Genetically engineered bacterium for de novo synthesis of cis,cis-muconic acid by using glucose as substrate and use thereof

Abstract

The present invention belongs to the technical field of gene recombination and metabolic engineering. Provided are a genetically engineered bacterium for the de novo synthesis of cis,cis-muconic acid by using glucose as a substrate and the use thereof. The genetically engineered bacterium for the de novo synthesis of cis,cis-muconic acid by using glucose as a substrate is a recombinant Corynebacterium glutamicum which is subjected to chassis microorganisms modification and comprises a cis,cis-muconic acid pathway construction module and an intermediate high-yield module. The production capacity of the strain is improved, and finally, 90.2 g / L MA is obtained from a fermentation broth. The genetically engineered bacterium can be used to produce multiple chemicals such as adipic acid and nylon-66 in a greener and lower-cost manner.

Description

A genetically engineered bacterium for synthesizing cis-cis-muconic acid from scratch using glucose as a substrate and its application Technical Field

[0001] The present invention relates to the technical field of gene recombination and metabolic engineering, and more particularly to a genetically engineered bacterium for synthesizing cis,cis-muconic acid from scratch using glucose as a substrate and its application. Background Art

[0002] Cis,cis-muconic acid (MA) is a six-carbon (C6) compound with two carboxyl groups at either end and two double bonds in the middle. Its molecular formula is C6H6O4, and its molecular weight is 142.11. It serves as a platform compound for the industrial production of important chemicals such as nylon-66, adipic acid, and polyurethane, and is a potential raw material for the preparation of functional resins, pharmaceuticals, and agricultural chemicals. It plays a particularly crucial role as a raw material for the production of adipic acid. Global consumption of adipic acid has exceeded 4 million tons, with my country's consumption exceeding 1 million tons, and demand is growing with economic development. MA is traditionally produced through chemical synthesis, primarily using highly corrosive or irritating solvents such as peracetic acid and acetic acid and using non-renewable petrochemical derivatives as raw materials. This method is time-consuming and highly polluting, making it incompatible with the current global goal of sustainable development. Therefore, the development of environmentally friendly MA production methods is gaining increasing attention. With the increasing maturity of genetic manipulation and metabolic engineering technologies, the research focus of MA production has gradually shifted to microbial conversion methods. Bioconversion does not require catalysts, solvents, or oxidants, and is a highly clean and harmless production process. It can effectively alleviate the many negative effects of chemical synthesis of muconic acid, but the concentration and efficiency of microbial production of muconic acid need to be further improved.

[0003] Different microorganisms have different endogenous metabolic characteristics. In the microbial transformation method, there are mainly two methods: biotransformation of aromatic compounds and microbial fermentation of sugars. Microorganisms such as Pseudomonas putida and Rhodococcus opacus can metabolize some aromatic compounds. By optimizing the expression of p-hydroxybenzoate-3-hydroxylase in the strain, 40 g / L of MA was produced in fed-batch fermentation using p-coumaric acid as the substrate (Kuatsjah E, et al. Debottlenecking 4-hydroxybenzoate hydroxylation in Pseudomonas putida KT2440 improves muconate productivity from p-coumarate). Jin Mingjie et al. knocked out the vanillin reductase gene in Rhodococcus opacus and introduced vanillin dehydrogenase, obtaining 4.3 g / L of MA and realizing the conversion of vanillin to MA (Jin, et al. Deciphering the metabolic distribution of vanillin in Rhodococcus opacus during lignin valorization). However, most of the benzene raw materials currently used in production are also derived from petroleum resources and are non-renewable raw materials. The direct production of MA using simple carbon sources such as glucose is more important to a certain extent. Conventional model organisms such as Saccharomyces cerevisiae and Escherichia coli have been modified to directly produce MA using glucose. In a study by Wang et al., by changing the shikimate pathway flux in yeast and increasing the supply of phosphoenolpyruvate, 20.8g / L of MA production was achieved in a 10L fermentor (Wang G, et al. An integrated yeast-based process for cis,cis-muconic acid production). Corynebacterium glutamicum is a microorganism with strong fermentation ability and has long been used in the industrial production of amino acids such as L-glutamic acid and L-lysine. From a metabolic perspective, MA is an intermediate in its own β-ketoadipate pathway and has the advantage of innate production of MA. It is an ideal host for the production of MA by biosynthetic pathways. For bulk chemicals, since their value is relatively low, improving product concentration and synthesis efficiency is the key to reducing costs. In order to enable cell factories to produce target products more efficiently, it is necessary to continue to use various means such as molecular biology technology and fermentation regulation to continuously optimize and transform production strains to improve the efficiency of converting target products, creating the possibility of more efficient and lower-cost production.

[0004] Therefore, providing a genetically engineered bacterium that can synthesize cis,cis-muconic acid from scratch using glucose as a substrate and its application are issues that need to be urgently addressed by those skilled in the art.

[0005] Summary of the Invention

[0006] In view of this, the present invention provides a genetically engineered bacterium for de novo synthesis of cis,cis-muconic acid using glucose as a substrate and its application. To address the problems existing in the current biological method for de novo synthesis of MA, a biological method for efficient de novo synthesis of MA was developed, and a recombinant Corynebacterium glutamicum that can more efficiently utilize glucose to produce MA was constructed.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] A genetically engineered bacterium for synthesizing cis,cis-muconic acid de novo using glucose as a substrate, wherein the genetically engineered bacterium is a recombinant Corynebacterium glutamicum that has been modified from a chassis microorganism and includes a cis,cis-muconic acid pathway building module and an intermediate high-yield module;

[0009] The chassis microorganism is modified by using Corynebacterium glutamicum as the starting strain, and knocking out the pyk (cgl2089) (pyruvate kinase), aroE (cgl1835) (shikimate 5-dehydrogenase), pcaG / H (cgl2630, cgl2631) (protocatechuate 3,4-dioxygenase subunits, protocatechuate 3,4-dioxygenase subunit beta (pcaH), protocatechuate 3,4-dioxygenase subunit alpha (pcaG)), and catB (cgl2635) (chloromuconate cycloisomerase) genes;

[0010] The cis-muconate pathway building block expresses the protocatechuate decarboxylase gene, the UbiX-like flavin prenyltransferase gene, the 4-hydroxybenzoate decarboxylase, subunit D gene, and the catechol 1,2-dioxygenase gene;

[0011] The intermediate high-yield module expresses a 3-dehydroquinate synthase gene, a 3-dehydroquinate dehydratase gene, a phosphate isomerase gene, and a transketolase gene.

