densitometry plot) shows the mean ± SD of 3-4 measurements. *p<0.05. NS=not significant. Scale bar = 100 pm.

[0008] Figs. 2A-2C presents experimental results showing that treatment with a DJ-1 inhibitor increases AGE levels in HREC. MTT assay was performed in 96-well plates to determine the toxicity of Isatin in HRECs (Fig. 2A). HREC were treated with 500 pM Isatin with or without 250 pM glyoxal (GO) for 24 h. CML was detected by western blotting (Fig. 2B). (3-Actin was used as a loading control. The densitometry plot represents the mean ± SD of triplicate measurements (Fig. 2C). CON=control. *p<0.05, and **p<0.01. NS=not significant.

[0009] Figs. 3A-3B presents experimental results showing that inhibition of DJ-1 activity promotes inflammation and apoptosis in HREC. HREC were treated with a mixture of pro- inflammatory cytokines (CM) in the presence or absence of Isatin (500 pM) for 48 h. Western blot was performed for iNOS (Fig. 3A) and cleaved caspase-3 (Fig. 3B). P-Actin was used as the loading control. The densitometry plot represents the mean ± SD of triplicate measurements. CON=control and CM=cytokine mixture (50 U / ml of IFN-y + 10 ng / ml of TNF-a + 10 ng / ml of IL-ip). ***p<0.001, and ****p<0.0001. NS=not significant.

[0010] Figs. 4A-4B presents experimental results showing that inhibition of DJ-1 regulates nuclear translocation of NF-kB and Nrf2 in response to inflammation in HREC. Cells were treated with Isatin (500 pM) for 20 h and then with or without CM for 2 h. The nuclear fraction was separated, and NF-kB (Fig. 4A) and Nrf2 (Fig. 4B) were measured by western blot. Histone (H3) was used as the loading control. The densitometric plots represent the mean ± SD of triplicate measurements. CON=control and CM=cytokine mixture. NS=not significant, ***p<0.001, and ****p<0.0001. NS=not significant.

[0011] Figs. 5A-5D presents experimental results showing that intravitreal delivery of an adeno-associated virus (AAV) serotype 2, AAV2-DJ-1 vector protects retinal capillaries against I / R injury. Western blotting for DJ-1 in mouse retinal homogenates after 6 weeks of injection of AAV2-DJ-1 and densitometry for DJ-1 (Fig. 5A). P-Actin was used as the loading control. Retinal capillary bed was prepared from untreated, and AAV2-DJ-1 treated (6 weeks), fixed, and stained for DJ-1 (green) and vWF (red, endothelial cell marker). Representative images are shown in (Fig. 5B). Retinal capillaries were with PAS stain. Representative images are shown in (Fig. 5C). Acellular capillaries (red) were counted in capillary' beds (Fig. 5D). **p<0.01, and ***p<0.001. NS=not significant.

[0012] Fig. 6 shows a proposed mechanism by which DJ-1 inhibits capillary degeneration in I / R injury. Hyperglycemia or ischemic injury to retinal endothelial cells decreases DJ-1 levels (mechanisms unknown). This decrease upregulates iNOS, activates NF-kB, reduces Nrf2 activation and increases AGE levels. The combined effect is the production of pro-inflammatory cytokines, ROS, and peroxynitrite; all can induce apoptosis.

[0013] Fig. 7 is a map of a vector comprising a mouse DJ-1 coding sequence.

[0014] Fig. 8 is a map of a vector as in Fig. 7, but comprising a human DJ-1 coding sequence rather than Fig. 7’s mouse sequence.DETAILED DESCRIPTION

[0015] Disclosed herein are compositions, methods, devices, and systems for treating endothelial cells of the retina. In many embodiments, the treatment may result in increased expression of DJ-1 in these cells, which may prevent or slow damage to the cells, for example damage resulting from hyperglycemia and ischemia. In many embodiments, a patient may be treated with the disclosed compositions to prevent or treat a retina-associated condition, for example the patient may suffer from diabetes and / or be at risk of or suffer from diabetic retinopathy.

[0016] Recent studies have shown that inflammation is a contributor to the development of DR. The observations that the pro-inflammatory cytokines TNF-a, IL- 1 (3, IL-6 and IFN-y, and the chemokines IL-8 and MCP-1, are elevated in the blood, retina, vitreous humor and aqueous humor in diabetes support a role for inflammation in DR. In addition, oxidative stress has been shown to contribute to pathological changes in the diabetic retina. The antioxidant defense system that reduces the burden of ROS-mediated damage is weakened in the diabetic retina. NF- kB regulates the expression of inducible nitric oxide synthase (iNOS), which generates nitric oxide. Peroxynitrite radicals formed from the reaction of nitric oxide and superoxide have deleterious effects on proteins, activate NADPH oxidase (to produce more superoxide) and induce apoptosis. Reactive oxy gen species (ROS) can also activate NF-kB signaling and induce the expression of proinflammatory mediators, such as ICAM-1, VCAM-1, COX-2 and proinfl ammatory cytokines. Oxidative stress-induced NF-kB activation is also responsible for the caspase-mediated capillary cell apoptosis.

[0017] Applicants have shown that, in human retinal endothelial cells (HRECs), proinflammatory cytokines induce apoptosis through peroxynitrite production. Accordingly, Applicants hypothesized that mitigation of oxidative stress may be useful in preventing DR.

[0018] DJ-1 (PARK7) is a member of the DJ-l / Hsp31 / PfpI superfamily and a multifunctional protein. It is translocated to the nucleus in response to growth factors and translocated to mitochondria under oxidative stress. DJ-1 sequesters Keapl in the cytoplasm and facilitates the nuclear translocation of Nrf-2. thereby reducing ROS through the increased expression of antioxidative genes. It has been shown that DJ-1 can stabilize the DNA binding of Nrf-2. DJ-1 prevents stress-induced apoptosis by blocking the activation of apoptotic signal- regulated kinase 1 , sequestering the death domain associated protein (Daxx) and increasing Akt phosphorylation through the reduction of PTEN.

[0019] DJ-1 function is important for the retina. Retinal abnormalities and visual dysfunction have been reported in DJ-1 KO mice. Overexpression of DJ-1 significantly reduces ROSgeneration and apoptosis in retinal pigment epithelial cells. Moreover, hyperglycemia reduces DJ-1 expression in retinal pericytes, which is accompanied by apoptosis mitigated by the overexpression of DJ-1.

[0020] To date, the role of DJ-1 on retinal endothelial cells has not been thoroughly elucidated. Here, Applicants show: the effect of diabetes on human retinal DJ-1 levels; the role of DJ-1 in oxidative and inflammatory stresses and apoptosis of HREC; and the effect of DJ-1 overexpression on retinal capillary degeneration following ischemic / reperfusion injury to the mouse retina.

[0021] Disclosed herein are compositions and methods useful in treating various diseases, disorders, and conditions, which may be characterized by one or more symptoms, for example retinopathy, such as diabetic retinopathy.Definitions

[0022] The following terms and phrases include the meanings provided below. The provided definitions are intended to aid in describing particular embodiments, and are not intended to limit the claimed compositions, methods, compounds, systems, and therapies. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. If there is an apparent discrepancy between the usage of a term in the art and its definition provided herein, the definition provided within the specification shall prevail.

[0023] The term ’‘about” or ‘'approximately” means an acceptable error for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined. In certain embodiments, the term “about” or “approximately” means within 1, 2. 3, or 4 standard deviations. In certain embodiments, the term “about” or “approximately” means within 30%. 25%. 20%. 15%. 10%. 9%, 8%, 7%. 6%, 5%. 4%, 3%, 2%. 1%, 0.5%, or 0.05% of a given value or range. Whenever the term “about” or “approximately” precedes the first numerical value in a series of two or more numerical values, it is understood that the term “about” or “approximately” applies to each one of the numerical values in that series.

[0024] The term '‘amelioration” as used herein refers to any improvement of a disease state (for example diabetic retinopathy) of a patient suffering therefrom, by the administration of one or more treatments, drugs, and / or compositions, according to the present disclosure, to such patient or subject in need thereof. Such an improvement may be seen as a slowing down of the progression, or a cessation of the progression, of the disease of the patient, a decrease in thefrequency, duration, and / or severity of any symptom, and / or an increase in frequency or duration of disease symptom-free periods or a prevention of impairment or disability due to the disease.

