Sugar nucleotide clearance in cancer therapy

Abstract

Provided herein are methods of treating cancer in a subject that include administering to the subject a therapeutically effective amount of an inhibitor of UXS1, wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid, and wherein the subject is diagnosed as having a UDGH-high cancer, thereby treating the UDGH-high cancer.

Description

[0001] SUGAR NUCLEOTIDE CLEARANCE IN CANCER THERAPY

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims priority to U.S. Provisional Patent Application No. 63 / 588,827, filed on October 9, 2023, which is incorporated herein by reference in its entirety.

[0004] SEQUENCE LISTING

[0005] This application contains a Sequence Listing that has been submitted electronically as an XML file named “07917-0443W01.xml.” The XML file, created on October 7, 2024, is 22000 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety.

[0006] TECHNICAL FIELD

[0007] Described here are methods of treating cancer in which targeted UDP-Glucuronate Decarboxylase 1 (UXS1) inhibition is used in cancers with elevated UDP-glucose dehydrogenase (UGDH) expression levels.

[0008] BACKGROUND

[0009] Altered metabolism is a hallmark of cancer and can support cancer functions such as rapid proliferation and survival under various stress states1. Recently, it is emerging that certain metabolic activities play important detoxifying roles by preventing the accumulation of toxic metabolic intermediates2-5. Importantly, a ‘kitchen sink’ model has been observed where a detoxifying enzyme is only required in cells with high metabolic production of the toxic metabolite, much as a drain is only needed when the faucet is turned on.

[0010] SUMMARY

[0011] The sugar nucleotide UDPGA is a multifunctional metabolite that is a currency for glycosylation and a substrate that cells conjugate to various xenobiotics to aid in their expulsion from cells15-17. It was found that UDPGA clearance by UXS1 is critically required for Golgi homeostasis in some cells, wherein cells that express elevated levels of the enzyme UGDH, which produces UDPGA, may have this detoxification requirement. Thus, provided herein are methods of treating a UDGH-high cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of an inhibitor of UXS1, wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid or a CRISPR / Cas9 complex targeting the UXS1 gene, preferably wherein the subject is diagnosed as having a UDGH-high cancer, thereby treating the UDGH-high cancer.

[0012] In some embodiments, the inhibitory nucleic acid comprises a small hairpin RNA (shRNA), antisense oligonucleotide, small nuclear RNA (snRNA), small interfering RNA (siRNA), or a single guide RNA (sgRNA) targeting a UXS1 nucleic acid. In some embodiments, the inhibitory nucleic acid comprises a small hairpin RNA (shRNA) targeting the UXS1 nucleic acid. In some embodiments, the inhibitory nucleic acid comprises an antisense oligonucleotide targeting the UXS1 nucleic acid. In some embodiments, the inhibitor comprises a CRISPR / Cas9 complex targeting the UXS1 gene.

[0013] In some embodiments, the diagnosing the subject comprises determining a level of UDGH in a biological sample comprising cancer cells from the subject; comparing the level of UDGH in the biological sample to a reference level, wherein the presence of a level of UDGH in the biological sample above the reference level indicates that the subject has UDGH-high cancer. In some embodiments, the UDGH-high cancer is a lung cancer, liver cancer, breast cancer, or prostate cancer. In some embodiments, the UDGH-high cancer is a lung cancer.

[0014] In some embodiments, any one of the methods described herein further comprises administering an anti-cancer treatment. In some embodiments, the anti-cancer treatment comprises a chemotherapeutic agent. In some embodiments, the chemotherapeutic agent comprises vincristine, prednisone, dexamethasone, busulfan, cisplatin, carboplatin, paclitaxel, docetaxel, nab-paclitaxel, altretamine, capecitabine, cyclophosphamide, etoposide (vp-16), gemcitabine, ifosfamide, irinotecan (cpt-11), liposomal doxorubicin, melphalan, pemetrexed, topotecan, vinorelbine, goserelin, leuprolide, tamoxifen, letrozole, anastrozole, exemestane, bevacizumab, olaparib, rucaparib, niraparib, nivolumab, pembrolizumab, durvalumab, atezolizumab, radioisotopes, monomethyl auristatin E (MMAE; e.g., vedotin), calicheamicins, deruxtecan, DM1, and any combinations thereof.

[0015] In some embodiments, the inhibitory nucleic acid inhibits UXS1 by knockdown of the UXS1 gene expression. Also provided herein are methods of enhancing response to chemotherapy in a subject, the method comprising administering to the subject a therapeutically effective amount of an inhibitor of UXS1, wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid targeting UXS1 or a CRISPR / CAS editing complex targeting UXS1, and wherein the subject is diagnosed as having a UDGH-high cancer, thereby enhancing response to chemotherapy in the subject.

[0016] Also provided herein are methods of suppressing tumor growth in a subject, the method comprising administering to the subject a therapeutically effective amount of an inhibitor of UXS1, wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid targeting UXS1 or of a CRISPR / CAS editing complex targeting UXS1, preferably wherein the subject is diagnosed as having a UDGH-high cancer, thereby suppressing tumor growth in the subject.

[0017] Also provided herein are compositions comprising an inhibitor of UXS1, wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid targeting UXS1 or a CRISPR / CAS editing complex targeting UXS1, for use in a method of treating a UDGH-high cancer in a subject, preferably wherein the subject is diagnosed as having a UDGH-high cancer.

[0018] In some embodiments, the inhibitory nucleic acid comprises a small hairpin RNA (shRNA), antisense oligonucleotide, small nuclear RNA (snRNA), small interfering RNA (siRNA), or single guide RNA (sgRNA) targeting a UXS1 nucleic acid. In some embodiments, the inhibitory nucleic acid comprises a small hairpin RNA (shRNA) targeting the UXS1 nucleic acid. In some embodiments, the inhibitory nucleic acid comprises an antisense oligonucleotide targeting the UXS1 nucleic acid. In some embodiments, the inhibitor comprises a CRISPR / CAS editing complex targeting UXS1.

[0019] In some embodiments, the subject has been diagnosed by a method comprising determining a level of UDGH in a biological sample comprising cancer cells from the subject; comparing the level of UDGH in the biological sample to a reference level, wherein the presence of a level of UDGH in the biological sample above the reference level indicates that the subject has UDGH-high cancer. In some embodiments, the UDGH-high cancer is a lung cancer, liver cancer, breast cancer, or prostate cancer. In some embodiments, the UDGH-high cancer is a lung cancer.

[0020] In some embodiments, any one of the compositions described herein further comprises an anti-cancer treatment. In some embodiments, the anti-cancer treatment comprises a chemotherapeutic agent. In some embodiments, the chemotherapeutic agent comprises vincristine, prednisone, dexamethasone, busulfan, cisplatin, carboplatin, paclitaxel, docetaxel, nab-paclitaxel, altretamine, capecitabine, cyclophosphamide, etoposide (vp-16), gemcitabine, ifosfamide, irinotecan (cpt-11), liposomal doxorubicin, melphalan, pemetrexed, topotecan, vinorelbine, goserelin, leuprolide, tamoxifen, letrozole, anastrozole, exemestane, bevacizumab, olaparib, rucaparib, niraparib, nivolumab, pembrolizumab, durvalumab, atezolizumab, radioisotopes, monomethyl auristatin E (MMAE), calicheamicins, deruxtecan, DM1, and any combinations thereof.

[0021] In some embodiments, the inhibitory nucleic acid inhibits UXS1 by knockdown of the UXS1 gene expression.

[0022] Also provided herein are compositions comprising a therapeutically effective amount of an inhibitor of UXS1, wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid targeting UXS1 or a CRISPR / CAS editing complex targeting UXS1 for use in method of enhancing response to chemotherapy in a subject, preferably wherein the subject is diagnosed as having a UDGH-high cancer, thereby enhancing response to chemotherapy in the subject.

[0023] Also provided herein are compositions comprising an inhibitor of UXS1, wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid targeting UXS1 or of a CRISPR / CAS editing complex targeting UXS1, for use in suppressing tumor growth in a subject, preferably wherein the subject is diagnosed as having a UDGH-high cancer, thereby suppressing tumor growth in the subject.

[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0025] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. BRIEF DESCRIPTION OF DRAWINGS

[0026] FIGs. 1A-1I show identification of UXS1 as an enzyme that is essential for cell survival in a manner that correlates with each cell line’s expression of the upstream enzyme UGDH. (FIG. 1A) Strategy for identification of toxic metabolite clearing enzymes. The approach was to identify novel detoxifier enzymes by finding scenarios where E2 is only essential in cells where El is highly expressed, suggesting that E2 is needed to get rid of El’s product. (FIG. IB) Correlation between gene expression of all genes (17386) with UXS1 dependency across 572 solid tumor cancer cell lines, showing UGDH as the top hit. (FIG. 1C) Correlation between UXS1 dependency and UGDH mRNA expression [log2(transcripts per million+1)] in cell-lines (gray) using pan-cancer genetic dependency dataset and gene expression dataset from CCLE, spearman coefficient =-0.41, R2= 0.17. The 122 lung cancer cell lines are highlighted in red, spearman coefficient = -0.61, R2= 0.37. (FIG. ID) Simplified diagram illustrating the metabolic pathway for UDPGA production. (FIG. IE) Relative viability of various cell lines following transduction with CRISPR / Cas9 with guides against UXS1 (light and dark blue bars) or CTRL (gray bars = 1.0) for 10 days (left Y axis). Cells are arranged in decreasing order of UGDH mRNA expression levels [log2(transcripts per million+1), overlaid as red line and dots; right Y axis], showing that UGDH high cancer cells are dependent on UXS1. (FIG. IF) Immunoblots showing KO of UXS1 in A549 and DLD1 cell lines 9 days post-transduction. (FIG. 1G) Relative viability of A549 cells either overexpressing blank vector or g2-resistant UXS1 then subjected to UXS1 KO with gl or g2, demonstrating that UXS1 KO toxicity is on target (CTRL = 1.0). (FIG. 1H) Cell cycle distribution in dox-inducible UXS1 iKO A549 cells, with or without induction for 5 days. (FIG. II) Relative viability of UXS1 iKO cells subjected to KO then treated with z-vad, Necrostain, or Ferrostatin at the indicated concentrations (Untreated = 1.0). For FIGs. 1G-1I, n=3 or more biological replicates and for FIG. IE n=2 biological replicates. Data are shown as mean ± s.d. P values were calculated using a two-tailed Student’s t- test: from left to right in FIG. 1G: p=0.227, p=0.0001, i: p=0.011, p=0.001, p=0.003 (n.s. not significant (p>0.05) **p<0.01, ****p<0.0001). FIGs. 1A and ID were created using Biorender.

[0027] FIGs. 2A-2L show UXS1 is required to detoxify the UDP-glucuronic acid produced by UGDH. (FIG. 2A) LC-MS quantification of UDP-GlcNAc (gray), UDP -hexose (blue), and UDPGA (red) in A549 cells subjected to CTRL or UXS1 KO at 6 and 8 days of transduction. UDP-hexose includes UDP-glucose, UDP-mannose, and UDP-galactose, which cannot be resolved due to similar MS2spectra. (FIG. 2B) Schematic of13C labeling using U-13C glucose to trace UDPGA and UDP-xylose labeling. (FIG. 2C) Production of M+5 UDP-xylose in picomoles / lE6 cells of control and UXS1 KO cells, quantified from UDP xylose standard curves. (FIG. 2D) Theoretic toxic-metabolite accumulation model: cancer cells expressing high UGDH (faucet ‘on’) results in toxic accumulation of UDPGA when UXS1 (drain) is knocked out. However, preemptive UGDH KO (‘faucet closed’) can prevent accumulation of UDPGA in cells and prevent UXS1 KO toxicity. (FIG. 2E) Production of M+6 UDPGA in picomoles / lE6 cells of control and UGDH KO cells, quantified from UDPGA standard curves. (FIG. 2F) Relative viability of A549 cells subjected to preemptive CTRL (gray) or UGDH (faucet; orange) KO, followed by CTRL or UXS1 (drain) KO. Values are relative to cells subjected to CTRL KO then CTRL KO (=1.0). (FIG. 2G) Immunoblot of UXS1 and UGDH protein levels under the KO combinations shown in FIG. 2C. (FIG. 2H) Viability of A549 and DLD1 cells with CTRL KO (gray) and UXS1 KO (orange), treated with indicated concentrations of 4MU, showing dosedependent rescue effect of this UDPGA-depleting agent. Values are relative to blank vector overexpressing, CTRL KO cells (=1.0). (FIG. 21) Viability of HT1080 cells overexpressing either blank vector (gray) or UGDH (red) then subjected to CTRL or UXS1 KO. Values are relative to blank vector overexpressing, CTRL KO cells (=1.0). (FIG. 2J) Immunoblot of UXS1 and UGDH protein levels under the OE / KO combinations shown in FIG. 2G; LE indicates low exposure, HE indicates high exposure. (FIG. 2K) M + 6 UDPGA production in A549 cells (n = 3 per group). The dotted purple line indicates UDPGA labelling in UXS1-KO cells minus the normal UDP-xylose production rate calculated from FIG. 2C, representing UDPGA production not accounted for by loss of clearance by UXS1. (FIG. 2L) Refined model depicting the negative feedback loop between UDP-xylose and UGDH. Data from FIGs. 2C, 2E, and 2K are from the same experimental sets. For FIGs. 2A, 2C, 2E, 2F, 2H, 21 and 2K, n=3 or more biological replicates. Data are shown as mean ± s.d. p values were calculated using two-tailed Student’s t-test: from left to right in FIG. 2A: p=0.025, p=0.019, p=0.020, p=0.022, p=0.023, p= 0.001, p=0.00001, p=0.009, p=0.017, FIG. 2F: p=0.003, p=0.004, p=0.002, FIG. 21: p=0.002, p=3.6E-05, p=0.007 (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). FIG. 2B was created using Biorender (biorender.com / ). FIGs. 3A-3J show UDPGA accumulation causes golgi dysfunction that leads to EGFR inactivation. (FIG. 3A) Dot plot of differentially expressed pathways identified by GSEA pathway analysis of RNAseq data from UXS1 KO A549 cells compared to CTRL KO. (FIG. 3B) Immunofluorescent images of UXS1 iKO or control iKO cells, 7 days post-induction, immunostained for Phalloidin (actin, green), GM130 (Golgi, red), and DAPI (nucleus, blue); scale bar=20pm. (FIG. 3C) Representative transmission electron microscope images of A549 control and (FIG. 3D) A549 UXS1 KO cells. The colored boxes in the whole cell images indicate locations where golgi structures are found, and the zoomed version of each is shown alongside, with the corresponding colored outline. Scale bar: Whole cell images=5pm, zoomed images=0.2pm. (FIG. 3E) Dot plot of total Golgi area per cell, labeled using GM130, from control, induced, and induced + 4MU (15 pM) UXS1 iKO cells, 7 days post-induction. Each dot represents a different cell, n=50 cells per condition. (FIG. 3F) Representative mass spectrometry N-glycan profiles of A549 cells subjected to CTRL or UXS1 KO, at 7 post-transduction, with annotated mass peaks. Values are relative to the total N glycans detected. (FIG. 3G) Immunoblots for EGFR, CD44, IGFR1, FGFR1, FGFR4, and HER2 glycoproteins in uninduced, induced, or induced plus 4MU UXS1 iKO cells. + indicates 15pM and ++ indicates 80pM 4MU. (FIG. 3H) Immunofluorescent images of uninduced or induced UXS1 iKO cells, immunostained for EGFR (green) and DAPI (blue). Scale bar = 40pm. (FIG. 31) FACS-based fluorescence histogram showing doxycycline induced and non-induced UXS1 iKO cells labeled with FITC conjugated EGFR antibody showing surface EGFR binding. (FIG. 3 J) Immunobloting of EGFR and downstream signaling components from induced UXS1 iKO cells or induced CTRL iKO cells, following serum starvation then EGF stimulation. pAkt = phospho (S473) Akt; pERKl / 2 = phospho ERKl / 2(T202 / Y204); pS6-kinase = phospho-S6 kinase(T389) phopshoantibodies. EGFR blotting was run on 4-15% gradient gel to show maximal shift of the protein, while the rest of the probes are run in 10% to allow probing for multiple epitopes. RNA was extracted from n=3 biological replicates for each condition for RNA sequencing. Cell lysates were harvested from n=2 biological replicates for each condition for glycan profiling, p values were calculated using two-tailed Student’s t-test. (****p<0.0001)

