Use of TST3b protein and biological material related thereto in regulating content of soluble sugar in solanum lycopersicum
Patent Information
- Application Number
- PCT/CN2024/137410
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-10-08
- Filing Date
- 2024-12-06
- Publication Date
- 2025-06-05
AI Technical Summary
The prior art is difficult to effectively regulate the soluble sugar content of tomato fruits, resulting in the limitation of tomato quality and yield.
By knocking out the tomato TST3b gene and gene editing using the CRISPR/Cas9 system, the activity or content of the protein TST3b is reduced, thereby increasing the soluble sugar content and single fruit weight of tomatoes.
The soluble sugar content and single fruit weight of tomatoes have been significantly improved, the quality and yield of tomatoes have been improved, and new materials have been provided for breeding tomato varieties.
Abstract
Description
Application of TST3b protein and related biomaterials in regulating soluble sugar content in tomatoes Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to application of TST3b protein and related biological materials in regulating the soluble sugar content of tomatoes. Background Art
[0002] Soluble sugars are the primary components affecting tomato sweetness and taste, playing a crucial role in the formation of fruit flavor and serving as a key indicator for evaluating tomato fruit quality. However, research on the regulation of soluble sugar content in tomato fruit remains limited, with few cloned genes involved in sugar content regulation and a lack of effective molecular marker-assisted breeding. Therefore, identifying and utilizing new genes that regulate soluble sugar content in tomato fruit is fundamental and crucial to addressing this issue and is of great significance for breeding high-yield, high-quality tomatoes.
[0003] The tomato fruit is a typical sink organ. 80% of the soluble sugars in the fruit are assimilated and transported from photosynthates produced by source organs such as leaves, while 20% comes from photosynthesis within the fruit itself. Sucrose is the primary assimilated product of tomato photosynthesis and the primary form of long-distance transport. During tomato fruit development, photosynthates are transported long distances from source organs such as mature leaves through the phloem to the fruit in the form of sucrose, where they are unloaded via the symplast and apoplast pathways. The MYB-like transcription factor SlGLK2 regulates the accumulation of chloroplasts and chlorophyll in the shoulder of the tomato fruit, near the stalk, giving the shoulder its dark green color. This, in turn, enhances fruit photosynthesis, increases starch content in immature fruit, and consequently, increases soluble sugar content in mature fruit. SlLIN5 encodes a cell wall sucrose invertase, involved in the apoplast pathway of sucrose unloading in tomato fruit. A single single nucleotide polymorphism (SNP) in this gene results in a nonsynonymous amino acid substitution, affecting enzyme activity and reducing sucrose conversion efficiency in tomato fruit, thereby lowering soluble sugar content.
[0004] The soluble sugar content of tomato fruit is a complex process, regulated by both the external environment and endogenous genes. While previous research has examined this, these genes often contribute to other unfavorable traits, creating bottlenecks in their utilization. Therefore, identifying and cloning genes that regulate soluble sugar content in tomato fruit and utilizing them is an effective approach to addressing this issue. SUMMARY OF THE INVENTION
[0005] The present invention knocks out the tomato TST3b gene to obtain a tomato mutant material with significantly increased soluble sugar content and single fruit weight, providing new material for tomato variety breeding. Technical issues
[0006] The technical problem to be solved by the present invention is how to increase the soluble sugar content and single fruit weight of tomatoes, thereby improving the quality and yield of tomatoes. Technical Solutions
[0007] In order to solve the above technical problems, the present invention first provides a substance that reduces the activity or content of protein TST3b, or an application of a substance that inhibits or reduces the expression of a gene encoding the protein TST3b, wherein the application is any of the following:
[0008] P1. Application in increasing soluble sugar content in tomatoes;
[0009] P2. Application in improving the sweetness of tomatoes;
[0010] P3, application in improving the taste of tomatoes;
[0011] P4. Application in improving tomato quality;
[0012] P5. Application in increasing single fruit weight of tomatoes;
[0013] P6. Application in increasing tomato yield;
[0014] P7, application in tomato breeding;
[0015] The protein TST3b may be the following protein A1), A2) or A3):
[0016] A1) a protein having an amino acid sequence of SEQ ID No. 2;
[0017] A2) a protein derived from A1) or having 80% or more identity with the protein of A1) and having the same function as the protein of A1) obtained by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence of A1);
[0018] A3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of A1), A2) or A3).
[0019] In the above application, the protein TST3b may be derived from tomato.