[0025] “Amino acid identity,” “residue identity,” “identity,” “identical,” and the like, as used herein refers to the structure of the functional group (R group) on the polypeptide backbone at a given position. Naturally occurring amino acid identities are (name / 3-letter code / one-letter code): alanine / ala / A; arginin e / arg / R; asparagine / asn / N; aspartic acid / asp / D; cysteine / cys / C; glutamine / gln / Q; glutamic acid / glu / E; glycine / gly / G; histidine / his / H; isoleucine / ile / I; leucine / leu / L; lysine / lys / K; methionine / met / M; phenylalanine / phe / F; proline / pro / P; serine / ser / S; threonine / thr / T; tryptophan / trp / W; tyrosine / tyr / Y ; and valine / val / V.

[0026] An amino acid within a molecule may be substituted to create an engineered molecule. The amino acid (aa or a.a.) residue can be replaced by a residue having similar physiochemical characteristics, that is a ‘conservative substitution’ - e.g., substituting one aliphatic residue for another (such as He, Vai, Leu, or Ala for one another), or substitution of one polar residue for another (such as between Lys and Arg; Glu and Asp; or Gin and Asn). Other such conservative substitutions, for example based on size, charge, polarity, hydrophobicity, chain rigidity / orientation, etc., are well known in the art of protein engineering. Polypeptides comprising conservative amino acid substitutions can be tested in any one of the assays described herein to confirm that a desired activity, e.g. binding, specificity, and / or function of a native or reference polypeptide is achieved.

[0027] While conservative substitutions within a protein, i.e. buried or non-solvent accessible residues / positions, may in some cases alter the structure of the protein or affect folding of the protein, conservative substitutions at or near the protein’s surface, i.e. exposed or solvent accessible residues / positions may cause little or no discernable change to the protein’s structure and / or function, unless the altered surface protein is necessary' for an interaction w ith another molecule, peptide, or protein. Thus, it is well within the abilities of the skilled artisan to alter the disclosed protein sequences by introducing conservative substitutions at up to 20% of the residues / positions without disrupting or changing the protein’s structure and / or function. In these cases, the disclosed proteins may be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a protein, or a protein coded for by a sequence disclosed herein, and are therefore disclosed as if expressly presented herein.

[0028] Amino acids can be grouped according to similarities in the properties of their side chains (in A. L. Lehninger, in Biochemistry, second ed., pp. 73-75, Worth Publishers, New York (1975)): (1) non-polar: Ala (A), Vai (V). Leu (L), He (I), Pro (P), Phe (F), Trp (W). Met (M); (2)uncharged polar: Gly (G), Ser (S), Thr (T), Cys (C), Tyr (Y), Asn (N), Gin (Q); (3) acidic: Asp (D), Glu (E); (4) basic: Lys (K), Arg (R), His (H). Alternatively, naturally occurring residues can be divided into groups based on common side-chain properties: (1) hydrophobic: leucine, Met, Ala, Vai, Leu, He; (2) neutral hydrophilic: Cys, Ser. Thr, Asn, Gin; (3) acidic: Asp. Glu; (4) basic: His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; (6) aromatic: Trp, Tyr, Phe. Non-conservative substitutions will entail exchanging a member of one of these classes for another class. Particular conservative substitutions include, for example; Ala into Gly or into Ser; Arg into Lys; Asn into Gin or into His; Asp into Glu; Cys into Ser; Gin into Asn; Glu into Asp; Gly into Ala or into Pro; His into Asn or into Gin; He into Leu or into Vai; Leu into He or into Vai; Lys into Arg, into Gin or into Glu; Met into Leu, into Tyr or into He; Phe into Met, into Leu or into Tyr; Ser into Thr; Thr into Ser; Trp into Tyr; Tyr into Trp; and / or Phe into Vai, into He or into Leu.

[0029] Alterations of the native amino acid sequence can be accomplished by any of a number of techniques known to one of skill in the art. Mutations can be introduced, for example, at particular loci by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites enabling ligation to fragments of the native sequence. Following ligation, the resulting reconstructed sequence encodes an analog having the desired amino acid insertion, substitution, or deletion. Alternatively, oligonucleotide-directed site-specific mutagenesis procedures can be employed to provide an altered nucleotide sequence having particular codons altered according to the substitution, deletion, or insertion required. Techniques for making such alterations are very well established and understood by those of skill in the art.

[0030] The terms “dosage’7or “dose” as used herein denote any form of the active ingredient formulation that contains an amount sufficient to produce a therapeutic effect with a single administration.

[0031] The term “effective amount” refers to an amount of a composition of the invention or other active ingredient sufficient to provide a therapeutic or prophylactic benefit in the treatment or prevention of a disease or to delay or minimize symptoms associated with a disease. Further, a therapeutically effective amount with respect to a compound of the invention means that amount of therapeutic agent alone, or in combination with other therapies, that provides a therapeutic benefit in the treatment or prevention of a disease. Used in connection with a composition of the present disclosure, the term can encompass an amount that improves overall therapy, reduces or avoids symptoms or causes of disease, or enhances the therapeutic efficacy or synergies with another therapeutic agent.

[0032] "‘Expression” as used herein, refers to cellular processes involved in producing, displaying (e.g., on or at a cell’s surface / outer membrane), or secreting RNA and proteins including where applicable, but not limited to, for example, transcription, transcript processing, translation and protein folding, modification and processing. Expression can refer to the transcription and stable accumulation of sense (e.g., mRNA) or antisense RNA derived from a nucleic acid fragment or fragments and / or to the translation of mRNA into a polypeptide.

[0033] The terms “modulate”, “modulation” and the like refer to the ability of a compound to increase or decrease the function, or activity of an organism, cell, protein, peptide, gene, biomarker, etc. (“target”). “Modulation”, in its various forms, is intended to encompass inhibition, antagonism, partial antagonism, activation, agonism and / or partial agonism of the activity7associated with the target. Inhibitors compounds may bind to, partially or totally block stimulation, decrease, prevent, delay activation, inactivate, desensitize, or down regulate signal transduction. The ability of a compound to modulate a target’s activity can be demonstrated in various ways, such as nucleic acid quantitation (northern analysis), an enzymatic assay or a cellbased assay.

[0034] DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) refer to nucleic acid molecules or nucleotide sequences having a backbone of sugar moieties which are deoxyribosyl and ribosyl moieties respectively. The sugar moieties may be linked to bases which are the 4 natural bases (adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U)). In RNA, the bases are A, G, C, and U. The sugar moieties may also be linked to unnatural bases such as inosine, xanthosine, 7-methylguanosine, dihydrouridine, 5-methylcytidine, etc. as are well known to those of skill in the art. Natural phosphodiester linkages between sugar (deoxyribosyl / ribosyl) moieties may optionally be replaced with phosphorothioates linkages.

[0035] A “patient” or “subject” includes a mammal or animal, such as a human, cow, horse, sheep, lamb, pig, chicken, turkey , quail, cat, dog, mouse, rat, rabbit, or guinea pig. The animal can be a mammal such as a non-primate or a primate (e.g., monkey and human). In one embodiment, a patient is a human, such as a human infant, child, adolescent, or adult of any or indeterminant sex.

[0036] “Prevention” as used herein means the avoidance of the occurrence or of the reoccurrence of a disease, disorder, or condition as specified herein, by the administration of a composition, compound, treatment, or therapy according to the present disclosure to a subject in need thereof.

[0037] As used herein, the terms “protein” and “polypeptide” are used interchangeably to designate a series of amino acid residues, connected to each other by peptide bonds between thealpha-amino and carboxy groups of adjacent residues. The terms “protein”, and “polypeptide” refer to a polymer of amino acids, or amino acid sequence, including modified amino acids (e.g., phosphorylated, glycated, glycosylated, etc.) and amino acid analogs, regardless of its size or function. “Protein” and “polypeptide” are often used in reference to relatively large polypeptides, whereas the term “peptide” is often used in reference to small polypeptides, but usage of these terms in the art overlaps. The terms “protein” and “polypeptide” are used interchangeably herein when referring to a gene product and fragments thereof. Thus, exemplary polypeptides, proteins, and amino acid sequences include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments and other equivalents, variants, fragments, and analogs of the foregoing.