[0028] FIGs. 4A-4P show UXS1 is a cancer-selective therapeutic target due to elevated UGDH expression in cancer subsets and chemo-resistant cancer cells. (FIG. 4A) Volume measurements showing mean (±SEM) of A549 UXS1 iKO, (FIG. 4B) H460 UXS1 iKO, and (FIG. 4C) HT1080 UXS1 iKO subcutaneous xenograft tumors. Tumors were grown until mean tumor volume reached between 200-250mm3, then either induced via dox chow (red, n=12 per line except n=l 1 for A549) or left uninduced (gray, n=12 per line). (FIG. 4D) Kaplan-Meier survival analysis for the A549 UXS1 iKO model, (FIG. 4E) H460 UXS1 iKO model, and (FIG. 4F) HT1080 UXS1 iKO model (M.S. = median survival). (FIG. 4G) Immunoblots for UGDH and actin from 11 lung cancer patient tissue samples and patient-matched normal lung tissues; cancer tissues are labeled in red and normal tissues are marked in blue. (FIG. 4H) Quantification of relative, actin normalized UGDH band intensities from FIG. 4G. (FIG. 41) Scatter plot of viability following UXS1 KO (y axis) against UGDH protein expression level (x axis) for 19 cancer and 9 normal cell lines of varying lineage, showing that all normal cell lines are in the UGDH-low, UXS1 KO-insensitive cluster (gray circle), in contrast to the UGDH-high, UXS1 KO-sensitive cancer lines (red circle). Immunoblots of UGDH level for each line are provided in FIG. IOC. Linear regression trendline is shown in black for all cancer lines examined. (FIG. 4J) Volcano plot showing spearman correlation between UGDH expression and Drug AUC (546 drugs), constructed by mining CCLE gene expression database8and drug AUCs (from PRISM drug sensitivity database59), indicating that more chemoresistant cancer cells express higher UGDH. (FIG. 4K) Survival data for parental (chemo-sensitive) and chemo-resistant Patient- derived organoid (PDO) TPN-01. (FIG. 4L) Immunoblot for UGDH and actin from parental and chemo-resistant PDO TPN-01. (FIG. 4M) Relative viabilities of parental and cisplatin-resistant TPN-01 subjected to UXS1 KO, indicating that cisplatin-resistant organoids are more sensitive to UXS1 loss. Values are relative to parental cells CTRL-KO (=1.0). (FIG. 4N) Volume measurements showing mean (±SEM) of A549 UXS1 iKO subcutaneous xenograft tumors. Data are from same experiment shown in FIG. 4A, but showing two additional arms, UXS1 KO and CTRL -KO treated with cisplatin (4mg / kg iv lx weekly, 3 weeks; indicated by arrows) at the same time as dox induction. Bliss independence scores were calculated for UXSl+cisplatin arm denoted by b#; values less than 1 indicate synergism. bl=0.66 (d22), b2=0.47 (d26), b3=0.57 (d30). (FIG. 40) Immunoblot for UGDH and actin in four randomly selected tumors from the control, cisplatin-treated, and UXS1 iKO groups of A549 UXS1 iKO xenograft experiment in FIG. 4N. (FIG. 4P) Quantification of relative, actin normalized UGDH band intensities from FIG. 40. For FIG. 4K, 4M, and 4P data are shown as mean ± s.d. and p values were calculated using two-tailed Student’s t-test: from left to right in FIG. 4A: p=0.003 in FIG. 4B: p=0.021, p=0.010, p=3.3E-08, FIG. 4C p=0.496, FIG. 4H p=0.003, FIG. 4K p=0.847, p=0.006, p=3.51E-06, FIG. 4M: p=0.0008, p=0.006, FIG. 4N: p=0.003, p=0.043, FIG. 4P: p=0.002, p=0.028 (n.s.: not significant, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). For FIG. 4H, p values are calculated using Wilcoxon matched-pairs signed rank test. *r and **r denotes the p value for tumor regression that was calculated between the starting tumor volume and the tumor volume for the specific point in the same arm.

[0029] FIGs. 5A-5J show UXS1 is required in a subset of cancer cells, and validation of CRISPR / cas9 reagents for UXS1. (FIG. 5A) Ranked list of the standard deviation of CERES gene-scores of all metabolic genes across 572 solid cancer cell lines, identifying UXS1 as one of the top enzymes having variable dependency. (FIG. 5B) UXS1 gene-score across cancer cell lines using pan-cancer dependency dataset7showing that only a subset of cancer cell lines (genescores below -0.5) is dependent on UXS1 for survival. A lower gene score means that a gene is more likely to be essential in a given cell line. A score of 0 is equivalent to a non-essential gene, whereas a score of -1 corresponds to the median of all common essential genes. (FIG. 5C) UXS1 immunoblots showing KO of UXS1 in HT1080 and H838 cell lines 9 days post transduction. (FIG. 5D) Schematic of UXS1 g2 and UXS1 CRISPR resistant g2 sequence, demonstrating the strategy of using 1 silent mutation in the PAM sequence (yellow highlight) and 2 silent mutations in the seed sequence (green highlight) to prevent CRISPR / cas9 targeting. (FIG. 5E) Relative viability of DLD1 cells either overexpressing blank vector or g2 -resistant UXS1 then subjected to UXS1 KO with gl or g2, demonstrating that UXS1 KO toxicity is on target (CTRL = 1.0). (FIG. 5F) Immunoblot of UXS1 levels in A549 and (FIG. 5G) DLD1 cells overexpressing blank or UXSl-g2 resistant vectors when subjected to CRISPR / Cas9 mediated KO of UXS1 (FIG. 5H) TLCv2 system60; LentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive sgRNA expression. UXS1 iKO and control iKO was prepared by cloning UXS l-g2 and CTRL (non-targeting guide) into the TLCv2 system, respectively. (FIG. 51) Relative viability of UXS1 iKO and control iKO cells with and without doxycycline induction (control iKO without doxycycline = 1.0). Induction consisted of lOOng / ml doxycycline treatment for 48 hours; cells were cultured for 4 more days before measuring viability. (FIG. 5J) UXS1 immunoblots showing KO of UXS1 in CCD18Lu and CCD8Lu cells, 9 days post-transduction. For FIGs. 5E and 51, n=3 or more biological replicates. Data are shown as mean ± s.d. p values were calculated using two-tailed Student’s t-test: from left to right in FIG. 5E: p=0.12, p=0.002, FIG. 51: p=0.663, p=5.4E-06 (n.s.: not significant, **p<0.01, ****p<0.0001). FIGs. 5D and 5H was created using Biorender.

[0030] FIGs. 6A-6D show additional data for UXS1 loss led cell cycle defects and cell death rescue. (FIG. 6A) Gating strategy for cell cycle analysis. Cells were first gated by forward (FSC- A) and side scatters (SSC-A) to remove cell debris, then by forward scatter area (FSC-A) and height (FSC-H) to select for single cells before plotting histograms for cell cycle profiles. This example gating strategy is shown in control iKO cells. (FIG. 6B) Representative cell cycle profiles for control iKO cells and (FIG. 6C) UXS1 iKO cells 5 days after doxycycline induction. The cell cycle phases were determined by fitting a univariate cell cycle model using the Watson pragmatic algorithm (FIG. 6D) Relative viability of DLD1 cells subjected to UXS1 KO then treated with z-vad, Necrostain, or Ferrostatin at the indicated concentrations (Untreated = 1.0). For FIG. 6D, n=3 biological replicates. Data are shown as mean ± s.d. p values were calculated using two-tailed Student’s t-test: from left to right in FIG. 6D: p=0.03, p=0.002, p=0.032 (*p<0.05, **p<0.01, ***p<0.001).

[0031] FIGs. 7A-7L show supporting data that UDPGA is toxic. (FIG. 7A) Relative viability of DLD1 cells subjected to preemptive CTRL (gray) or UGDH (faucet; orange) KO, followed by CTRL or UXS1 (drain) KO. Values are relative to cells subjected to CTRL KO then CTRL KO (=1.0). (FIG. 7B) Immunoblot of UXS1 and UGDH protein levels under the KO combinations shown in FIG. 7A. (FIG. 7C) GC-MS quantification of UDPGA in cell-lines subjected to CTRL (gray) or UXS1 KO (pink) at 8 days of transduction. (FIG. 7D) Relative viability of A549 UXS1 iKO cells grown in media containing increasing glucose concentrations. Values are relative to uninduced cells grown in media containing 25 mM glucose (=1.0). (FIG. 7E) GC-MS quantification of UDPGA (blue; left Y axis) and relative viability (red; right Y axis) of A549 cells treated with increasing concentrations of UDPGA, showing dose-dependent increase in UDPGA and accompanying decrease in viability. (FIG. 7F) Viability of H838 cells overexpressing either blank vector (gray) or UGDH (red) then subjected to CTRL or UXS1 KO. Values are relative to blank vector overexpressing, CTRL KO cells (=1.0). (FIG. 7G) Immunoblot of UXS1 and UGDH protein levels under the OE / KO combinations shown in FIG. 7C; LE indicates low exposure, HE indicates high exposure. (FIG. 7H) Relative UDP-xylose produced (M+5 UDP-xylose / M+6 UDPGA) in control, UGDH KO, and UXS1 KO cells. (FIG. 71) Relative UDPGA produced (M+6 UDPGA / M+6 UDP-glucose) in control, UGDH KO, and UXS1 KO cells. (FIG. 7 J) Unlabelled UDP-glucose (M + 0) in control and UXS1 KO A549 cells (<1 h) (n = 3 per group). (FIG. 7K) Total UDP-glucose (M + 6 + M + 0) in control and UXS1 KO A549 cells (<1 h) (n = 3 per group). (FIG. 7L) Fractional labeling of UDP-glucose [M + 6 UDP-glucose / total UDP-glucose] of control and UXS1 KO cells (<1 h) (n = 3 per group). For FIGs. 7A, 7C, 7D, 7E, 7F, 7H and 71 n=3 biological replicates. Data are shown as mean ± s.d. p values were calculated using two-tailed Student’s t-test: from left to right in FIG. 7A: p=0.002, p=0.0001. p=7.9E-06, FIG. 7C: p=0.52, p=0.006, p=0.013, FIG. 7D p=0.0006, p=0.015, FIG. 7E: (UDPGA) p=0.016, p=O.O35, p=0.0001, (viability) p=0.0007, p=0.0008, p=3.14E-05 FIG. 7F: p=0.001, p=0.011, p=0.001 (n.s.: not significant, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

[0032] FIGs. 8A-8D show downstream proteoglycan impact of UGDH and UXS1 KO. (FIG. 8A) Sulfated glycosaminoglycans (sGAG) levels quantified using DMMB assay from UGDH KO, UXS1 KO, and UGDH-UXS1 DKO A549 cells and in (FIG. 8B) DLD1 cells. (FIG. 8C) Hyaluronic acid levels quantified via competitive ELISA from the conditioned media obtained from UGDH KO, UXS1 KO, and UGDH-UXS1 DKO A549 cells and in (FIG. 8D) DLD1 cells. Data are shown as mean ± s.d. p values were calculated using two-tailed Student’s t-test: from left to right in FIG. 8A: p=0.024, p=0.019, p=0.028, p=0.012, p=0.031, FIG. 8B: p=0.337, p=0.145, p=0.117, p=0.098, p=0.137, FIG. 8C: p=0.479, p=0.19, p=0.015, p=0.018, p=0.027, FIG. 8D: p=0.492, p=0.71, p=0.004, p=0.002, p=0.004 (n.s.: not significant ,*p<0.05, **p<0.01).

