Recombinant adeno-associated virus particle, recombinant adeno-associated virus vector system, and use thereof

Abstract

Provided are a recombinant adeno-associated virus particle, a recombinant adeno-associated virus vector system, and a use thereof. A novel recombinant adeno-associated virus efficiently crossing the blood-brain barrier is prepared, named rAAV32.eB, the capsid thereof being a mutant of the capsid protein AAVhu.32, comprising mutations at two sites, A587D and Q588G, and having the 7-amino acid peptide TLAVPFK inserted between amino acids 588 and 589. A corresponding recombinant adeno-associated virus vector system is also constructed, and an AAV32.eB serotype plasmid is constructed. It is also found that rAAV32.eB has a higher efficiency in transducing neural cells across the blood-brain barrier, and using it for more efficient gene delivery can provide better tools for neuroscience research and the treatment of whole-brain systemic genetic diseases, neurodegenerative diseases, etc.

Description

A recombinant adeno-associated virus particle, a recombinant adeno-associated virus vector system and its application Technical Field

[0001] The present invention relates to the fields of genetic engineering and biotechnology, and in particular to a recombinant adeno-associated virus particle, a recombinant adeno-associated virus vector system and applications thereof. Background Art

[0002] One of the main challenges in neuroscience research and gene therapy for the nervous system is how to efficiently deliver target genes by breaking through the blood-brain barrier. Delivering target genes to the nervous system requires a tool vector. Among the many existing tool vectors, adeno-associated virus (AAV) vectors are widely popular due to their excellent gene delivery efficiency, stable safety, and relatively low cytotoxicity. Adeno-associated virus is a small, non-enveloped, single-stranded DNA virus with an icosahedral structure. To date, no diseases related to AAV have been reported. Therefore, it is recognized as the safest viral vector and has become a hot topic in gene therapy vector research.

[0003] There are numerous AAV serotypes, each with distinct targeting and infection characteristics. AAV type 9 (AAV9) is one of the few naturally occurring AAV serotypes capable of crossing the blood-brain barrier and infecting neural cells. Furthermore, studies have reported that other AAV serotypes, such as AAVhu.32, can also cross the blood-brain barrier (Yoon et al., 2020, 143; 2058–2072). However, although AAVhu.32 is more efficient at crossing the blood-brain barrier than AAV9, its efficiency remains low, failing to meet the goal of efficient delivery across the blood-brain barrier. Further improvement in delivery efficiency is needed.

[0004] Therefore, the existing technology still needs to be improved and developed. Technical issues

[0005] In view of the above-mentioned deficiencies in the prior art, the purpose of the present invention is to provide a recombinant adeno-associated virus particle, a recombinant adeno-associated virus vector system and its application, aiming to solve the problem of low efficiency of current adeno-associated virus vectors crossing the blood-brain barrier. Technical Solutions

[0006] The technical solutions of the present invention are as follows:

[0007] A recombinant adeno-associated virus particle, comprising an AAVhu.32 capsid protein mutant; relative to the wild-type AAVhu.32 capsid protein, the AAVhu.32 capsid protein mutant includes mutations at two amino acid positions 587 and 588, and an amino acid fragment as shown in SEQ. ID NO.1 is inserted between amino acids 588 and 589.

[0008] The recombinant adeno-associated virus particles, wherein the alanine at the 587th amino acid site of the AAVhu.32 capsid protein mutant is mutated to aspartic acid, and the glutamine at the 588th amino acid site is mutated to glycine.

[0009] The recombinant adeno-associated virus particle, wherein the genome of the recombinant adeno-associated virus particle contains an exogenous target gene with a nucleotide sequence encoding a target gene product.

[0010] The recombinant adeno-associated virus particles, wherein the target gene product is a protein, a polypeptide or an interfering RNA.

[0011] A recombinant adeno-associated virus vector system, comprising one or more vectors, at least one of which is a recombinant adeno-associated virus packaging plasmid, wherein the recombinant adeno-associated virus packaging plasmid comprises a nucleic acid fragment for encoding the AAVhu.32 capsid protein mutant as described above.

[0012] The recombinant adeno-associated virus vector system, wherein at least one vector is an adeno-associated virus core plasmid, and the adeno-associated virus core plasmid contains inverted terminal repeat sequences ITR at both ends, a promoter, an exogenous target gene, a transcriptional regulatory element WPRE and a transcription termination sequence hGH polyA.

