Corynebacterium sp. strain with carrageenan degradation and galactose utilization abilities introduced thereinto and method for producing histidine from seaweed using same

Abstract

The present invention relates to a Corynebacterium sp. strain with enhanced histidine production ability and introduced galactose utilization ability, and a method for producing histidine from seaweed using same. The transformed Corynebacterium sp. strain of the present invention exhibits excellent histidine production ability through the enhancement of the galactose utilization and histidine production pathways, thereby producing amino acids on the basis of an eco-friendly process. Additionally, since galactose obtained from the degradation of carrageenan, a major component of seaweed, is utilized, the invention provides the advantage of utilizing seaweed as a biomass resource.

Description

A strain of Corynebacterium spp. with carrageenan decomposition and galactose utilization ability and a method for producing histidine from seaweed using the strain

[0001] The present invention relates to a Corynebacterium strain having improved histidine production ability and a histidine production method using the same.

[0002] Currently, due to the climate change agreement and strengthened environmental regulations, research on renewable energy sources such as bio, hydrogen, and solar energy is actively being conducted worldwide to develop stable and environmentally friendly energy sources that can replace oil and coal. Bioenergy production primarily utilizes grains such as sugarcane and corn, as well as lignocellulosic resources, which are forestry and agricultural byproducts. Leading countries in renewable energy production, such as the United States, Brazil, and Germany, are conducting research and production on these resources. However, limitations in biofuel production using grains and lignocellulosic resources are emerging due to issues such as food shortages, limited cultivation areas depending on crop type, difficulties in nutrient supply, and the economic feasibility of additional pretreatment processes for hemicellulose and lignin in addition to cellulose.

[0003] To address these issues, marine algae, whose cell walls are composed of a large amount of fiber and various polysaccharides, have recently attracted attention as a new bioenergy source. Major seaweed producers are Asian countries such as Korea, Japan, China, and Indonesia, which have a larger area of ​​ocean available for cultivation than land. Furthermore, seaweed grows faster than wood and plant cellulose and absorbs carbon dioxide from the air through photosynthesis, thereby reducing greenhouse gas emissions. Furthermore, the low lignin content in seaweed simplifies the pretreatment process. Furthermore, these large seaweeds are composed of approximately 60-95% water, with more than 50% carbohydrates, giving them significant potential as a biofuel source. Meanwhile, seaweed farming, primarily laver (primarily Porphyra yezoensis), is actively pursued in Korea and Japan, and red algae account for more than half of the seaweed native to Korea. In addition, it has a wider habitat than brown or green algae, and grows naturally from shallow waters to deep waters where sunlight reaches, so it has a greater number of species than other algae, making it excellent in terms of raw material supply and demand. In addition, it contains a lot of carbohydrates, that is, simple sugar convertible substances that microorganisms can convert into ethanol, compared to other seaweeds, so it has an advantage in terms of energy conversion. Depending on the species, the types and bonding forms of polysaccharides that make up macroalgae vary. Among them, red algae are composed of cellulose, a structural polysaccharide of the inner layer of the cell wall, and viscous polysaccharides with sulfate groups in the outer layer and between cells, such as agar and carrageenan, as well as xylan and mannan. In particular, agar and carrageenan are representative at 28% and 24%, respectively, while cellulose is not that abundant at 3-16%.

[0004] To date, red algae has been used to extract polysaccharides such as agar and carrageenan through processing methods such as alkaline, acid, or enzyme treatment. These polysaccharides have been widely utilized industrially as food and cosmetic additives, and as healthy food resources. However, the complex structure of red algae itself makes it difficult to decompose, making it difficult to use as a substrate for biofuel production. Furthermore, the disposal of byproducts and waste generated beyond the currently used materials remains a problem. As a member of the OECD, Korea is obligated to comply with the '96 Protocol' adopted by the London Convention, which regulates ocean dumping of wastes. Therefore, the possibility of a crisis arising from the disposal of discarded seaweed cannot be ruled out after 2012.

[0005] Meanwhile, histidine is one of the twenty standard amino acids found in proteins. An essential amino acid for humans, histidine is a crucial component of histamine synthesis, which enhances capillary permeability in the circulatory system. As a histamine precursor, histidine enhances sexual function and promotes gastric acid secretion in hypochlorhydria, enhancing digestion. It also raises blood pressure and strengthens the muscles of the bronchial tubes. It is also essential for tissue growth and repair, making it essential for infant growth. Furthermore, histidine is also essential for boosting immunity in patients recovering from illness, making it a valuable amino acid supplement, like other essential amino acids.

[0006] Accordingly, the present inventors confirmed that a transformed Corynebacterium strain in which genes related to the histidine production pathway, carrageenan degradation, and galactose utilization pathway are overexpressed or introduced has excellent carrageenan degradation ability and histidine production ability, and completed the present invention.

[0007] The purpose of the present invention is to provide a transformant Corynebacterium strain in which a gene encoding ATP phosphoribosyltransferase, a gene encoding Glucose-6-phosphate 1-dehydrogenase, a gene encoding 6-phosphogluconate dehydrogenase, a gene encoding Ribose-phosphate pyrophosphokinase, a gene encoding Histidinol dehydrogenase, a gene encoding Nucleoside diphosphate kinase, a gene encoding Adenylate kinase, and a gene encoding Bifunctional purine biosynthesis protein PurH are overexpressed.

[0008] In addition, another object of the present invention is to provide a composition for producing histidine comprising the transformed Corynebacterium spp. strain.

[0009] In addition, another object of the present invention is to provide a method for producing histidine from a Corynebacterium spp. strain, which comprises a step of culturing the transformed Corynebacterium spp. strain.

[0010] In addition, another object of the present invention is to provide a composition for producing histidine, comprising seaweed, a carrageenan decomposing enzyme, and the transformed Corynebacterium spp. strain.

[0011] In addition, another object of the present invention is to provide a method for producing histidine using seaweed.

[0012] To achieve the above purpose, the present invention provides a transformed Corynebacterium strain overexpressing a gene encoding ATP phosphoribosyltransferase, a gene encoding Glucose-6-phosphate 1-dehydrogenase, a gene encoding 6-phosphogluconate dehydrogenase, a gene encoding Ribose-phosphate pyrophosphokinase, a gene encoding Histidinol dehydrogenase, a gene encoding Nucleoside diphosphate kinase, a gene encoding Adenylate kinase, and a gene encoding Bifunctional purine biosynthesis protein PurH.

[0013] Next, the present invention provides a composition for producing histidine comprising the transformed Corynebacterium spp. strain.

[0014] Furthermore, the present invention provides a method for producing histidine from a Corynebacterium spp. strain, comprising a step of culturing the transformed Corynebacterium spp. strain.

[0015] In addition, a composition for producing histidine is provided, comprising seaweed, a carrageenan decomposing enzyme, and the transformed Corynebacterium spp. strain.

[0016] Lastly, the present invention provides a method for producing histidine using seaweed, comprising the steps of: saccharifying seaweed using a carrageenan decomposing enzyme to produce a seaweed hydrolysate; and inoculating and fermenting a transformed Corynebacterium spp. strain into a medium containing the seaweed hydrolysate.