[0038] “Subject in need,” “patient” or those “in need of treatment” include those already with existing disease (for example, without limitation, diabetic retinopathy) as well as those at risk of or susceptible to the disease. The terms also include human and other mammalian subjects that receive either prophylactic or therapeutic treatments as disclosed herein.

[0039] The terms “treat,” “treating,” and “treatment” refer to eliminating, reducing, suppressing, or ameliorating, either temporarily or permanently, either partially or completely, a clinical symptom, manifestation or progression of an event, disease or condition associated with immune disorders and diseases described herein. As is recognized in the pertinent field, methods and compositions employed as therapies may reduce the severity of a given disease state but need not abolish every manifestation of the disease to be regarded as useful. Similarly, a prophylactically administered treatment need not be completely effective in preventing the onset of a condition to constitute a viable prophylactic method or agent. Simply reducing the impact of a disease (for example, as disclosed herein, retinopathy, ischemic injury', etc.) and / or reducing the number or severity of associated symptoms, or by increasing the effectiveness of another treatment, or by producing another beneficial effect, or reducing the likelihood that the disease will occur or worsen in a subject, is sufficient. One embodiment of the present disclosure is directed to a method for determining the efficacy of treatment comprising administering to a patient therapeutic treatment in an amount, duration, and repetition sufficient to induce a sustained improvement over pre-existing conditions, or a baseline indicator that reflects the severity of the particular disorder.

[0040] “Therapeutically effective amount” means an amount of a drug, composition, compound, treatment, or therapy' of the present disclosure that alone, or in combination with other therapies, (i) treats the particular disease, condition, or disorder, (ii) attenuates, ameliorates, or eliminates one or more symptoms of the particular disease, condition, or disorder, or (iii)prevents or delays, the onset of one or more symptoms of the particular disease, condition, or disorder described herein. The term can encompass an amount that improves overall therapy, reduces, or avoids symptoms or causes of disease, or enhances the therapeutic efficacy or synergizes with another therapeutic agent. In the case of the retinopathy, the therapeutically effective amount of the drug, composition, compound, treatment, or therapy may reduce the reduce inflammatory signals, reduce or prevent apoptosis, etc.

[0041] “Vector” refers to a nucleic acid molecule which is capable of transporting another nucleic acid linked, typically covalently using gene engineering methods, thereto. One type of vector is a “plasmid,” which refers to circular double-stranded DNA into which an additional DNA segment can be ligated. Another type of vector is a phage vector. Yet another type of vector is a viral vector, where an additional DNA segment can be added to or ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (for example, bacterial vectors having a bacterial origin of replication and episomal mammalian vectors, while mammalian vectors may replicate in mammalian cells). Other vectors (for example, non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thus are replicated along with the host genome. In addition, certain vectors are capable of reproduction in bacteria and mammalian cells, as well as being able to express genes in bacterial and mammalian environments. Many vectors are capable of directing expression of genes to which they are operatively linked. Such vectors are referred to herein as “recombinant expression vectors” or simply “expression vectors.” In general, expression vectors useful in recombinant DNA techniques are often in the form of plasmids. In the present specification, “virus,” “plasmid,” “viral vector” and “vector” may be used interchangeably.Patients

[0042] Various patients may be treated with the disclosed compositions and methods. In most embodiments, the patient is a mammal, for example a human. In many embodiments, the patients may be at risk of developing, or currently suffering from a disease or condition related to retinal degradation, especially retinopathy. In other embodiments, the patient may suffer from glaucoma or age-related macular degeneration. In many embodiments, the patient may be diabetic or prediabetic, and may be suffering from or at risk of developing diabetic retinopathy.

[0043] In many embodiments, patients treated with the disclosed methods and composition may experience a halt or reduction in progression of retinopathy. In many cases, the patient's disease progression may be assayed by testing the eyes for visual acuity’, which may involve various testing regimen well know n to those of skill in the art such as an ophthalmologist. Insome cases the test may be a dilated fundus exam, fluorescein angiography, and or optical coherence tomography. In many embodiments, a medical professional, for one example an ophthalmologist, may monitor the retina for morphological abnormalities of the retina and register a halt or reduction in progression of retinopathy as is well known by those of skill in the art.

[0044] In other embodiments, the amount or number of morphological abnormalities in the retina measured or observed before treatment may not increase after treatment, whereas without treatment a deterioration would be expected. For example the number of retinal abnormalities measured at a first time, before treatment, and a second time, after treatment, for example measurements of the number of acellular capillaries, may change by less than 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, or 2%. For one example, the number of acellular capillaries measured at the second time may be the same or slightly more at the second time, for example the number may increase less than about 30%, 25%, 20%, 15%, 10%. 9%, 8%, 7%. 6%, 5%, 4%, 3%, or 2%. For another example the number of pericytes measured at the second time may be the same or only slightly less, the number may reduce by less than 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, or 2%. In other embodiments, visual acuity measured at the second time may decrease by less than about 30%, 25%, 20%, 15%, 10%, 9%. 8%, 7%, 6%, 5%, 4%, 3%, or 2% relative to the measurement at the first time. In many embodiments ,the second measurement may be 1, 2, 3, 4, 5, 6, or more weeks after treatment, for example 4 weeks or 6 weeks.Target cells

[0045] Various cells may benefit from treatment with the disclosed compositions and methods. In various embodiments, the cell may be at risk of apoptosis. In many embodiments the cell may be a retinal cell, for example an endothelial cell, especially retinal endothelial cells. In many embodiments, the cells may be capillary cells in the retina.Therapeutic administration

[0046] Various methods may be used to administer the therapeutic compositions. In many embodiments, the compositions may be injected into the eye of a patient, for example the compositions may be delivered intravitreally, for example by intravitreal injection.

[0047] Various dosing regimen may be employed for treating a patient with the disclosed compositions and methods. In many embodiments, the patient may be administered a composition comprising between about IxlO8and IxlO12copies of the disclosed DJ-1 gene or viral genomes (vg) comprising the DJ-1 gene per eyeball, for example more than about IxlO8, IxlO9, IxlO10, or IxlO11vg per eyeball, and less than about IxlO12. IxlO11. IxlO10, or IxlO9vgper eyeball. In many embodiments, the composition may be a liquid formulation comprising from about IxlO9to IxlO12vg per milliliter (mL). In many embodiments, the volume of liquid composition injected may be between about 10 pl and 100 pl, for example more than 20 pl, 30 pl, 40 pl, 50 pl, 60 pl, 70 pl, 80 pl. 90 pl, 100 pl, and less than about 100 pl, 90 pl. 80 pl, 70 pl, 60 pl, 50 pl, 40 pl, 30 pl, or 20 pl. In some embodiments, the disclosed compositions may be administered once or more than once, in some embodiments, the composition maybe administered 1, 2, 3, 4, 5, 6, 7, 8. 9, or 10 times in a year. In most cases, the eye of the patient may be examined about 2, 3. 4, 5, 6 or more weeks after injection to assess progression of the disease.

[0048] To assess the impact of diabetes on DJ-1 expression in retinal capillaries, crosssections of human retinas, obtained from non-diabetic (ND) donors, diabetic donors without retinopathy (DB), and diabetic donors with retinopathy (DR), were subjected to immunostaining for to identify DJ-1 as well as vWF, an endothelial cell marker. Applicants detected DJ-1 in retinal capillaries with colocalization of vWF in ND and DB retinas. However, retinas from donors with DR exhibited a lower intensify of DJ-1 staining. DJ-1 expression in human retinas was also studied using western blotting.

[0049] Applicants have identified a reduction in DJ-1 levels in the retinas of diabetic patients, especially those with retinopathy. Specifically, Applicants identified a reduction of 4% and 32% in DJ-1 levels in the DB and DR retinas, respectively, compared to retinas from nondiabetic donors. In some embodiments, DJ-1 expression in the retinas of patients with diabetes may be reduced from about 3% to about 60%, for example reduced more than 3%, 4%. 5%, 6%, 7%, 8%, 9%. 10%. 15%. 20%. 25%. 30%. 35%. 40%. 45%. 50%. 55%. or 60% and less than about 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5%.

[0050] High glucose concentrations also resulted in reductions in DJ-1 expression.Specifically, ulturing HREC with high glucose (HG, 25 mM). to induce diabetes-like stress, also significantly reduced DJ-1 expression compared to cells cultured with control levels of glucose (5 mM).