[0013] In the recombinant adeno-associated virus vector system, at least one vector is an adenovirus element helper plasmid.

[0014] A pharmaceutical composition, characterized in that it comprises the recombinant adeno-associated virus particles described in any one of the above items, and / or the recombinant adeno-associated virus vector system described in any one of the above items.

[0015] Use of the recombinant adeno-associated virus particle as described in any one of the above items and / or the recombinant adeno-associated virus vector system as described in any one of the above items in gene delivery to the central nervous system.

[0016] Use of the recombinant adeno-associated virus particle as described in any of the above items and / or the recombinant adeno-associated virus vector system as described in any of the above items in the preparation of a drug for treating whole-brain systemic genetic diseases or neurodegenerative diseases. Beneficial effects

[0017] The present invention provides a recombinant adeno-associated virus particle, a recombinant adeno-associated virus vector system, and its application. The present invention prepares a new recombinant adeno-associated virus (rAAV) that efficiently crosses the blood-brain barrier, named rAAV32.eB. Its capsid is a mutant of the AAVhu.32 capsid protein. Compared with the wild-type AAVhu32 capsid protein VP1, there are three major position changes, including mutations at two sites, A587D and Q588G, and a 7-amino acid peptide segment TLAVPFK is inserted between amino acids 588 and 589. At the same time, the present invention also constructs a corresponding recombinant adeno-associated virus vector system and an AAV32.eB serotype plasmid. Moreover, the recombinant adeno-associated virus rAAV32.eB prepared by the present invention is infected by intravenous injection. Compared with rAAVhu.32, rAAV32.eB has a higher efficiency in transducing neural cells across the blood-brain barrier. Finally, the present invention obtained a new recombinant adeno-associated virus rAAV32.eB through engineering modification, and used it for more efficient gene delivery, which can provide better tools for neuroscience research and the treatment of whole-brain systemic genetic diseases, neurodegenerative diseases, etc., and has broad application value and market prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] FIG1 is a schematic diagram of the pAAV2 / 32.eB serotype plasmid constructed in accordance with an embodiment of the present invention.

[0019] FIG2 is a schematic diagram of brain tissue slice imaging results provided by an embodiment of the present invention. Modes for Carrying Out the Invention

[0020] The present invention provides a recombinant adeno-associated virus particle, a recombinant adeno-associated virus vector system, and applications thereof. To clarify the objectives, technical solutions, and effects of the present invention, the present invention is described in further detail below. It should be understood that the specific embodiments described herein are intended only to illustrate the present invention and are not intended to limit the present invention.

[0021] An embodiment of the present invention provides a recombinant adeno-associated virus particle, which contains an AAVhu.32 capsid protein mutant; relative to the wild-type AAVhu.32 capsid protein, the AAVhu.32 capsid protein mutant includes mutations at two amino acid sites, 587 and 588, and an amino acid fragment as shown in SEQ. ID NO.1 is inserted between amino acids 588 and 589.

[0022] SEQ. ID NO.1:TLAVPFK

[0023] In some embodiments, the AAVhu.32 capsid protein mutant has an alanine mutation at amino acid position 587 to aspartic acid (A587D), and a glutamine mutation at amino acid position 588 to glycine (Q588G).

[0024] In the present invention, "AAV" is an abbreviation for adeno-associated virus and can be used to refer to the virus itself or its derivatives. Unless otherwise required, the term includes subtypes and naturally occurring and recombinant forms. The abbreviation "rAAV" refers to recombinant adeno-associated virus, also known as recombinant AAV vector. The term "AAV" can be used to refer to adeno-associated viruses of different serotypes, and the genome sequences of different subtypes of AAV, as well as the sequences of natural terminal repeats (ITRs), Rep proteins and capsid subunits are known in the art. Such sequences can be found in the literature or public databases such as gene banks. Recombinant adeno-associated virus particles (abbreviated as "AAV virus particles" or "AAV viruses") refer to virus particles composed of at least one AAV capsid protein and an encapsidated polynucleotide rAAV vector. The recombinant adeno-associated virus particles (named rAAV32.eB) involved in the present invention contain the above-mentioned AAVhu.32 capsid protein mutant.