[0017] The transgenic Corynebacterium strain of the present invention exhibits excellent histidine production capacity through enhanced galactose utilization and histidine production pathways, enabling the production of amino acids through an eco-friendly process. Furthermore, because it utilizes galactose, obtained through the decomposition of carrageenan, a major component of seaweed, it offers the advantage of utilizing seaweed as biomass.

[0018] FIG. 1 is a diagram simply showing a biosynthetic pathway for histidine production through carrageenan decomposition in one embodiment of the present invention.

[0019] FIG. 2 is a diagram showing the results of confirming the histidine production ability of a transformed Corynebacterium strain with an enhanced histidine production pathway in one embodiment of the present invention.

[0020] FIG. 3 is a diagram showing the results of confirming the carrageenan decomposition ability of Iduronate-2-sulfatase and Kappa-carrageenase in one embodiment of the present invention.

[0021] FIG. 4 is a diagram showing the results of confirming the galactose utilization ability and histidine production ability of a transformed Corynebacterium strain into which a galactose utilization pathway has been introduced in one embodiment of the present invention.

[0022] FIG. 5 is a diagram showing the results of confirming the galactose utilization ability of a transformed Corynebacterium strain into which a galactose utilization pathway has been introduced and cultured under optimal culture conditions in one embodiment of the present invention.

[0023] FIG. 6 is a diagram showing the results of confirming histidine production through galactose consumption by a transformed Corynebacterium strain cultured under optimal culture conditions with a galactose utilization pathway introduced and pentose phosphate, ATP regeneration, and histidine biosynthesis pathways enhanced, in one embodiment of the present invention.

[0024] Hereinafter, the present invention will be described in detail with reference to the attached drawings, using exemplary embodiments. However, the following exemplary embodiments are provided as illustrative examples of the present invention. If a detailed description of a technology or configuration well known to those skilled in the art is judged to unnecessarily obscure the gist of the present invention, such detailed description may be omitted, and the present invention is not limited thereby. The present invention is capable of various modifications and applications within the scope of the following claims and equivalents interpreted therefrom.

[0025] In addition, the terms used in this specification are terms used to appropriately express preferred embodiments of the present invention, and may vary depending on the intention of the user or operator, or the customs of the field to which the present invention belongs. Therefore, the definitions of these terms should be determined based on the contents throughout this specification. Throughout the specification, when a part is said to "include" a certain component, this does not mean that other components are excluded, but rather that other components may be included, unless specifically stated otherwise.

[0026] Throughout this specification, '%' used to indicate the concentration of a particular substance is (w / w) % for solid / solid, (w / v) % for solid / liquid, and (v / v) % for liquid / liquid, unless otherwise stated.

[0027] Hereinafter, the present invention will be described in more detail.

[0028] In one aspect, the present invention relates to a transformant Corynebacterium strain overexpressing a gene encoding ATP phosphoribosyltransferase, a gene encoding Glucose-6-phosphate 1-dehydrogenase, a gene encoding 6-phosphogluconate dehydrogenase, a gene encoding Ribose-phosphate pyrophosphokinase, a gene encoding Histidinol dehydrogenase, a gene encoding Nucleoside diphosphate kinase, a gene encoding Adenylate kinase, and a gene encoding Bifunctional purine biosynthesis protein PurH.

[0029] In one embodiment of the present invention, the gene encoding the ATP phosphoribosyltransferase may be derived from Corynebacterium glutamicum and may consist of a base sequence of SEQ ID NO: 1. In addition, if the gene is capable of expressing a protein exhibiting substantially ATP phosphoribosyltransferase activity as a base sequence that exhibits a homology of 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, and most specifically 99% or more with the sequence of SEQ ID NO: 1, it may be included without limitation.

[0030] In one embodiment of the present invention, the gene encoding the Glucose-6-phosphate 1-dehydrogenase may be derived from Corynebacterium glutamicum and may be composed of a base sequence of SEQ ID NO: 2. In addition, if the gene is capable of expressing a protein exhibiting Glucose-6-phosphate 1-dehydrogenase activity as a base sequence that exhibits 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, and most specifically 99% or more homology with the sequence of SEQ ID NO: 2, it may be included without limitation.

[0031] In one embodiment of the present invention, the gene encoding the 6-phosphogluconate dehydrogenase may be derived from Corynebacterium glutamicum and may be composed of a base sequence of SEQ ID NO: 3. In addition, if the base sequence exhibits a homology of 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, and most specifically 99% or more to the sequence of SEQ ID NO: 3 and is capable of expressing a protein exhibiting substantial 6-phosphogluconate dehydrogenase activity, it may be included without limitation.

[0032] In one embodiment of the present invention, the gene encoding the Ribose-phosphate pyrophosphokinase may be derived from Corynebacterium glutamicum and may be composed of a base sequence of SEQ ID NO: 4. In addition, if the gene is capable of expressing a protein exhibiting substantial Ribose-phosphate pyrophosphokinase activity as a base sequence that exhibits a homology of 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, and most specifically 99% or more with the sequence of SEQ ID NO: 4, it may be included without limitation.

[0033] In one embodiment of the present invention, the gene encoding the Histidinol dehydrogenase may be derived from Corynebacterium glutamicum and may consist of a base sequence of SEQ ID NO: 5. In addition, if the gene is capable of expressing a protein exhibiting substantial Histidinol dehydrogenase activity as a base sequence that exhibits 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, and most specifically 99% or more homology with the sequence of SEQ ID NO: 5, it may be included without limitation.

[0034] In one embodiment of the present invention, the gene encoding the nucleoside diphosphate kinase may be derived from Corynebacterium glutamicum and may be composed of a base sequence of SEQ ID NO: 6. In addition, if the gene is capable of expressing a protein exhibiting substantial nucleoside diphosphate kinase activity as a base sequence having a homology of 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, and most specifically 99% or more with the sequence of SEQ ID NO: 6, it may be included without limitation.

[0035] In one embodiment of the present invention, the gene encoding the Adenylate kinase may be derived from Corynebacterium glutamicum and may consist of a base sequence of SEQ ID NO: 7. In addition, if the base sequence exhibits 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, and most specifically 99% or more homology with the sequence of SEQ ID NO: 7 and is capable of expressing a protein exhibiting substantial Adenylate kinase activity, it may be included without limitation.

[0036] In one embodiment of the present invention, the gene encoding the Bifunctional purine biosynthesis protein PurH may be derived from Corynebacterium glutamicum and may be composed of a base sequence of SEQ ID NO: 8. In addition, if the gene is capable of expressing a protein exhibiting Bifunctional purine biosynthesis protein PurH activity as a base sequence that exhibits 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, and most specifically 99% or more homology with the sequence of SEQ ID NO: 8, it may be included without limitation.

[0037] In one embodiment of the present invention, the transformed Corynebacterium strain may be one in which the tkt promoter of the tkt gene (Genbank ID: BAB98967.1) and the hisD promoter of the hisD gene (Genbank ID: BAB99495.1) are replaced with the H36 promoter, which is a high-expression synthetic promoter, but is not limited thereto.