[0020] In the above application, the tomato breeding is to select varieties with high soluble sugar content, and / or high sweetness, and / or good quality, and / or high single fruit weight, and / or high yield.
[0021] In the above application, SEQ ID No. 2 in the sequence listing consists of 725 amino acid residues.
[0022] The one or more amino acid residues mentioned above may specifically be up to ten amino acid residues.
[0023] In the above application, the gene encoding the protein TST3b may be a DNA molecule as shown in a1) or a2) or a3) below:
[0024] a1) The coding sequence is the DNA molecule shown in SEQ ID No. 1 in the sequence listing;
[0025] a2) a DNA molecule that has 90% or more identity with the nucleotide sequence defined in a1) and encodes the protein TST3b described above;
[0026] a3) A DNA molecule that hybridizes under stringent conditions to the nucleotide sequence defined in a1) or a2) and encodes the protein TST3b described above.
[0027] In the above application, the gene encoding the protein TST3b can be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcription level of the gene; 2) regulation after transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the cell nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; 6) post-translational regulation of the gene (that is, regulation of the activity of the protein translated by the gene).
[0028] In the above application, the substance that reduces the activity or content of protein TST3b may be a substance that knocks out the gene encoding the protein TST3b, and / or a substance that inhibits or reduces the expression of the gene encoding the protein TST3b.
[0029] In the above application, inhibiting or reducing the expression of the gene encoding the protein TST3b can be achieved by gene knockout or gene silencing.
[0030] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout is the inactivation of a specific target gene by changing its DNA sequence.
[0031] Gene silencing refers to the phenomenon of making a gene non-expressed or under-expressed without damaging the original DNA. Gene silencing is based on the premise of not changing the DNA sequence, making the gene non-expressed or under-expressed. Gene silencing can occur at two levels: one is gene silencing at the transcriptional level caused by DNA methylation, heterochromatinization, and position effects, and the other is post-transcriptional gene silencing, that is, gene inactivation at the level of gene transcription by specifically inhibiting the target RNA, including antisense RNA, co-suppression, gene repression (quelling), RNA interference (RNAi), and microRNA (miRNA)-mediated translation inhibition.
[0032] In the above application, the agent that inhibits or reduces the expression of the gene encoding the protein TST3b may be an agent that inhibits or reduces the expression of the gene. The agent that inhibits or reduces the expression of the gene may be an agent that knocks out the gene, such as an agent that knocks out the gene by homologous recombination, or an agent that knocks out the gene by CRISPR-Cas9. The agent that inhibits or reduces the expression of the gene may comprise a polynucleotide that targets the gene, such as siRNA, shRNA, sgRNA, miRNA or antisense RNA.
[0033] In the above application, the substance that reduces the activity or content of protein TST3b, or the substance that inhibits or reduces the expression of the gene encoding the protein TST3b, may be any of the following substances c1) to c4):
[0034] c1) a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the protein TST3b;
[0035] c2) an expression cassette containing the nucleic acid molecule described in c1);
[0036] c3) a recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2);
[0037] c4) A recombinant microorganism containing the nucleic acid molecule described in c1), or a recombinant microorganism containing the expression cassette described in c2), or a recombinant microorganism containing the recombinant vector described in c3).
[0038] c1) The nucleic acid molecule may be an sgRNA that targets the gene encoding protein TST3b and / or the gene encoding protein B described above, or a DNA molecule that expresses the sgRNA.
[0039] The sgRNAs are sgRNA named sgRNA1 and sgRNA named sgRNA2, the target sequence of sgRNA1 is positions 59-77 of SEQ ID No.1, and the target sequence of sgRNA2 is positions 117-135 of SEQ ID No.1.
[0040] The term "identity" refers to sequence similarity to a naturally occurring nucleic acid sequence. Identity can be assessed visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to assess the identity between related sequences. The 90% or greater identity can mean at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity.
[0041] In order to solve the above technical problems, the present invention also provides a method for increasing the soluble sugar content, and / or sweetness, and / or quality, and / or single fruit weight, and / or yield of tomatoes, comprising increasing the soluble sugar content, and / or sweetness, and / or quality, and / or single fruit weight, and / or yield of tomatoes by inhibiting or reducing the expression level of the gene encoding the protein TST3b in the tomato genome.