[0051] Treating HREC with pro-inflammatory cytokine mixture (CM) activated caspase-3 by 19.4-fold (p<0.0001). Co-treatment of HREC with isatin and CM resulted in a further increase in cleaved caspase-3 (26.9-fold over control, and 1.4-fold over CM-treated cells, p<0.001). Applicants hypothesized, from these results, that DJ-1 may play a protective role against CM- induced apoptosis in HRECs.

[0052] Applicant investigated the relationship between NF-kB and DJ-1. First, Applicants treated HREC with CM, resulting in NF-kB activation, as indicated by the translocation of p65subunit into the nucleus. Specifically, Applicants measured a 1.6-fold increase in NF-kB activation compared to controls cells. Co-treatment of HREC with isatin and CM further increased p65 levels in the nucleus - about 4.0-fold compared to controls.

[0053] Applicants hypothesized, from these results, that DJ-1 may help prevent NF-kB activation during inflammatory stress in HREC. Applicants also showed that treatment of HREC with CM promoted the translocation of Nrf2 into the nucleus, which suggested a protective mechanism against oxidative damage. Treatment of HREC with isatin and CM significantly reduced (pO.OOOl) translocation of Nrf2 compared to CM treatment alone. These results indicated that DJ-1 may contribute to Nrf2 activation. Isatin-induced inhibition of DJ-1 activity exhibited contrasting outcomes in HREC in response to CM; there was a notable increase in the nuclear translocation of NF-kB and a decrease in Nrf2. From these results, Applicants hypothesized that DJ-1 may be involved in regulating the antioxidant mechanism.

[0054] Applicants overexpressed DJ-1 in retinal endothelial cells using adeno-associated virus (AAV) serotype 2 (AAV2)-mediated transduction. 6 weeks after receiving a single intravitreal injection of AAV2-DJ-1, retinal homogenates were subjected to western blotting for human DJ-1. These studies showed an increase in DJ-1 levels of about 1.4-fold (p<0.01). Additionally, transduction of AAV2-DJ-1 also substantially increased DJ-1 levels in the capillaries. Co-staining for vWF showed that DJ-1 is highly expressed in endothelial cells.

[0055] 4 weeks after receiving a single AAV2-DJ-1 injection, retinas were subjected to ischemic / reperfusion (I / R) injury. Following I / R injury, mice were sacrificed after 2 weeks, and their retinal capillary beds were prepared and stained with periodate-Schiff staining to visualize acellular capillaries. These studies showed that 1 / R injury increased the acellular capillary numbers to 2.1 -fold from the baseline in untreated mice. However, mice treated with AAV2-DJ- 1 showed a significant (p<0.001) reduction in acellular capillary numbers of about 1.4-fold (p<0.01 when compared to I / R). In some embodiments, patients treated with the disclosed compositions and methods may experience a decrease in the number of acellular capillaries, relative to an patient that does not receive treatment. In many embodiments, the decrease may be from about 10% to about 50%, for example a decrease greater than about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50%, and less than about 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, or 10%. In other embodiments, treating an eye of the patient with the disclosed compositions and methods may result in halting or slowing the increase in acellular capillaries in that eye, relative an untreated eye.

[0056] The DJ-1 overexpression alone did not cause the formation of acellular capillaries. Together, these results suggest that DJ-1 expression in endothelial cells may protect retinal capillaries from ischemia / reperfusion injury.

[0057] Applicants show that diabetes affects the levels of DJ-1 in human retina. Further, Applicants also show that DJ-1 plays a role in protecting against ischemic damage in retinal capillaries and oxidative and inflammatory damage and apoptosis of HREC. Upregulation of cleaved caspase-3 in inflammatory cytokine-exposed HREC and exacerbation of that effect when a DJ-1 inhibitor is included point to the protective role of DJ-1 against apoptosis in retinal endothelial cells. In many embodiments, the disclosed compositions and methods may prevent apoptosis of retinal endothelial cells and / or slow the increase in the number of apoptotic retinal endothelial cells in a treated patient.

[0058] Applicants show that retinal DJ-1 levels are reduced in human diabetic retinas, especially those with DR. In DR, inflammatory and oxidative stress are elevated. The reduced levels of DJ-1 may increase oxidative stress in the retina, as DJ-1 has been shown to possess strong antioxidative activity. Oxidative stress in DR can occur from the activation of biochemical pathways, such as the polyol pathway, excessive AGE synthesis, or damage to mitochondrial electron transport chain proteins. In many embodiments, the disclosed compositions and methods may be useful in preventing or slowing reduction of DJ-1 levels in retinal endothelial cells and / or may increase the DJ-1 levels in retinal endothelial cells of a treated patient.

[0059] Applicants also show that HREC treated with isatin had decreased levels of Nrf2. implicating DJ-1 in helping protect oxidative stress by upregulating Nrf2. Nrf2 is a transcription factor that regulated the synthesis of several anti-oxidative enzymes, including GSH peroxidase and SOD2. Nrf2 levels have been shown to be upregulated in diabetic retinas, without wishing to be restricted by theory, this upregulation may be via a DJ-1 -dependent mechanism. Applicant’s results suggest that DJ-l’s activity may be required for Nrf2 synthesis. For example, the absence of Nrf2 promotes retinal capillary cell death in mice subjected to I / R stress. It has been observed that Keapl is elevated under hyperglycemic conditions in retinal endothelial cells. Since Keapl sequesters and promotes the degradation of Nrf2, its elevation promotes Nrf2 degradation and increases oxidative stress. Studies have suggested that DJ-1 may affect the transcriptional functions and stability of Nrf2. DJ-1 appears to be important for retinal endothelial cells through its regulation of antioxidative pathways via Nrf2.

[0060] Applicants have shown that inhibition of DJ-1 by isatin enhanced the nuclear localization of NF-kB in HREC. This result suggested that DJ-1 may inhibit NF-kB activation inHREC. NF-kB activation has been well documented in DR. Studies have shown that in the absence of DJ-1, NF-kB may be activated in cells.

[0061] Overexpression of DJ-1 or its activation may benefit the diabetic retina by reducing NF-kB activation. Applicants demonstrate that DJ-1 may help protect retinal endothelial cells by inhibiting AGE formation and inflammatory, oxidative and nitrosative stress. Without wishing to be restricted by theory, Applicants hypothesized that these mechanisms may contribute to the inhibition of retina capillary degeneration in mice treated with AAV2-DJ-1 and subjected to I / R injury.

[0062] Applicants used the Tie2 promoter to drive the expression of DJ-1 in endothelial cells. These studies showed that high levels of DJ-1 expression in retinal capillaries and the ability of transduced DJ-1 to prevent capillary' degeneration in endothelial cells strongly indicate that using AAV2 to deliver DJ-1 may help reduce early damage in DR. The early intervention will likely reduce subsequent pathologies that lead to vision-threatening proliferative DR.

[0063] The disclosed compositions include a coding sequence for the DJ-1 gene sequence. In many embodiments the disclosed DJ-1 sequence may code for a protein that is 80% identical, or greater, to the protein coded for by accession numbers BC_002187. 1 or NM_007262.5, for example the protein may have an identity greater 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% to the protein coded for by the sequences of accession numbers BC002187 or NM_007262.5. In many embodiments, the composition may include a sequence that codes for a protein at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the protein coded for by the sequenceATGGCTTCCAAAAGAGCTCTGGTCATCCTGGCTAAAGGAGCAGAGGAAATGGAGAC GGTCATCCCTGTAGATGTCATGAGGCGAGCTGGGATTAAGGTCACCGTTGCAGGCCT GGCTGGAAAAGACCCAGTACAGTGTAGCCGTGATGTGGTCATTTGTCCTGATGCCAG CCTTGAAGATGCAAAAAAAGAGGGACCATATGATGTGGTGGTTCTACCAGGAGGTA ATCTGGGCGCACAGAATTTATCTGAGTCTGCTGCTGTGAAGGAGATACTGAAGGAG CAGGAAAACCGGAAGGGCCTGATAGCCGCCATCTGTGCAGGTCCTACTGCTCTGTTG GCTCATGAAATAGGTTTTGGAAGTAAAGTTACAACACACCCTCTTGCTAAAGACAA AATGATGAATGGAGGTCATTACACCTACTCTGAGAATCGTGTGGAAAAAGACGGCC TGATTCTTACAAGCCGGGGGCCTGGGACCAGCTTCGAGTTTGCGCTTGCAATTGTTG AAGCCCTGAATGGCAAGGAGGTGGCGGCTCAAGTGAAGGCTCCACTTGTTCTTAAA GACTAG (Sequence 1; human DJ-1 coding sequence).