[0025] To address the low efficiency of rAAVhu.32 in crossing the blood-brain barrier, the present invention has obtained a new recombinant adeno-associated virus (rAAV) that efficiently crosses the blood-brain barrier through genetic engineering. The new recombinant adeno-associated virus is named rAAV32.eB, and its capsid is a mutant of the AAVhu.32 capsid protein. Compared with the AAVhu32 capsid protein VP1, it has three major position changes, including mutations at two sites, A587D and Q588G, and has inserted a 7-amino acid peptide segment TLAVPFK, which is inserted between sites 588 and 589 corresponding to the wild-type AAVhu.32 capsid protein. The recombinant adeno-associated virus rAAV32.eB prepared by the present invention is infected by intravenous injection. Compared with rAAVhu.32, rAAV32.eB has a higher efficiency in transducing neural cells across the blood-brain barrier. Finally, the present invention obtained a new recombinant adeno-associated virus rAAV32.eB (also known as recombinant adeno-associated virus particles) through engineering modification, and used it for more efficient gene delivery, which can provide better tools for neuroscience research and the treatment of whole-brain systemic genetic diseases, neurodegenerative diseases, etc., and has broad application value and market prospects.

[0026] In some embodiments, the genome of the recombinant adeno-associated virus particle comprises an exogenous target gene having a nucleotide sequence encoding a target gene product.

[0027] "Exogenous" refers to an entity that is derived from a genotype that is different from the entity being compared. For example, nucleotides introduced into a plasmid or vector derived from a different species through genetic engineering techniques are exogenous nucleotides. An rAAV comprising an exogenous nucleic acid encoding an exogenous gene product of interest is an rAAV that includes a nucleic acid that is not typically found in naturally occurring wild-type AAV, and the encoded exogenous gene product of interest is a gene product that is not typically encoded by naturally occurring wild-type AAV.

[0028] In some embodiments, the target gene product is a protein.

[0029] In some embodiments, the target gene product is a polypeptide.

[0030] In some embodiments, the target gene product is interfering RNA.

[0031] Specifically, the interfering RNA can be selected from siRNA or shRNA.

[0032] The present invention constructs a new rAAVhu.32 mutant (rAAV32.eB) and uses it for gene delivery; compared with the original AAVhu.32, rAAV32.eB is more efficient in delivering exogenous genes across the blood-brain barrier.

[0033] An embodiment of the present invention also provides a recombinant adeno-associated virus vector system, which comprises one or more vectors, wherein at least one vector is a recombinant adeno-associated virus packaging plasmid, and the recombinant adeno-associated virus packaging plasmid comprises a nucleic acid fragment for encoding the above-mentioned AAVhu.32 capsid protein mutant.

[0034] In some embodiments, the AAVhu.32 capsid protein mutant includes mutations at two amino acid positions 587 and 588, and an amino acid fragment TLAVPFK is inserted between amino acids 588 and 589.

[0035] The nucleic acid fragment of the capsid protein is generally referred to as the Cap gene fragment in the present invention. The rep and Cap genes of AAV refer to polynucleotide sequences encoding the replication and encapsidation proteins of the adeno-associated virus. The rep and Cap genes can be located on the same or different plasmids.

[0036] In some embodiments, the recombinant adeno-associated virus packaging plasmid uses pAAV2 / hu.32 as a backbone and is obtained by synthesizing the full-length gene sequence of the hu.32 capsid (GenBank: AY530597.1) and then replacing the full-length gene sequence corresponding to the capsid (cap2) on pAAV2 / 2 (Brinkase (Shenzhen) Biotechnology Co., Ltd.).

[0037] In some embodiments, the recombinant adeno-associated virus packaging plasmid comprises a rep gene segment of type 2 adeno-associated virus.

[0038] In some embodiments, the AAV32.eB sequence of the recombinant adeno-associated virus packaging plasmid is obtained by mutating AAVhu.32 and inserting a peptide segment, and its Cap gene sequence is shown in SEQ ID NO.2. Compared with AAVhu.32Cap, it has mutations at two sites, A587D and Q588G, and a 7-amino acid peptide segment TLAVPFK is inserted after site 588.