[0042] The above-mentioned inhibition or reduction of the expression level of the gene encoding the protein TST3b in the tomato genome can be achieved by any method in the existing technology to cause the gene to produce a deletion mutation, an insertion mutation or a base change mutation, thereby reducing or losing the gene function, specifically chemical mutagenesis, physical mutagenesis, RNAi, genome site-directed editing or homologous recombination, etc.
[0043] In the above-mentioned genome site-directed editing method, zinc finger nuclease (ZFN) technology, transcription activator-like effector nuclease (TALEN) technology or clustered regularly interspaced short palindromic repeats and their related systems (Clustered regularly interspaced short palindromic repeats / CRISPR associated, CRISPR / Cas9 system) technology, and other technologies that can achieve genome site-directed editing can be used. Regardless of which method is adopted, the entire coding gene of the protein described above can be used as a target, and the various elements that regulate the expression of the protein-coding gene described above can be used as targets, as long as the loss or reduction of gene function can be achieved. For example, the exons or 5'UTR of the coding gene of the protein described above can be used as targets.
[0044] The method described above may include introducing into the tomato a substance that reduces or inhibits the activity of the protein TST3b, or a substance that reduces or inhibits the expression of the gene encoding the protein TST3b. The substance that reduces or inhibits the activity of the protein TST3b, or the substance that reduces or inhibits the expression of the gene encoding the protein TST3b, may be any of the following substances c1) to c4):
[0045] c1) a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the protein TST3b mentioned above;
[0046] c2) an expression cassette containing the nucleic acid molecule described in c1);
[0047] c3) a recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2);
[0048] c4) A recombinant microorganism containing the nucleic acid molecule described in c1), or a recombinant microorganism containing the expression cassette described in c2), or a recombinant microorganism containing the recombinant vector described in c3).
[0049] c1) The nucleic acid molecule is an sgRNA targeting the gene encoding the protein TST3b mentioned above or a DNA molecule expressing the sgRNA.
[0050] The sgRNAs are sgRNA named sgRNA1 and sgRNA named sgRNA2, the target sequence of sgRNA1 is positions 59-77 of SEQ ID No.1, and the target sequence of sgRNA2 is positions 117-135 of SEQ ID No.1.
[0051] The above-mentioned reduction or inhibition of the expression of the protein TST3b encoding gene is to replace the protein TST3b encoding gene shown in SEQ ID No.1 in the tomato genome with the TST3b-1 gene or the TST3b-2 gene, wherein the TST3b-1 gene is a DNA molecule obtained by deleting the nucleotide G at position 132 of SEQ ID No.1 in the sequence list, while keeping the other nucleotides of SEQ ID No.1 unchanged; the TST3b-2 gene is a DNA molecule obtained by deleting the nucleotide TG at positions 131-132 of SEQ ID No.1 in the sequence list, while keeping the other nucleotides of SEQ ID No.1 unchanged.
[0052] The present invention also protects the above protein TST3b.
[0053] The present invention also protects biological materials related to protein TST3b, wherein the biological materials related to protein TST3b are any one of the following B1) to B5):
[0054] B1) Nucleic acid molecule encoding TST3b;
[0055] B2) an expression cassette containing the nucleic acid molecule described in B1);
[0056] B3) a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B1);
[0057] B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);
[0058] B5) A transgenic plant cell line containing the nucleic acid molecule of B1), or a transgenic plant cell line containing the expression cassette of B2), or a transgenic plant cell line containing the recombinant vector of B3).
[0059] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.
[0060] In the above biological material, the nucleic acid molecule in B1) is a cDNA molecule or a DNA molecule whose coding sequence is SEQ ID No. 1.
[0061] Among them, SEQ ID No. 1 in the sequence listing consists of 2178 nucleotides and encodes the protein shown in SEQ ID No. 2.