[0064] The disclosed composition may include a vector comprising a DJ-1 gene. In most embodiments, the DJ-1 gene is a mammalian gene, for example a human gene. In many embodiments, the DJ-1 gene is coded for by Sequence 1, or a sequence that codes for a protein that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the protein coded for by Sequence 1. In many embodiments the coding sequence of DJ-1 may be adjacent a promoter, such as a Tie2 promoter, for example the Tie 2 promoter with the sequence cactagcttactaagatctaatgaaaatcaagatgctaggcacagtgccagatactttaacatagtaatatgactctttagagttttgagacagg gcctcatatagtttatgatgaattcactgttttgtcaaagatgaccttgaactcttaatccattcccaaagtgttgttgtcatatgtttgcaccactcct ggcttcatagtgtttttaaaacacccatggagagtcgggtgtgaagatccacacgtctaacctcagcatctggtgaatcaaggcaggagggc gggtggttgcaggctggctataatatctaagtttcagttagtaagggctgcataatgaaacactgtcttaaacacaaaaccaaaacccatgaa ggagatactattgccatttaaaagtctctggaatggaaatagctatcataatcttacctctgagccagtgtctgccctcaggtgtgcctgaggac tgaacagggctatgcactcctcaggttggaaacattactagtcctcagtgtctgctcttgacctgttaacagctgagtcagggtctgccctcag ctgtgcctgaggacagagctgagctatctacccctgcagattggaagcattacaggcactcaagatcagccctgaagtgataaaacctaag gcagaaatccaccaagactagcagtgcctccgtgtctcttcctgtggctggtgggaaagagaggggcagtccttccttgatgcaaggtcgt gtgtctagtggcacgcttccttcattcccagtgagagcaagtgatcacctgggtaaggaaggttcaggtgcctgagctcgctggagaattcat cactcatccatcactctgctcctgtagacataatcacttctgttgggtctttatagagatgatttataactttgttgtttatagtttttatgaatgtgtgta ttcatttaggtcacatgggaggtacacattttcaggtgtctgtctttccatcacacgggctttgaattaaactcagtcttggttttaccggctgagc catctcacctgcctgattatttaaaaatctccggagtaatccaggagtgtggtttatgattgtagtatcaacactcgggaggctgagggagcat cgttatcatgagctccaggctagttccaggcttgcctaagctgtagagcaagtcactctcttaaaaagtgcctctcccatatttttgtatataattt gcatctgaaattctgtttgccaataactatgaaattattcacattactaaaatcttcctgtgccaagttctccaacgaattagatcacactcagatg aaatgctaataaaaattaaagctgtagccagtagcatgcgtatatttgggctcagggccaacaggcaggcgatctgggtgtaagaaaatagg ctaatggctgtggaatctggtctctagtggctccgctgagagctgacctcaaccacgctccctcaaattgattgccttccaggttatgatttctca tcacaggaaactttgttgcccaattcaaaccctgtgagtgaaaacaaaaacaggagagcaagtgctgctccccgtgccccaaagccccttct gtcagggatcccaaatgcaccccagagaacagcttagcctgcaagggctggtcctcatcgcataccatacataggtggagggcttgttattc aattcctggcctatgagaggatacccctattgttcctgaaaatgctgaccaggaccttacttgtaacaaagatccctctgccccacaatccagtt aaggcaggagcaggagccggagcaggagcagaagataagccttggatgaagggcaagatggatagggctcgctctgccccaagccct gctgataccaagtgcctttaagatacagcctttcccatcctaatctgcaaaggaaacaggaaaaaggaacttaaccctccctgtgctcagaca gaaatgagactgttaccgcctgcttctgtggtgtttctccttgccgccaacttgtaaacaagagcgagtggaccatgcgagcgggaagtcgc aaagttgtgagttgttgaaagctagtaagcttgcggccgctctag (Sequence 2). In many embodiments t