[0039] In some embodiments, at least one vector in the recombinant adeno-associated virus vector system is an adeno-associated virus core plasmid.

[0040] Specifically, the adeno-associated virus core plasmid contains inverted terminal repeat sequences ITR at both ends, a promoter, an exogenous target gene, a transcriptional regulatory element WPRE and a transcriptional termination sequence hGH polyA.

[0041] More specifically, the exogenous target gene includes a reporter gene;

[0042] More specifically, the reporter gene is EGFP;

[0043] In a specific embodiment, the adeno-associated virus core plasmid is pAAV-CMV-EGFP-WPRE-hGH polyA.

[0044] In some embodiments, at least one vector in the recombinant adeno-associated virus vector system is an adenovirus element helper plasmid.

[0045] Specifically, the adenovirus element helper plasmid is pAd-Helper.

[0046] In some embodiments provided by the present invention, the recombinant adeno-associated virus particles are obtained by co-transfecting a packaging cell line with the recombinant adeno-associated virus packaging plasmid, adeno-associated virus core plasmid and adenovirus element helper plasmid.

[0047] In some embodiments, the packaging cell line is selected from HEK-293 cells, HEK-293T cells, or HEK-293FT cells;

[0048] In some embodiments, the molecular numbers of the recombinant adeno-associated virus packaging plasmid, the adeno-associated virus core plasmid, and the adenovirus element helper plasmid are 1:1:1.

[0049] The present invention constructs a recombinant adeno-associated virus packaging plasmid, the AAV32.eB serotype plasmid, and uses it to package recombinant adeno-associated virus particles. The recombinant adeno-associated virus rAAV32.eB-CMV-EGFP-WPRE-hGH polyA was prepared, and the recombinant adeno-associated virus rAAV32.eB prepared by the present invention was verified to be more efficient at transducing neurons across the blood-brain barrier than rAAVhu.32 via intravenous infection. This provides a better tool for neuroscience research and the treatment of systemic genetic diseases and neurodegenerative diseases, and has broad application value and market prospects.

[0050] An embodiment of the present invention further provides a pharmaceutical composition comprising the recombinant adeno-associated virus particles and / or the recombinant adeno-associated virus vector system as described above.

[0051] In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or excipient.

[0052] Specifically, the carriers such as additives and flavoring agents are made into various dosage forms, including powders, tablets, pellets, capsules, microcapsules, granules or liquids.

[0053] The embodiments of the present invention further provide a use of the recombinant adeno-associated virus particle and / or the recombinant adeno-associated virus vector system described above in central nervous system gene delivery.

[0054] The embodiments of the present invention also provide a use of the recombinant adeno-associated virus particles and / or the recombinant adeno-associated virus vector system as described above in the preparation of drugs for treating whole-brain systemic genetic diseases or neurodegenerative diseases.

[0055] The present invention provides a recombinant adeno-associated virus (RAV) vector system for efficiently delivering exogenous genes across the blood-brain barrier to targeted neural cells, and the resulting recombinant AAV. The RAV is a mutant of the hu.32 adeno-associated virus (rAAVhu.32), designated rAAV32.eB. rAAV32.eB carrying the target gene was injected into mice through the tail vein, demonstrating efficient transduction across the blood-brain barrier into the central nervous system. Ultimately, the present invention constructed a novel rAAVhu.32 mutant (rAAV32.eB) for gene delivery. Compared to the original AAVhu.32, rAAV32.eB demonstrates greater efficiency in delivering exogenous genes across the blood-brain barrier, providing a new viral vector for whole-brain neural structure and function research and gene delivery. It has broad application value and promising market prospects in areas such as central nervous system network analysis, disease modeling, and gene therapy.

[0056] The following is a further explanation of a recombinant adeno-associated virus particle, a recombinant adeno-associated virus vector system and its application according to the present invention through specific examples:

[0057] Generally, the nomenclature used in and techniques of cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry described herein are those well known and commonly used in the art. Unless otherwise indicated, the methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references.

[0058] Example 1 Construction of rAAV32.eB vector

[0059] The AAV32.eB sequence was obtained by mutating AAVhu.32 and inserting a peptide segment. Its Cap gene sequence is shown in SEQ. ID NO.2. Compared with AAVhu.32Cap, it has mutations at two sites, A587D and Q588G, and a 7-amino acid peptide segment TLAVPFK is inserted after site 588.