[0012] Furthermore, the protocatechuate decarboxylase gene is the protocatechuate decarboxylase gene aroY derived from Klebsiella pneumoniae;

[0013] The flavin isoprenyltransferase gene includes a flavin isoprenyltransferase gene kpdB derived from Escherichia coli and a flavin isoprenyltransferase gene kpdB derived from Klebsiella pneumoniae;

[0014] The 4-hydroxybenzoate decarboxylase D subunit gene includes a 4-hydroxybenzoate decarboxylase D subunit gene kpdD derived from Escherichia coli and a 4-hydroxybenzoate decarboxylase D subunit gene kpdD derived from Klebsiella pneumoniae;

[0015] The catechol 1,2-dioxygenase gene includes a catechol 1,2-dioxygenase gene catA from Pseudomonas putida and an endogenous catechol 1,2-dioxygenase gene catA from Corynebacterium glutamicum;

[0016] The 3-dehydroquinate synthetase is the endogenous 3-dehydroquinate synthetase gene aroB of Corynebacterium glutamicum;

[0017] The 3-dehydroquinic acid dehydratase gene is the endogenous 3-dehydroquinic acid dehydratase gene aroD of Corynebacterium glutamicum;

[0018] The phosphate isomerase gene is the endogenous phosphate isomerase gene qsuB of Corynebacterium glutamicum;

[0019] The transketolase gene is the endogenous transketolase gene tkt of Corynebacterium glutamicum;

[0020] The nucleotide sequence of the protocatechuate decarboxylase gene aroY from Klebsiella pneumoniae is shown in SEQ ID NO.37;

[0021] The nucleotide sequence of the Escherichia coli-derived flavin isoprenyltransferase gene kpdB is shown in SEQ ID NO.68;

[0022] The nucleotide sequence of the flavin isoprenyltransferase gene kpdB from Klebsiella pneumoniae is shown in SEQ ID NO.38;

[0023] The nucleotide sequence of the D subunit gene kpdD of the 4-hydroxybenzoate decarboxylase from Escherichia coli is shown in SEQ ID NO.69;

[0024] The nucleotide sequence of the D subunit gene kpdD of the 4-hydroxybenzoate decarboxylase from Klebsiella pneumoniae is shown in SEQ ID NO.39;

[0025] The nucleotide sequence of the catechol 1,2-dioxygenase gene catA from Pseudomonas putida is shown in SEQ ID NO.76;

[0026] The nucleotide sequence of the endogenous catechol 1,2-dioxygenase gene catA of Corynebacterium glutamicum is shown in SEQ ID NO.35;

[0027] The nucleotide sequence of the endogenous 3-dehydroquinate synthase gene aroB of Corynebacterium glutamicum is shown in SEQ ID NO.51;

[0028] The nucleotide sequence of the endogenous 3-dehydroquinate dehydratase gene aroD of Corynebacterium glutamicum is shown in SEQ ID NO.52;

[0029] The nucleotide sequence of the endogenous phosphate isomerase gene qsuB of Corynebacterium glutamicum is shown in SEQ ID NO.50;

[0030] The nucleotide sequence of the endogenous transketolase gene tkt of Corynebacterium glutamicum is shown in SEQ ID NO.53.

[0031] Preferably, the protocatechuate decarboxylase gene is the protocatechuate decarboxylase gene aroY derived from Klebsiella pneumoniae;

[0032] The flavin isoprenyltransferase gene is a flavin isoprenyltransferase gene kpdB derived from Klebsiella pneumoniae;

[0033] The 4-hydroxybenzoate decarboxylase, D subunit gene is a 4-hydroxybenzoate decarboxylase, D subunit gene kpdD derived from Kleber pneumoniae;

[0034] The catechol 1,2-dioxygenase gene is the endogenous catechol 1,2-dioxygenase gene catA of Corynebacterium glutamicum;

[0035] The 3-dehydroquinate synthetase is the endogenous 3-dehydroquinate synthetase gene aroB of Corynebacterium glutamicum;

[0036] The 3-dehydroquinic acid dehydratase gene is the endogenous 3-dehydroquinic acid dehydratase gene aroD of Corynebacterium glutamicum;

[0037] The phosphate isomerase gene is the endogenous phosphate isomerase gene qsuB of Corynebacterium glutamicum;

[0038] The transketolase gene is the endogenous transketolase gene tkt of Corynebacterium glutamicum.

[0039] Furthermore, the intermediate high-yield module also expresses a 2-phospho-3-dehydro-deoxyheptanoic acid aldolase gene.

[0040] Furthermore, the 2-phospho-3-dehydro-deoxyheptanoic acid aldolase gene is the endogenous 2-phospho-3-dehydro-deoxyheptanoic acid aldolase gene aroG of Corynebacterium glutamicum;

[0041] The nucleotide sequence of the endogenous 2-phospho-3-dehydro-deoxyheptanoic acid aldolase gene of Corynebacterium glutamicum is shown in SEQ ID NO.81.

[0042] Furthermore, a method for constructing a genetically engineered bacterium that de novo synthesizes cis,cis-muconic acid using glucose as a substrate comprises the following steps:

[0043] (1) Using Corynebacterium glutamicum ATCC13032 as the starting strain, the pyk (cgl2089), aroE (cgl1835), pcaG / H (cgl2630, cgl2631), and catB (cgl2635) genes were deleted to obtain modified Corynebacterium glutamicum;

[0044] (2) The cis-, cis-muconate pathway building blocks and intermediate high-yield modules described in the modified Corynebacterium glutamicum.

[0045] Furthermore, the genetically engineered bacteria or the method are used in the production of cis-cis muconic acid.

[0046] Furthermore, the genetically engineered bacteria or the method are used to increase the production of cis-cis muconic acid.

[0047] Furthermore, a method for producing cis-cis muconic acid is provided, which comprises fermenting the genetically engineered bacteria or the genetically engineered bacteria constructed by the method.

[0048] To this end, the present invention provides a biological synthesis pathway for cis, cis-muconic acid (Figure 1):

[0049] The three main decomposition pathways in the glucose production pathway were knocked out in Corynebacterium glutamicum through chassis modification, expressing the missing and low-activity enzyme genes and their related proteins for glucose production MA, and strengthening the key enzyme genes of the core pathway.

[0050] The main decomposition pathway for producing MA from glucose is as follows: knocking out aroE (cgl1835) (shikimate 5-dehydrogenase) to reduce the flux to shikimate, knocking out pcaG / H (cgl2630, cgl2631) (protocatechuate 3,4-dioxygenase subunit beta (pcaH), protocatechuate 3,4-dioxygenase subunit alpha (pcaG)) to block the conversion to 3-carboxymuconate, and knocking out catB (cgl2635) (chloromuconate cycloisomerase) to block the decomposition of muconate into muconolactone. Knocking out the main decomposition pathway in MA production increases the flux of MA production and achieves more MA enrichment.

[0051] The deletion and low-activity enzyme genes for expressing glucose-producing MA and their related proteins are expressed by expressing aroY (protocatechuate decarboxylase), kpdB (UbiX-like flavin prenyltransferase), kpdD (4-hydroxybenzoate decarboxylase, subunit D), and catA (catechol 1,2-dioxygenase) from different sources, thereby achieving the construction of a muconic acid production pathway within the strain.

[0052] The key enzyme genes of the enhanced core pathway are increased by knocking out pyk (cgl2089) (pyruvate kinase) and expressing tkt (transketolase), thereby increasing the accumulation of phosphoenolpyruvate (PEP) and D-erythrose 4-phophate (E4P), the precursor substances for the synthesis of 3-deoxy-7-phospho-D-arabinoheptulosonate (3-deoxy-7-phosphate, DAHP) in the shikimate pathway. By increasing the flux of PEP and E4P, the flux of the production pathway is increased, which is more conducive to the production of MA.