[0033] FIGs. 9A-9J show additional details of Golgi stress, altered glycosylation, and signaling / cell cycle changes following UXS1 ablation. (FIG. 9A) ARF4 immunoblots in UGDH high (UXS1 (A549) iKO and Hl 944) and low (HT1080) cells, 7 days post UXS1 KO, showing that ARF4 is only induced only in UGDH high cells following UXS1 ablation. (FIG. 9B) Changes in Oligomannose glycans (FIG. 9C) Paucimannose glycans (FIG. 9D) Sialylated glycans and (FIG. 9E) glycans with poly-LacNac extensions in A549 cells subjected to CTRL or UXS1 KO. (FIG. 9F) O-glycan profding analysis performed on A549 cells subjected to CTRL or UXS1 KO at 7d post-transduction. (FIG. 9G) Immunoblots of phospho-histone H3 and actin from A549 UXS1 iKO and control iKO cells at indicated timepoints post doxycycline induction. Nocodazole-treated cells are used as a positive control for enrichment for cells in M phase. (FIG. 9H) Dot plot of total Golgi area per cell, from A549 UXS1 iKO cells induced via doxycycline, then labeled using GM130 at indicated days post-induction. No serum (orange) cells were serum starved for 12 hours before labeling, which results in GO cell cycle arrest and synchronization, p values from left to right are p=0.49, p=0.054, p=0.641, p=0.046. (FIG. 91) GSEA enrichment plot showing that EGFR signaling and Cell Cycle genesets are highly depleted in UXS1 KO A549 cells compared to CTRL KO. (FIG. 9J) Same findings in another UXS1 sensitive cell line (H460). Cell Cycle genes are the most depleted geneset for ‘C2; canonical pathways’ (as shown in FIG. 3A), while EGFR Signaling genes are the most depleted geneset for the ‘C2; chemical and genetic perturbations’ ontology scheme. Data are shown as mean ± s.d. p values were calculated using two-tailed Student’s t-test (n.s.: not significant, *p<0.05)

[0034] FIGs. 10A-10K show additional details of golgi and ER morphology, and EGFR localization after UXS1 ablation. (FIG. 10A) Immunofluorescent images of UXS1 iKO or control iKO cells, 7 days post doxycycline induction, immunostained with Giantin (medial-golgi, green), (FIG. IOC) TGN46 (trans-golgi, green), or (FIG. 10E) Calnexin (ER, red); scale bar=20 pm. (FIG. 10B) Dot plot of total golgi area per cell from uninduced and induced UXS1 iKO cells at 7 days postinduction, as labeled with Giantin, (FIG. 10D) TGN-46, or (FIG. 10F) Calnexin (n=50 cells for each stain). (FIG. 10G) Immunoblot for ER stress markers IREla, CHOP, and BiP in A549 and DLD1 UXS1 KO cells 7 days post transduction. Tunicamycin treated cells are positive control for ER stress. (FIG. 10H) Dot plot of total golgi area per cell, labeled using GM130, from control, UXS1 KO, and UGDH-UXS1 DKO (A549) cells, 7 days post UXS1 transduction; n=50 cells. (FIG. 101) Quantification of relative actin-normalized EGFR expression (immunoblots from 3 independent experiments) in induced compared to uninduced UXS1 iKO A549 cells, 5d postinduction. In each experiment, the uninduced EGFR = 1.0. (FIG. 10J) Gating strategy for EGFR cell surface quantitation analysis. Cells were first gated by forward (FSC-A) and side scatters (SSC-A) to remove cell debris, then by forward scatter area (FSC-A) and height (FSC-H) to select for single cells before plotting histograms for FITC channel. Example gating strategy is shown for UXS1 iKO cells. (FIG. 10K) Quantitation of cell surface EGFR labeling via 3 independent flow cytometry experiments. Data are shown as mean ± s.d., p values were calculated using two-tailed Student’s t-test: from left to right in FIG. 10B: p=1.65E-09 in FIG. 10D: p=2.1E-l l in FIG. 10F: p=0.885 in FIG. 10H: p= 9.8E-10, p=0.131 in FIG. 101: p=0.011 in FIG. 1 OK: p=0.001 (n s : not significant, *p<0.05, ***p<0.001 , ****p<0.0001).

[0035] FIGs. 11A-11D show UDPGA accumulation occurs in cytosol and overexpression of SLC35D1 does not impact toxicity of UXS1 KO. (FIG. 11A) Viability of A549 and DLD1 cells overexpressing either blank vector (gray) or SLC35D1 (dark green) then subjected to CTRL or UXS1 KO. Values are relative to blank vector overexpressing, CTRL KO cells (=1.0). (FIG. 11B) Immunoblot of UXS1 and SLC35D1 protein levels under the OE / KO combinations shown in FIG. 11A. (FIG. 11C) GC-MS UDPGA quantitation of cytoplasmic and organellar fractions of either induced or uninduced A549 UXS1 iKO cells. (FIG. 11D) Immunoblots of proteins located in nucleus (PARP1), ER (Calnexin), Golgi (GM130), mitochondria (NDUFS3), and cytoplasm (PSPH and tubulin) in cytosolic and organellar fractions. Cytochrome c is used as a control for intact organelles (mitochondria). Data are shown as mean ± s.d. p values were calculated using two-tailed Student’s t-test: from left to right in FIG. 11A: p=0.391, p=0.379, p=0.792, p=0.106 in FIG. 11C: p=0.018, p=0.002 (n.s.: not significant, *p<0.05, **p<0.01).

[0036] FIGs. 12A-12K show additional in-vivo data. (FIG. 12A) Schematic of in-vivo xenograft experiments shown in FIGs.4A-4F, and 4P. A549 / H460 / HT1080 UXS1 iKO cells were injected subcutaneously into 6 weeks old nude female mice and allowed for tumors to establish. Once the mean tumor was 200-250mm3, the mice were divided into groups for control (uninduced) and dox chow induction of UXS1 KO. A549 xenograft experiment had additional cisplatin arms. The animals were euthanized when individual tumor volume reached 2000mm3. (FIG. 12B) Immunoblots for UXS1 and actin of H460 and HT1080 UXS1 iKO cells in culture with and without doxycycline induction. (FIG. 12C) Relative viability of H460 UXS1 iKO and HT1080 UXS1 iKO cells with and without doxycycline induction (without doxycycline = 1.0). Induction consisted of lOOng / ml doxycycline treatment for 48 hours; cells were cultured for 4 more days before measuring viability. (FIG. 12D) Immunoblot for UXS1 and actin in six individual tumors each from the control and UXS1 iKO group of HT 1080 UXS1 iKO xenograft experiment. (FIG. 12E) Weight of mice in grams from xenograft experiments of A549, (FIG. 12F) H460, and (FIG. 12G) HT1080 from control and UXS1 iKO arms of the experiment. (FIG. 12H) LC-MS Quantification of UDPGA from endpoint tumors from another A549 iKO cohort where tumors were allowed to form for 17 days, induced for KO, then euthanized at 19 days postinduction (p=0.003). (FIG. 121) Immunoblot for ARF4 and actin from four individual tumors in FIG. 12H. (FIG. 12J) Immunoblot for UGDH and actin from organs harvested from control and cisplatin-treated mice (representative pair shown) treated with the same regimen of cisplatin as in FIG. 4N (4mg / kg iv lx weekly, 3 weeks). (FIG. 12K) Quantitation of relative, actin normalized UGDH band intensities from control and cisplatin-treated mice (n=4 each) with the same regimen. Data are shown as mean ± s.d.. p values were calculated using a two-tailed Student’s t-test: from left to right in FIG. 12C: p=1.34E-08, p=0.44 FIG. 12H: p=0.003 in FIG. 12K: p=0.966, p=0.978, p=0.478, p=0.471. (n.s.: not significant, **p<0.01, ****p<0.0001). FIG. 12A was created using Biorender.

[0037] FIGs. 13A-13F show UGDH is elevated in cancer subsets. (FIG. 13A) Immunoblots for UGDH and actin from 11 breast cancer patient tissue samples and 8 normal breast tissues; cancer tissues are labeled in red and normal tissues are labeled in blue. Numbers indicate deidentified patient code, and tumors and normals sharing the same number are adjacent samples from the same patient. (FIG. 13B) Quantification of relative, actin normalized UGDH band intensities from FIG. 13A (p=0.023). (FIG. 13C) Expression profiles of UGDH in 10 types of normal and tumor tissues. The plot is obtained from GEPIA261, a web gene expression profiling tool that plots normalized mRNA-seq data from patient tumor tissues and normal tissues obtained from TCGA and GTEx. All tumor types shown have over 2-fold UGDH expression in tumors than normal tissues (q value <0.01). q values have been determined by ANOVA and adjusted for false discovery rate. The dotted line indicates mean UGDH TPM of liver normal samples, highest among other normal organs. (FIG. 13D) Top dot plot showing viability following UXS1 KO (y axis) and bottom dot plot showing corresponding UGDH protein expression level (y axis) for 19 cancer and 9 normal cell lines of varying lineage (x axis). Cancer lines are divided between High (red) and Low(gray) UGDH expressing lines based on arbitrary cut-off 1.25 units; normal lines are labeled as blue dots. (FIG. 13E) Immunoblots of UGDH and actin for cancer cell lines and normal cells (non-transformed primary or immortalized cells) shown in FIGs. 4H and 13D; UXS1 KO sensitive cell lines are labeled in red and insensitive lines are labeled in gray and normal lines are labeled in blue. (FIG. 13F) Immunoblots for UGDH and actin from 6 normal liver, 6 normal kidney and, 5 normal colon patient tissue samples compared with 2 representative (UGDH high) lung cancer patient samples; cancer tissues are labeled in red and normal tissues are labeled in blue. Data are shown as mean ± s.d. p values were calculated using two-tailed Student’s t-test (*p<0.05). FIGs. 14A-14L show additional chemo-resistance data and RNA interference data for UXS1. (FIG. 14A) Viability of parental (chemo-sensitive) and chemo-resistant Patient-derived organoid (PDO) TPN-02 subjected to varying doses of cisplatin. (FIG. 14B) Immunoblot for UGDH and actin from parental and chemo-resistant PDO TPN-02. (FIG. 14C) Relative viabilities of parental and cisplatin-resistant TPN-02 subjected to UXS1 KO, indicating that cisplatin-resistant organoids are more sensitive to UXS1 loss. Values are relative to parental cells CTRL-KO (=1.0). (FIG. 14D) Sigmoidal drug response curves for MDAMB231 parental (gray) and cisplatin-resistant (violet) cells in response to cisplatin treatment and MDAMB231 parental (gray) and paclitaxel-resistant (orange) counterparts in response to paclitaxel. (FIG. 14E) Immunoblot for UGDH and actin from MDAMB231 parental and drug-resistant counterparts. (FIG. 14F) Relative viabilities of MDAMB231 cisplatin (violet) and paclitaxel (orange) resistant clones subjected to UXS1 KO, indicating that MDAMB231 resistant clones are more sensitive to UXS1 loss. Values are relative to CTRL -KO for each clone (=1.0). (FIG. 14G) Sigmoidal drug response curves for H2170 parental (gray) and cisplatin-resistant (violet) cells in response to Cisplatin treatment and H2170 parental (gray) and paclitaxel-resistant (orange) cells in response to paclitaxel. (FIG. 14H) Immunoblot for UGDH and actin from H2170 parental and drugresistant clones. (FIG. 141) Relative viabilities of H2170 cisplatin (violet) and paclitaxel (orange) resistant clones subjected to UXS1 KO, indicating that H2170 resistant clones are more sensitive to UXS1 loss. Values are relative to CTRL-KO for each clone (=1.0). (FIG. 14J) Immunoblots for glycoproteins FGFR1, FGFR4, CD44 and UXS1 in A549 cells subjected to RNAi. UXS1 blots indicate that shUXSl-2 and shUXSl-3, but not shUXSl-1, result in effective knockdown of UXS1, # denotes that shUXSl-1 is a poor performing shRNA. (FIG. 14K) Relative viabilities of A549 cells subjected to RNA interference (RNAi) mediated knock-down of UXS1, showing that the two guides which effectively knock down UXS1 result in toxicity. (FIG. 14L) Dot plot of total golgi area per cell, labeled using GM130, from A549 cells subjected to shGFP or shUXSl-2, 7 days post-transduction; n=50 cells. Data are shown as mean ± s.d. p values were calculated using a two-tailed Student’s t-test: from left to right in FIG. 14A p=0.005, p=0.007, p=4.12E-05 in FIG. 14C p=0.006, p=1.13E-05 FIG. 14F p=0.002, p=6.07E- 05, p=2.47E-05, p=0.021 in FIG. 141 p=0.006, p=0.019, p=2.4E-5, p=0.021 in FIG. 14L p=2.2E-26. (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). DETAILED DESCRIPTION

[0038] Identifying metabolic steps that are specifically required for the survival of cancer cells but dispensable in normal cells remains a challenge. Evidence indicates that a sugar nucleotide biosynthetic pathway that can be exploited in cancer cells without affecting normal cells. A systematic examination of conditionally essential metabolic enzymes revealed that UXS1, a Golgi enzyme that converts one sugar nucleotide (UDP-glucuronic acid; UDPGA) to another (UDP-xylose), is essential only in cells that express high levels of its immediate upstream enzyme UGDH. This conditional relationship may exist because UXS1 is required expressly to eliminate the UDPGA that UGDH produces. UXS1 functions not only to clear UDPGA, but limits UDPGA production through negative feedback on UGDH. Excess UDGPA disrupts Golgi morphology and function, which impedes the trafficking of surface receptors such as EGFR to the plasma membrane and diminishes cell signaling capacity. UGDH expression is elevated in several cancers, including lung adenocarcinoma, and further enhanced during chemo-resistant selection. As a result, these cancer cells are selectively dependent on UXS1 for UDPGA detoxification, revealing a highly predictable Achille’s heel for therapy.