[0060] To construct the AAV32.eB serotype plasmid, this example synthesized primers Mu-32.eB-F (SEQ. ID NO. 3) and Mu-32.eB-R (SEQ. ID NO. 4). Using point mutagenesis, and using plasmid pAAV2 / hu.32 as a template (this plasmid was obtained by synthesizing the full-length gene sequence of the capsid of hu.32 (GenBank: AY530597.1) and then replacing the full-length gene sequence corresponding to the capsid (cap2) on pAAV2 / 2 (Brinkase (Shenzhen) Biotechnology Co., Ltd.)), a PCR reaction was performed using the Fast Mutagenesis System kit to obtain pAAV2 / 32.eB. The details are as follows:

[0061] SEQ. ID NO.3

[0062] GATGGGACTTTGGCGGTGCCTTTTAAGGCACAGGCGCAGACCGGCTGGGTTCAAAACCAAGGAATA

[0063] SEQ. ID NO.4

[0064] CTTAAAAGGCACCGCCAAAGTCCCATCACTCTGGTGGTTTGTGGCCACTTGTCCA

[0065] The PCR reaction system is:

[0066] 2 × TransStart FastPfu Fly PCR SuperMix, 25 μl;

[0067] 10 μM forward primer, 1 μl;

[0068] 10 μM reverse primer, 1 μl;

[0069] Template pAAV2 / hu.32, 2 μl;

[0070] ddH2O, 31 μl.

[0071] The reaction program was as follows: 98°C, 5 min; 36 cycles of {98°C, 30 s; 60°C, 30 s; 72°C, 5 min; 72°C, 10 min}; and 16°C, 30 min.

[0072] The PCR product was digested with 1 μl of the template digestion enzyme DMT at 37°C for 1 hour. A 5 μl aliquot of the digested product was used to transform competent Stbl3 cells. After 16 hours, a single colony was picked and activated and inoculated into 15 ml of LB liquid medium. After culture and amplification, the plasmid was extracted and sequenced. A map of the constructed recombinant adeno-associated virus serotype packaging plasmid, pAAV2 / 32.eB, is shown in Figure 1. All PCR primers, gene synthesis, and sequencing were performed by commercial companies.

[0073] Example 2 Preparation of recombinant adeno-associated virus

[0074] The virus packaging method refers to AAV13 Enables Precise Targeting of Local Neural Populations, Hanet. al.; Int. J. Mol. Sci, 2022, 23(21), 12806; doi: 10.3390 / ijms232112806. A three-plasmid packaging system was used to package adeno-associated virus. The core element plasmid pAAV-CMV-EGFP-WPRE-hGH polyA, the adenovirus element auxiliary plasmid pAd-Helper and the pAAV2 / 32.eB (or pAAV2 / hu.32) serotype plasmid were co-transfected into HEK-293T cells at a ratio of 1:1:1 according to the number of plasmid molecules. After 72 hours of transfection, the supernatant and cell pellet were collected, concentrated and purified by iodixanol gradient centrifugation, and finally stained with SYBR Green The titer of recombinant adeno-associated virus was detected by qPCR, and the titer of the rAAV32.eB-CMV-EGFP-WPRE-hGH polyA virus was 1.0×10 13VG / mL, and the titer of rAAVhu.32-CMV-EGFP-WPRE-hGH polyA virus was 1.0×10 13 VG / mL.

[0075] Example 3 Application of recombinant adeno-associated virus

[0076] The prepared rAAV32.eB-CMV-EGFP-WPRE-hGH polyA and rAAVhu.32-CMV-EGFP-WPRE-hGH polyA (as a control) viruses were injected into 8-10 week old C57BL / 6 mice (purchased from a commercial company) via tail vein injection, with a virus titer of 1.0 × 10 13 VG / mL, with a 100 μL injection per mouse. Brain tissue was harvested 3 weeks later by perfusion. Mouse brain tissue was fixed in DEPC-treated PFA for 4 hours and then dehydrated in DEPC-treated 30% sucrose-PBS for 48 hours. The dehydrated brains were thoroughly embedded in tissue embedding medium and cut into 40 μm sections using a freezing microtome. The sections were mounted and imaged microscopically using a slide scanner. Brain tissue sections from C57BL / 6 mice injected with the rAAV32.eB-CMV-EGFP-WPRE-hGH polyA and rAAhu.32-CMV-EGFP-WPRE-hGH polyA viral vectors were imaged, as shown in Figure 2. The rAAV32.eB virus exhibited stronger fluorescence and a greater number of positive cells throughout the brain than the rAAVhu.32 virus.