[0062] In the above-mentioned biological material, the expression cassette containing the nucleic acid molecule (TST3b gene expression cassette) described in B2) refers to a nucleic acid molecule capable of expressing TST3b in a host cell. This nucleic acid molecule may include not only a promoter for initiating transcription of the TST3b gene, but also a terminator for terminating TST3b transcription. Furthermore, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to, constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to, the constitutive promoter 35S of cauliflower mosaic virus; a wound-inducible promoter from tomato, leucine aminopeptidase ("LAP," Chao et al. (1999) Plant Physiology 120:979-992); a chemically inducible promoter from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiocarboxylic acid S-methyl ester)); the tomato proteinase inhibitor II promoter (PIN2) or the LAP promoter (both inducible by methyl jasmonate); a heat shock promoter (U.S. Pat. No. 5,187,267); a tetracycline-inducible promoter (U.S. Pat. No. 5,057,422); a seed-specific promoter, such as the millet seed-specific promoter pF128 (CN101063139B (China Patent No. 20071106)). 0099169.7)), seed storage protein-specific promoters (e.g., the promoters of phaseolin, napin, oleosin, and soybean beta-conglycin (Beachy et al. (1985) EMBO J. 4:3047-3053)). These can be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators include, but are not limited to, the Agrobacterium nopaline synthase terminator (NOS terminator), the cauliflower mosaic virus CaMV 35S terminator, the tml terminator, the pea rbcS E9 terminator, and the nopaline and octopine synthase terminators (see, for example, Odell et al. (1996) EMBO J. 4:3047-3053). 985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).
[0063] In the above-mentioned biological materials, the recombinant microorganisms can specifically be yeast, bacteria, algae and fungi. Beneficial effects
[0064] The present invention discloses a method for knocking out the TST3b gene of tomatoes to improve the soluble sugar content, and / or sweetness, and / or quality, and / or single fruit weight, and / or yield of tomatoes. Specifically, the CRISPR / Cas9 system is used to edit the TST3b gene in the starting tomatoes, and the TST3b gene is mutated to cause the translation protein to terminate prematurely, thereby obtaining transgenic tomatoes and realizing the editing of the TST3b gene in the starting tomatoes. The present invention uses CRISPR / Cas9-mediated gene editing technology to perform site-directed knockout of specific targets on the tomato TST3b gene, obtaining tomato mutant materials with significantly improved soluble sugar content and single fruit weight, and providing new materials for tomato variety breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0065] FIG1 shows the expression pattern of the TST3b gene in Example 1 of the present invention.
[0066] FIG2 is an editing vector of the TST3b gene in Example 1 of the present invention.
[0067] FIG3 shows the mutation types of TST3b gene-edited plants in Example 1 of the present invention. The target 1 (Target 1) and its upstream and downstream sequences of the wild-type WT, mutant tst3b-cr1 (labeled as tst3bcr1 in the figure), and mutant tst3b-cr2 (labeled as tst3bcr2 in the figure) are all 5'-GATGGGACAATGCGACGATAGCAGGACT-3' (SEQ ID No. 15), the target 2 (Target 2) and its upstream and downstream sequences of the wild-type WT are 5'-ACAAACACAGCCAACCATGGAAGGGCTAATT-3' (SEQ ID No. 16), the target 2 (Target 2) and its upstream and downstream sequences of the mutant tst3b-cr1 are 5'-ACAAACACAGCCAACCATGAAGGGCTAATT-3' (SEQ ID No. 17), and the target 2 (Target 2) and its upstream and downstream sequences of the mutant tst3b-cr2 are 5'-ACAAACACAGCCAACCAGAAGGGCTAATT-3' (SEQ ID No. 18).
[0068] FIG4 shows the soluble sugar content phenotype of the fruit of the tst3b-cr mutant in Example 1 of the present invention.
[0069] FIG5 shows the fruit weight phenotype of the tst3b-cr mutant in Example 1 of the present invention. Modes for Carrying Out the Invention
[0070] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0071] The experimental methods in the following examples are conventional methods unless otherwise specified. The materials and reagents used in the following examples are conventional biochemical reagents and can be obtained from commercial sources unless otherwise specified.
[0072] 1 Vectors and strains
[0073] In the following examples, Agrobacterium tumefaciens EHA105 was a product of Beijing Quanshijin Biotechnology Co., Ltd.
[0074] In the following examples, Agrobacterium AGL1 was a product of Beijing Quanshijin Biotechnology Co., Ltd.
[0075] 2 Plant strains
[0076] In the following examples, wild currant tomato (Solanum pimpinellifolium), referred to as PP, is publicly available from the Tomato Genetics Resource Center at the University of California, Davis (https: / / tgrc.ucdavis.edu / ). Accession number is PI365967.
[0077] The formula of the LB solid medium containing 50 mg / L kanamycin described in the following examples is: 50 mg / L kanamycin, 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 15 g / L agar, and the pH was adjusted to 7.5 with NaOH.
[0078] In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA.
[0079] The following examples used Excel spreadsheets to process data. Experimental results are expressed as mean ± standard deviation using the Student's t-test. P < 0.05 (*) indicates a significant difference, and P < 0.01 (**) indicates a very significant difference. The quantitative experiments in the following examples were performed in triplicate, unless otherwise specified, and the results were averaged.