[0065] The disclosed vector may be an adeno-associated virus (AAV) vector. In may embodiments AAV serotype 2, or AAV2. The disclosed AAV2 vector may include a human DJ- 1 gene, for example Sequence 1. The vector may include a nucleotide sequence that is at least about 80%, 81%, 82%, 83%. 84%. 85%. 86%. 87%. 88%. 89%. 91%. 92%, 93%, 94%, 95%,96%, 97%, 98%, or 99% identical to the sequence: ggggggggggggggggggttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccg ggctttgcccgggcggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctagatctgaattcg gtaccgggccccccctcgaggtcgacactagcttactaagatctaatgaaaatcaagatgctaggcacagtgccagatactttaacatagta atatgactctttagagttttgagacagggcctcatatagtttatgatgaattcactgttttgtcaaagatgaccttgaactcttaatccattcccaaa gtgttgttgtcatatgtttgcaccactcctggcttcatagtgtttttaaaacacccatggagagtcgggtgtgaagatccacacgtctaacctcag catctggtgaatcaaggcaggagggcgggtggttgcaggctggctataatatctaagtttcagttagtaagggctgcataatgaaacactgtc ttaaacacaaaaccaaaacccatgaaggagatactattgccatttaaaagtctctggaatggaaatagctatcataatcttacctctgagccagt gtctgccctcaggtgtgcctgaggactgaacagggctatgcactcctcaggttggaaacattactagtcctcagtgtctgctcttgacctgtta acagctgagtcagggtctgccctcagctgtgcctgaggacagagctgagctatctacccctgcagattggaagcattacaggcactcaaga tcagccctgaagtgataaaacctaaggcagaaatccaccaagactagcagtgcctccgtgtctcttcctgtggctggtgggaaagagaggg gcagtccttccttgatgcaaggtcgtgtgtctagtggcacgcttccttcattcccagtgagagcaagtgatcacctgggtaaggaaggttcag gtgcctgagctcgctggagaattcatcactcatccatcactctgctcctgtagacataatcacttctgttgggtctttatagagatgatttataactt tgttgtttatagtttttatgaatgtgtgtattcatttaggtcacatgggaggtacacattttcaggtgtctgtctttccatcacacgggctttgaattaa actcagtcttggttttaccggctgagccatctcacctgcctgattatttaaaaatctccggagtaatccaggagtgtggtttatgattgtagtatca acactcgggaggctgagggagcatcgttatcatgagctccaggctagttccaggcttgcctaagctgtagagcaagtcactctcttaaaaag tgcctctcccatatttttgtatataatttgcatctgaaattctgtttgccaataactatgaaattattcacattactaaaatcttcctgtgccaagttctc caacgaattagatcacactcagatgaaatgctaataaaaattaaagctgtagccagtagcatgcgtatatttgggctcagggccaacaggca ggcgatctgggtgtaagaaaataggctaatggctgtggaatctggtctctagtggctccgctgagagctgacctcaaccacgctccctcaaa ttgattgccttccaggttatgatttctcatcacaggaaactttgttgcccaattcaaaccctgtgagtgaaaacaaaaacaggagagcaagtgct gctccccgtgccccaaagccccttctgtcagggatcccaaatgcaccccagagaacagcttagcctgcaagggctggtcctcatcgcatac catacataggtggagggcttgttattcaattcctggcctatgagaggatacccctattgttcctgaaaatgctgaccaggaccttacttgtaaca aagatccctctgccccacaatccagttaaggcaggagcaggagccggagcaggagcagaagataagccttggatgaagggcaagatgg atagggctcgctctgccccaagccctgctgataccaagtgcctttaagatacagcctttcccatcctaatctgcaaaggaaacaggaaaaag gaacttaaccctccctgtgctcagacagaaatgagactgttaccgcctgcttctgtggtgtttctccttgccgccaacttgtaaacaagagcga gtggaccatgcgagcgggaagtcgcaaagttgtgagttgttgaaagctagtaagcttgcggccgctctagaggatccggtactcgaggaa ctgaaaaaccagaaagttaactggtaagtttagtctttttgtcttttatttcaggtcccggatccggtggtggtgcaaatcaaagaactgctcctc agtggatgttgcctttacttctaggcctgtacggaagtgttacttctgctctaaaagctgcggaattgtacccgcggccgcgccaccATGG CTTCCAAAAGAGCTCTGGTCATCCTGGCTAAAGGAGCAGAGGAAATGGAGACGGTC ATCCCTGTAGATGTCATGAGGCGAGCTGGGATTAAGGTCACCGTTGCAGGCCTGGCT GGAAAAGACCCAGTACAGTGTAGCCGTGATGTGGTCATTTGTCCTGATGCCAGCCTT GAAGATGCAAAAAAAGAGGGACCATATGATGTGGTGGTTCTACCAGGAGGTAATCT GGGCGCACAGAATTTATCTGAGTCTGCTGCTGTGAAGGAGATACTGAAGGAGCAGG AAAACCGGAAGGGCCTGATAGCCGCCATCTGTGCAGGTCCTACTGCTCTGTTGGCTCATGAAATAGGTTTTGGAAGTAAAGTTACAACACACCCTCTTGCTAAAGACAAAATG ATGAATGGAGGTCATTACACCTACTCTGAGAATCGTGTGGAAAAAGACGGCCTGAT TCTTACAAGCCGGGGGCCTGGGACCAGCTTCGAGTTTGCGCTTGCAATTGTTGAAGC CCTGAATGGCAAGGAGGTGGCGGCTCAAGTGAAGGCTCCACTTGTTCTTAAAGACT AGgcggccgcggggatccagacatgataagatacatgatgagttggacaaaccacaactagaatgcagtgaaaaaaatgcttatttgt gaaattgtgatgctattgctttatttgtaaccatataagctgcaataaacaagttaacaacaacaattgcattcatttatgttcaggtcagggg gaggtgtgggaggttttttagtcgacctcgagcagtgtggttttgcaagaggaagcaaaaagcctctccacccaggcctggaatgtttccac ccaagtcgaaggcagtgtggttgcaagaggaagcaaaaagcctctccacccaggcctggaatgttccacccaatgtcgagcaacccc gcccagcgtctgtcatggcgaattcgaacacgcagatgcagtcggggcggcgcggtcccaggtccactcgcatataaggtgacgcgt gtggcctcgaacaccgagcgaccctgcagccaatatgggatcggccattgaacaagatggattgcacgcaggttctccggccgcttgggt ggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggt tctltttgtcaagaccgacclglccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttcct tgcgcagctgtgctcgacgtgtcactgaagcgggaagggactggctgctatgggcgaagtgccggggcaggatctcctgtcatctcacc ttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccatcgaccaccaagcg aaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgcc agccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcat ggtggaaaatggccgcttctggatcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgtggctacccgtgata tgctgaagagctggcggcgaatgggctgaccgctcctcgtgcttacggtatcgccgctcccgatcgcagcgcatcgcctctatcgcc ttcttgacgagtcttctgaggggatccgtcgactagagctcgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccct cccccgtgccttccttgaccctggaaggtgccactcccactgtccttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcat tctattctggggggtggggtggggcaggacagcaagggggaggatgggaagacaatagcaggcatgctggggagagatctaggaac ccctagtgatggagtggccactccctctctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgaccttg gtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaacccccccccccccccccctgcagccctgcataatgaat cggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcgg cgagcggtatcagctcactcaaaggcggtaatacggtatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggcca gcaaaaggccaggaaccgtaaaaaggccgcgtgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctc aagtcagaggtggcgaaacccgacaggactataaagataccaggcgttccccctggaagctccctcgtgcgctctcctgttccgaccctg ccgcttaccggatacctgtccgcctttctccctcgggaagcgtggcgcttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgt tcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgcctatccggtaactatcgtctgagtccaacccggtaa gacacgactatcgccactggcagcagccactggtaacaggatagcagagcgaggtatgtaggcggtgctacagagtctgaagtggtg gcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttacctcggaaaaagagtggtagctcttgatcc ggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatc tttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatcctttta aattaaaaatgaagttltaaatcaatctaaagtatalalgagtaaactlggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaat gataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgca actttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgcta caggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtg caaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataatt ctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgct cttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactct caaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggt gagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattatt gaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccga aaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggccctttcgtctcgcgcgtttcg gtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgt cagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgcgg tgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgttaaat cagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttgga acaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcac cctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagcc ggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgta accaccacacccgccgcgcttaatgcgccgctacagggcgcgtcgcgccattcgccattcaggctacgcaactgttgggaagggcgatc ggtgcgggcctcttcgctattacgccaggctgca (Sequence 3; pTR-Tie2-hDJ-l).EXAMPLESExample 1 - MethodsDetection of DJ- 1 in human retinas

[0066] Human cadaver eyes were obtained from Non-diabetic, ND (66.8 ± 5.8 Y, 6 (5M:1F) Diabetic. DB (68.2 ± 4.0 Y, 6 (5M: 1F) diabetic with retinopathy, DB DR (67.0 ± 6.2, 6 (5M: 1F) within 10 h post-mortem from Eversight Eye Bank. Post-mortem human eyes were obtained from Eversight Eyebank. For all donors, both globes were collected within lOh of death, with one eye immediately frozen while the contralateral eye was immersed and fixed in 10% formalin for 24h prior to being transferred into PBS for shipping. Once received, the fixed samples were dissected and cryoprotected by sucrose gradient processing before being embedded in a 2: 1 mix of 20% sucrose and OCT compound. For the fresh frozen specimen, the retinal tissues were dissected, and retinal homogenates were prepared by sonication in RIPA buffer supplementedwith protease inhibitor. Protein concentrations of retinal homogenates were determined by colorimetric protein assay.

[0067] The retinal homogenates were subjected to western blotting for DJ-1. The cryosectioned retinas were blocked one h, immunolabeled with anti-DJ-1 (1 : 100 dilution, Cat# sc-55572, Santa Cruz Biotechnology, CA) and anti-von Willebrand factor (vWF, 1 :250 dilution, Cat# ab6994, Abeam, Cambridge, MA) overnight at 4°C, and incubated with Alexa Fluor 488 donkey anti-mouse, and Texas red-conjugated goat anti-rabbit IgG (1:500 dilution, Invitrogen, Carlsbad. CA) for 2 h at room temperature. Retinal images were captured with 20X or 40X objective lenses in a Zeiss confocal microscope (Nikon Eclipse Ti, Nikon Instruments Inc., Tokyo, Japan).HREC culture

[0068] HREC were isolated and cultured according to a previously established method. For all experiments, cells at passage numbers between 3 and 8 were used. The HREC w ere cultured in 0.2% gelatin-coated plates with Dulbecco's modified Eagle's medium / F12 containing 10% fetal bovine serum, 15 mg / ml endothelial cell growth supplements, 1 % penicillin / streptomycin, and 1% insulin-transferrin-selenium at 37°C. To determine the effects of inflammatory stress on DJ-1, HREC were incubated with a cytokine mixture (CM) consisting of 10 ng / mL of each TNF- a. IL- 1[3, and IFN-y in serum-free media for 24 h. To inhibit DJ-1 activity’, cells were pre-treated with 500 pM isatin (Cat# 114618, Sigma- Aldrich) for 2 h before the treatment of CM.DJ-1 activity assay in HREC

[0069] HREC were cultured in the presence of 250 pM glyoxal with or without isatin (500 pM). Following 24 h of culture, cells were lysed with RIP A buffer containing a protease inhibitor, and the cell lysates were subjected to western blotting for CML.Nuclear translocation of NF-kB and Nrf2

[0070] HREC w ere seeded at 1 x 106cells in a 60 mm2dish. After 24 h of culture, cells w ere detached. The cytoplasmic and nuclear proteins were separated using NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Cat# 78833, Thermo Scientific), following the manufacturer’s instructions. Ten micrograms of nuclear proteins were subjected to western blot analysis.Western blotting