[0039] The sugar nucleotide UDPGA is a multifunctional metabolite that is a currency for glycosylation and a substrate that cells conjugate to various xenobiotics to aid in their expulsion from cells16-18. It has been found that UDPGA clearance by UXS1 is required for Golgi homeostasis in some cells. Importantly, this is a conditional requirement: only cells that express elevated levels of the enzyme UGDH, which produces UDPGA, have this detoxification requirement. This may have a vital cancer therapy implication, as many types of cancers have elevated UGDH relative to normal cells. Only in these types of cancer cells, UXS1 disruption can result in aberrant Golgi morphology and glycosylation defects leading to death. The upregulation of UGDH in cancer cells may occur in some cancers from the selective advantage in drug clearance, wherein the development of resistant subpopulations of cancer cells to xenobiotic, cancer cell-killing compounds is accompanied by elevated UGDH expression. This introduces a targetable liability in the form of a requirement for UDPGA detoxification via UXS1.

[0040] Furthermore, an unexpected link has been revealed between a sugar nucleotide metabolic pathway and the modulation of signal transduction processes. It was shown that impairment of UXS1 and accumulation of UDPGA, by impairing the Golgi maturation of cell-surface proteins such as growth factor receptors, acts to ‘silence’ a cancer cell so it cannot respond to extracellular cues. Thus, in addition to killing cancer cells outright via toxic UDPGA levels, nuanced cancer therapy strategies may be suggested using such mechanisms to ‘silence’ cancer cell activities such as hyperproliferation and metastasis. That deregulation of sugar nucleotide metabolism can subdue the sensitivity of cells to extracellular cues is a concept that may be broadly relevant to cell biology and in multiple health contexts beyond cancer therapy.

[0041] Thus, several methods are described herein, including methods in which targeted UXS1 disruption / inhibition are used, e.g., in cancers that express UDGH. In some embodiments, provided herein are methods of treating cancer in a subject, the method including administering to the subject a therapeutically effective amount of an inhibitor of UXS1, wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid, and wherein the subject is diagnosed as having a UDGH-high cancer, thereby treating the UDGH-high cancer. Also provided herein are methods of enhancing response to chemotherapy and / or suppressing tumor growth in a subject, the method including administering to the subject a therapeutically effective amount of an inhibitor of UXS1, wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid, and wherein the subject is diagnosed as having a UDGH-high cancer, thereby suppressing tumor growth in the subject.

[0042] Various non-limiting aspects of these methods are described herein and can be used in any combination without limitation. Additional aspects of various components of the methods described herein are known in the art.

[0043] It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise.

[0044] As used herein, the term “administration” typically refers to the administration of a composition to a subject or system to achieve delivery of an agent that is, or is included in, the composition. Those of ordinary skill in the art will be aware of a variety of routes that may, in appropriate circumstances, be utilized for administration to a subject, for example a human. For example, in some embodiments, administration may be ocular, oral, parenteral, topical, etc. In some particular embodiments, administration may be bronchial (e.g., by bronchial instillation), buccal, dermal (which may be or comprise, for example, one or more of topical to the dermis, intradermal, interdermal, transdermal, etc.), enteral, intra-arterial, intradermal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, within a specific organ (e. g. intrahepatic), mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (e.g., by intratracheal instillation), vaginal, vitreal, etc. In some embodiments, administration may involve only a single dose. In some embodiments, administration may involve application of a fixed number of doses. In some embodiments, administration may involve dosing that is intermittent (e.g., a plurality of doses separated in time) and / or periodic (e.g., individual doses separated by a common period of time) dosing. In some embodiments, administration may involve continuous dosing (e.g., perfusion) for at least a selected period of time.

[0045] As used herein, the terms “cancer”, “tumor”, and “carcinoma” refer to cells that exhibit relatively abnormal, uncontrolled, and / or autonomous growth, so that they exhibit an aberrant growth phenotype characterized by a significant loss of control of cell proliferation. In some embodiments, a tumor may be or comprise cells that are precancerous (e.g., benign), malignant, pre-metastatic, metastatic, and / or non-metastatic. The present disclosure specifically identifies certain cancers to which its teachings may be particularly relevant. In some embodiments, a relevant cancer may be characterized by a solid tumor. In some embodiments, a relevant cancer may be characterized by a metastatic solid tumor. In some embodiments, a relevant cancer may be characterized by a hematologic tumor. In general, examples of different types of cancers known in the art include, for example, a bladder cancer, breast cancer, cervical cancer, colon cancer, endometrial cancer, esophageal cancer, fallopian tube cancer, gall bladder cancer, gastrointestinal cancer, head and neck cancer, hematological cancer, Hodgkin lymphoma, laryngeal cancer, liver cancer, lung cancer, lymphoma, melanoma, mesothelioma, ovarian cancer, primary peritoneal cancer, salivary gland cancer, sarcoma, stomach cancer, thyroid cancer, pancreatic cancer, renal cell carcinoma, glioblastoma and prostate cancer. In some embodiments, hematopoietic cancers can include leukemias, lymphomas (Hodgkin’s and nonHodgkin’s), myelomas and myeloproliferative disorders; sarcomas, melanomas, adenomas, carcinomas of solid tissue, squamous cell carcinomas of the mouth, throat, larynx, and lung, liver cancer, genitourinary cancers such as prostate, cervical, bladder, uterine, and endometrial cancer and renal cell carcinomas, bone cancer, pancreatic cancer, skin cancer, cutaneous or intraocular melanoma, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, head and neck cancers, breast cancer, gastro-intestinal cancers and nervous system cancers, benign lesions such as papillomas, precancerous pathology such as myelodysplastic syndromes, acquired aplastic anemia, Fanconi anemia, paroxysmal nocturnal hemoglobinuria (PNH) and 5q- syndrome and the like.

[0046] As used herein, a “cell” can refer to either a prokaryotic or eukaryotic cell, optionally obtained from a subject or a commercially available source.

[0047] As used herein, “delivering”, “gene delivery”, “gene transfer”, “transducing” can refer to the introduction of an exogenous polynucleotide into a host cell, irrespective of the method used for the introduction. Such methods include a variety of well-known techniques such as vector- mediated gene transfer (e.g., viral infection / transfection, or various other protein-based or lipid- based gene delivery complexes) as well as techniques facilitating the delivery of “naked” polynucleotides (e.g., electroporation, “gene gun” delivery and various other techniques used for the introduction of polynucleotides). The introduced polynucleotide may be stably or transiently maintained in the host cell. Stable maintenance typically requires that the introduced polynucleotide either contains an origin of replication compatible with the host cell or integrates into a replicon of the host cell such as an extrachromosomal replicon (e.g., a plasmid) or a nuclear or mitochondrial chromosome.

[0048] In some embodiments, a polynucleotide can be inserted into a host cell by a gene delivery molecule. Examples of gene delivery molecules can include, but are not limited to, liposomes, micelles biocompatible polymers, including natural polymers and synthetic polymers; lipoproteins; polypeptides; polysaccharides; lipopolysaccharides; artificial viral envelopes; metal particles; and bacteria, or viruses, such as baculovirus, adenovirus and retrovirus, bacteriophage, cosmid, plasmid, fungal vectors and other recombination vehicles typically used in the art which have been described for expression in a variety of eukaryotic and prokaryotic hosts, and may be used for gene therapy as well as for simple protein expression.

[0049] As used herein, the term “endogenous” refers to any material growing or originating from within a cell, a tissue, or an organism. As used herein, the term “exogenous” refers to any material introduced from or originating from outside a cell, a tissue or an organism that is not produced by or does not originate from the same cell, tissue, or organism in which it is being introduced.

[0050] As used herein, the term “expression” refers to the process by which polynucleotides are transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. In some embodiments, if the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. The expression level of a gene may be determined by measuring the amount of mRNA or protein in a cell or tissue sample; further, the expression level of multiple genes can be determined to establish an expression profile for a particular sample.

[0051] As used herein, “modulating” can refer to modifying, regulating, or altering the endogenous gene expression in a cell. In some embodiments, modulating gene expression can include systematically influencing RNA stability and / or translation by activating or suppressing the gene expression. In some embodiments, modulation of gene expression can include stabilizing a target RNA. In some embodiments, stabilizing a target RNA can increase translation of the target RNA. In some embodiments, modulation of gene expression can include destabilizing a target RNA. In some embodiments, destabilizing a target RNA can suppress translation of the target RNA. In some embodiments, modulation of gene expression can include increasing translation of a target RNA. In some embodiments, modulation of gene expression can include suppressing translation of a target RNA. In some embodiments, the gene expression of the target RNA is upregulated. In some embodiments, the gene expression of the target RNA is downregulated.

[0052] As used herein, “nucleic acid” or “nucleic acid molecule” is used to include any compound and / or substance that comprise a polymer of nucleotides. In some embodiments, a polymer of nucleotides is referred to as polynucleotides. Exemplary nucleic acids or polynucleotides can include, but are not limited to, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a P-D-ribo configuration, a-LNA having an a-L-ribo configuration (a diastereomer of LNA), 2’-amino-LNA having a 2’-amino functionalization, and 2’-amino-a-LNA having a 2’-amino functionalization) or hybrids thereof. Naturally occurring nucleic acids generally have a deoxyribose sugar (e.g., found in deoxyribonucleic acid (DNA)) or a ribose sugar (e.g., found in ribonucleic acid (RNA)).

[0053] A nucleic acid can contain nucleotides having any of a variety of analogs of these sugar moieties that are known in the art. A deoxyribonucleic acid (DNA) can have one or more bases selected from the group consisting of adenine (A), thymine (T), cytosine (C), or guanine (G), and a ribonucleic acid (RNA) can have one or more bases selected from the group consisting of uracil (U), adenine (A), cytosine (C), or guanine (G). In some embodiments, the term “nucleic acid” or “nucleic acid molecule” refers to a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), or a combination thereof, in either a single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses complementary sequences as well as the sequence explicitly indicated. In some embodiments of any of the isolated nucleic acids described herein, the isolated nucleic acid is DNA. In some embodiments of any of the isolated nucleic acids described herein, the isolated nucleic acid is RNA.

[0054] As used herein, the term “nucleotides” and “nt” are used interchangeably herein to generally refer to biological molecules that comprise nucleic acids. Nucleotides can have moieties that contain the known purine and pyrimidine bases. Nucleotides may have other heterocyclic bases that have been modified. Such modifications include, e.g., methylated purines or pyrimidines, acylated purines or pyrimidines, alkylated riboses, or other heterocycles. The terms “polynucleotides,” “nucleic acid,” and “oligonucleotides” can be used interchangeably. They can refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure, and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise non-naturally occurring sequences. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.

[0055] As used herein, the terms “about” and “approximately,” when used to modify an amount specified in a numeric value or range, indicate that the numeric value as well as reasonable deviations from the value known to the skilled person in the art, for example ± 20%, ± 10%, or ± 5%, are within the intended meaning of the recited value.

[0056] Method of treating cancer targeting UXS1

[0057] Provided herein are methods of treating cancer in a subject that include administering to the subject a therapeutically effective amount of an inhibitor of UXS1, e.g., wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid or a CRISPR / Cas9 complex targeting UXS1, and preferably wherein the subject is diagnosed as having a UDGH-high cancer, thereby treating the UDGH-high cancer. Also provided herein are methods of enhancing response to chemotherapy and / or suppressing tumor growth in a subject, the method including administering to the subject a therapeutically effective amount of an inhibitor of UXS1, e.g., wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid or a CRISPR / Cas9 complex targeting UXS1, and wherein preferably the subject is diagnosed as having a UDGH-high cancer.

[0058] The methods described herein show that the sugar nucleotide biosynthetic pathway has therapeutic vulnerabilities that can be exploited in cancer cells with limited impact on normal cells. UXS1, a Golgi enzyme that converts UDP-glucuronic acid (UDPGA) to UDP-xylose, is essential only in cells that express high levels of its immediate upstream enzyme UGDH. This conditional relationship exists because UXS1 is required to prevent excess accumulation of UDPGA produced by UGDH. UXS1 functions not only to clear UDPGA, but limits UDPGA production through negative feedback on UGDH. Excess UDPGA disrupts Golgi morphology and function, which impedes the trafficking of surface receptors such as EGFR to the plasma membrane and diminishes cell signaling capacity. UGDH expression is elevated in several cancers, including lung adenocarcinoma, and is further enhanced during chemo-resistant selection, wherein these cancer cells are selectively dependent on UXS1 for UDPGA detoxification. Also, targeting UXS1 can induce apoptosis in cancer cells from a UDGH-high cancer, while inhibition of UXS1 is unlikely to show toxicity to normal cells with lower expression of UGDH. Therefore, a UXS1 targeting therapy can be expected to be more effective when administered with chemotherapy because chemotherapy has been shown to induce UGDH expression. UDGH-high cancer

[0059] As used herein, a “UDGH-high cancer” refers to a cancer wherein cells express elevated levels of the enzyme UDGH, which produces UDPGA, relative to normal cells. In some embodiments, a UDGH-high cancer can include lung cancer, liver cancer, breast, cancer, glioblastoma, melanoma, testicular cancer, or prostate cancer (FIG. 13C). In some embodiments, a UDGH-high cancer is lung adenocarcinoma.