[0080] Example 1: Spatiotemporal expression of the TST3b gene in different tissues and organs of tomato
[0081] The nucleotide sequence of the TST3b gene (Solyc03g032040) cDNA from wild currant tomato PP is shown in SEQ ID No. 1, and the amino acid sequence of the protein TST3b encoded thereby is shown in SEQ ID No. 2.
[0082] To clarify the role of TST3b in tomato fruit development, qRT-PCR was used to detect changes in TST3b expression using cDNA from wild currant tomato (Solanum pimpinellifolium, PP) fruit at flowering day, 2, 5, 10, and 20 days after flowering, and at the green, veraison, orange, and red stages. The primer sequences are as follows:
[0083] TST3b-F: ACAAGCAGGCGTTGGAGTTC (SEQ ID No. 3, identical to SEQ ID No. 1, positions 1602-1621);
[0084] TST3b-R: AGCGGTGGAGATCACAGCAT (SEQ ID No. 4, reverse complement to the sequence at positions 1832-1851 of SEQ ID No. 1).
[0085] The tomato gene SlUBI3 was selected as the internal reference gene, and the primers used were as follows:
[0086] Actin-F:TCTTCCGACACCATCGACAA (SEQ ID No. 5);
[0087] Actin-R:AGAACTGCAACACAGTGAGC (SEQ ID No. 6).
[0088] The results are shown in Figure 1. The expression level of TST3b gene was higher during fruit development and lower after fruit ripening, indicating that TST3b gene may play a role in fruit development.
[0089] Example 2: CRISPR / Cas9 editing to verify the function of the TST3b gene
[0090] 1. Construction of CRISPR / Cas9 editing vector for TST3b gene
[0091] Based on the coding sequence of the TST3b gene (shown in SEQ ID No. 1), two CRISPR / Cas9 editing target sequences were designed using CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR / ). The specific target sequences were named target 1 and target 2, respectively.
[0092] Target 1: 5'-GGGACAATGCGACGATAGC-3' (SEQ ID No. 7, corresponding to positions 59-77 of SEQ ID No. 1);
[0093] Target 2: 5'-AACACAGCCAACCATGGAA-3' (SEQ ID No. 8, corresponding to positions 117-135 of SEQ ID No. 1).
[0094] The sgRNA targeting target 1 in the CRISPR / Cas9 method is recorded as sgRNA1, and the sgRNA targeting target 2 is recorded as sgRNA2.
[0095] TST3b-CR-F1: ATATATGGTCTCGTTTGGGGACAATGCGACGATAGCGTTTTAGAGCTAGAAATAGC (SEQ ID No. 9, the sequence indicated in italics is the sequence that binds to target 1);
[0096] TST3b-CR-R1: ATTATTGGTCTCGAAACTTCCATGGTTGGCTGTGTTCTGCACCAGCCGGGAATCGAA (SEQ ID No. 10, the sequence indicated in italics is the sequence bound by target 2).
[0097] Using the pCBC_DT1T2_SlU6p vector (described in the following literature: Li R, Sun S, Wang HJ, Wang KT, Yu H, Zhou Z, Xin PY, Chu JF, Zhao TM, Wang HZ, Li JY, Cui X. 2020. FIS1 encodes a GA2-oxidase that regulates fruit firmness in tomato. Nature Communications 11.) as a template, PCR amplification was performed with primers TST3b-CR-F1 and TST3b-CR-R1 to obtain the sgRNA1_gRNA scaffold_sgRNA2 fragment, which contains the coding sequences of both sgRNA1 and sgRNA2.
[0098] The sgRNA1_gRNA scaffold_sgRNA2 fragment and the pCAMBIA2300_35S_Cas9_SlU6p_sgRNA vector (described in the following literature: Song, J., Zhang, S., Wang, X., Sun, S., Liu, Z., Wang, K., Wan, H., Zhou, G., Li, R., Yu, H., and Cui, X. (2020). Variations in Both FTL1 and SP5G, Two Tomato FT Paralogs, Control Day-Neutral Flowering. Molecular plant.) were then digested with BsaI and ligated using T4 DNA ligase to obtain the ligation product. The product was cultured in LB solid medium containing kanamycin, screened for positive clones by colony PCR, and sequenced for verification. The plasmid was then isolated and used for future use. This is the CRISPR / Cas9 vector for the TST3b gene, designated TST3b_CRISPR. Figure 2 shows the TST3b_CRISPR structure.