[0071] Ten micrograms of human retinal homogenates, cell lysate protein, or cell nuclear proteins were subjected to western blot analysis. HRECs were lysed using RIPA buffer containing a protease inhibitor cocktail. Briefly, the proteins were separated on a 12% SDS-PAGE, and the membrane was transferred, incubated with a primary antibody overnight at 4°C. Subsequently, HRP-conjugated anti-mouse (1:5,000 dilution, Cat# 7076S) or anti-rabbit secondary' antibodies (1 :5,000 dilution, Cat#7074S, Cell Signaling Technology) were incubated for 1 h at room temperature. The bands were detected using the SuperSignal Femto Kit (Pierce Chemicals, Dallas, TX) and visualized with ChemiDoc™ XRS+ (BioRad). The band intensity was quantified after normalization with 0-actin or Histone H3 using Image J software. The primary antibodies were as follows: iNOS (Cat# 610431, BD bioscience, Billerica, MA), Cleaved caspase-3 (Cat# 9664S), NF-kB (Cat# 3034S), Nrf2 (Cat# 8882S). (3-actin and Histone H3 (Cat# 4499S, Cell Signaling Technology).Construction of AAV2-Tie2-DJ-l Vector

[0072] AAV2-DJ-1 driven by the Tie2 promoter was developed for endothelial-specific expression of DJ-1 . For this construct, the murine DJ-1 cDNA was cloned between the Tie2 promoter and an SV40 poly adenylation element in the pTR-AAV plasmid that contains flanking wild-type AAV2 internal terminal repeat elements. After sequence verification, this plasmid was used to package Tie2-DJ-l into AAV serotype 2 using the triple-plasmid transfection method in human embry onic kidney cells (HEK-293T), followed by iodixanol gradient isolation and anion exchange chromatography as previously described. Any contaminating endotoxins were removed (Pierce High Capacity' Endotoxin Removal Resin, ThermoFisher), and endotoxin levels measured to be <5 endotoxin units / mL (Endosafe LAL, Charles River). All cloning, AAV production, and testing were conducted by the Ocular Gene Therapy Core at the University of Florida, Gainesville, FL. In other embodiments, the adeno-associated virus may be selected from serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9. 10, or 11.Intravitreal injection of AAV2-DJ-1 and retinal ischemic / reperfusion (I / R) injury'

[0073] All animal experiments adhered to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Mice were subjected to retinal I / R injury as previously described. They were randomly assigned into two groups: 1 / R injury-only group or I / R injury’ and AAV2-DJ-1 treated group. 1 pl of a composition comprising AAV2-DJ-1 (1X109vector genome / 1 pL) was injected intravitreally into both eyes. After four weeks, mice were subjected to I / R injury in their right eye, and then they were euthanized on day 14 post-injury. In the I / R injury-only group, vehicle (HBSS) was injected intravitreally.Retinal capillary bed preparation and staining

[0074] Fourteen days after the I / R injury, mice were sacrificed, and their eyes were enucleated. Retinas were dissected under light microscopy and incubated in elastase (40 U / mL, pH 6.8, Cat# 324682-250U, EMD Millipore, Billerica, MA) for 40 min at 37°C with gentleagitation. Retinas were then incubated in 100 mM Tris buffer, pH 8.5 on a rocker for 30 min at room temperature. The inner limiting membrane was carefully removed under a light microscope and shaken overnight at room temperature to loosen the remaining neural cells. The retinas were then transferred to glass microscopy slides, and the remaining neuronal tissues were removed through gentle agitation produced by a 20 pL pipette using Tris-HCl. Periodic acid Schiff (PAS) and Hematoxylin and Eosin (H&E) staining were used to visualize the retinal capillaries. Images were acquired with a widefield microscope (Nikon ECLIPSE Ti2, Japan). Acellular capillaries were counted and expressed as numbers per mm2of retina.DJ-1 overexpression in retina capillary

[0075] The retina capillaries were prepared and stained with PAS and H&E staining, as above. The capillaries were circled with a Pap pen and blocked in a solution of 5% normal donkey serum and 1% Triton X-100 in PBS for 1 h. The capillaries were immunostained overnight at 4°C with anti-DJ-1) and anti-vWF. The next day, the capillaries were incubated with goat anti-mouse Alexa 488 (1: 1000 dilution. Cat# A-l 1001. Invitrogen. Carlsbad, CA) for 2 h and Texas red- conjugated goat anti-rabbit IgG antibody (1: 1000 dilution, Cat# T-2767, Invitrogen). Five random regions of the capillary were imaged using a Zeiss confocal microscope (Nikon Eclipse Ti, Japan).Statistical analysis

[0076] Statistical analyses were conducted using GraphPad Prism software version 10 (GraphPad Prism Software, Inc., San Diego, CA). One-way ANOVA and multicomparison tests were utilized to assess the significance of differences among the groups. A p-value of <0.05 was considered statistically significant.Example 2 - DJ-1 levels are reduced in human DR retinas

[0077] To assess the impact of diabetes on DJ-1 expression in the retinal capillaries, crosssections of human retinas, obtained from non-diabetic (ND), diabetic without retinopathy (DB), and diabetic with retinopathy (DR) donors, were subjected to immunostaining for DJ-1 (green) along with vWF (red), an endothelial cell marker. DJ-1 was detected in retinal capillaries with colocalization of vWF in ND and DB retinas, while retinas with DR exhibited a lower intensity of DJ-1 staining (Fig. 1A). Next, we quantified the DJ-1 expression in human retinal homogenates by western blotting. The results indicated a reduction of 4% and 32% in DJ-1 levels in the DB and DR retinas, respectively, when compared to the ND (Fig. IB). HREC were cultured with high glucose (HG, 25 mM) to induce diabetes-like stress. Culturing with highglucose resulted in a significant reduction in DJ-1 expression compared to cells cultured with control levels of glucose (5 mM) (Fig. 1C).Example 3 - Isatin inhibits DJ-1 activity in HREC

[0078] To investigate whether DJ-1 is catalytically active in HREC, we incubated HREC with isatin. The cell viability assays indicated that isatin is non-toxic to HREC up to a concentration of 500 pM, and a slight decrease in cell viability was observed at concentrations of 750 and 1000 pM, although the differences were not statistically significant Based on this result, a concentration of 500 pM was employed in all subsequent experiments. Previous studies have reported that DJ-1 inhibits the formation of advanced glycation end products (AGEs) in proteins, although the mechanism is controversial. CML is a major AGE in proteins and it is formed from glycation by glyoxal and other carbohydrates. Western blotting results revealed the accumulation of CML in several cellular proteins following glyoxal treatment (Fig. 2B). Treatment with isatin further increased the levels of CML. Densitometric measurements showed a 2.8-fold increase of CML in glyoxal-treated cells (p<0.05) and a 5.1-fold increase after glyoxal + isatin treatment (p<0.01) over controls (Fig. 2C). indicating isatin was effective in inhibiting DJ-l ’s cellular activity.Example 4 - Inhibition of DJ-1 enhances iNOS

[0079] Next, we assessed whether DJ-1 has a role in the expression of iNOS in response to pro-inflammatory cytokines in HREC. Fig 3A shows that treating HREC with CM increased iNOS expression (a 6.6-fold increase over control). This increase was further accentuated in the presence of isatin (a 4.0-fold increase over CM-treated, pcO.001), suggesting that the reduction of DJ-1 induces the inflammation-mediated iNOS expression in HREC.Example 5 - DJ-1 inhibits CM-mediated apoptosis in HREC

[0080] Treatment of CM activated caspase-3 by 19.4-fold (p<0.0001) in HREC, as indicated by cleaved caspase-3 in cell lysates (Fig. 3B). Co-treatment of isatin and CM resulted in a more pronounced increase in cleaved caspase-3 (26.9-fold over control, and 1.4-fold over CM-treated cells, p<0.001), suggesting that DJ-1 plays a protective role against CM-induced apoptosis in HRECs.Example 6 - DJ-1 inactivation reduces NF-kB and Nrf2

[0081] NF-kB activation, as indicated by the translocation of p65 subunit into the nucleus, exhibited a 1.6-fold increase over controls in HREC treated with CM (Fig. 4A). Co-treatment of isatin along with CM significantly (p<0.001) elevated p65 levels by 4.0-fold in the nucleuscompared to control. This result suggests that DJ-1 prevents NF-kB activation during inflammatory' stress in HREC. Treatment of CM promoted the translocation of Nrf2 into the nucleus in HREC (Fig. 4B), possibly as a protective mechanism against oxidative damage. The treatment of isatin and CM significantly reduced (pO.OOOl) the translocation of Nrf2 when compared to CM, indicating that DJ-1 likely contributes to Nrf2 activation. Isatin-induced inhibition of DJ-1 activity exhibited contrasting outcomes in HREC in response to CM; there was a notable increase in the nuclear translocation of NF-kB and a decrease in Nrf2. These results suggest a plausible involvement of DJ-1 in regulating the antioxidant mechanism.Example 7 - DJ-1 transduction protects I / R-induced retinal capillary degeneration in mice

[0082] Next, we overexpressed the levels of DJ-1 in retinal endothelial cells using AAV2- mediated transduction. After 6 weeks of intravitreal injection of AAV2-DJ-1. retinal homogenates were subjected to western blotting for human DJ-1. As shown in Fig. 5A, the DJ-1 levels increased 1.4-fold (p<0.01 ) following mediated DJ-1 transduction. Additionally, retinas digested with elastase and the capillary' preparations subjected to immunofluorescence staining for DJ-1 showed that AAV2-DJ-1 treatment substantially increased DJ-1 levels in the capillaries (Fig. 5B). Co-staining for vWF showed that DJ-1 is highly expressed in endothelial cells.