[0038] In one embodiment of the present invention, the H36 promoter may be represented by the base sequence of SEQ ID NO: 9, but is not limited thereto.

[0039] In one embodiment of the present invention, the transformed Corynebacterium strain may have an enhanced pentose phosphate pathway, a histidine synthetic pathway, and an ATP regeneration pathway, thereby increasing histidine production, but is not limited thereto.

[0040] In one embodiment of the present invention, the gene encoding the galactose transporter may be derived from Saccharomyces cerevisiae and may consist of a base sequence of SEQ ID NO: 10. In addition, if the base sequence exhibits a homology of 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, and most specifically 99% or more with the sequence of SEQ ID NO: 10 and is capable of expressing a protein exhibiting substantial galactose transporter activity, it may be included without limitation.

[0041] In one embodiment of the present invention, the gene encoding the galactose-1-phophate uridylytransferase may be derived from Escherichia coli and may consist of a base sequence of SEQ ID NO: 11. In addition, if the base sequence exhibits a homology of 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, and most specifically 99% or more with the sequence of SEQ ID NO: 11 and is capable of expressing a protein exhibiting substantial galactose-1-phophate uridylytransferase activity, it may be included without limitation.

[0042] In one embodiment of the present invention, the gene encoding the Aldose-1-epimerase may be derived from Escherichia coli and may consist of a base sequence of SEQ ID NO: 12. In addition, if the base sequence exhibits a homology of 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, and most specifically 99% or more with the sequence of SEQ ID NO: 12 and is capable of expressing a protein exhibiting substantial Aldose-1-epimerase activity, it may be included without limitation.

[0043] In one embodiment of the present invention, the gene encoding the galactokinase may be derived from Corynebacterium glutamicum and may consist of a base sequence of SEQ ID NO: 13. In addition, if the gene is capable of expressing a protein exhibiting substantial galactokinase activity as a base sequence that exhibits 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, and most specifically 99% or more homology with the sequence of SEQ ID NO: 13, it may be included without limitation.

[0044] In one embodiment of the present invention, the transformed Corynebacterium spp. strain may have a galactose uptake system introduced, but is not limited thereto.

[0045] In one embodiment of the present invention, the Corynebacterium genus strain is Corynebacterium granulosum, Corynebacterium glucuronolyticum, Corynebacterium glutamicum, Corynebacterium glycinophilum, Corynebacterium diphtheriae, Corynebacterium lilium, Corynebacterium renale, Corynebacterium melassecola, Corynebacterium matruchotii, Corynebacterium McGinley macginleyi), Corynebacterium minutissimum, Corynebacterium bovis, Corynebacterium thermoaminogenes, Corynebacterium pseudodiphtheriticum (Corynebacterium hofmannii), Corynebacterium pseudotuberculosis, Corynebacterium spec, Corynebacterium striatum, Corynebacterium amycolatum, Corynebacterium acetoacidophilum, Corynebacterium Corynebacterium acetoglutamicum,Corynebacterium accolens, Corynebacterium aquaticum, Corynebacterium afermentans, Corynebacterium auris, Corynebacterium argentoratense, Corynebacterium alkanolyticum, Corynebacterium ammoniagenes, Corynebacterium efficiens, Corynebacterium ovis, Corynebacterium urealyticum, Corynebacterium ulcerans, It may be selected from the group consisting of Corynebacterium xerosis, Corynebacterium jeikeium, Corynebacterium callunae, Corynebacterium tenuis, Corynebacterium parvum, Corynebacterium propinquum, Corynebacterium flavescens, Corynebacterium pyogenes, Corynebacterium halofytica, Corynebacterium haemolyticum and Corynebacterium herculis. and preferably Corynebacterium glutamicum,But it is not limited to this.

[0046] In one embodiment of the present invention, the transformed Corynebacterium spp. strain may be a transformed microorganism in which a recombinant vector including a gene encoding ATP phosphoribosyltransferase, a gene encoding Glucose-6-phosphate 1-dehydrogenase, a gene encoding 6-phosphogluconate dehydrogenase, a gene encoding Ribose-phosphate pyrophosphokinase, a gene encoding Histidinol dehydrogenase, a gene encoding Nucleoside diphosphate kinase, a gene encoding Adenylate kinase, and a gene encoding Bifunctional purine biosynthesis protein PurH is introduced into the transformed Corynebacterium spp. strain; and a recombinant vector including a gene encoding galactose transporter, a gene encoding galactose-1-phophate uridylytransferase, a gene encoding Aldose-1-epimerase, and a gene encoding galactokinase.

[0047] The term "recombinant" as used herein refers to a cell that replicates a heterologous nucleic acid, expresses said nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. A recombinant cell can express a gene or gene fragment not found in the cell's native form, either in sense or antisense form. A recombinant cell can also express a gene found in the cell's native form, but in a modified form that has been reintroduced into the cell by artificial means.

[0048] In addition, the recombinant vector may include, without limitation, linear DNA, plasmid DNA, recombinant viral vector, etc., as long as it can be introduced into a host cell to deliver a target gene. The recombinant virus may be any one selected from the group consisting of retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, and lentivirus, but is not limited thereto.

[0049] The term “transformation” used in the present invention means that the genetic properties of a microorganism change when the microorganism receives DNA provided from outside.

[0050] In addition, the transformation may be performed using a suitable standard technique known in the art, such as, but not limited to, electroporation, electroinjection, microinjection, calcium phosphate co-precipitation, calcium chloride / rubidium chloride, retroviral infection, DEAE-dextran, cationic liposome, polyethylene glycol-mediated uptake, gene gun, etc.

[0051] In one aspect, the present invention relates to a composition for producing histidine comprising the above-described transformed Corynebacterium spp. strain.

[0052] Since the composition for producing histidine of the present invention includes the above-described transformed Corynebacterium spp. strain, descriptions of overlapping contents with the above-described transformed Corynebacterium spp. strain of the present invention are omitted to avoid excessive complexity of the present specification due to descriptions of overlapping contents.

[0053] The term “composition” used in the present invention means a mixture of various substances for producing a target substance, including a microbial culture medium, a carbon source, trace elements, and microbial spawn.

[0054] In one aspect, the present invention relates to a method for producing histidine from a Corynebacterium spp. strain, comprising the step of culturing the transformed Corynebacterium spp. strain.

[0055] In one embodiment of the present invention, the histidine may be produced through the use of galactose, but is not limited thereto.

[0056] The term "cultivation" in the present invention refers to growing target cells or tissues under artificially controlled environmental conditions. Representative environmental conditions include nutrients, temperature, osmotic pressure, pH, gas composition, and light, but the medium directly influences the growth. The medium can be broadly divided into liquid and solid media. The cultivation of the transformed Corynebacterium strain of the present invention can be performed using methods widely known in the art.

[0057] Specifically, the above cultivation is not particularly limited thereto as long as the transformed Corynebacterium spp. strain can produce histidine, but may be continuously cultivated in a batch process or a fed batch or repeated fed batch process, but is not limited thereto.