[0060] In some embodiments, a subject can be diagnosed as having a UDGH-high cancer by determining a level of UDGH in a biological sample comprising cancer cells from the subject, and comparing the level of UDGH in the biological sample to a reference level, wherein the presence of a level of UDGH in the biological sample above the reference level indicates that the subject has the UDGH-high cancer. Suitable reference levels can be determined using methods known in the art, e.g., using standard molecular biological or clinical trial methodology and statistical analysis, or using reference levels obtained from normal tissues in the same subject. The reference values can have any relevant form. In some cases, the reference comprises a predetermined value for a meaningful level of UDGH, e.g., a control reference level that represents a normal level of UDGH, e.g., a level in an unaffected subject or a subject who is not at risk of developing a disease described herein, and / or a disease reference that represents a level of the proteins associated with conditions associated with UDGH, e.g., a level in a subject having cancer (e.g., a cancer as described herein). The presence and / or level of UDGH protein can be evaluated using methods known in the art, e g., using standard electrophoretic and quantitative immunoassay methods for proteins, including but not limited to, Western blot; enzyme linked immunosorbent assay (ELISA); biotin / avidin type assays; protein array detection; radioimmunoassay; immunohistochemistry (IHC); immune-precipitation assay; FACS (fluorescent activated cell sorting); mass spectrometry (Kim (2010) Am J Clin Pathol 134: 157-162; Yasun (2012) Anal Chem 84(14):6008-6015; Brody (2010) Expert Rev Mol Diagn 10(8): 1013-1022; Philips (2014) PLOS One 9(3):e90226; Pfaffe (2011) Clin Chem 57(5): 675-687). The presence and / or level of UDGH nucleic acid can be evaluated using methods known in the art, e.g., using polymerase chain reaction (PCR), reverse transcriptase polymerase chain reaction (RT-PCR), quantitative or semi-quantitative real-time RT-PCR, digital PCR i.e. BEAMing ((Beads, Emulsion, Amplification, Magnetics) Diehl (2006) Nat Methods 3:551-559) ; RNAse protection assay; Northern blot; various types of nucleic acid sequencing (Sanger, pyrosequencing, NextGen eration Sequencing); fluorescent in-situ hybridization (FISH); or gene array / chips) (Lehninger Biochemistry (Worth Publishers, Inc., current addition; Sambrook, et al, Molecular Cloning: A Laboratory Manual (3. Sup. rd Edition, 2001); Bernard (2002) Clin Chem 48(8): 1178-1185; Miranda (2010) Kidney International 78:191-199; Bianchi (2011) EMBO Mol Med 3:495-503; Taylor (2013) Front. Genet. 4: 142; Yang (2014) PLOS One 9(1 l):el 10641);

[0061] Nordstrom (2000) Biotechnol. Appl. Biochem. 31(2): 107-112; Ahmadian (2000) Anal Biochem 280: 103-110. In some embodiments, high throughput methods, e.g., protein or gene chips as are known in the art (see, e.g., Ch. 12, Genomics, in Griffiths et al., Eds. Modem genetic Analysis, 1999, W. H. Freeman and Company; Ekins and Chu, Trends in Biotechnology, 1999, 17:217-218; MacBeath and Schreiber, Science 2000, 289(5485): 1760-1763; Simpson, Proteins and Proteomics: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 2002; Hardiman, Microarrays Methods and Applications: Nuts & Bolts, DNA Press, 2003), can be used to detect the presence and / or level of UDGH nucleic acids.

[0062] Inhibitory nucleic acids targeting UXS1 In some embodiments, an inhibitor of UXS1 comprises an inhibitory nucleic acid targeting UXS1. Exemplary UXS1 sequences include the following:

[0063] Table 1. Exemplary human UDP-glucuronic acid decarboxylase 1 (UXS1) sequences

[0064] Inhibitory nucleic acids useful in the present methods and compositions can include antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, single- or double-stranded RNA interference (RNAi) compounds such as siRNA compounds, modified bases / locked nucleic acids (LNAs), peptide nucleic acids (PNAs), and other oligomeric compounds or oligonucleotide mimetics that hybridize to at least a portion of the target UXS1 nucleic acid and modulate its function. In some embodiments, the inhibitory nucleic acids include antisense RNA, antisense DNA, chimeric antisense oligonucleotides, antisense oligonucleotides comprising modified linkages, interference RNA (RNAi), short interfering RNA (siRNA); a micro, interfering RNA (miRNA); a small, temporal RNA (stRNA); or a short, hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); small activating RNAs (saRNAs), or combinations thereof. See, e.g., WO 20100401 12. In some embodiments, the inhibitory nucleic acid comprises a small hairpin RNA (shRNA), antisense RNA, small nuclear RNA (snRNA), small interfering RNA (siRNA), or single guide RNA (sgRNA) targeting a UXS1 nucleic acid. In some embodiments, the inhibitory nucleic acid comprises a CRISPR / Cas9 complex targeting a UXS1 gene. In some embodiments, the inhibitory nucleic acid inhibits UXS1 by knockdown of the UXS1 gene expression.

[0065] In some embodiments, the inhibitory nucleic acids are 10 to 50, 10 to 20, 10 to 25, 13 to 50, or 13 to 30 nucleotides in length. One having ordinary skill in the art will appreciate that this embodies inhibitory nucleic acids having complementary portions of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or any range therewithin. In some embodiments, the inhibitory nucleic acids are 15 nucleotides in length. In some embodiments, the inhibitory nucleic acids are 12 or 13 to 20, 25, or 30 nucleotides in length. One having ordinary skill in the art will appreciate that this embodies inhibitory nucleic acids having complementary portions of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length, or any range therewithin (complementary portions refers to those portions of the inhibitory nucleic acids that are complementary to the target sequence). The inhibitory nucleic acids useful in the present methods are sufficiently complementary to the target RNA, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect. As used herein, "complementary" refers to the capacity for pairing, through hydrogen bonding, between two sequences comprising naturally or non-naturally occurring bases or analogs thereof. For example, if a base at one position of an inhibitory nucleic acid is capable of hydrogen bonding with a base at the corresponding position of a RNA, then the bases are considered to be complementary to each other at that position. In some embodiments, 100% complementarity is not required.

[0066] Routine methods can be used to design an inhibitory nucleic acid that binds to the target sequence with sufficient specificity. In some embodiments, the methods include using bioinformatics methods known in the art to identify regions of secondary structure, e.g., one, two, or more stem-loop structures, or pseudoknots, and selecting those regions to target with an inhibitory nucleic acid. For example, “gene walk” methods can be used to optimize the inhibitory activity of the nucleic acid; for example, a series of oligonucleotides of 10-30 nucleotides spanning the length of a target RNA can be prepared, followed by testing for activity. Optionally, gaps, e.g., of 5-10 nucleotides or more, can be left between the target sequences to reduce the number of oligonucleotides synthesized and tested. GC content is preferably between about 30-60%. Contiguous runs of three or more Gs or Cs should be avoided where possible (for example, it may not be possible with very short (e.g., about 9-10 nt) oligonucleotides).

[0067] In some embodiments, the inhibitory nucleic acid molecules can be designed to target a specific region of the RNA sequence. For example, a specific functional region can be targeted, e.g., a region comprising a known RNA localization motif (i.e., a region complementary to the target nucleic acid on which the RNA acts). Alternatively or in addition, highly conserved regions can be targeted, e.g., regions identified by aligning sequences from disparate species such as primate (e.g., human) and rodent (e.g., mouse) and looking for regions with high degrees of identity. Percent identity can be determined routinely using basic local alignment search tools (BLAST programs) (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656), e.g., using the default parameters.

[0068] Once one or more target regions, segments or sites have been identified, e.g., within a target sequence known in the art or provided herein, inhibitory nucleic acid compounds are chosen that are sufficiently complementary to the target, i.e., that hybridize sufficiently well and with sufficient specificity (i.e., do not substantially bind to other non-target RNAs), to give the desired effect.

[0069] In the context of this invention, hybridization means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. Complementary, as used herein, refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a RNA molecule, then the inhibitory nucleic acid and the RNA are considered to be complementary to each other at that position. The inhibitory nucleic acids and the RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other. Thus, “specifically hybridisable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the inhibitory nucleic acid and the RNA target. For example, if a base at one position of an inhibitory nucleic acid is capable of hydrogen bonding with a base at the corresponding position of a RNA, then the bases are considered to be complementary to each other at that position. 100% complementarity is not required.

[0070] It is understood in the art that a complementary nucleic acid sequence need not be 100% complementary to that of its target nucleic acid to be specifically hybridisable. A complementary nucleic acid sequence for purposes of the present methods is specifically hybridisable when binding of the sequence to the target RNA molecule interferes with the normal function of the target RNA to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the sequence to non-target RNA sequences under conditions in which specific binding is desired, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed under suitable conditions of stringency. For example, stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM trisodium citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium citrate. Low stringency hybridization can be obtained in the absence of organic solvent, e.g., formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide, and more preferably at least about 50% formamide. Stringent temperature conditions will ordinarily include temperatures of at least about 30° C, more preferably of at least about 37° C, and most preferably of at least about 42° C. Varying additional parameters, such as hybridization time, the concentration of detergent, e.g., sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Various levels of stringency are accomplished by combining these various conditions as needed. In a preferred embodiment, hybridization will occur at 30° C in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS. In a more preferred embodiment, hybridization will occur at 37° C in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 pg / ml denatured salmon sperm DNA (ssDNA). In a most preferred embodiment, hybridization will occur at 42° C in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 pg / ml ssDNA. Useful variations on these conditions will be readily apparent to those skilled in the art.

[0071] For most applications, washing steps that follow hybridization will also vary in stringency. Wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature. For example, stringent salt concentration for the wash steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate. Stringent temperature conditions for the wash steps will ordinarily include a temperature of at least about 25° C, more preferably of at least about 42° C, and even more preferably of at least about 68° C. In a preferred embodiment, wash steps will occur at 25° C in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 42° C. in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 68° C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. Additional variations on these conditions will be readily apparent to those skilled in the art. Hybridization techniques are well known to those skilled in the art and are described, for example, in Benton and Davis (Science 196: 180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York. In general, the inhibitory nucleic acids useful in the methods described herein have at least 80% sequence complementarity to a target region within the target nucleic acid, e.g., 90%, 95%, or 100% sequence complementarity to the target region within an RNA. For example, an antisense compound in which 18 of 20 nucleobases of the antisense oligonucleotide are complementary, and would therefore specifically hybridize, to a target region would represent 90 percent complementarity. Percent complementarity of an inhibitory nucleic acid with a region of a target nucleic acid can be determined routinely using basic local alignment search tools (BLAST programs) (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). Inhibitory nucleic acids that hybridize to an RNA can be identified through routine experimentation. In general the inhibitory nucleic acids must retain specificity for their target, i.e., must not directly bind to, or directly significantly affect expression levels of, transcripts other than the intended target.

[0072] For further disclosure regarding inhibitory nucleic acids, please see US2010 / 0317718 (antisense oligos); US2010 / 0249052 (double-stranded ribonucleic acid (dsRNA)); US2009 / 0181914 and US2010 / 0234451 (LNAs); US2007 / 0191294 (siRNA analogues); US2008 / 0249039 (modified siRNA); and WO2010 / 129746 and W02010 / 040112 (inhibitory nucleic acids).

[0073] Antisense

[0074] In some embodiments, the inhibitory nucleic acids are antisense oligonucleotides. Antisense oligonucleotides are typically designed to block expression of a DNA or RNA target by binding to the target and halting expression at the level of transcription, translation, or splicing. Antisense oligonucleotides of the present invention are complementary nucleic acid sequences designed to hybridize under stringent conditions to an RNA. Thus, oligonucleotides are chosen that are sufficiently complementary to the target, i.e., that hybridize sufficiently well and with sufficient specificity, to give the desired effect. siRNA / shRNA

[0075] In some embodiments, the nucleic acid sequence that is complementary to a target RNA can be an interfering RNA, including but not limited to a small interfering RNA (“siRNA”) or a small hairpin RNA (“shRNA”). Methods for constructing interfering RNAs are well known in the art. For example, the interfering RNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e., each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure); the antisense strand comprises nucleotide sequence that is complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof (i.e., an undesired gene) and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. Alternatively, interfering RNA is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions are linked by means of nucleic acid based or non-nucleic acid-based linker(s). The interfering RNA can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises a nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The interfering can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA molecule capable of mediating RNA interference.

[0076] In some embodiments, the interfering RNA coding region encodes a self-complementary RNA molecule having a sense region, an antisense region and a loop region. Such an RNA molecule when expressed desirably forms a “hairpin” structure, and is referred to herein as an “shRNA.” The loop region is generally between about 2 and about 10 nucleotides in length. In some embodiments, the loop region is from about 6 to about 9 nucleotides in length. In some embodiments, the sense region and the antisense region are between about 15 and about 20 nucleotides in length. Following post-transcriptional processing, the small hairpin RNA is converted into a siRNA by a cleavage event mediated by the enzyme Dicer, which is a member of the RNase III family. The siRNA is then capable of inhibiting the expression of a gene with which it shares homology. For details, see Brummelkamp et al., Science 296:550-553, (2002); Lee et al, Nature Biotechnol., 20, 500-505, (2002); Miyagishi and Taira, Nature Biotechnol 20:497-500, (2002); Paddison et al. Genes & Dev. 16:948-958, (2002); Paul, Nature Biotechnol, 20, 505-508, (2002); Sui, Proc. Natl. Acad. Sd. USA, 99(6), 5515-5520, (2002); Yu et al. Proc NatlAcadSci USA 99:6047-6052, (2002).