[0083] I / R injury was instituted after 4 weeks of AAV2-DJ-1 injection. Following I / R injury, mice were sacrificed after 2 weeks, and their retinal capillary beds were prepared and stained with periodate-Schiff staining to visualize acellular capillaries. The I / R injury' increased the acellular capillary numbers to 2. 1-fold from the baseline in untreated mice (Fig. 5C). However, prior expression of DJ-1 significantly (p<0.00I) reduced acellular capillary numbers by 1.4-fold (p<0.01 when compared to I / R) (Fig. 5D). The DJ-1 overexpression alone did not cause the formation of acellular capillaries. Together, these results suggest that DJ-1 expressed in endothelial cells protects retinal capillaries from ischemia / reperfusion injury. While multiple embodiments are disclosed, still other embodiments of the present invention will become apparent to those skilled in the art from the following detailed description. As will be apparent, the invention is capable of modifications in various obvious aspects, all without departing from the spirit and scope of the present invention. Accordingly, the detailed description is to be regarded as illustrative in nature and not restrictive.

[0084] All references disclosed herein, whether patent or non-patent, are hereby incorporated by reference as if each was included at its citation, in its entirety'. In case of conflict between reference and specification, the present specification, including definitions, will control.

[0085] Although the present disclosure has been described with a certain degree of particularity, it is understood the disclosure has been made by way of example, and changes indetail or structure may be made without departing from the spirit of the disclosure as defined in the appended claims.

Claims

CLAIMSWe claim:

1. A composition for use in treating retinopathy in a patient in need thereof, the composition comprising: a nucleic acid coding sequence for a DJ-1 gene; a nucleic acid sequence comprising a promoter for regulating expression of the DJ-1 sequence; a nucleic acid sequence comprising a polyadenylation site.

2. The composition of claim 1, comprising an adeno-associated virus (AAV) vector comprising the DJ-1 gene, the promoter and the polyadenylation site, wherein the AAV is serotype 2.

3. The composition of claim 1 or 2, wherein the polyadenylation site is an SV40 polyadenylation site.

4. The composition of any one of claims 1-3. wherein the promoter is a Tie-2 promoter.

5. The composition of any one of claims 1-4, wherein the nucleic acid coding sequence for the DJ-1 gene is more than 80% identical to human DJ-1.

6. The composition of any one of claims 1-5, wherein the composition is a liquid composition.

7. The composition of any one of claims 1-6. wherein the composition comprises between IxlO8and IxlO12copies of the DJ-1 gene per milliliter.

8. The composition of any one of claims 1-7, wherein the composition comprises IxlO11and IxlO12copies of the DJ-1 gene per milliliter.

9. The composition of any one of claims 1-7, wherein the composition comprises IxlO12copies of the DJ-1 gene per milliliter.

10. A method for treating retinopathy, comprising: administering a therapeutic composition to a patient having or at risk of developing a disease associated with retinal degeneration, the composition comprising: a nucleic acid coding sequence for a DJ-1 gene;a nucleic acid sequence comprising a promoter for regulating expression of the DJ-1 sequence; and a polyadenylation site.1 1 . The method of claim 10, comprising an adeno-associated virus (AAV) vector comprising the DJ-1 gene, the promoter and the polyadenylation site, wherein the AAV is serotype 2.

12. The method of claim 10 or 11, wherein the poly adenylation site is an SV40 polyadenylation site.

13. The method of any one of claims 10-12, wherein the promoter is a Tie-2 promoter.

14. The method of any one of claims 10-13, wherein the nucleic acid coding sequence for the DJ-1 gene is more than 80% identical to human DJ-1.

15. The method of any one of claims 10-14, wherein the therapeutic composition is a liquid composition.

16. The method of any one of claims 10-15, wherein the therapeutic composition comprises between IxlO8and IxlO12copies of the DJ-1 gene per ml.

17. The method of any one of claims 10-16, wherein the therapeutic composition comprises IxlO11and IxlO12copies of the DJ-1 gene per ml.

18. The method of any one of claims 10-17, wherein the therapeutic composition comprises IxlO12copies of the DJ-1 gene per ml.

19. The method of any one of claims 10-18, wherein the patient is administered between about 10 and 100 pl of the therapeutic composition per eye.

20. The method of any one of claims 10-19, wherein the patient is administered about 100 pl of the therapeutic composition per eye.

21. The method of any one of claims 10-20, wherein the patient is administered the therapeutic composition once per eye.

22. The method of any one of claims 10-21 , wherein the patient is administered the therapeutic composition twice per eye.

23. The method of any one of claims 10-22, wherein the patient is administered a second therapeutic composition more than 1 week after the initial administration.

24. The method of any one of claims 10-23, wherein therapeutic composition is administered by intravitreal injection.

25. The method of any one of claims 10-24, wherein the patient’s retinas are examined prior to administration of the therapeutic compound.

26. The method of any one of claims 10-25, wherein the patient’s retinas are examined a first time prior to administration of the therapeutic compound and a second time after administration of the therapeutic compound.

27. The method of any one of claims 10-26, wherein the patient’s retinas are examined a first time prior to administration of the therapeutic compound and a second time after administration of the therapeutic compound, wherein the after-administration exam determines that retinas have undergone little or no increase in morphological abnormalities.

28. The method of any one of claims 10-27, wherein the patient’s visual acuity is determined a first time prior to administration of the therapeutic compound and a second time after administration of the therapeutic compound, and wherein the patients visual acuity has not deteriorated or has deteriorated less than about 10%.

29. The method of any one of claims 26-28, where in the second time is less than 8 weeks after administration of the therapeutic compound.

30. A method for treating a subject suffering from or at risk of developing a retinal condition, comprising: examining a retina of the subject a first time to determine a starting value for the retina’s structure or function: administering a composition comprising a nucleic acid comprising Sequence 1, or a nucleic acid sequence coding for a protein at least 80% identical to the protein coded for by Sequence 1, to an eye of the subject comprising the retina; examining the subject’s retina a second time to determine a post-administration value for the retina’s structure or function.

31. The method of claim 30, wherein the nucleic acid comprises Sequence 2.

32. The method of claim 30 or claim 31, wherein the nucleic acid comprises Sequence 3.

33. The method of any one of claims 31-32, wherein the retinal condition is selected from retinal degradation, glaucoma, age-related macular degeneration, retinopathy, and diabetic retinopathy, and the structure or function is selected from a morphological abnormality and visual acuity.

34. A composition for use in treating a subject suffering from a retinal condition, comprising: a nucleic acid comprising Sequence 1 , or a nucleic acid sequence coding for a protein at least 80% identical to the protein coded for by Sequence 1; and a pharmaceutically acceptable carrier.

35. The composition of claim 34, wherein the nucleic acid comprises Sequence 2.

36. The composition of claim 34 or claim 35, wherein the nucleic acid comprises Sequence 3.

37. The composition of any one of claims 34-36, wherein the retinal condition is selected from retinal degradation, glaucoma, age-related macular degeneration, retinopathy, and diabetic retinopathy, and the structure or function is selected from a morphological abnormality and visual acuity.

Images