[0058] The culture medium used must adequately meet the requirements of the specific strain. Any medium known to be suitable for culturing Corynebacterium strains may be used without limitation, including BHI medium, BHIS medium, BHISG medium, CGXII medium, CGAF medium, and CN40 medium.

[0059] Potential sources of sugars include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used individually or as a mixture. Potential sources of nitrogen include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture. Potential sources of phosphorus include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or their corresponding sodium-containing salts. In addition, the culture medium must contain a metal salt such as magnesium sulfate or iron sulfate that is necessary for growth. Finally, in addition to the above substances, essential growth substances such as amino acids and vitamins may be used. Furthermore, appropriate precursors may be used in the culture medium. The above-mentioned raw materials may be added to the culture in a batch or continuous manner during the cultivation process, using an appropriate method.

[0060] The pH of the culture can be adjusted by appropriately using basic compounds such as sodium hydroxide, potassium hydroxide, or ammonia, or acid compounds such as phosphoric acid or sulfuric acid. Furthermore, foaming can be suppressed by using antifoaming agents such as fatty acid polyglycol esters. Oxygen or an oxygen-containing gas (e.g., air) is injected into the culture to maintain aerobic conditions. The culture temperature is usually between 20°C and 45°C, preferably between 25°C and 40°C.

[0061] Cultivation is continued until the maximum amount of histidine is produced. Histidine may be released into the culture medium or contained within the cells. The medium may preferably contain glucose, galactose, or carrageenan, which can serve as substrates for histidine production. The scope of glucose, galactose, or carrageenan includes all natural products (particularly, seaweed) containing the above substances.

[0062] The method for producing histidine of the present invention comprises a step of recovering histidine from cells or a culture medium. Methods for recovering histidine from cells or a culture medium are widely known in the art. The histidine recovery method may use methods such as centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g., ammonium sulfate precipitation), and chromatography (e.g., HPLC, ion exchange, affinity, hydrophobicity, and size exclusion).

[0063] In one aspect, the present invention relates to a composition for producing histidine comprising seaweed, a carrageenan decomposing enzyme and the transformed Corynebacterium spp. strain.

[0064] In one embodiment of the present invention, the seaweed may be at least one selected from the group consisting of red algae, brown algae, and green algae, and may preferably be red algae containing a large amount of carrageenan, but is not limited thereto.

[0065] In one embodiment of the present invention, the carrageenan decomposing enzyme may be, but is not limited to, Iduronate-2-sulfatase, Kappa-carrageenase, or a mixture thereof.

[0066] In one embodiment of the present invention, the gene encoding Iduronate-2-sulfatase may be derived from Zobellia galactanivorans and may consist of a base sequence of SEQ ID NO: 14. In addition, if a base sequence exhibits 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, and most specifically 99% or more homology with the sequence of SEQ ID NO: 14 and is capable of expressing a protein exhibiting substantial Iduronate-2-sulfatase activity, it may be included without limitation.

[0067] In one embodiment of the present invention, the gene encoding the Kappa-carrageenase may be derived from Zobellia galactanivorans and may consist of a base sequence of SEQ ID NO: 15. In addition, if the base sequence exhibits a homology of 70% or more, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, and most specifically 99% or more with the sequence of SEQ ID NO: 15 and is capable of expressing a protein exhibiting substantial Kappa-carrageenase activity, it may be included without limitation.

[0068] In one aspect, the present invention relates to a method for producing histidine using seaweed, comprising the steps of: saccharifying seaweed using a carrageenan decomposing enzyme to produce a seaweed hydrolysate; and inoculating and fermenting a transformed Corynebacterium spp. strain into a medium containing the seaweed hydrolysate.

[0069] In one embodiment of the present invention, the carrageenan decomposing enzyme may be, but is not limited to, Iduronate-2-sulfatase, Kappa-carrageenase, or a mixture thereof.

[0070] In one embodiment of the present invention, the seaweed may be at least one selected from the group consisting of red algae, brown algae, and green algae, and may preferably be red algae containing a large amount of carrageenan, but is not limited thereto.

[0071] In one embodiment of the present invention, the red algae may include, but are not limited to, seaweed, laver, kotoni, gaedobak, round laver, gaeummu, saebal, champulga, gosiraegi, jindubal, chamdobak, thorny ummu, silkworm, danbak, stone laver, stone tree, and jinuari.

[0072] In one embodiment of the present invention, brown algae may be used, but are not limited to, seaweed, kelp, sea mustard, sea squirt, sea mustard, sea tangle, sea mustard, sea tangle, sea tangle, sea tangle, sea tangle, sea tangle, sea tangle, sea tangle, sea tangle, sea tangle, sea tangle, sea tangle, etc.

[0073] In one embodiment of the present invention, the green algae may include, but are not limited to, blue seaweed, seaweed, sea mustard, sea cucumber, sea mustard, sea mustard, and sea mustard.

[0074] In one embodiment of the present invention, the Corynebacterium spp. strain may be cultured in a BHISG (Brain heart infusion-supplemented with glucose) medium under culture conditions of 25 to 35°C, air 1.5 to 2.5 L / min, and pH 6.0 to 8.0 for 20 to 28 hours, and then cultured in a pre-culture medium under culture conditions of 25 to 35°C, 150 to 250 rpm, air 1.5 to 2.5 L / min, and pH 6.0 to 8.0 for 20 to 28 hours.

[0075] In one embodiment of the present invention, the BHISG (Brain heart infusion-supplemented with glucose) medium contains 15 to 25 g / L glucose, 33 to 41 g / L brain heart infusion, and 87 to 95 g / L C6H 14 O6, 15 to 25 g / L C6H 12 O 6, It may contain, but is not limited to, 20 to 30 μg / L kanamycin and 5 to 15 μg / L chloramphenicol.

[0076] In one embodiment of the present invention, the pre-culture medium may include, but is not limited to, 2 to 4 g / L peptone, 0.9 to 1.5 g / L potassium dihydrogen phosphate, 1 to 3 g / L sodium citrate, 2 to 4 g / L yeast extract, 17 to 23 g / L glucose, 0.5 to 1.5 mg / L biotin, 0.5 to 1.5 mg / L cobalamine, 0.5 to 1.5 mg / L pantothenate, 0.5 to 1.5 mg / L thiamine HCL, and 0.5 to 1.5X trace element.

[0077] In one embodiment of the present invention, the medium may be a CN40 medium, a CGXII medium, a CGAF medium, and preferably a CN40 medium, but is not limited thereto.

[0078] In one embodiment of the present invention, the CN40 medium may contain, but is not limited to, 4 to 5 g / L peptone, 7 to 9 g / L ammonium sulfate, 1 to 3 g / L potassium dihydrogen phosphate, 17 to 23 g / L corn syrup, 1 to 3 g / L sodium citrate, 7 to 9 g / L yeast extract, 9 to 11 g / L galactose, 1 to 3 g / L MgSO4, 9 to 11 mg / L biotin, 1 to 3 mg / L cobalamine, 1 to 3 mg / L pantothenate, 9 to 11 mg / L thiamine HCL, and 0.5 to 1.5X trace element.