[0099] 2. Obtaining CRISPR / Cas9-edited mutants
[0100] The CRISPR vector TST3b_CRISPR successfully constructed in step 1 was transferred into Agrobacterium AGL1, and wild currant tomato (PP) was used as the recipient for Agrobacterium-mediated genetic transformation.
[0101] The 8 regenerated plants were tested for the Cas 9 gene by PCR using the following primers: Cas 9-F and Cas9-R:
[0102] Cas 9-F: CACTATCCTTCGCAAGACCC (SEQ ID No. 11);
[0103] Cas9-R: GAGATTCCCGAACAAGCCG (SEQ ID No. 12).
[0104] The PCR products were detected by gel electrophoresis, and the Cas9 gene was detected in 6 plants.
[0105] The editing site of the TST3b gene was amplified by PCR using the primer pair consisting of CR-TST3b-F and CR-TST3b-R:
[0106] CR-TST3b-F: AACATGTTGCAAGGATGGG (SEQ ID No. 13);
[0107] CR-TST3b-R: TGACAAAAACATTCCAAGGGA (SEQ ID No. 14).
[0108] The PCR products were sequenced and two homozygous mutant plants were finally obtained.
[0109] Individual T0 homozygous mutant plants were preserved for seed, yielding T1 seeds for sowing. T1 plants without the Cas9 gene (detection primers: Cas9-F and Cas9-R) were selected and self-pollinated to yield two independent CRISPR lines with different TST3b mutation types, designated tst3b-cr1 and tst3b-cr2. The sequences of their gene editing sites are shown in Figure 3.
[0110] Compared with the wild type (WT), the TST3b gene in the tst3b-cr1 (marked as tst3bcr1 in Figure 3) genome mutated: at target site 2 (Target2), the nucleotide G was deleted at position 132 of SEQ ID No.1, a total deletion of 1bp, resulting in a frameshift mutation in the TST3b gene, resulting in the TST3b-1 gene, which is unable to encode the protein TST3b with the amino acid sequence of SEQ ID No.2, ultimately causing the loss of TST3b function and thus knocking out the TST3b gene.
[0111] Compared with the wild type (WT), the TST3b gene in the tst3b-cr2 (marked as tst3bcr2 in Figure 3) genome mutated: at target site 2 (Target2), the nucleotide TG was deleted at positions 131-132 of SEQ ID No.1, a total of 2 bp was deleted, resulting in a frameshift mutation in the TST3b gene, resulting in the TST3b-2 gene, which was unable to encode the protein TST3b with the amino acid sequence of SEQ ID No.2, ultimately causing the loss of TST3b function and knocking out the TST3b gene.
[0112] 3. Investigating the Soluble Sugar Content Phenotype of CRISPR Mutants
[0113] To identify the phenotype of CRISPR materials, homozygous mutant CRISPR materials without Cas 9 (tst3b-cr1 and tst3b-cr2) and wild-type PP (WT) were planted in a solar greenhouse with three replicates, and five plants of each line were planted in each replicate.
[0114] The peels of red-ripe fruits from the 2nd to 4th ears were taken, frozen in liquid nitrogen, ground, and then mixed. The soluble sugar content was detected by liquid chromatography-mass spectrometry.
[0115] The results are shown in Figure 4. Compared with the wild-type control, the CRISPR mutant plants (tst3b-cr1 and tst3b-cr2) showed a significant increase in soluble sugar content. This result proves that TST3b is an important regulatory gene for soluble sugar content in tomato fruit.
[0116] 4. Investigating the fruit weight phenotype of CRISPR mutants
[0117] To identify the phenotype of CRISPR materials, homozygous mutant CRISPR materials without Cas 9 (tst3b-cr1 and tst3b-cr2) and wild-type PP (WT) were planted in a solar greenhouse with three replicates, and five plants of each line were planted in each replicate.
[0118] After the fruits were ripe, the total weight and number of fruits in each ear from the 2nd to the 4th ears were counted, and the average fruit weight was calculated.
[0119] The results are shown in Figure 5. Compared to wild-type controls, the CRISPR mutant plants (tst3b-cr1 and tst3b-cr2) showed significantly increased fruit weight. This result demonstrates that knocking out TST3b increases both soluble sugar content and fruit weight in tomato fruit.
[0120] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.