[0077] The target RNA cleavage reaction guided by siRNAs is highly sequence specific. In general, siRNA containing a nucleotide sequence identical to a portion of the target nucleic acid are preferred for inhibition. However, 100% sequence identity between the siRNA and the target gene is not required to practice the present invention. Thus, the present methods have the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence. For example, siRNA sequences with insertions, deletions, and single point mutations relative to the target sequence have also been found to be effective for inhibition. Alternatively, siRNA sequences with nucleotide analog substitutions or insertions can be effective for inhibition. In general, the siRNAs must retain specificity for their target, i.e., must not directly bind to, or directly significantly affect expression levels of, transcripts other than the intended target.

[0078] Modified Inhibitory Nucleic Acids

[0079] In some embodiments, the inhibitory nucleic acids used in the methods described herein are modified, e.g., comprise one or more modified bonds or bases. A number of modified bases include phosphorothioate, methylphosphonate, peptide nucleic acids, or locked nucleic acid (LNA) molecules. Some inhibitory nucleic acids are fully modified, while others are chimeric and contain two or more chemically distinct regions, each made up of at least one nucleotide. These inhibitory nucleic acids typically contain at least one region of modified nucleotides that confers one or more beneficial properties (such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the target) and a region that is a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. Chimeric inhibitory nucleic acids can be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and / or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. In some embodiments, the oligonucleotide is a gapmer (contain a central stretch (gap) of DNA monomers sufficiently long to induce RNase H cleavage, flanked by blocks of LNA modified nucleotides; see, e.g., Stanton et al., Nucleic Acid Ther. 2012. 22: 344-359; Nowotny et al., Cell, 121 : 1005- 1016, 2005; Kurreck, European Journal of Biochemistry 270:1628-1644, 2003; Fluiter et al., Mol Biosyst. 5(8): 838-43, 2009). In some embodiments, the oligonucleotide is a mixmer (includes alternating short stretches of LNA and DNA; Naguibneva et al., Biomed Pharmacother. 2006 Nov; 60(9):633-8; 0rom et al., Gene. 2006 May 10; 372(): 137-41). Representative United States patents that teach the preparation of such hybrid structures comprise, but are not limited to, US patent nos. 5,013,830; 5,149,797; 5, 220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of which is herein incorporated by reference.

[0080] In some embodiments, the inhibitory nucleic acid comprises at least one nucleotide modified at the 2' position of the sugar, most preferably a 2'-O-alkyl, 2'-O-alkyl-O-alkyl or 2'- fluoro-modified nucleotide. In other preferred embodiments, RNA modifications include 2'- fluoro, 2'-amino and 2' O-methyl modifications on the ribose of pyrimidines, abasic residues or an inverted base at the 3' end of the RNA. Such modifications are routinely incorporated into oligonucleotides and these oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) than; 2'-deoxyoligonucleotides against a given target.

[0081] A number of nucleotide and nucleoside modifications have been shown to make the oligonucleotide into which they are incorporated more resistant to nuclease digestion than the native oligodeoxynucleotide; these modified oligos survive intact for a longer time than unmodified oligonucleotides. Specific examples of modified oligonucleotides include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. Most preferred are oligonucleotides with phosphorothioate backbones and those with heteroatom backbones, particularly CH2 -NH-0-CH2, CH,~N(CH3)~O~CH2 (known as a methylene(methylimino) or MMI backbone], CH2 — O--N (CH3)-CH2, CH2 -N (CH3)-N (CH3)-CH2 and O-N (CH3)- CH2 -CH2 backbones, wherein the native phosphodiester backbone is represented as O- P- O- CH,); amide backbones (see De Mesmaeker et al. Ace. Chem. Res. 1995, 28:366-374); morpholino backbone structures (see Summerton and Weller, U.S. Pat. No. 5,034,506); peptide nucleic acid (PNA) backbone (wherein the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleotides being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone, see Nielsen et al., Science 1991, 254, 1497). Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3'alkylene phosphonates and chiral phosphonates, phosphinates, phosphorami dates comprising 3'-amino phosphorami date and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2’; see US patent nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5, 177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455, 233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563, 253; 5,571,799; 5,587,361; and 5,625,050.

[0082] Morpholino-based oligomeric compounds are described in Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510); Genesis, volume 30, issue 3, 2001; Heasman, J., Dev. Biol., 2002, 243, 209-214; Nasevicius et al., Nat. Genet., 2000, 26, 216-220; Lacerra et al., Proc. Natl. Acad. Sci., 2000, 97, 9591-9596; and U.S. Pat. No. 5,034,506, issued Jul. 23, 1991.

[0083] Cyclohexenyl nucleic acid oligonucleotide mimetics are described in Wang et al., J. Am. Chem. Soc., 2000, 122, 8595-8602.

[0084] Modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl intemucleoside linkages, mixed heteroatom and alkyl or cycloalkyl intemucleoside linkages, or one or more short chain heteroatomic or heterocyclic intemucleoside linkages. These comprise those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts; see US patent nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264, 562; 5, 264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596, 086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623, 070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference.

[0085] One or more substituted sugar moieties can also be included, e.g., one of the following at the 2' position: OH, SH, SCH3, F, OCN, OCH3, OCH3 O(CH2)n CH3, O(CH2)n NH2or O(CH2)n CH3where n is from 1 to about 10; Ci to CIO lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF3 ; OCF3; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; SOCH3; SO2 CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an oligonucleotide; or a group for improving the pharmacodynamic properties of an oligonucleotide and other substituents having similar properties. A preferred modification includes 2'-methoxyethoxy [2'-0-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl)] (Martin et al, Helv. Chim. Acta, 1995, 78, 486). Other preferred modifications include 2'-methoxy (2'-0-CH3), 2'-propoxy (2'-OCH2CH2CH?) and 2'- fluoro (2'-F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group.

[0086] Inhibitory nucleic acids can also include, additionally or alternatively, nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2' deoxycytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2- (methylamino)adenine, 2- (imidazolylalkyl)adenine, 2-(aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2 -thiouracil, 2-thiothymine, 5-bromouracil, 5- hydroxymethyluracil, 8-azaguanine, 7- deazaguanine, N6 (6-aminohexyl)adenine and 2,6- diaminopurine. Kornberg, A., DNA Replication, W. H. Freeman & Co., San Francisco, 1980, pp 75-77; Gebeyehu, G., et al. Nucl. Acids Res. 1987, 15:4513). A "universal" base known in the art, e.g., inosine, can also be included. 5-Me-C substitutions have been shown to increase nucleic acid duplex stability by 0.6- 1 ,2<0>C. (Sanghvi, Y. S., in Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions.

[0087] It is not necessary for all positions in a given oligonucleotide to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single oligonucleotide or even at within a single nucleoside within an oligonucleotide.

[0088] In some embodiments, both a sugar and an internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-b ackbone of an oligonucleotide is replaced with an amide containing backbone, for example, an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds comprise, but are not limited to, US patent nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al, Science, 1991, 254, 1497-1500.

[0089] Inhibitory nucleic acids can also include one or more nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases comprise the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases comprise other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2- propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudo-uracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8- hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5- bromo, 5- trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylquanine and 7- methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3- deazaguanine and 3 -deazaadenine. Further, nucleobases comprise those disclosed in United States Patent No. 3,687,808, those disclosed in 'The Concise Encyclopedia of Polymer Science And Engineering', pages 858- 859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandle Chemie, International Edition', 1991, 30, page 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications', pages 289- 302, Crooke, S T. and Lebleu, B. ea., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, comprising 2- ami nopropyl adenine, 5-propynyluracil and 5- propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2<0>C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds, 'Antisense Research and Applications', CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2'-O-methoxy ethyl sugar modifications. Modified nucleobases are described in US patent nos. 3,687,808, as well as 4,845,205; 5, 130,302; 5,134,066; 5,175, 273; 5, 367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,596,091; 5,614,617; 5,750,692, and 5,681,941, each of which is herein incorporated by reference.

[0090] In some embodiments, the inhibitory nucleic acids are chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Such moieties comprise but are not limited to, lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S- tritylthiol (Manoharan et al, Ann. N. Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49- 54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1 ,2-di-O-hexadecyl- rac- glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Mancharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-t oxy cholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937). See also US patent nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552, 538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486, 603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762, 779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082, 830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5, 245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391, 723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5, 565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599, 928 and 5,688,941, each of which is herein incorporated by reference.

[0091] These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups can include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve uptake, enhance resistance to degradation, and / or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present invention. Representative conjugate groups are disclosed in International Patent Application No. PCT / US92 / 09196, filed Oct. 23, 1992, and U.S. Pat. No. 6,287,860, which are incorporated herein by reference. Conjugate moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-5-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or tri ethylammonium l,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxy cholesterol moiety. See, e.g., U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941 ; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941.

[0092] Locked Nucleic Acids (LNAs)

[0093] In some embodiments, the modified inhibitory nucleic acids used in the methods described herein comprise locked nucleic acid (LNA) molecules, e.g., including [alpha]-L- LNAs. LNAs comprise ribonucleic acid analogues wherein the ribose ring is “locked” by a methylene bridge between the 2’-oxgygen and the 4’-carbon - i.e., oligonucleotides containing at least one LNA monomer, that is, one 2'-O,4'-C-methylene-^-D-ribofuranosyl nucleotide. LNA bases form standard Watson-Crick base pairs but the locked configuration increases the rate and stability of the basepairing reaction (Jepsen et al., Oligonucleotides, 14, 130-146 (2004)). LNAs also have increased affinity to base pair with RNA as compared to DNA. These properties render LNAs especially useful as probes for fluorescence in situ hybridization (FISH) and comparative genomic hybridization, as knockdown tools for miRNAs, and as antisense oligonucleotides to target mRNAs or other RNAs, e.g., RNAs as described herein.

[0094] The LNA molecules can include molecules comprising 10-30, e.g., 12-24, e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in each strand, wherein one of the strands is substantially identical, e.g., at least 80% (or more, e.g., 85%, 90%, 95%, or 100%) identical, e.g., having 3, 2, 1, or 0 mismatched nucleotide(s), to a target region in the RNA. The LNA molecules can be chemically synthesized using methods known in the art.

[0095] The LNA molecules can be designed using any method known in the art; a number of algorithms are known, and are commercially available (e.g., on the internet, for example at exiqon.com). See, e.g., You et al., Nuc. Acids. Res. 34:e60 (2006); McTigue et al., Biochemistry 43:5388-405 (2004); and Levin et al., Nuc. Acids. Res. 34:el42 (2006). For example, “gene walk” methods, similar to those used to design antisense oligos, can be used to optimize the inhibitory activity of the LNA; for example, a series of oligonucleotides of 10-30 nucleotides spanning the length of a target RNA can be prepared, followed by testing for activity. Optionally, gaps, e.g., of 5-10 nucleotides or more, can be left between the LNAs to reduce the number of oligonucleotides synthesized and tested. GC content is preferably between about 30-60%. General guidelines for designing LNAs are known in the art; for example, LNA sequences will bind very tightly to other LNA sequences, so it is preferable to avoid significant complementarity within an LNA. Contiguous runs of more than four LNA residues, should be avoided where possible (for example, it may not be possible with very short (e.g., about 9-10 nt) oligonucleotides). In some embodiments, the LNAs are xylo-LNAs.

[0096] For additional information regarding LNAs see U.S. Pat. Nos. 6,268,490; 6,734,291; 6,770,748; 6,794,499; 7,034,133; 7,053,207; 7,060,809; 7,084,125; and 7,572,582; and U.S. PreGrant Pub. Nos. 20100267018; 20100261175; and 20100035968; Koshkin et al. Tetrahedron 54, 3607-3630 (1998); Obika et al. Tetrahedron Lett. 39, 5401-5404 (1998); Jepsen et al., Oligonucleotides 14: 130-146 (2004); Kauppinen et al., Drug Disc. Today 2(3):287-290 (2005); and Ponting et al., Cell 136(4): 629-641 (2009), and references cited therein.

[0097] Making and Using Inhibitory Nucleic Acids

[0098] The nucleic acid sequences used to practice the methods described herein, i.e., inhibitory nucleic acids targeting UXS1, can be isolated from a variety of sources, genetically engineered, amplified, and / or expressed / generated recombinantly. Recombinant nucleic acid sequences can be individually isolated or cloned and tested for a desired activity. Any recombinant expression system can be used, including e.g., in vitro, bacterial, fungal, mammalian, yeast, insect or plant cell expression systems.

[0099] Nucleic acid sequences encoding the inhibitory nucleic acids can be inserted into delivery vectors and expressed from transcription units within the vectors, e.g., as discussed below. The recombinant vectors can be, e.g., DNA plasmids or viral vectors. Generation of the vector construct can be accomplished using any suitable genetic engineering techniques well known in the art, including, without limitation, the standard techniques of PCR, oligonucleotide synthesis, restriction endonuclease digestion, ligation, transformation, plasmid purification, and DNA sequencing, for example as described in Sambrook et al. Molecular Cloning: A Laboratory Manual. (1989)), Coffin et al. (Retroviruses. (1997)) and “RNA Viruses: A Practical Approach” (Alan J. Cann, Ed., Oxford University Press, (2000)). As will be apparent to one of ordinary skill in the art, a variety of suitable vectors are available for transferring inhibitory nucleic acids into cells. The selection of an appropriate vector to deliver inhibitory nucleic acids and optimization of the conditions for insertion of the selected expression vector into the cell, are within the scope of one of ordinary skill in the art without the need for undue experimentation. Viral vectors comprise a nucleotide sequence having sequences for the production of recombinant virus in a packaging cell. Viral vectors expressing inhibitory nucleic acids can be constructed based on viral backbones including, but not limited to, a retrovirus, lentivirus, adenovirus, adeno- associated virus, pox virus or alphavirus. The recombinant vectors capable of expressing the inhibitory nucleic acids can be delivered as described herein, and persist in target cells (e.g., stable transformants).