[0079] In one embodiment of the present invention, the fermentation may be performed for 40 to 50 hours under culture conditions of 25 to 35°C, 200 to 600 rpm, air 1.5 to 2.5 L / min, and pH 6.0 to 8.0, but is not limited thereto.

[0080] In one aspect, the present invention provides a pathway and culture conditions that optimize the utilization of galactose, a main component of seaweed, and the production of histidine.

[0081] Hereinafter, embodiments of the present invention will be described in more detail with reference to the attached drawings. However, the following embodiments are intended only to concretize the contents of the present invention and are not intended to limit the present invention.

[0082] <Example 1> Development of a Corynebacterium strain with an enhanced histidine production pathway

[0083] To develop a strain that increases histidine production, a recombinant vector that induces overexpression of genes related to the pentose phosphate pathway, histidine synthetic pathway, and ATP regeneration pathway, which are histidine production pathways, was constructed, and the recombinant vector was transformed into a Corynebacterium strain to produce a transformed Corynebacterium strain with an enhanced histidine production pathway (see Fig. 1).

[0084] First, to enhance the pentose phosphate pathway and histidine synthetic pathway, the tkt promoter of the tkt gene (Genbank ID: BAB98967.1) and the hisD promoter of the hisD gene (Genbank ID: BAB99495.1) were replaced with the H36 promoter (SEQ ID NO: 9), a highly expressive synthetic promoter, and the start codon of the pgi gene (Genbank ID: 69621401) was substituted from ATG to GTG. CRISPR vectors were constructed to replace the promoters of each gene and change the base sequence. For the construction of the above vector, the RA and LA sequences of the tkt and hisD genes were amplified by PCR using primers tkt LA F, tkt LA R, tkt RA F, tkt RA R, hisD LA F, hisD LA R, hisD RA F, hisD RA R, respectively, and the genes of tkt RA: 600 bp, tkt LA: 587 bp, hisD RA: 600 bp, and hisD LA: 600 bp were amplified. Afterwards, for the introduction of the H36 promoter, the related promoter was amplified by PCR using primers H36 F and R, and a 74 bp gene sequence was secured. Afterwards, each gene was inserted into the pJYS2 vector to construct a recombinant vector. To change the start codon of the pgi gene, the relevant gene was amplified through PCR using crRNA pgi F and R primers, and a 75 bp base sequence was obtained. The relevant base sequence was then cloned into pJYS2 to construct a recombinant vector.Afterwards, to enhance the pentose phosphate pathway, histidine synthetic pathway, and ATP regeneration pathway, an overexpression vector containing the genes of hisG (SEQ ID NO: 1, ATP phosphoribosyltransferase), zwf (SEQ ID NO: 2, Glucose-6-phosphate 1-dehydrogenase), gnd (SEQ ID NO: 3, 6-phosphogluconate dehydrogenase), prs (SEQ ID NO: 4, Ribose-phosphate pyrophosphokinase), hisD (SEQ ID NO: 5, Histidinol dehydrogenase), ndk (SEQ ID NO: 6, Nucleoside diphosphate kinase), adk (SEQ ID NO: 7, Adenylate kinase), and purH (SEQ ID NO: 8, Bifunctional purine biosynthesis protein PurH) was constructed. For the construction of the overexpression vector, the hisG gene was amplified by PCR using forward and reverse primers (HisG F, HisG R) containing restriction enzyme sequences from the genomic DNA of Corynebacterium glutamicum (C. glutaminifera) and a sequence of 605 bp was obtained. The Zwf gene was amplified by PCR using forward and reverse primers (Zwf F, Zwf R) containing restriction enzyme sequences from the genomic DNA of Corynebacterium glutaminifera (C. glutaminifera) and a sequence of 1455 bp was obtained. The Gnd gene was amplified by PCR using forward and reverse primers (Gnd F, Gnd R) containing restriction enzyme sequences from the genomic DNA of Corynebacterium glutaminifera (C. glutaminifera) and a sequence of 1479 bp was obtained. The Prs gene was amplified by PCR using forward and reverse primers (Gnd F, Gnd R) containing restriction enzyme sequences from the genomic DNA of Corynebacterium glutaminifera (C. glutaminifera).The HisD gene was amplified by PCR using forward and reverse primers (Prs F, Prs R) containing restriction enzyme sequences from the genomic DNA of Corynebacterium glutamicum (C. glutamiaum), and a sequence of 978 bp was obtained. The HisD gene was amplified by PCR using forward and reverse primers (HisD F, HisD R) containing restriction enzyme sequences from the genomic DNA of Corynebacterium glutamicum (C. glutamiaum), and a sequence of 1329 bp was obtained. The amplified gene and the pEKEx2 vector were treated with BamH1, EcoR1, and Kpn1 restriction enzymes, and then ligated with T4 ligase to construct a recombinant vector. Afterwards, the purH, adk, and ndk genes were amplified by PCR using forward and reverse primers (purH F, purH R, adk F, adk R, ndk F, ndk R) containing restriction enzyme sequences, respectively, to obtain sequences of 411, 546, and 1563 bp, respectively. Afterwards, the amplified genes and the pMT-tac vector were treated with BamH1 restriction enzyme and ligated with T4 ligase to construct a recombinant vector. Afterwards, the constructed vectors were transformed into Corynebacterium glutamicum by electroporation (2.5 kV), and the histidine production ability of the transformants was confirmed. Specifically, the histidine production ability was measured through o-phthaladehyde (OPA) derivatization based on the Agilent Zorbax Eclipse AAA column using high-performance liquid chromatography (HPLC).

[0085] The recombinant vectors and strains used in the present invention are shown in Tables 1 and 2, and the primer information used in this experiment is shown in Table 3. All transformed strains were cultured in a 250 ml shaker Erlenmeyer flask containing 50 ml of CN40 medium (containing 20 g / L glucose) at 30°C and 200 rpm for 72 hours.

[0086] As a result, as shown in Fig. 2, it was confirmed that the histidine production ability of the TDPH4 strain was improved 1.44-fold and that of the TDPH6 strain was improved 2.15-fold compared to the TDP strain (Fig. 2a, b). In addition, in the case of the TDP strain (5.25 ng / gdcw) with an enhanced pentose phosphate and histidine pathway, the amount of NADPH was confirmed to increase 4.14-fold compared to the wild type strain (1.27 ng / gdcw), and additionally, hisG * In the case of the TDPH4 strain, which is a strain with an enhanced pentose-phosphate pathway due to overexpression of ,zwf,gnd, and prs, 7.7 ng / gdcw of NADPH was produced, indicating a 1.48-fold increase in NADPH production compared to the TDP strain (Fig. 2c). In addition, in the TDPH6 strain, in which hisD, ndk, adk, and purH were additionally expressed, it was confirmed that the mRNA expression levels of related genes were increased (Fig. 2d, e).