[0121] CROSS-REFERENCE TO RELATED APPLICATIONS
[0122] This application claims priority to the Chinese patent application (application number 202311294131.0) filed on October 8, 2023, the entire contents of which are incorporated herein by reference. Industrial Applicability
[0123] This study uses CRISPR / Cas9-mediated gene editing to knock out a specific target in the tomato TST3b gene, generating mutants with significantly increased soluble sugar content and fruit weight. This approach provides new material for tomato variety breeding. This approach has significant application value in research on improving tomato quality and holds broad application potential and market prospects in the agricultural sector. Sequence Listing Free Content
[0124] SEQ ID No.1
[0125]
[0126] SEQ ID No.2
[0127] MRGAVLIALAAAIGNMLQGWDNATIAGSVLYIKKEFNLQTQPTMEGLIVAMSLIGATVITTFSGPVSDMLGRRPMLIISSVLYFLSGLVMLWAPNVYVLLLARLLDGFGIGLAVTLVPVYISETAPPEIRGQLNTFPQFTGSLGMFLSYCMVFGMSLTQAPSWRLMLGVLSIPSLAYFFLALFYLPESPRWLVSKGRMKEAKQVLQRLRGREDVSGEMALLMEGLGVGGEVSIEEYIIGPDNELADNHDEKDQIKLYGAEEGLSWIAKPVTGQSTLGLVSRHGSMANQSMPLMDPLVTLFGSVHEKMPEMGSMRSMLFSNVGSMFNITENQGKTDNWDEESQKDEENHMSDGSGAESDDNLRSPLLSRQGTNAEGNMGPPTSLSMRQGSNFMQANGVGEQASMGIGGGWQLAYRKDEKKEGALKRIYLHEEGGSGSRRGSIISLPGDAHADQAEFIHAAALVSQSVLRAESVLGQQSIEEAIETQSETVTKKSVWKALLEPGVKHALIVGVGLQILQQFSGINGVLYYTPQILEQAGVGVLLSNMGIGSDSASFLISAVTTLLMLPTIGVAMRLMDLAGRRWLLLATLPVLLSSLIVLVLGNVINMGEVMHAVISTASVVVYFCTFVMGFGPIPNILCSEIFPTSVRGICIAICALTFWIGDIIVTYSLPVMLNSIGLGGVFAIYAVVCAVAWVFVFLKVPETKGMPLEVITEFFAVGAKKAATE
[0128] SEQ ID No.3
[0129] ACAAGCAGGCGTTGGAGTTC
[0130] SEQ ID No.4
[0131] AGCGGTGGAGATCACAGCAT
[0132] SEQ ID No.5
[0133] TCTTCCGACACCATCGAA
[0134] SEQ ID No.6
[0135] AGAACTGCAACAGTGAGC
[0136] SEQ ID No.7
[0137] GGGACAATGCGACGATAGC
[0138] SEQ ID No.8
[0139] AACACACACATGGAA
[0140] SEQ ID No.9
[0141] ATATATGGTCTTCGTTTGGGGACAATGCGACGATAGCGTTTTAGAGCTAGAAATAGC
[0142] SEQ ID No.10
[0143] ATTATTGGTCTCGAAACTTCCATGGTTGGCTGTGTTCTGCACCAGCCGGGAATCGAA
[0144] SEQ ID No.11
[0145] CACTATCCTTCGCAAGACCC
[0146] SEQ ID No.12
[0147] GAGATTCCCGAACAAGCCG
[0148] SEQ ID No.13
[0149] AACATGTTGCAAGGATGGG
[0150] SEQ ID No.14
[0151] TGACAAAAAACTCCAAGGGA
[0152] SEQ ID No.15
[0153] GATGGGACAATGCGACGATAGCAGGACT
[0154] SEQ ID No.16
[0155] ACAAACACAGCCAACCATGGAAGGGCTAATT
[0156] SEQ ID No.17
[0157] ACAAACACAGCCAACCATGAAGGGCTAATT
[0158] SEQ ID No.18
[0159] ACAAACACAGCCAACCAGAAGGGCTAATT
Claims
1. A substance for reducing the activity or content of protein TST3b, or a substance for inhibiting or reducing the expression of a gene encoding the protein TST3b, characterized in that: The application is any of the following: P1. Application in increasing soluble sugar content in tomatoes; P2. Application in improving the sweetness of tomatoes; P3, application in improving the taste of tomatoes; P4. Application in improving tomato quality; P5. Application in increasing single fruit weight of tomatoes; P6. Application in increasing tomato yield; P7, application in tomato breeding; The protein TST3b may be the following protein A1), A2) or A3): A1) a protein having an amino acid sequence of SEQ ID No. 2; A2) A protein derived from A1) or having more than 80% identity with the protein shown in A1) and having the same function, obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in A1); A3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of A1), A2) or A3).