[0053] The key enzyme genes of the enhanced core pathway also include overexpression of endogenous aroG (phospho-2-dehydro-3-deoxyheptonate aldolase), aroB (3-dehydroquinate synthase), aroD (shikimate / quinate dehydratase) and qsuB (phosphate isomerase) using a combinatorial metabolic engineering strategy. By overexpressing key intermediate production genes, the conversion degree of the intermediates is improved, and more MA accumulation is obtained.

[0054] As can be seen from the above technical solutions, compared with the prior art, the present invention discloses a genetically engineered bacterium for de novo synthesis of cis-cis-muconic acid using glucose as a substrate and its application. Specifically, a recombinant Corynebacterium glutamicum for more efficiently producing MA using glucose is provided. By knocking out the main decomposition pathway in the production pathway and expressing enzyme genes and proteins that are endogenously missing and have low activity in the strain, the production pathway within the strain is constructed. Subsequently, by increasing the metabolic flux of the production pathway and strengthening the key enzyme genes in the core pathway, the production capacity of the strain is greatly improved. Ultimately, 90.2 g / L of MA was obtained in the fermentation broth, which is the current record for the production of muconic acid using glucose or (and) glycerol as substrates. It has broad application prospects and provides the possibility of greener and lower-cost production of many chemicals such as adipic acid and nylon-66. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0056] FIG1 is a diagram illustrating a biological synthesis pathway for cis-cis-muconic acid according to the present invention;

[0057] Figure 2 shows the fermentation growth, metabolism and MA production of strain MA1 of the present invention in different systems; A: 50 mL shake flask fermentation system; B: 5 L fermentor tank fermentation system;

[0058] FIG3 shows the growth metabolism and MA production of strain MA2 in a 50 mL shake flask fermentation;

[0059] FIG4 shows the growth metabolism and MA production of strain MA3 of the present invention in a 50 mL shake flask fermentation;

[0060] FIG5 shows the growth metabolism and MA production of strain MA4 of the present invention in 50 mL shake flask fermentation. DETAILED DESCRIPTION

[0061] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0062] LBHIS medium: 5.0 g / L peptone, 2.5 g / L yeast extract, 5.0 g / L NaCl, 18.5 g / L brain heart extract (BHI), 91.0 g / L sorbitol. 1.8%-2% agar was added to the corresponding LBHIS solid medium.

[0063] LBG medium: peptone 10.0 g / L, yeast powder 5.0 g / L, NaCl 10.0 g / L, glucose 20.0 g / L.

[0064] EPO medium: peptone 10.0 g / L, yeast powder 5.0 g / L, NaCl 10.0 g / L, glycine 30.0 g / L, Tween 80 10.0 g / L.

[0065] 30% sucrose medium: peptone 10.0 g / L, yeast powder 5.0 g / L, NaCl 10.0 g / L, sucrose 300.0 g / L.

[0066] 20% sucrose solid medium: peptone 10.0 g / L, yeast powder 5.0 g / L, NaCl 10.0 g / L, sucrose 200.0 g / L, agar 15.0 g / L.

[0067] Fermentation medium: glucose 65.0 g / L, urea 5.0 g / L, corn extract 8.0 g / L, biotin 4 × 10 -4 g / L, VB1 biotin 4×10 -4 g / L, K2HPO4 1.0 g / L, KH2PO4 1.0 g / L, CaCl2·2H2O 29.4 mg / L, MgSO4·7H2O 1.2325 g / L, trace element solution 0.2%. (Trace element solution preparation method: weigh 1g FeSO4·7H2O, 1g MnSO4·H2O, 0.1g ZnSO4·7H2O, 0.2g CuSO4, 0.002g NiCl2·6H2O, add water to 100mL, then add 100μl concentrated hydrochloric acid to adjust the pH, then filter through a microbial filter, and add 0.2% to the fermentation medium system.)

[0068] Example 1

[0069] A method for constructing a genetically engineered bacterium for de novo synthesis of cis,cis-muconic acid using glucose as a substrate comprises the following steps:

[0070] (1) Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, catB-up (as shown in SEQ ID NO. 1) was amplified using primers catB-up-F / catB-up-R, and catB-down (as shown in SEQ ID NO. 2) was amplified using primers catB-down-F / catB-down-R to obtain the upstream and downstream homology arms of catB knockout. The primer sequences are:

[0071] catB-up-F: 5'-CTAGACTTTTTTCCAGAGCTTTTTGGAACAGCTTG-3'; SEQ ID NO.3;

[0072] catB-up-R: 5'-CCAGAAAGCCATAGAAAAAGGAGAATTATCGATGCTGTTTCTAGCACG-3'; SEQ ID NO.4;

[0073] catB-down-F: 5'-TTTTTCTATGGCTTTCTGGTTAAGTGGGAAA-3'; SEQ ID NO.5;

[0074] catB-down-R: 5'-TTATCGAGTTCAGCCGATCACAAAGATTTTTC-3'; SEQ ID NO. 6.

[0075] Gene amplification system: Primestar (Takara) 25 μL, upstream and downstream primers 2 μL each, template 1 μL, ddH2O 20 μL.

[0076] Gene amplification program: pre-denaturation at 98°C for 3 minutes; denaturation at 98°C for 10 seconds, annealing at 57°C for 30 seconds, extension at 72°C for 10 seconds / kb, 35 cycles; extension at 72°C for 10 minutes.

[0077] The PCR products were subjected to agarose gel electrophoresis and product recovery to obtain gene fragments catB-up and catB-down.

[0078] The plasmid vector pk18mobsacb was linearized with primers pK18-catBF / pK18-catBR to obtain the pk-catB vector. The primer sequences are as follows:

[0079] pK18-catBF: 5'-ATCGGCTGAACTCGATAAAAGCTTGGCACTGGCCG-3'; SEQ ID NO.7;

[0080] pK18-catBR: 5'-CAAAAAGCTCTGGAAAAAGTCTAGAGGATCCCCGGGTACCG-3'; SEQ ID NO. 8.

[0081] Add 3 μL catB-up, 3 μL catB-down, 4 μL pK-catB vector and 10 μL Gibson ligase to a PCR tube. The ligation temperature is 50°C and the ligation time is 15 min. The total system is 20 μL.

[0082] All 20 μl of the Gibson ligation system was transformed into commercially competent E. coli Trans10 (Beijing Quanshijin Biotechnology) for culture and maintenance. The transformation process was strictly carried out according to the manufacturer's instructions: after incubation at 37°C for 1 hour, the cells were plated onto LB plates (containing 50 μg / mL kanamycin) and then incubated at 37°C for an additional 12 hours. 10-20 individual colonies were selected for colony PCR amplification and DNA sequencing verification. The primers for colony PCR amplification and DNA sequencing were the catB-up-F / catB-down-R primers described above.

[0083] A correct single colony was selected and named Escherichia coli EC001, and the plasmid was named pK18-catB. After expansion and plasmid extraction, the pK18-catB plasmid was obtained, which was then electroporated into the competent cell of Corynebacterium glutamicum ATCC13032.