[0087] Vector FeaturepEKEx2C. glutamicum-E. colishuttle vector, P tac ,lacI,Kan R,pBL1oripEKEx2::hisG*::zwf::gndpEKEx2, carryinghisG*(C-terminal area ofhisGwas deleted),zwf, andgndgenes originating fromC. glutamicumoriginating fromC. glutamicumpEKEx2::hisG*::zwf::gnd::prspEKEx2::hisG*::zwf::gnd, carryingprsgene originating fromC. glutamicumpMT-tacC. glutamicum-E. colishuttle vector, P tac ,Amp R ,Cm R ,pCG1oripMT-tac::purH::adk::ndkpMT-tac, carryingpurH, adk, ndkgenes originating fromC. glutamicum

[0088] 균주특징C. glutamicumATCC13032wild typeTDPC. glutamicumATCC13032 with replacement of the native promoter oftktgene andhisDgene by H36 synthetic promoter and the start codon ofpgigene was modified from atg to gtg, harboring pEKEx2TDPH3TDP harboring pEKEx2::hisG*::zwf::gndTDPH4TDP harboring pEKEx2::hisG*::zwf::gnd::prsTDPH6TDP harboring pEKEx2::hisG*::zwf::gnd::prs::hisD,pMT-tac::purH::adk::ndk

[0089] 프라이머(제한효소)염기서열(5'-3')tkt LA F(EcoR1)ATATGAATTCTAAGTTGTGAGTCCTTATtkt LA R(Xma1)ATACCCGGGCAATCTTAAGTCTGGGAtkt RA F(Xba1)ATATCTAGATTGACCACCTGACGCTGTCACCTGtkt RA R(Sal1)ATAGTCGACCAGCTGCTGGGTGCCAGCGAH36 F (BamH1)ATAGGATCCTCTATCTGGTGCCCTAAACGH36 R (Xba1)ATATCTAGACATGCTACTCCTAACCARNAgic FCTAGGTATAATGGATCGAATTTCTACTGTTGTAGATATGGCGGACATTcrRNA pgi RTTTATTTAAATGGATCTGGGTGGTCGAAATGTCCGCCATATCTACAAChisD LA F (Sal1)ATAGTCGACTCATCGGCATTGTTCGTGTCGhisD LA R (BamH1)GGGGGGGGATCCAGAGTTCATTTGAATTAGACTTAAAACTTAAAATGACChisD RA F (BamH1)ATAGGATCCTGCGGGCTTAAGAACTTGThisD RA R (EcoR1)ATAGAATTCGCCAGCCACCGTGCTCAGcrRNA hisD FAAGCTTGCATGGCGGCCGGAATTTCTACTGTTGTAGATCCTATTGTATTCCcrRNA hisD RTAAATGGATCTGCGGCCGTGTTACGTGGGGAATAGGATCTACAACAGTAGhisG F (BamH1)ATAGGATCCATGTTGAAAATCGCTGTCCChisG R (Kpn1)ATAGGTACCCTAGATGCGGGCGATGCzwf FGCATCGCCCGCATCTAGGGTACAAGGAGATAGATGGTGATCTTCGGTGTCzwf R (Kpn1)CCAGTGAATTCGAGCTCGGTACCTTATGGCCTGCGCCAGGnd FCCTGGCGCAGGCCATAAGGTACAAGGAGATATAGATGCCGTCAAGTACGATCAAgnd R(Kpn1)CCAGTGAATTCGAGCTCGGTACCTTAAGCTTCAACCTCGGAGCGprs FGCTCCGAGGTTGAAGCTTAAGGTACAAGGAGATATAGATGACTGCTCACTGGAAACAprs R (Kpn1)GGCCAGTGAATTCGAGCTCGGGTACCTTAGGCCTCGCCCTCGhisD FTCGAGGGCGAGGCCTAAGGTACAAGGAGATATAGATGTTGAATGTCACTGACCTGhisD R (Kpn1)CAGTGAATTCGAGCTCGGGTACCTTAGGCCTCGTCGGTGGndk FGGAGATATCATATCGATGGATCCATGACTGAACGTACTCTCATCndk R (BamH1)GTACGAGTCGCATCTATATCTCCTTTTACAGGTTAGGGAACCAGATAdk FCTCCATCTGGTTCCCTAACCTGTAAAAGGAGATATAGATGCGACTCGTACTCCTadk RCGCGGTACCCGGGGATCTTATTTGCCCAGTGCCTTGpurH FGGCAAATAAGATCCCCGGAAGGAGATATAGATGAGCGATGATCGTAAGGpurH RAACAGGCGGCCGCGGTACCCGGGTTAGTGAGCGAAGTGTCGCG

[0090] <Example 2> Confirmation of the carrageenan decomposition ability of iduronate-2-sulfatase and kappa-carrageenase.

[0091] 2-1. Production of transformants expressing the idsA3 gene and cgkA gene

[0092] To decompose carrageenan, the main component of red algae, the idsA3 gene (Iduronate-2-sulfatase) and cgkA gene (Kappa-carrageenase), which are related to the carrageenan hydrolysis pathway, were expressed through the pColdII vector. For the construction of this overexpression vector, the idsA3 gene was amplified by PCR using forward and reverse primers (IdsAF, IdsA R) containing restriction enzyme sequences from the genomic DNA of Zobellia galactanivorans, resulting in a sequence of 1531 bp (SEQ ID NO: 14). The cgkA gene was amplified by PCR using forward and reverse primers (CgkA F, CgkA R) containing restriction enzyme sequences from the genomic DNA of Zobellia galactanivorans, resulting in a sequence of 1641 bp (SEQ ID NO: 15). To perform in vitro experiments expressing kappa-carrageenase and iduronate-2-sulfatase for the degradation of carrageenan, the constructed recombinant vector was transformed into E. coliBL21 by the heat shock method.

[0093] Vector FeaturepColdIIE. coli expression vector, P CSPA ,TEE,lacI,Amp R ,Pbr322oripColdII::cgkAPColdII, carryingcgkAgene originating fromZobellia galactanivoranspColdII::idsA3PColdII, carryingidsA3gene originating fromZ. galactanivorans

[0094] Strain characteristics E. coliBL21pColdII::cgkAE. coliBL21 harboring pColdII::cgkAvectorE. coliBL21pColdII::idsA3E. coliBL21 harboring pColdII::idsA3vector

[0095] Primer (restriction enzyme) base sequence (5'-3')idsA3_FATATGAGCTCTGCAGCTCGGCACAidsA3_RGCGCAAGCTTTTAGTTTAGGGAATGTTGCTCTTTCgkA_FATATGAGCTCTATGAAAAAACCAAATTTTTATGGCCgkA_RGCGCAAGCTTTTACTCCACGAGTATCTTTTT

[0096] 2-2. Confirmation of expression of idsA3 and cgkA genes

[0097] To confirm the protein expression of the transformant obtained in Example 2-1, purification using His-Tag and SDS-PAGE were performed. The E. coli transformant was cultured with shaking at 16°C for 12 hours in a concentration of 1 mM IPTG, and then centrifuged to obtain cells. The cells were disrupted using ultrasound, centrifuged, and the supernatant was prepared and concentrated to obtain the Iduronate-2-sulfatase protein for the idsA3 gene and the Kappa-carrageenase protein for the cgkA gene, which were then loaded onto SDS-PAGE. As a result, it was confirmed that bands appeared at positions identical to the sizes of Iduronate-2-sulfatase and Kappa-carrageenase (Fig. 3a).