[0077] In summary, the present invention provides a recombinant adeno-associated virus particle, a recombinant adeno-associated virus vector system, and its application. The present invention prepares a novel recombinant adeno-associated virus (rAAV) that efficiently crosses the blood-brain barrier, named rAAV32.eB. Its capsid is a mutant of the AAVhu.32 capsid protein. Compared with the wild-type AAVhu32 capsid protein VP1, there are three major position changes, including mutations at two sites, A587D and Q588G, and a 7-amino acid peptide segment TLAVPFK is inserted between amino acids 588 and 589. At the same time, the present invention also constructs a corresponding recombinant adeno-associated virus vector system and an AAV32.eB serotype plasmid. Moreover, the recombinant adeno-associated virus rAAV32.eB prepared by the present invention is infected by intravenous injection. Compared with rAAVhu.32, rAAV32.eB has a higher efficiency in transducing neural cells across the blood-brain barrier. Finally, the present invention obtained a new recombinant adeno-associated virus rAAV32.eB through engineering modification, and used it for more efficient gene delivery, which can provide better tools for neuroscience research and the treatment of whole-brain systemic genetic diseases, neurodegenerative diseases, etc., and has broad application value and market prospects.

[0078] It should be understood that the application of the present invention is not limited to the above examples. For those skilled in the art, improvements or changes can be made based on the above description. All these improvements and changes should fall within the scope of protection of the claims attached to the present invention.

Claims

1. A recombinant adeno-associated virus particle, characterized in that: It comprises an AAVhu.32 capsid protein mutant; relative to the wild-type AAVhu.32 capsid protein, the AAVhu.32 capsid protein mutant comprises mutations at two amino acid sites, 587 and 588, and an amino acid fragment as shown in SEQ. ID NO.1 is inserted between amino acids 588 and 589.

2. The recombinant adeno-associated virus particle according to claim 1, characterized in that In the AAVhu.32 capsid protein mutant, the alanine at the 587th amino acid position is mutated to aspartic acid, and the glutamine at the 588th amino acid position is mutated to glycine.

3. The recombinant adeno-associated virus particle according to claim 1, characterized in that The genome of the recombinant adeno-associated virus particle contains an exogenous target gene of a nucleotide sequence encoding a target gene product.

4. The recombinant adeno-associated virus particle according to claim 3, characterized in that The target gene product is a protein, a polypeptide or an interfering RNA.

5. A recombinant adeno-associated virus vector system, characterized in that: It comprises one or more vectors, wherein at least one vector is a recombinant adeno-associated virus packaging plasmid, and the recombinant adeno-associated virus packaging plasmid comprises a nucleic acid fragment for encoding the AAVhu.32 capsid protein mutant as described in claim 1.

6. The recombinant adeno-associated virus vector system according to claim 5, characterized in that: At least one vector is an adeno-associated virus core plasmid, which comprises inverted terminal repeat sequences ITR at both ends, a promoter, an exogenous target gene, a transcription regulatory element WPRE and a transcription termination sequence hGH polyA.

7. The recombinant adeno-associated virus vector system according to claim 5, characterized in that: At least one of the vectors is an adenoviral element helper plasmid.

8. A pharmaceutical composition, characterized in that Comprising the recombinant adeno-associated virus particle according to any one of claims 1 to 4, and / or the recombinant adeno-associated virus vector system according to any one of claims 5 to 7.

9. Use of the recombinant adeno-associated virus particle according to any one of claims 1 to 4 and / or the recombinant adeno-associated virus vector system according to any one of claims 5 to 7 in central nervous system gene delivery.

10. Use of the recombinant adeno-associated virus particle according to any one of claims 1 to 4 and / or the recombinant adeno-associated virus vector system according to any one of claims 5 to 7 in the preparation of drugs for treating whole-brain systemic genetic diseases or neurodegenerative diseases.

Images