[0084] The competent cells of Corynebacterium glutamicum ATCC13032 were prepared as follows: glycerol-preserved strains of Corynebacterium glutamicum ATCC13032 were streaked onto LBHIS plates and cultured in a 30°C incubator until clear colonies formed. Colonies were picked from the plates and inoculated into LBHIS liquid test tube culture medium for 12 h. The cells were then cultured at an initial OD of 0. 600 The OD value is about 0.3, and then the cells are inoculated into EPO culture medium. 600 The concentration of the culture medium was 0.9, and the bacterial suspension was placed in a centrifuge tube. The cells were ice-bathed for 15 minutes, and then centrifuged at 4500 rpm for 10 minutes to collect the cells (packed in 1.5 mL centrifuge tubes). The cells were resuspended in 100 μL of pre-cooled 10% glycerol and the above centrifugation was repeated three times. After washing, the cells were resuspended in 100 μL of 10% sterile glycerol to obtain competent cells of Corynebacterium glutamicum ATCC13032.

[0085] Electroporation was performed as follows: Add 2-4 μL of plasmid to each tube of competent cells and incubate on ice for 10 minutes. Transfer the mixture to a pre-chilled electroporation cuvette and perform electroporation at 1.8 kV, 5 ms, 50 μF, and 100 Ω. Immediately after electroporation, add 800 μL of LBHIS medium, incubate in a 46°C water bath for 6 minutes, and then incubate at 30°C for 2-3 hours. Plate the cells onto solid LBHIS plates containing 50 μg / mL kanamycin and incubate at 30°C for 24-36 hours before verification.

[0086] For the knockout strain, several single colonies grown on the above plates should be selected for verification of the sacB gene. The verification primers are as follows:

[0087] sacB-F: 5'-CTCAAGCGTTTGCGAAAGAAACG-3'; SEQ ID NO.9;

[0088] sacB-R: 5'-GAGTCAGTGAACAGGTACCATTTGCC-3'; SEQ ID NO. 10.

[0089] The verified correct strain was inoculated into 30% sucrose medium and cultured for 24 hours. After the bacterial liquid became turbid, it was streaked onto 20% sucrose medium and colony PCR of the sacB gene was continued. At this time, the single colony in which the sacB gene was not amplified was the correct colony. The bacteria were inoculated into LBHIS liquid medium for culture. After it became turbid, it was purified on an LBHIS solid plate and verified again using the upstream and downstream fragment primers catB-up-F / catB-up-R and catB-down-F / catB-down-R of the target gene. After confirmation, the target gene knockout strain was preserved and ready for use. It was named Corynebacterium glutamicum GM1.

[0090] (2) Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, primers aroE-up-F / aroE-up-R were used to amplify aroE-up (as shown in SEQ ID NO. 11), and primers aroE-down-F / aroE-down-R were used to amplify aroE-down (as shown in SEQ ID NO. 12) to obtain the upstream and downstream homology arms of the aroE knockout. The primer sequences are:

[0091] aroE-up-F: 5'-GTCGCTCACCGCGATTTTAGAGTGGC-3'; SEQ ID NO.13;

[0092] aroE-up-R: 5'-GATGTGACTAAATCTTAGTGACTATTTACATGGGTGG-3'; SEQ ID NO.14;

[0093] aroE-down-F: 5'-GTCACTAAGATTTAGTCACATCCGAGAGCCGAGTACCG-3'; SEQ ID NO.15;

[0094] aroE-down-R: 5'-TCTCTGCTTGAGACTTAAGCGTTTATCCG-3'; SEQ ID NO. 16.

[0095] The plasmid vector pk18mobsacb was linearized with primers pK18-aroEF / pK18-aroER to obtain the pk-aroE vector. The primer sequences are as follows:

[0096] pK18-aroEF: 5'-CTTAAGTCTCAAGCAGAGAGACCTGCAGGCATGCAAGC-3'; SEQ ID NO.17;

[0097] pK18-aroER: 5'-TAAAATCGCGGTGAGCGACTCTAGAGGATCCCCGGGTAC-3'; SEQ ID NO. 18.

[0098] The gene amplification system and gene amplification procedure were the same as above to obtain aroE-up, aroE-down and pK-aroE vectors. The ligation transformation verification method was the same as above to obtain Escherichia coli EC002. The plasmid was named pK18-aroE. After expansion and plasmid extraction, the pK18-aroE plasmid was obtained.

[0099] Plasmid pK18-aroE was electroporated into a GM1 competent cell of Corynebacterium glutamicum. Preparation of competent cells, electroporation, sacB verification, and sucrose culture were performed as described above. The aroE knockout verification primers were aroE-up-F / aroE-down-R as described above.

[0100] The strain that has been successfully knocked out of aroE by verifying the primers is inoculated into LBHIS liquid medium for culture, and streaked onto LBHIS solid medium plates for purification and re-verification. After confirmation, the strain can be preserved for use and named Corynebacterium glutamicum GM2.

[0101] (3) Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, primers pcaG / H-up-F / pcaG / H-up-R were used to amplify pcaG / H-up (as shown in SEQ ID NO. 19), and primers pcaG / H-down-F / pcaG / H-down-R were used to amplify pcaG / H-down (as shown in SEQ ID NO. 20) to obtain the upstream and downstream homology arms for knocking out pcaG / H. The primer sequences are:

[0102] pcaG / H-up-F: 5'-AACGTTGACGGTGATGCCATC-3'; SEQ ID NO. 21;

[0103] pcaG / H-up-R: 5'-ATTGACCCGATCTTTATACTCCGACCTTG-3'; SEQ ID NO. 22;

[0104] pcaG / H-down-F: 5'-GAGTATAAAGATCGGGTCAATGCGAGACCTTTCTGCGTCTAGTG-3'; SEQ ID NO. 23;

[0105] pcaG / H-down-R: 5'-CCATCGCATTGCCGAAAAGCTG-3'; SEQ ID NO. 24.

[0106] The plasmid vector pk18mobsacb was linearized with primers pK18-pcaF / pK18-pcaR to obtain the pk-pca vector. The primer sequences are as follows:

[0107] pK18-pcaF: 5'-TTCGGCAATGCGATGGGACCTGCAGGCATGCAAGC-3'; SEQ ID NO. 25;

[0108] pK18-pcaR: 5'-ATCACCGTCAACGTTGACTCTAGAGGATC-3'; SEQ ID NO. 26.

[0109] The gene amplification system and gene amplification procedure were the same as above to obtain pcaG / H-up, pcaG / H-down and pk-pca vectors. The ligation transformation verification method was the same as above to obtain Escherichia coli EC003. The plasmid was named pK18-pca. After expansion and plasmid extraction, the pK18-pca plasmid was obtained.

[0110] Plasmid pK18-pca was electroporated into a GM2 competent cell of Corynebacterium glutamicum. Preparation of competent cells, electroporation, sacB verification, and sucrose culture were performed as described above. The primers for pcaG / H knockout verification were pcaG / H-up-F / pcaG / H-down-R, as described above.