[0098] 2-3. Confirmation of the carrageenan decomposition ability of iduronate-2-sulfatase and kappa-carrageenase

[0099] In order to specifically confirm the activity of the above Iduronate-2-sulfatase and Kappa-carrageenase, hydrolysis activity analysis using carrageenan as a substrate was performed using purified Iduronate-2-sulfatase and Kappa-carrageenase. Specifically, for the measurement of hydrolysis activity, 10 mg / ml of each enzyme was treated and 1% (w / v) of kappa-carrageenan was used. Each enzyme and substrate was reacted at 30°C in 1.0 mM MgCl2, 1.0 mM NaCl2, 100 mM sodium acetate buffer (pH 5.0). After reacting at 60°C for 5 minutes, the reaction was stopped through heat treatment at 99°C, and the hydrolysis activity was measured by measuring the amounts of galactose and sulfate, respectively. In Figure 3, Control means 50 mM citric acid buffer, IdsA3 means single treatment with Iduronate-2-sulfatase, CgkA means single treatment with Kappa-carrageenase, and CgkA and IdsA3 mean combined treatment with Iduronate-2-sulfatase and Kappa-carrageenase.

[0100] As a result, as shown in Fig. 3, when Iduronate-2-sulfatase and Kappa-carrageenase were treated simultaneously, it was confirmed that the hydrolysis activity increased by about 2 times compared to when each enzyme was treated alone when carrageenan was used as a substrate (Fig. 3b). In addition, it was confirmed that about 2 mM sulfate was produced when Iduronate-2-sulfatase was treated alone on carrageenan (Fig. 3c). Through the above results, it was confirmed that the treatment with Iduronate-2-sulfatase successfully removed sulfate, which is known to be a residue of carrageenan, and that the hydrolysis of Kappa-carrageenase was significantly increased through the removal of sulfate.

[0101] These results indicate that Iduronate-2-sulfatase and Kappa-carrageenase have carrageenan-decomposing activity and can decompose carrageenan, the main component of seaweed, into galactose, and confirm the production of d-galactose through the decomposition of carrageenan, thereby confirming the usability of marine biomass.

[0102] <Example 3> Development of a transformed Corynebacterium strain with a galactose utilization pathway introduced

[0103] Based on the results of Examples 1 and 2 above, the inventors of the present invention produced a recombinant strain capable of galactose metabolism, added Iduronate-2-sulfatase and Kappa-carrageenase to the medium, and cultured the recombinant strain using carrageenan as a single carbon source, and then confirmed the ability to utilize galactose and produce histidine.

[0104] Specifically, to introduce a galactose uptake system into a transformed Corynebacterium strain (TDPH6) with an enhanced histidine production pathway, a galactose transporter gene from Saccharomyces cerevisiae and the Leloir pathway in an E. coli K-12 strain for galactose metabolism were introduced (see Fig. 1). Each gene was introduced into the pEKEx2 vector, an overexpression vector. The gal2 gene (SEQ ID NO: 10), known as a galactose transporter, was amplified by PCR using forward and reverse primers (Gal2_F, Gal2_R) containing restriction enzyme sequences from the genomic DNA of S. cerevisiae, and a sequence of 1725 bp was obtained. In addition, to introduce and strengthen the galactose utilization pathway, the galT (SEQ ID NO: 11, galactose-1-phophate uridylytransferase) and galM (SEQ ID NO: 12, Aldose-1-epimerase) genes were amplified by PCR using forward and reverse primers (GalT_F, GalT_R; GalM_F, GalM_R) containing restriction enzyme sequences from the genomic DNA of E. coli, and the galK (SEQ ID NO: 13, galactokinase) gene was amplified by PCR using forward and reverse primers (GalK_F, GalK_R) containing restriction enzyme sequences from the genomic DNA of Corynebacterium glutamicum, obtaining sequences of 1296 bp, 1041 bp, and 1047 bp, respectively. A transformed Corynebacterium strain with a galactose utilization pathway was constructed by introducing an overexpression vector containing gal2, galT, galM, and galK into a transformed Corynebacterium strain with an enhanced histidine production pathway, and its galactose utilization and histidine production abilities were confirmed.All transformants were cultured in 250 ml shaker Erlenmeyer flasks containing 50 ml of CN40 medium (containing 10 g / L galactose) at 30°C and 200 rpm for 36 h. The recombinant vectors and strains used in this experiment are shown in Tables 7 and 8, and the primers are shown in Table 9.

[0105] As a result, as shown in Fig. 4, it was confirmed that the strain into which the galactose utilization pathway was introduced consumed approximately 23% of galactose and produced approximately 150 mg of histidine in 36 hours (Fig. 4a). In addition, it was confirmed that the histidine yield was the highest at approximately 3 mg / g / h in the 6-hour period (Fig. 4b). These results confirmed that the transformed Corynebacterium strain into which the galactose utilization pathway was introduced can consume galactose and produce histidine.

[0106] Vector FeaturepEKEx2C. glutamicum-E. colishuttle vector, P tac ,lacI,Kan R ,pBL1oripEKEx2::hisG*::zwf::gndpEKEx2, carryinghisG*(C-terminal area ofhisGwas deleted),zwfandgndgenes originating fromC. glutamicumpEKEx2::hisG*::zwf::gnd::prspEKEx2::hisG*::zwf::gnd, carryingprsgene originating fromC. glutamicumpEKEx2::hisG*::zwf::gnd::prs::hisDpEKEx2::hisG*::zwf::gnd::prs, carryinghisDgene originating fromC. glutamicumpMT-tacC. glutamicum-E. colishuttle vector, P tac ,Amp R ,Cm R,pCG1oripMT-tac::purH::adk::ndkpMT-tac, carryingpurH, adk, ndkgenes originating fromC. glutamicumpMT-tac::purH::adk::ndk::gal2K™pMT-tac::purH::adk::ndk, carryinggal2, galK, galTandgalM(gal2is originating fromSaccharomyces cerevisiae,galTandgalMare originating fromE. coliK-12, and glutamicum originating fromC).