[0100] Nucleic acid sequences used in the present methods and compositions can be synthesized in vitro by well-known chemical synthesis techniques, as described in, e.g., Adams (1983) J. Am. Chem. Soc. 105:661; Belousov (1997) Nucleic Acids Res. 25:3440-3444; Frenkel (1995) Free Radic. Biol. Med. 19:373-380; Blommers (1994) Biochemistry 33:7886-7896; Narang (1979) Meth. Enzymol. 68:90; Brown (1979) Meth. Enzymol. 68: 109; Beaucage (1981) Tetra. Lett. 22:1859; U.S. Patent No. 4,458,066.

[0101] Nucleic acid sequences can be stabilized against nucleolytic degradation such as by the incorporation of a modification, e.g., a nucleotide modification. For example, nucleic acid sequences can include a phosphorothioate at least the first, second, or third intemucleotide linkage at the 5' or 3' end of the nucleotide sequence. As another example, the nucleic acid sequence can include a 2'-modified nucleotide, e.g., a 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl (2'-0-M0E), 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O- DMAOE), 2'-O-dimethylaminopropyl (2'-0-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O- DMAEOE), or 2'-O— N-methylacetamido (2'-O— NMA). As another example, the nucleic acid sequence can include at least one 2'-O-methyl-modified nucleotide, and in some embodiments, all of the nucleotides include a 2'-O-methyl modification. In some embodiments, the inhibitory nucleic acids are “locked,” i.e., comprise nucleic acid analogues in which the ribose ring is “locked” by a methylene bridge connecting the 2’-0 atom and the 4’-C atom (see, e.g., Kaupinnen et al., Drug Disc. Today 2(3):287-290 (2005); Koshkin et al., J. Am. Chem. Soc., 120(50): 13252-13253 (1998)). For additional modifications see US 20100004320, US 20090298916, and US 20090143326. Techniques for the manipulation of inhibitory nucleic acids used to practice the methods described herein, such as, e.g., subcloning, labeling probes (e.g., random-primer labeling using Klenow polymerase, nick translation, amplification), sequencing, hybridization and the like are well described in the scientific and patent literature, see, e.g., Sambrook et al., Molecular Cloning; A Laboratory Manual 3d ed. (2001); Current Protocols in Molecular Biology , Ausubel et al., eds. (John Wiley & Sons, Inc., New York 2010); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); Labor atory Technicpies In Biochemistry And Molecular Biology: Hybridization With Nucleic Acid Probes, Parti. Theory and Nucleic Acid Preparation, Tijssen, ed. Elsevier, N.Y. (1993).

[0102] CRISPR UXS1 Gene Editing Complexes

[0103] The present methods can also include the delivery a CRISPR UXS1 gene editing complex. The gene editing complex includes a Cas9 editing enzyme and one or more guide RNAs directing the editing enzyme to UXS1, and can be delivered as nucleic acids encoding the editing enzyme and the guide RNAs, or as ribonucleoprotein complexes (RNPs).

[0104] Guide RNAs directing the editing enzyme to UXS1

[0105] The gene editing complex also includes guide RNAs directing the editing enzyme to UXS1, i.e., comprising a sequence that is complementary to the sequence of a nucleic acid encoding UXS1, and that include a PAM sequence that is targetable by the co-administered Cas9 editing enzyme. In some embodiments, the precursor sequence is targeted by the guide RNA, i.e., comprising a sequence that is complementary to the sequence of a nucleic acid encoding UXS1. In some embodiments, the precursor sequence is targeted by the guide RNA. In some embodiments, a guide RNA comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

[0106] Cas9 editing enzymes

[0107] The methods include the delivery of Cas9 editing enzymes to the cells. The editing enzymes can include one or more of Streptococcus thermophilus (ST) Cas9 (StCas9); Treponema denticola (TD) (TdCas9); Streptococcus pyogenes (SP) (SpCas9); Staphylococcus aureus (SA) Cas9 (SaCas9); o Neisseria haracteriza (NM) Cas9 (NmCas9), as well as variants thereof that are at least 80%, 85%, 90%, 95%, 99% or 100% identical thereto that retain at least one function of the parent protein, e.g., the ability to complex with a gRNA, bind to target DNA specified by the gRNA, and alter the sequence of the target DNA. Variants include the SpCas9 DI 135E variant; SpCas9 VRER variant; SpCas9 EQR variant; and the SpCas9 VQR variant, among others. In some embodiments, base editors and other Cas fusions can also be used to introduce specific edits that abrogate expression of functional protein.

[0108] To determine the percent identity of two sequences, the sequences are aligned for optimal comparison purposes (gaps are introduced in one or both of a first and a second amino acid or nucleic acid sequence as required for optimal alignment, and non-homologous sequences can be disregarded for comparison purposes). The length of a reference sequence aligned for comparison purposes is at least 80% (in some embodiments, about 85%, 90%, 95%, or 100% of the length of the reference sequence) is aligned. The nucleotides or residues at corresponding positions are then compared. When a position in the first sequence is occupied by the same nucleotide or residue as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.

[0109] The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch ((1970) J. Mol. Biol. 48:444-453) algorithm which has been incorporated into the GAP program in the GCG software package, using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.

[0110] The sequences of the Cas9s are known in the art; see, e.g., Kleinstiver et al., Nature. 2015 Jul 23; 523(7561): 481-485; WO 2016 / 141224; US 9,512,446; US-2014-0295557; WO 2014 / 204578; and WO 2014 / 144761. The methods can also include the use of the other previously described variants of the SpCas9 platform (e.g., truncated sgRNAs (Tsai et al., Nat Biotechnol 33, 187-197 (2015); Fu et al., Nat Biotechnol 32, 279-284 (2014)), nickase mutations (Mali et al., Nat Biotechnol 31, 833-838 (2013); Ran et al., Cell 154, 1380-1389 (2013)), Fokl- dCas9 fusions (Guilinger et al., Nat Biotechnol 32, 577-582 (2014); Tsai et al., Nat Biotechnol 32, 569-576 (2014); WO2014144288). See also Hou, Z. et al. Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria haracteriza. Proc Natl Acad Sci U S A (2013); Fonfara, I. et al. Phylogeny of Cas9 determines functional exchangeability of dual-RNA and Cas9 among orthologous type II CRISPR-Cas systems. Nucleic Acids Res 42, 2577-2590 (2014); Esvelt, K.M. et al. Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods 10, 1116-1121 (2013); Cong, L. et al. Multiplex genome engineering using CRISPR / Cas systems. Science 339, 819-823 (2013); Horvath, P. et al. Diversity, activity, and evolution of CRISPR loci in Streptococcus thermophilus. J Bacterio! 190, 1401-1412 (2008).

[0111] As noted above, the Cas9 can be delivered as a purified protein (e.g., a recombinantly produced purified protein, prefolded and optionally complexed with the sgRNA) or as a nucleic acid encoding the Cas9, e g., an expression construct. Purified Cas9 proteins can be produced using methods known in the art, e g., expressed in prokaryotic or eukaryotic cells and purified using standard methodology. For example, the methods can include delivering the Cas9 protein and guide RNA together, e.g., as a complex. For example, the Cas9 and gRNA can be overexpressed in a host cell and purified, then complexed with the guide RNA (e.g., in a test tube) to form a ribonucleoprotein (RNP), and delivered to cells. In some embodiments, the Cas9 can be expressed in and purified from bacteria through the use of bacterial Cas9 expression plasmids. For example, His-tagged Cas9 proteins can be expressed in bacterial cells and then purified using nickel affinity chromatography. The RNPs can be delivered to the cells in vivo or in vitro, e.g., using lipid-mediated transfection or electroporation. See, e.g., Liang et al., lournal of biotechnology 208 (2015): 44-53; Zuris et al. Nature biotechnology 33.1 (2015): 73-80; Kim et al. Genome research 24.6 (2014): 1012-1019. Efficiency of protein delivery can be enhanced, e.g., using electroporation (see, e.g., Wang et al., lournal of Genetics and Genomics 43(5):319— 327 (2016)); cationic or lipophilic carriers (see, e.g., Yu et al., Biotechnol Lett. 2016; 38: 919- 929; Zuris et al., Nat Biotechnol. 33(l):73-80 (2015)); or even lentiviral packaging particles (see, e.g., Choi et al., Gene Therapy 23, 627-633 (2016)).

[0112] Expression Constructs

[0113] Expression constructs encoding an inhibitory nucleic acid, or one or both of guide RNAs and / or Cas9 editing enzymes, can be administered in any effective carrier, e.g., any formulation or composition capable of effectively delivering the component gene to cells. Approaches include insertion of the gene in viral vectors, including recombinant retroviruses, adenovirus, adeno-associated virus, lentivirus, and herpes simplex virus-1, or recombinant bacterial or eukaryotic plasmids. Viral vectors transfect cells directly; plasmid DNA can be delivered naked or with the help of, for example, cationic liposomes (lipofectamine) or derivatized (e.g., antibody conjugated), polylysine conjugates, haracteri S, artificial viral envelopes or other such intracellular carriers, as well as direct injection of the gene construct or CaPCh precipitation.

[0114] A preferred approach for introduction of nucleic acid into a cell is by use of a viral vector containing nucleic acid, e.g., a cDNA. Infection of cells with a viral vector has the advantage that a large proportion of the targeted cells can receive the nucleic acid. Additionally, molecules encoded within the viral vector, e.g., by a cDNA contained in the viral vector, are expressed efficiently in cells that have taken up viral vector nucleic acid.

[0115] Retrovirus vectors and adeno-associated virus vectors can be used as a recombinant gene delivery system for the transfer of exogenous genes. These vectors provide efficient delivery of genes into cells, and the transferred nucleic acids are stably integrated into the chromosomal DNA of the host cell. The development of specialized cell lines (termed “packaging cells”) which produce only replication-defective retroviruses has increased the utility of retroviruses for gene therapy, and defective retroviruses are characterized for use in gene transfer for gene therapy purposes (for a review see Miller, Blood 76:271 (1990)). A replication defective retrovirus can be packaged into virions, which can be used to infect a target cell through the use of a helper virus by standard techniques. Protocols for producing recombinant retroviruses and for infecting cells in vitro with such viruses can be found in Ausubel, et al., eds., Current Protocols in Molecular Biology, Greene Publishing Associates, (1989), Sections 9.10-9.14, and other standard laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP, pWE and pEM which are known to those skilled in the art. Examples of suitable packaging virus lines for preparing both ecotropic and amphotropic retroviral systems include Crip, Cre, 2 and TAm Retroviruses have been used to introduce a variety of genes into many different cell types, including epithelial cells, in vitro (see for example Eglitis, et al. (1985) Science 230:1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464; Wilson et al. (1988) Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano et al. (1990) Proc. Natl. Acad. Sci. USA 87:6141-6145; Huber et al. (1991) Proc. Natl. Acad. Sci. USA 88:8039-8043; Ferry et al. (1991) Proc. Natl. Acad. Sci. USA 88:8377-8381; Chowdhury et al. (1991) Science 254: 1802-1805; van Beusechem et al. (1992) Proc. Natl. Acad. Sci. USA 89:7640-7644; Kay et al. (1992) Human Gene Therapy 3:641-647; Dai et al. (1992) Proc. Natl. Acad. Sci. USA 89: 10892-10895; Hwu et al. (1993) J. Immunol. 150:4104-4115; U.S. Patent No. 4,868,116; U.S. Patent No. 4,980,286; PCT Application WO 89 / 07136; PCT Application WO 89 / 02468; PCT Application WO 89 / 05345; and PCT Application WO 92 / 07573).

[0116] Lentiviral vectors transduce dividing as well as quiescent cells. This can be viewed as a major advantage with respect to gene therapy for tumors in general, as within a short treatment window most tumor cells (and especially GSC) do not divide. Therapeutic use of the lentiviral editing approach can be a legitimate alternative to other viral systems, as high viral titers can be produced, nonproliferating cells that are especially abundant in the walls of the tumor cavity after surgery can be transduced, and transduction efficacies are very high. An additional advantage of a locally applied vesicular stomatitis virus glycoprotein (VSV-G) pseudotyped lentivirus is its inactivation by human serum that would reduce systemic effects. To further reduce neurotrophism, and enhance selective tropism for glioma and GSC, the commonly bound envelope glycoprotein of VSV can be replaced with a more selective variant glycoprotein of lymphocytic choriomeningitis virus (LCMV-GP). LCMV-GP is not cytotoxic when injected locally or systemically, can be packaged with other components of the CRISPR-Cas9 system, and efficiently transduces solid glioma tissues as well as infiltrating tumor cells.

[0117] Another viral gene delivery system useful in the present methods utilizes adenovirus- derived vectors. The genome of an adenovirus can be manipulated, such that it encodes and expresses a gene product of interest but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. See, for example, Berkner et al., BioTechniques 6:616 (1988); Rosenfeld et al., Science 252:431-434 (1991); and Rosenfeld et al., Cell 68: 143-155 (1992). Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 dl324 or other strains of adenovirus (e.g., Ad2, Ad3, or Ad7 etc.) are known to those skilled in the art. Recombinant adenoviruses can be advantageous in certain circumstances, in that they are not capable of infecting non-dividing cells and can be used to infect a wide variety of cell types, including epithelial cells (Rosenfeld et al., (1992) supra). Furthermore, the virus particle is relatively stable and amenable to purification and concentration, and as above, can be modified so as to affect the spectrum of infectivity. Additionally, introduced adenoviral DNA (and foreign DNA contained therein) is not integrated into the genome of a host cell but remains episomal, thereby avoiding potential problems that can occur as a result of insertional mutagenesis in situ, where introduced DNA becomes integrated into the host genome (e.g., retroviral DNA). Moreover, the carrying capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) relative to other gene delivery vectors (Berkner et al., supra; Haj-Ahmand and Graham, J. Virol. 57:267 (1986).

[0118] Vectors based on recombinant Adenovirus-5 (Ad5): Ad5 have many advantages for this purpose, including non-integration, lack of insertional mutagenesis, high-efficiency transduction, and accommodation of large expression cassettes; these vectors have also been utilized in multiple clinical trials.