[0111] The strain that has been successfully knocked out of pcaG / H by verifying the primers is inoculated into LBHIS liquid medium for culture, and streaked onto LBHIS solid medium plates for purification and re-verification. After confirmation, the strain can be preserved for use and named Corynebacterium glutamicum GM3.

[0112] (4) Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, primers pyk-up-F / pyk-up-R were used to amplify pyk-up (as shown in SEQ ID NO. 27), and primers pyk-down-F / pyk-down-R were used to amplify pyk-down (as shown in SEQ ID NO. 28) to obtain the upstream and downstream homology arms of the pyk knockout. The primer sequences are:

[0113] pyk-up-F: 5'-CTCTAGAGTCCAACAGAGGTGCCGTTGTCAAAG-3'; SEQ ID NO. 29;

[0114] pyk-up-R: 5'-GGCTGCTTAAATCTTTCAAAAAATGCGTTGACAC-3'; SEQ ID NO.30;

[0115] pyk-down-F: 5'-GAAAGATTTAAGCGAGCCCATAAGCCTAGTACGTCATTCC-3'; SEQ ID NO.31;

[0116] pyk-down-R: 5'-CAGGTCGTCCTTGATGCAGCGATCGTG-3'; SEQ ID NO. 32.

[0117] The plasmid vector pk18mobsacb was linearized with primers pK18-pykF / pK18-pykR to obtain the pk-pyk vector. The primer sequences are as follows:

[0118] pK18-pykF: 5'-CATCAAGGACGACCTGCAGGCATGCAAGC-3'; SEQ ID NO.33;

[0119] pK18-pykR: 5'-CTCTGTTGGACTCTAGAGGATCCCCGGGTAC-3'; SEQ ID NO. 34.

[0120] The gene amplification system and gene amplification procedure were the same as above to obtain pyk-up, pyk-down and pk-pyk vectors. The ligation transformation verification method was the same as above to obtain Escherichia coli EC004. The plasmid was named pK18-pyk. After expansion and plasmid extraction, the pK18-pyk plasmid was obtained.

[0121] Plasmid pK18-pyk was electroporated into a GM3 competent cell of Corynebacterium glutamicum. Preparation of competent cells, electroporation, sacB verification, and sucrose culture were performed as described above. The pyk knockout verification primers were the same as described above: pyk-up-F / pyk-down-R.

[0122] The strain that has been successfully knocked out of pyk by verifying the primers is inoculated into LBHIS liquid culture medium for culture, and streaked onto LBHIS solid culture medium plates for purification and re-verification. After confirmation, the strain can be preserved for use and named Corynebacterium glutamicum GM4.

[0123] (5) Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the primers CG-catA-F / CG-catA-R were used to amplify the catA fragment (as shown in SEQ ID NO. 35), and catA derived from Corynebacterium glutamicum with seamless cloning homology arms (ribosome binding sites, as shown in SEQ ID NO. 36) connected to the plasmid was obtained.

[0124] Using genomic DNA of Klebsiella pneumoniae subsp. pneumoniae as a template, the primers aroY-F / aroY-R were used to amplify the fragment aroY (as shown in SEQ ID NO. 37), obtaining a Klebsiella pneumoniae-derived aroY fragment with seamless cloning homology arms connected to catA and RBS.

[0125] Using genomic DNA of Klebsiella pneumoniae subsp. pneumoniae as a template, primers KP-kpdB-F / KP-kpdB-R were used to amplify the kpdB fragment (as shown in SEQ ID NO. 38) to obtain a Klebsiella pneumoniae-derived kpdB fragment with seamless cloned homology arms connected to aroY.

[0126] Using genomic DNA of Klebsiella pneumoniae subsp. pneumoniae as a template, primers KP-kpdD-F / KP-kpdD-R were used to amplify the kpdD fragment (as shown in SEQ ID NO. 39), obtaining a Klebsiella pneumoniae-derived kpdD fragment with seamless cloning homology arms and RBS connected to kpdB and plasmid.

[0127] The primer sequences are:

[0128] CG-catA-F: 5'-CATATGACTTCAGCTGAACAGATCGTTGATC-3'; SEQ ID NO.40;

[0129] CG-catA-R: 5'-CTAGTCTTCCTTATCCAGGACGAATGGG-3'; SEQ ID NO.41;

[0130] aroY-F: 5'-CCTGGATAAGGAAGACTAGAAGGAGGATATACATATGACCGCACCGATTCAGGATC-3'; SEQ ID NO.42;

[0131] aroY-R: 5'-ATCCCAATAATCAGTTTCATATGTATATCCTCCTTTTATTTTGCGCTACCCTGGTTTTTTTCC-3'; SEQ ID NO.43;

[0132] KP-kpdB-F: 5'-CATATGAAACTGATTATTGGGATGACGGGG-3'; SEQ ID NO.44;

[0133] KP-kpdB-R: 5'-TTATTCGATCTCCTGTGCAAATTGTTCT-3'; SEQ ID NO.45;

[0134] KP-kpdD-F: 5'-GCACAGGAGATCGAATAAAAGGAGGATATACATATGATTTGTCCACGTTGCGC-3'; SEQ ID NO.46;

[0135] KP-kpdD-R: 5'-GATTAACGCTTATCTTCCGGCAATAGCG-3'; SEQ ID NO. 47.

[0136] The plasmid vector pEC-XK99E was linearized using primers PEC-1-1F / PEC-1-1R to obtain the PEC vector. The primer sequences are as follows:

[0137] PEC-1-1F: 5'-CGGAAGATAAGCGTTAATCTAGAGTCGACCTGCAGGCATG-3'; SEQ ID NO.48;

[0138] PEC-1-1R: 5'-GTTCAGCTGAAGTCATATGTATATCCTCCTTGAGCTCGAATTCTTCTGTTTCCTGT G-3'; SEQ ID NO. 49.

[0139] The gene amplification system and procedure were the same as above, yielding catA, aroY, kpdB, kpdD, and the pEC-1 vector. 1.5 μl of catA, 1.5 μl of aroY, 1.5 μl of kpdB, 1.5 μl of kpdD, 4 μl of the pEC-1 vector, and 10 μl of Gibson enzyme were added to a PCR tube. Ligation and transformation were performed as above. Several colonies were selected and sent to BGI for sequencing using the aforementioned CG-catA-F / KP-kpdBD-R primers. Sequencing was performed using the same sequencing method. The correct strain was designated E. coli EC005, and the plasmid was designated pEC-1. After expansion and plasmid extraction, the pEC-1 plasmid was obtained.

[0140] (6) Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the primers qsuB-F / qsuB-R were used to amplify the fragment qsuB (as shown in SEQ ID NO. 50), and qsuB derived from Corynebacterium glutamicum with seamlessly cloned homology arms connected to the plasmid was obtained.

[0141] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the primers aroB-F / aroB-R were used to amplify the fragment aroB (as shown in SEQ ID NO.51), obtaining the Corynebacterium glutamicum-derived aroB fragment with seamless cloned homology arms and RBS connected to qsuB.

[0142] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the primers aroD-F / aroD-R were used to amplify the fragment aroD (as shown in SEQ ID NO. 52), obtaining the Corynebacterium glutamicum-derived aroD fragment with seamless cloned homology arms and RBS connected to aroB.