[0107] 균주특징TDPH6G2TDP harboring pEKEx2::hisG*::zwf::gnd::prs::hisD,pMT-tac::purH::adk::ndk::gal2KTM

[0108] 프라이머염기서열(5'-3')Gal2_FCCAAGCTTGCATGCCTGCAATGGCAGTTGAGGAGAACAAGal2_RTGGCCATGTATATCTCCTTGTCGACTTATTCTAGCATG GCCTTGTACCGalK_FATAGTCGACAAGGAGATATACATGGCCATTTGGCAGCCAAGalK_RATAGGATCCCTAGCCCTGTTCCGCGACGalT_FCCCGGGTAC CGAGCTCGAATTAAGGAGATATACATGACGCAATTTAATCCCGTGalT_RGTAAAACGACGGCCAGTGAATTCTTACTCCGGATTCGCGAGalM_FACGTCGCGGAACAGGGCTAGAAGGAGATATACATGCTGAACGAAACTCCCGGalM_RTCTCATCCATCCAAACAGGCCGACTTAGCCTAGCCTA

[0109] <실시예 6> 갈락토오즈 이용능이 도입된 균주의 갈락토오즈 이용 최적 배걡촴

[0110] To increase galactose utilization, optimal culture conditions for a strain with galactose utilization introduced through fermentation were established. The strain was cultured in BHISG (20 g / L glucose, 37 g / L brain heart infusion, 91 g / L C6H 14 O 6, 20 g / L C6H 12 O 6, After culturing on solid medium (25 μg / L kanamycin and 10 μg / L chloramphenicol) at 30°C for 24 h, the cells were cultured in pre-culture medium (3 g / L peptone, 1.2 g / L potassium dihydrogen phosphate, 2 g / L sodium citrate, 3 g / L yeast extract, 20 g / L glucose, 1 mg / L biotin, 1 mg / L cobalamine, 1 mg / L pantothenate, 1 mg / L thiamine HCL, 1x trace element, pH 7) at 30°C and 200 rpm for 24 h. Afterwards, it was cultured in 2 L of CN40 medium (4.54 g / L peptone, 8.0 g / L ammonium sulfate, 2.0 g / L potassium dihydrogen phosphate, 20 g / L corn syrup, 2 g / L sodium citrate, 8 g / L yeast extract, 40 g / L galactose, 2 g / L MgSO4, 10 mg / L biotin, 2 mg / L cobalamine, 2 mg / L pantothenate, 10 mg / L thiamine HCL, 1x trace element) at 30 ℃, 200-600 rpm for 45 h. During the culture, air was adjusted to 2 L / min, pH was 7.0, and when DO dropped below 20, rpm was increased by 20 until the maximum culture was achieved at 200 to 600 rpm.

[0111] As a result, as shown in Fig. 5, it was confirmed that the galactose utilization ability increased to 100% 24 hours after the strain cultured in BHISG medium and pre-culture medium was inoculated into CN40 medium, thereby establishing optimal galactose utilization culture conditions.

[0112] In addition, as shown in Fig. 6, it was confirmed that 100% of galactose was consumed and approximately 0.4 g / L of histidine was produced, thereby establishing optimal galactose utilization culture conditions.

[0113] As described above, specific embodiments of the present invention have been described in detail. However, those skilled in the art who understand the spirit of the present invention will be able to easily suggest other inventions that are backwards or other embodiments included within the scope of the spirit of the present invention by adding, changing, or deleting other components within the scope of the same spirit. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention is indicated by the scope of the claims described below rather than the detailed description described above, and all changes or modified forms derived from the meaning and scope of the claims and their equivalent concepts should be interpreted as being included in the scope of the present invention.

Claims

1. A transformed Corynebacterium strain in which a gene encoding ATP phosphoribosyltransferase, a gene encoding Glucose-6-phosphate 1-dehydrogenase, a gene encoding 6-phosphogluconate dehydrogenase, a gene encoding Ribose-phosphate pyrophosphokinase, a gene encoding Histidinol dehydrogenase, a gene encoding Nucleoside diphosphate kinase, a gene encoding Adenylate kinase, and a gene encoding Bifunctional purine biosynthesis protein PurH are overexpressed.

2. In paragraph 1, A transformed Corynebacterium strain, characterized in that the gene encoding the above ATP phosphoribosyltransferase is represented by the base sequence of sequence number 1.

3. In paragraph 1, A transformed Corynebacterium strain, characterized in that the gene encoding the above Glucose-6-phosphate 1-dehydrogenase is represented by the base sequence of sequence number 2.

4. A transformed Corynebacterium strain, characterized in that the gene encoding the above 6-phosphogluconate dehydrogenase is represented by the base sequence of sequence number 3.

5. In paragraph 1, A transformed Corynebacterium strain, characterized in that the gene encoding the above ribose-phosphate pyrophosphokinase is represented by the base sequence of sequence number 4.

6. In paragraph 1, A transformed Corynebacterium strain, characterized in that the gene encoding the above Histidinol dehydrogenase is represented by the base sequence of SEQ ID NO:

5.

7. In paragraph 1, A transformed Corynebacterium strain, characterized in that the gene encoding the nucleoside diphosphate kinase is represented by the base sequence of SEQ ID NO:

6.

8. In paragraph 1, A transformed Corynebacterium strain, characterized in that the gene encoding the above adenylate kinase is represented by the base sequence of sequence number 7.

9. In paragraph 1, A transformed Corynebacterium strain, characterized in that the gene encoding the above-mentioned bifunctional purine biosynthesis protein PurH is represented by the base sequence of SEQ ID NO:

8.

10. In paragraph 1, The above-mentioned transformed Corynebacterium strain is characterized in that the tkt promoter of the tkt gene (Genbank ID: BAB98967.1) and the hisD promoter of the hisD gene (Genbank ID: BAB99495.1) are replaced with the H36 promoter, which is a high-expression synthetic promoter, and the start codon of the pgi gene (Genbank ID: 69621401) is replaced from ATG to GTG.

11. In paragraph 10, A transformed Corynebacterium spp. strain, characterized in that the above H36 promoter is represented by the base sequence of sequence number 9.

12. In paragraph 1, The above-mentioned transformed Corynebacterium strain is a transformed Corynebacterium strain having an enhanced pentose phosphate pathway, a histidine synthetic pathway, and an ATP regeneration pathway.

13. In paragraph 1, The above-mentioned transformed Corynebacterium strain is a transformed Corynebacterium strain in which a gene encoding a galactose transporter, a gene encoding galactose-1-phophate uridylytransferase, and a gene encoding aldose-1-epimerase are introduced, and a gene encoding galactokinase is overexpressed.

14. In paragraph 13, A transformed Corynebacterium strain characterized in that the gene encoding the galactose transporter is derived from Saccharomyces cerevisiae.

15. In paragraph 13, A transformed Corynebacterium strain, characterized in that the gene encoding the galactose-1-phophate uridylytransferase and the gene encoding the aldose-1-epimerase are derived from Escherichia coli.

16. In paragraph 13, The above-mentioned transformed Corynebacterium strain is a transformed Corynebacterium strain into which a galactose uptake system has been introduced.

17. A composition for producing histidine, comprising a transformed Corynebacterium strain according to any one of claims 1 to 16.

18. A method for producing histidine from a strain of Corynebacterium spp., comprising a step of culturing a transformed strain of Corynebacterium spp. according to any one of claims 1 to 16.

19. A composition for producing histidine, comprising seaweed, a carrageenan decomposing enzyme, and a transformed Corynebacterium strain according to any one of claims 13 to 16.

20. A step of producing a seaweed hydrolysate by saccharifying seaweed using a carrageenan decomposing enzyme; and A method for producing histidine using seaweed, comprising the step of inoculating and fermenting the transformed Corynebacterium spp. strain into a medium containing the seaweed hydrolyzate.

Images