2. The use according to claim 1, characterized in that: The protein TST3b is derived from tomato.
3. The use according to claim 1 or 2, characterized in that: The coding gene of the protein TST3b is a DNA molecule shown in a1) or a2) or a3) below: a1) The coding sequence is the DNA molecule shown in SEQ ID No.1 in the sequence list; a2) a DNA molecule having 90% or more identity with the nucleotide sequence defined in a1) and encoding the protein TST3b described above; a3) A DNA molecule which hybridizes under stringent conditions with the nucleotide sequence defined in a1) or a2) and encodes the protein TST3b described above.
4. The use according to any one of claims 1 to 3, characterized in that: The substance that reduces the activity or content of protein TST3b, or the substance that inhibits or reduces the expression of the gene encoding the protein TST3b, is any one of the following substances c1)-c4): c1) a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the protein TST3b; c2) an expression cassette containing the nucleic acid molecule described in c1); c3) a recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2); c4) a recombinant microorganism containing the nucleic acid molecule described in c1), or a recombinant microorganism containing the expression cassette described in c2), or a recombinant microorganism containing the recombinant vector described in c3).
5. The use according to any one of claims 1 to 4, characterized in that: c1) The nucleic acid molecule is a sgRNA targeting the gene encoding the protein TST3b according to any one of claims 1 to 3 or a DNA molecule expressing the sgRNA.
6. The application according to claim 5, characterized in that: The sgRNAs are sgRNA named sgRNA1 and sgRNA named sgRNA2, the target sequence of sgRNA1 is positions 59-77 of SEQ ID No.1, and the target sequence of sgRNA2 is positions 117-135 of SEQ ID No.
1.
7. A method for increasing the soluble sugar content, and / or sweetness, and / or quality, and / or single fruit weight, and / or yield of tomatoes, characterized in that: The method comprises increasing the soluble sugar content, and / or sweetness, and / or quality, and / or single fruit weight, and / or yield of tomatoes by inhibiting or reducing the expression level of the gene encoding the protein TST3b described in any one of claims 1-3 in the tomato genome.
8. The method according to claim 7, characterized in that: The method comprises introducing into the tomato a substance that reduces the activity or content of the protein TST3b according to any one of claims 1 to 3, or introducing a substance that reduces the expression of the gene encoding the protein TST3b according to any one of claims 1 to 3; the substance that reduces the activity or content of the protein TST3b according to any one of claims 1 to 3, or introducing a substance that reduces the expression of the gene encoding the protein TST3b according to any one of claims 1 to 3 is any one of the following substances c1) to c4): c1) a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the protein TST3b; c2) an expression cassette containing the nucleic acid molecule described in c1); c3) a recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2); c4) a recombinant microorganism containing the nucleic acid molecule described in c1), or a recombinant microorganism containing the expression cassette described in c2), or a recombinant microorganism containing the recombinant vector described in c3).
9. The method according to claim 8, characterized in that: c1) The nucleic acid molecule is a sgRNA targeting the gene encoding the protein TST3b according to any one of claims 1 to 3 or a DNA molecule expressing the sgRNA.
10. The method according to claim 7, characterized in that: The reduction or inhibition of the expression of the protein TST3b encoding gene is to replace the protein TST3b encoding gene shown in SEQ ID No.1 in the tomato genome with the TST3b-1 gene or the TST3b-2 gene, wherein the TST3b-1 gene is a DNA molecule obtained by deleting the nucleotide G at position 132 of SEQ ID No.1 in the sequence list, while keeping the other nucleotides of SEQ ID No.1 unchanged; the TST3b-2 gene is a DNA molecule obtained by deleting the nucleotide TG at positions 131-132 of SEQ ID No.1 in the sequence list, while keeping the other nucleotides of SEQ ID No.1 unchanged.
Citation Information
Patent Citations
Method of enhancing the seed yield and promoting the growth of plants
CN103097401A
Pyrus fruit sugar transporter gene PbTMT4 and application thereof
CN107400671A
Ostmt1 gene involved in vacuolar sugar transport from rice
KR1020110085729A