[0143] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the primers tkt-F / tkt-R were used to amplify the fragment tkt (as shown in SEQ ID NO.53), obtaining a tkt fragment derived from Corynebacterium glutamicum with seamless cloning homology arms and RBS connected to aroD and plasmid.

[0144] The primer sequences are:

[0145] qsuB-F: 5'-CATATGCGTACATCCATTGCCACTG-3'; SEQ ID NO.54;

[0146] qsuB-R: 5'-CTAGTTTGGGATTCCCCGCTCG-3'; SEQ ID NO.55;

[0147] aroB-F: 5'-GGGGAATCCCAAACTAGAAGGAGGATATACATATGAGCGCAGTGCAGATTTTCAAC-3'; SEQ ID NO.56;

[0148] aroB-R: 5'-CTTTTAGTGGCTGATTGCCTCATAAGC-3'; SEQ ID NO.57;

[0149] aroD-F: 5'-GCAATCAGCCACTAAAAGGAGGATATACATATGCCTGGAAAAATTCTC-3'; SEQ ID NO.58;

[0150] aroD-R: 5'-CTTTACGTGAGGACATATGTATATCCTCCTTCTACTTTTTGAGATTTGCCAGGATA TCGACC-3'; SEQ ID NO.59;

[0151] tkt-F: 5'-GCAAATCTCAAAAAGTAGAAGGAGGATATACATATGTCCTCACGTAAAGAGCTT G-3'; SEQ ID NO.60;

[0152] tkt-R: 5'-GGGGATCCTCTAGATTACAGCAGTTCTTTTGCTTTCGC-3'; SEQ ID NO. 61.

[0153] The plasmid vector PXMJ19 was linearized using primers PXM-1-1F / PXM-1-1R to obtain the PXM vector. The primer sequences are as follows:

[0154] PXM-1-1F: 5'-GTAATCTAGAGGATCCCCGGGTACC-3'; SEQ ID NO.62;

[0155] PXM-1-1R: 5'-CAATGGATGTACGCATATGTATATCCTCCTTGTCGACCTGCAGGCATGC-3'; SEQ ID NO. 63.

[0156] The gene amplification system and procedure were the same as above. qsuB, aroB, aroD, tkt, and PXM vectors were obtained. 1.5 μl of qsuB, 1.5 μl of aroB, 1.5 μl of aroD, 1.5 μl of tkt, and 4 μl of PXM vector from different sources were added to a PCR tube, along with 10 μl of Gibson enzyme. Ligation and transformation were performed as above. Several colonies were selected and sent to BGI for sequencing using the qsuB-F / tkt-R primers described above. Sequencing was performed using the same sequencing method. The correct strain was designated Escherichia coli EC006, and the plasmid was named pXM-1. After expansion and plasmid extraction, the pXM-1 plasmid was obtained.

[0157] Plasmids pEC-1 and pXM-1 were simultaneously electroporated into competent cells of Corynebacterium glutamicum GM4 using the aforementioned experimental procedures. The mixture was plated onto LBHIS solid medium plates containing 50 g / L kanamycin and 5 g / L chloramphenicol. After colonies emerged, individual colonies were selected and verified for kana (primers kana-F / kana-R) and Cm (primers Cm-F / Cm-R) genes. Strains with both genes verified were designated Corynebacterium glutamicum MA1.

[0158] The primer sequences are:

[0159] kana-F: 5'-GTGAAACCAGTAACGTTATACGATGTCGC-3'; SEQ ID NO.64;

[0160] kana-R: 5'-CTCACTGCCCGCTTTCCAG-3'; SEQ ID NO.65;

[0161] Cm-F: 5'-CTTCACCGCCTGGCCCTG-3'; SEQ ID NO.66;

[0162] Cm-R: 5'-CGCCCGGAAGAGAGTCAATTCAG-3'; SEQ ID NO. 67.

[0163] Corynebacterium glutamicum MA1 was fermented in 50 mL shake flask system and 5 L fermentor system with feeding verification.

[0164] ① Strain activation

[0165] A single colony of Corynebacterium glutamicum MA1 was picked and inoculated into LBHIS liquid medium, cultured at 30°C and 200 rpm for 12 h, and then transferred to fresh LBG liquid medium for secondary activation for 12 h. The activated strain MA1 was used for growth test or fermentation.

[0166] ② Shake flask fermentation conditions

[0167] The constant temperature shaking condition was 30℃ and 200rpm. 50mL of fermentation broth (fermentation medium containing 50μg / mL kanamycin and 5μg / mL chloramphenicol) was placed in a 250mL baffled bottle and the initial OD 600 The induction agent IPTG (final concentration of 0.8 mM) was added at 3 h of fermentation, and the changes in sugar components and fermentation products were detected by HPLC.

[0168] ③5L fermentation tank fermentation conditions

[0169] The fermentation tank conditions were 30°C, 400 rpm, initial pH 7.0, inoculation OD 600 2.0 (the inoculum size is approximately 5-10% of the fermentation volume), ventilation is 0.2 L / min; the fermentor filling volume is 50% of the total volume; an appropriate amount of defoamer is added at the beginning of the fermentation, and whether to add it depends on the fermentation conditions; during the fermentation process, the pH is automatically adjusted with 50% phosphoric acid and 25% ammonia water, respectively; the inducer IPTG (final concentration is 0.8 mM) is added at 12 hours of fermentation; after 24 hours of fermentation, glucose (glucose concentration is 800 g / L) is automatically fed at a rate of 5 mL / h, and changes in sugar components and fermentation products are detected by HPLC.

[0170] Fermentation product detection:

[0171] The liquid chromatography-mass spectrometer was purchased from Agilent. Glucose was detected using an Aminex HPX-87H column, an UltiMate 3000 Variable Wavelength Detector, a mobile phase of 5 mM H₂SO₄, a column temperature of 65°C, and a flow rate of 0.6 mL / min. MA was detected using an Aminex HPX-87H column, a mobile phase of 5 mM H₂SO₄, a RefractoMax 520 UV detector, a UV light of 210 nm, a column temperature of 40°C, and a flow rate of 0.5 mL / min. The content of the data peaks of the different fermentation samples was calculated based on the standard curves drawn from the standard samples. The results are shown in Tables 1 and 2 and Figure 2.

[0172] Table 1 50 mL shake flask fermentation

[0173] Table 2 5L system fermentation tank feeding experiment

[0174] The strain produced 12.04 g / L of MA in a 50 mL shake flask fermentation ( FIG. 2A ), and 90.2 g / L of MA in a 5 L fermenter fed-batch experiment ( FIG. 2B ).

[0175] Example 2

[0176] A method for constructing a genetically engineered bacterium for de novo synthesis of cis,cis-muconic acid using glucose as a substrate comprises the following steps:

[0177] Using the genomic DNA of Escherichia coli EC869 as a template, the primers EC-kpdB-F / EC-kpdB-R were used to amplify the fragment kpdB (as shown in SEQ ID NO. 68) to obtain the Escherichia coli EC869-derived kpdB with seamlessly cloned homology arms connected to the plasmid.

[0178] Using the genomic DNA of Escherichia coli EC869 as a template, the primers EC-kpdD-F / EC-kpdD-R were used to amplify the fragment kpdD (as shown in SEQ ID NO. 69), obtaining a kpdD fragment derived from Corynebacterium glutamicum with seamless cloning homology arms and RBS connected to kpdB and plasmid.

[0179] The primer sequences are as follows:

[0180] EC-kpdB-F: 5'-CATATGAAACTGATCGTCGGGATGACAG-3'; SEQ ID NO.70;

[0181] EC-kpdB-R: 5'-CTTTTATTCATTCTCCTGAGAAAAATTCCGGGC-3'; SEQ ID NO.71;

[0182] EC-kpdD-F: 5'-TTCTCAGGAGAATGAATAAAAGGAGGATATACATATGATTTGTCCACGTTGTGCCG-3'; SEQ ID NO.72;

[0183] EC-kpdD-R: 5'-GATTAGCGCTTACCTTCCGCCAG-3'; SEQ ID NO. 73.

[0184] The plasmid vector pEC-1 was linearized using primers PEC-2-1F / PEC-2-1R to obtain the PECa vector. The primer sequences are as follows:

[0185] PEC-2-1F: 5'-GGAAGGTAAGCGCTAATCTAGAGTCGACCTGCAGGCATG-3'; SEQ ID NO.74;

[0186] PEC-2-1R: 5'-CGACGATCAGTTTCATATGTATATCCTCCTTTTATTTTGCGCTACCCTGGTTTTTTT CC-3'; SEQ ID NO. 75.

[0187] The gene amplification system and procedure were the same as in Example 1. kpdB, kpdD, and PECa vectors were obtained. 2 μl of kpdB, 2 μl of kpdD, and 6 μl of PECa vector from different sources were added to a PCR tube, along with 10 μl of Gibson enzyme. The ligation and transformation method was the same as in Example 1. Several colonies that grew were selected and sent to BGI for sequencing. Sequencing primers were the aforementioned EC-kpdB-F / EC-kpdD-R. Sequencing was performed using a single-pass sequencing method. The correct strain was named Escherichia coli EC007, and the plasmid was named pEC-2. After expansion and plasmid extraction, the pEC-2 plasmid was obtained.

[0188] Plasmids pEC-2 and pXM-1 were simultaneously electroporated into the competent cell of Corynebacterium glutamicum GM4. The experimental steps were the same as those in Example 1. The kana (primers kana-F / kana-R) and Cm (primers Cm-F / Cm-R) genes were verified at the same time. The strain in which both genes were verified to be correct was named Corynebacterium glutamicum MA2.

[0189] Corynebacterium glutamicum MA2 was fermented in a 50 mL shake flask system, and the fermentation medium and fermentation operation were the same as in Example 1. Strain MA2 produced 9.4 g / L of MA in the 50 mL shake flask fermentation (Table 3 and Figure 3).

[0190] Table 3

[0191] Example 3

[0192] A method for constructing a genetically engineered bacterium for de novo synthesis of cis,cis-muconic acid using glucose as a substrate comprises the following steps:

[0193] Using the genomic DNA of Pseudomonas putida KT2440 as a template, the primers PP-catA-F / PP-catA-R were used to amplify the fragment catA (as shown in SEQ ID NO. 76) to obtain catA derived from Pseudomonas putida KT2440 with seamless cloned homology arms connected to the plasmid.

[0194] The primer sequences are as follows:

[0195] PP-catA-F: 5'-CATATGAGCAAGATTCTCACCACCGC-3'; SEQ ID NO.77;

[0196] PP-catA-R: 5'-CTTTTAGGCGAGATTGATGCCCAGG-3'; SEQ ID NO. 78.

[0197] The plasmid vector pEC-1 was linearized using primers PEC-3-1F / PEC-3-1R to obtain the PECb vector. The primer sequences are as follows:

[0198] PEC-3-1F: 5'-CATCAATCTCGCCTAAAAGGAGGATATACATATGACCGCACC-3'; SEQ ID NO.79;

[0199] PEC-3-1R: 5'-GGTGAGAATCTTGCTCATATGTATATCCTCCTTGAGCTCGAATTCTTCTGTTTCCTGTG-3'; SEQ ID NO. 80.

[0200] The gene amplification system and gene amplification procedure are the same as those in Example 1.

[0201] The catA and PECb vectors were connected using the Gibson ligation method described in Example 1. The correct plasmid was obtained through the same verification steps described above and named pEC-3.

[0202] Plasmids pEC-3 and pXM-1 were simultaneously electroporated into the competent cell of Corynebacterium glutamicum GM4. The experimental steps were the same as those in Example 1. Verification of the kana (primers kana-F / kana-R) and Cm (primers Cm-F / Cm-R) genes was continued. The strain in which both genes were verified to be correct was named Corynebacterium glutamicum MA3.

[0203] Corynebacterium glutamicum MA3 was fermented in a 50 mL shake flask system, and the fermentation medium and fermentation operation were the same as in Example 1. Strain MA3 produced 10.0 g / L of MA in the 50 mL shake flask fermentation system (Table 4 and Figure 4).

[0204] Table 4

[0205] Example 4

[0206] A method for constructing a genetically engineered bacterium for de novo synthesis of cis,cis-muconic acid using glucose as a substrate comprises the following steps:

[0207] Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the primers aroG-F / aroG-R were used to amplify the fragment aroG (as shown in SEQ ID NO.81), obtaining aroG derived from Corynebacterium glutamicum with seamless cloning homology arms connected to the plasmid pXM-1.

[0208] The primer sequences are as follows:

[0209] aroG-F: 5'-CATATGAATTATCAGAACGACGATTTACGCATCAAAG-3'; SEQ ID NO.82;

[0210] aroG-R: 5'-CTTTTACCCGCGACGCGCTTT-3'; SEQ ID NO. 83.

[0211] The plasmid vector pXM-1 was linearized using primers PXM-2-1F / PXM-2-1R to obtain the PXMa vector. The primer sequences are as follows:

[0212] PXM-2-1F: 5'-CGTCGCGGGTAAAAGGAGGATATACATATGTCCTCACGTAAAG-3'; SEQ ID NO.84;

[0213] PXM-2-1R: 5'-GTCGTTCTGATAATTCATATGTATATCCTCCTTCTACTTTTTGAGATTTGCCAGGAT ATCGACC-3'; SEQ ID NO. 85.

[0214] The gene amplification system and gene amplification procedure are the same as those in Example 1.

[0215] The aroG fragment and the PXMa vector were connected using the Gibson ligation method described in Example 1. The correct plasmid was obtained through the same verification steps described above and named pXM-2.

[0216] Plasmids pEC-1 and pXM-2 were simultaneously electroporated into the competent cell of Corynebacterium glutamicum GM4. The experimental steps were the same as those in Example 1. Verification of the kana (primers kana-F / kana-R) and Cm (primers Cm-F / Cm-R) genes was continued, and the correctly verified strain was named Corynebacterium glutamicum MA4.

[0217] Corynebacterium glutamicum MA4 was fermented in a 50 mL shake flask system, and the fermentation medium and fermentation operation were the same as in Example 1. Strain MA4 produced 6.4 g / L of MA in the 50 mL shake flask system (Table 5 and Figure 5).

[0218] Table 5

[0219] The peak time of the MA standard product is 30.367 min, and the peak time of the fermentation product of the genetically engineered strain prepared in Example 1-4 is also 30.367 min, which is consistent with the peak time of the MA standard product, proving that the fermentation product of the engineered strain is the target product - MA.

[0220] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A genetically engineered bacterium for synthesizing cis-cis-muconic acid from scratch using glucose as a substrate, characterized in that: The genetically engineered bacteria are recombinant Corynebacterium glutamicum that have been transformed with chassis microorganisms and include a cis-cis-muconate pathway building module and an intermediate high-yield module; The chassis microorganism is transformed to use Corynebacterium glutamicum as the starting strain, and the pyk, aroE, pcaG / H, and catB genes are knocked out; The cis-muconate pathway building block expresses a protocatechuate decarboxylase gene, a flavin isoprenyltransferase gene, a 4-hydroxybenzoate decarboxylase, D subunit gene, and a catechol 1,2-dioxygenase gene; The intermediate high-yield module expresses a 3-dehydroquinate synthetase gene, a 3-dehydroquinate dehydratase gene, a phosphate isomerase gene and a transketolase gene.

2. A genetically engineered bacterium for synthesizing cis-cis-muconic acid from scratch using glucose as a substrate according to claim 1, characterized in that: The protocatechuate decarboxylase gene is a protocatechuate decarboxylase gene derived from Klebsiella pneumoniae; The flavin isoprenyltransferase gene includes a flavin isoprenyltransferase gene derived from Escherichia coli and a flavin isoprenyltransferase gene derived from Kleber pneumoniae; The 4-hydroxybenzoate decarboxylase, D subunit gene includes a 4-hydroxybenzoate decarboxylase, D subunit gene derived from Escherichia coli and a 4-hydroxybenzoate decarboxylase, D subunit gene derived from Kleber pneumoniae; The catechol 1,2-dioxygenase gene includes a catechol 1,2-dioxygenase gene derived from Pseudomonas putida and a catechol 1,2-dioxygenase gene endogenous to Corynebacterium glutamicum; The 3-dehydroquinate synthetase is an endogenous 3-dehydroquinate synthetase gene of Corynebacterium glutamicum; The 3-dehydroquinic acid dehydratase gene is an endogenous 3-dehydroquinic acid dehydratase gene of Corynebacterium glutamicum; The phosphate isomerase gene is an endogenous phosphate isomerase gene of Corynebacterium glutamicum; The transketolase gene is an endogenous transketolase gene of Corynebacterium glutamicum; The nucleotide sequence of the protocatechuate decarboxylase gene from Klebsiella pneumoniae is shown in SEQ ID NO.37; The nucleotide sequence of the flavin isoprenyltransferase gene from Escherichia coli is shown in SEQ ID NO.68; The nucleotide sequence of the flavin isoprenyltransferase gene from Klebsiella pneumoniae is shown in SEQ ID NO.38; The nucleotide sequence of the D subunit gene of the 4-hydroxybenzoate decarboxylase from Escherichia coli is shown in SEQ ID NO.69; The nucleotide sequence of the D subunit gene of the 4-hydroxybenzoate decarboxylase from Klebsiella pneumoniae is shown in SEQ ID NO.39; The nucleotide sequence of the catechol 1,2-dioxygenase gene from Pseudomonas putida is shown in SEQ ID NO.76; The nucleotide sequence of the endogenous catechol 1,2-dioxygenase gene of Corynebacterium glutamicum is shown in SEQ ID NO.35; The nucleotide sequence of the endogenous 3-dehydroquinate synthase gene of Corynebacterium glutamicum is shown in SEQ ID NO.51; The nucleotide sequence of the endogenous 3-dehydroquinic acid dehydratase gene of Corynebacterium glutamicum is shown in SEQ ID NO.52; The nucleotide sequence of the endogenous phosphate isomerase gene of Corynebacterium glutamicum is shown in SEQ ID NO.50; The nucleotide sequence of the endogenous transketolase gene of Corynebacterium glutamicum is shown in SEQ ID NO.

53.

3. A genetically engineered bacterium for synthesizing cis,cis-muconic acid from scratch using glucose as a substrate according to claim 2, characterized in that: The protocatechuate decarboxylase gene is a protocatechuate decarboxylase gene derived from Klebsiella pneumoniae; The flavin isoprenyltransferase gene is a flavin isoprenyltransferase gene derived from Kleber pneumoniae; The 4-hydroxybenzoate decarboxylase, D subunit gene is a 4-hydroxybenzoate decarboxylase, D subunit gene derived from Kleber pneumoniae; The catechol 1,2-dioxygenase gene is an endogenous catechol 1,2-dioxygenase gene of Corynebacterium glutamicum; The 3-dehydroquinate synthetase is an endogenous 3-dehydroquinate synthetase gene of Corynebacterium glutamicum; The 3-dehydroquinic acid dehydratase gene is an endogenous 3-dehydroquinic acid dehydratase gene of Corynebacterium glutamicum; The phosphate isomerase gene is an endogenous phosphate isomerase gene of Corynebacterium glutamicum; The transketolase gene is an endogenous transketolase gene of Corynebacterium glutamicum.

4. A genetically engineered bacterium for synthesizing cis,cis-muconic acid from scratch using glucose as a substrate according to claim 3, characterized in that: The intermediate high-yield module also expresses a 2-phospho-3-dehydro-deoxyheptanoic acid aldolase gene.

5. A genetically engineered bacterium for synthesizing cis,cis-muconic acid from scratch using glucose as a substrate according to claim 4, characterized in that: The 2-phospho-3-dehydro-deoxyheptanoic acid aldolase gene is an endogenous 2-phospho-3-dehydro-deoxyheptanoic acid aldolase gene of Corynebacterium glutamicum; The nucleotide sequence of the endogenous 2-phospho-3-dehydro-deoxyheptanoic acid aldolase gene of Corynebacterium glutamicum is shown in SEQ ID NO.

81.

6. A method for constructing a genetically engineered bacterium for synthesizing cis-cis-muconic acid from scratch using glucose as a substrate, characterized in that: The following steps are involved: (1) Using Corynebacterium glutamicum ATCC13032 as the starting strain, knocking out the pyk, aroE, pcaG / H and catB genes to obtain a modified Corynebacterium glutamicum; (2) expressing the cis-muconate pathway building blocks and intermediate high-yield modules of claim 1 in a modified Corynebacterium glutamicum.

7. Use of the genetically engineered bacteria according to any one of claims 1 to 5 or the method according to claim 6 in producing cis-cis-muconic acid.

8. Use of the genetically engineered bacteria according to any one of claims 1 to 5 or the method according to claim 6 in increasing the production of cis-cis-muconic acid.

9. A method for producing cis-muconic acid, characterized in that: Fermentation is carried out using the genetically engineered bacteria described in any one of claims 1 to 5 or the genetically engineered bacteria constructed by the method described in claim 6.

Images