[0119] Helper-dependent (HDAd) vectors can also be produced with all adenoviral sequences deleted except the origin of DNA replication at each end of the viral DNA along with packaging signal at 5-prime end of the genome downstream of the left packaging signal. HDAd vectors are constructed and propagated in the presence of a replication-competent helper adenovirus that provides the required early and late proteins necessary for replication.

[0120] Yet another viral vector system useful for delivery of nucleic acids is the adeno- associated virus (AAV). Adeno-associated virus is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle. (For a review see Muzyczka et al., Curr. Topics in Micro. And Immunol.158:97-129 (1992). It is also one of the few viruses that may integrate its DNA into non-dividing cells and exhibits a high frequency of stable integration (see for example Flotte et al., Am. I. Respir. Cell. Mol. Biol. 7:349-356 (1992); Samulski et al., J. Virol. 63:3822-3828 (1989); and McLaughlin et al., I. Virol. 62: 1963-1973 (1989). Vectors containing as little as 300 base pairs of AAV can be packaged and can integrate. Space for exogenous DNA is limited to about 4.5 kb. An AAV vector such as that described in Tratschin et al., Mol. Cell. Biol. 5:3251- 3260 (1985) can be used to introduce DNA into cells. A variety of nucleic acids have been introduced into different cell types using AAV vectors (see for example Hermonat et al., Proc. Natl. Acad. Sci. USA 81 :6466-6470 (1984); Tratschin et al., Mol. Cell. Biol. 4:2072-2081 (1985); Wondisford et al., Mol. Endocrinol. 2:32-39 (1988); Tratschin et al., J. Virol. 51 :611-619 (1984); and Flotte et al., J. Biol. Chem. 268:3781-3790 (1993). The identification of Staphylococcus aureus (SaCas9) and other smaller Cas9 enzymes that can be packaged into adeno-associated viral (AAV) vectors that are highly stable and effective, easily produced, approved by FDA, and tested in multiple clinical trials, paves new avenues for therapeutic gene editing. Of high relevance to GBM, better tissue distribution of AAV provides an additional advantage for invasive and recurrent tumors. UXS1 -targeting AAV vectors of various serotypes, including AAV1, AAV2, AAV8, AAV9, and AAVrh.10, can be used, all of which were previously tested in clinical trials. UXS1 targeting AAV plasmid [based on Addgene Plasmids #61592, #61594], a single vector expressing SaCas9, gRNA, and Ampicillin selection marker can be utilized. Since PAM consensus sequence is different between SpCas9 and SaCas9 (the late cleaves genomic targets most efficiently with NNGRRT or NNGRR (R= A or G), as also the length required for SaCas9 gRNAs (21-23nt), several targeting constructs have been designed.

[0121] Preferably, the CRISPR UXS1 editing complex is specific, i.e., induces genomic alterations preferentially at the target site (UXS1), and does not induce alterations at other sites, or only rarely induces alterations at other sites.

[0122] Pharmaceutical Compositions

[0123] The methods described herein can include the administration of pharmaceutical compositions and formulations comprising inhibitory nucleic acid sequences or CRISPR / Cas9 / gRNA complexes designed to target UXS1.

[0124] In some embodiments, the compositions are formulated with a pharmaceutically acceptable carrier. The pharmaceutical compositions and formulations can be administered parenterally, topically, orally or by local administration, such as by aerosol or transdermally. The pharmaceutical compositions can be formulated in any way and can be administered in a variety of unit dosage forms depending upon the condition or disease and the degree of illness, the general medical condition of each patient, the resulting preferred method of administration and the like. Details on techniques for formulation and administration of pharmaceuticals are well described in the scientific and patent literature, see, e g., Remington: The Science and Practice of Pharmacy, 21st ed., 2005.

[0125] The inhibitory nucleic acids can be administered alone or as a component of a pharmaceutical formulation (composition). The compounds may be formulated for administration, in any convenient way for use in human or veterinary medicine. Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions. Formulations of the compositions described herein include those suitable for intradermal, inhalation, oral / nasal, topical, parenteral, rectal, and / or intravaginal administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient (e.g., nucleic acid sequences of this invention) which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration, e.g., intradermal or inhalation. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect, e.g., an antigen specific T cell or humoral response.

[0126] Pharmaceutical formulations can be prepared according to any method known to the art for the manufacture of pharmaceuticals. Such drugs can contain sweetening agents, flavoring agents, coloring agents and preserving agents. A formulation can be admixtured with nontoxic pharmaceutically acceptable excipients which are suitable for manufacture. Formulations may comprise one or more diluents, emulsifiers, preservatives, buffers, excipients, etc. and may be provided in such forms as liquids, powders, emulsions, lyophilized powders, sprays, creams, lotions, controlled release formulations, tablets, pills, gels, on patches, in implants, etc.

[0127] Pharmaceutical formulations for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in appropriate and suitable dosages. Such carriers enable the pharmaceuticals to be formulated in unit dosage forms as tablets, pills, powder, dragees, capsules, liquids, lozenges, gels, syrups, slurries, suspensions, etc., suitable for ingestion by the patient. Pharmaceutical preparations for oral use can be formulated as a solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable additional compounds, if desired, to obtain tablets or dragee cores. Suitable solid excipients are carbohydrate or protein fillers include, e.g., sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxy-methylcellulose; and gums including arabic and tragacanth; and proteins, e.g., gelatin and collagen. Disintegrating or solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate. Push-fit capsules can contain active agents mixed with a filler or binders such as lactose or starches, lubricants such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active agents can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers.

[0128] Aqueous suspensions can contain an active agent (e.g., nucleic acid sequences as described herein) in admixture with excipients suitable for the manufacture of aqueous suspensions, e.g., for aqueous intradermal injections. Such excipients include a suspending agent, such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia, and dispersing or wetting agents such as a naturally occurring phosphatide (e.g., lecithin), a condensation product of an alkylene oxide with a fatty acid (e.g., polyoxyethylene stearate), a condensation product of ethylene oxide with a long chain aliphatic alcohol (e.g., heptadecaethylene oxycetanol), a condensation product of ethylene oxide with a partial ester derived from a fatty acid and a hexitol (e.g., polyoxyethylene sorbitol mono-oleate), or a condensation product of ethylene oxide with a partial ester derived from fatty acid and a hexitol anhydride (e.g., polyoxyethylene sorbitan mono-oleate). The aqueous suspension can also contain one or more preservatives such as ethyl or n-propyl p-hy dr oxy benzoate, one or more coloring agents, one or more flavoring agents and one or more sweetening agents, such as sucrose, aspartame or saccharin. Formulations can be adjusted for osmolarity.

[0129] In some embodiments, oil-based pharmaceuticals are used for administration of nucleic acid sequences. Oil-based suspensions can be formulated by suspending an active agent in a vegetable oil, such as arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin; or a mixture of these. See e.g., U.S. Patent No. 5,716,928 describing using essential oils or essential oil components for increasing bioavailability and reducing inter- and intra-individual variability of orally administered hydrophobic pharmaceutical compounds (see also U.S. Patent No. 5,858,401). The oil suspensions can contain a thickening agent, such as beeswax, hard paraffin or cetyl alcohol. Sweetening agents can be added to provide a palatable oral preparation, such as glycerol, sorbitol or sucrose. These formulations can be preserved by the addition of an antioxidant such as ascorbic acid. As an example of an injectable oil vehicle, see Minto (1997) J. Pharmacol. Exp. Ther. 281 :93-102.

[0130] Pharmaceutical formulations can also be in the form of oil-in-water emulsions. The oily phase can be a vegetable oil or a mineral oil, described above, or a mixture of these. Suitable emulsifying agents include naturally-occurring gums, such as gum acacia and gum tragacanth, naturally occurring phosphatides, such as soybean lecithin, esters or partial esters derived from fatty acids and hexitol anhydrides, such as sorbitan mono-oleate, and condensation products of these partial esters with ethylene oxide, such as polyoxyethylene sorbitan mono-oleate. The emulsion can also contain sweetening agents and flavoring agents, as in the formulation of syrups and elixirs. Such formulations can also contain a demulcent, a preservative, or a coloring agent. In alternative embodiments, these injectable oil-in-water emulsions comprise a paraffin oil, a sorbitan monooleate, an ethoxylated sorbitan monooleate and / or an ethoxylated sorbitan trioleate.

[0131] The pharmaceutical compounds can also be administered by in intranasal, intraocular and intravaginal routes including suppositories, insufflation, powders and aerosol formulations (for examples of steroid inhalants, see e.g., Rohatagi (1995) J. Clin. Pharmacol. 35:1187-1193; Tjwa (1995) Ann. Allergy Asthma Immunol. 75: 107-111). Suppositories formulations can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at body temperatures and will therefore melt in the body to release the drug. Such materials are cocoa butter and polyethylene glycols.

[0132] In some embodiments, the pharmaceutical compounds can be delivered transdermally, by a topical route, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.

[0133] In some embodiments, the pharmaceutical compounds can also be delivered as microspheres for slow release in the body. For example, microspheres can be administered via intradermal injection of drug which slowly release subcutaneously; see Rao (1995) J. Biomater Sci. Polym. Ed. 7:623-645; as biodegradable and injectable gel formulations, see, e.g., Gao (1995) Pharm. Res. 12:857-863 (1995); or, as microspheres for oral administration, see, e g., Eyles (1997) J. Pharm. Pharmacol. 49:669-674.

[0134] In some embodiments, the pharmaceutical compounds can be parenterally administered, such as by intravenous (IV) administration or administration into a body cavity or lumen of an organ. These formulations can comprise a solution of active agent dissolved in a pharmaceutically acceptable carrier. Acceptable vehicles and solvents that can be employed are water and Ringer's solution, an isotonic sodium chloride. In addition, sterile fixed oils can be employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can likewise be used in the preparation of injectables. These solutions are sterile and generally free of undesirable matter. These formulations may be sterilized by conventional, well known sterilization techniques. The formulations may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents, e.g., sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like. The concentration of active agent in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight, and the like, in accordance with the particular mode of administration selected and the patient's needs. For IV administration, the formulation can be a sterile injectable preparation, such as a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated using those suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation can also be a suspension in a nontoxic parenterally-acceptable diluent or solvent, such as a solution of 1,3-butanediol. The administration can be by bolus or continuous infusion (e.g., substantially uninterrupted introduction into a blood vessel for a specified period of time).

[0135] In some embodiments, the pharmaceutical compounds and formulations can be lyophilized. Stable lyophilized formulations comprising an inhibitory nucleic acid can be made by lyophilizing a solution comprising a pharmaceutical as described herein and a bulking agent, e.g., mannitol, trehalose, raffinose, and sucrose or mixtures thereof. A process for preparing a stable lyophilized formulation can include lyophilizing a solution about 2.5 mg / mL protein, about 15 mg / mL sucrose, about 19 mg / mL NaCl, and a sodium citrate buffer having a pH greater than 5.5 but less than 6.5. See, e.g., U.S. 20040028670.

[0136] The compositions and formulations can be delivered by the use of liposomes. By using liposomes, particularly where the liposome surface carries ligands specific for target cells, or are otherwise preferentially directed to a specific organ, one can focus the delivery of the active agent into target cells in vivo. See, e.g., U.S. Patent Nos. 6,063,400; 6,007,839; Al-Muhammed (1996) J. Microencapsul. 13:293-306; Chonn (1995) Curr. Opin. Biotechnol. 6:698-708; Ostro (1989) Am. J. Hosp. Pharm. 46: 1576-1587. As used in the present invention, the term "liposome" means a vesicle composed of amphiphilic lipids arranged in a bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes that are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.

[0137] Liposomes can also include "sterically stabilized" liposomes, i.e., liposomes comprising one or more specialized lipids. When incorporated into liposomes, these specialized lipids result in liposomes with enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Liposomes and their uses are further described in U.S. Pat. No. 6,287,860.

[0138] The formulations can be administered for prophylactic and / or therapeutic treatments. In some embodiments, for therapeutic applications, compositions are administered to a subject who is need of reduced triglyceride levels, or who is at risk of or has a disorder described herein, in an amount sufficient to cure, alleviate or partially arrest the clinical manifestations of the disorder or its complications; this can be called a therapeutically effective amount. For example, in some embodiments, pharmaceutical compositions as described herein are administered in an amount sufficient to decrease serum levels of triglycerides in the subject.

[0139] The amount of pharmaceutical composition adequate to accomplish this is a therapeutically effective dose. The dosage schedule and amounts effective for this use, i.e., the dosing regimen, will depend upon a variety of factors, including the stage of the disease or condition, the severity of the disease or condition, the general state of the patient's health, the patient’s physical status, age and the like. In calculating the dosage regimen for a patient, the mode of administration also is taken into consideration.

[0140] The dosage regimen also takes into consideration pharmacokinetics parameters well known in the art, i.e., the active agents’ rate of absorption, bioavailability, metabolism, clearance, and the like (see, e g., Hidalgo-Aragones (1996) J. Steroid Biochem. Mol. Biol. 58:611-617; Groning (1996) Pharmazie 51 :337-341; Fotherby (1996) Contraception 54:59-69; Johnson (1995) J. Pharm. Sci. 84: 1144-1146; Rohatagi (1995) Pharmazie 50:610-613; Brophy (1983) Eur. J. Clin. Pharmacol. 24: 103-108; Remington: The Science and Practice of Pharmacy, 21st ed., 2005). The state of the art allows the clinician to determine the dosage regimen for each individual patient, active agent and disease or condition treated. Guidelines provided for similar compositions used as pharmaceuticals can be used as guidance to determine the dosage regiment, i.e., dose schedule and dosage levels, administered practicing the methods as described herein are correct and appropriate.

[0141] Single or multiple administrations of formulations can be given depending on for example: the dosage and frequency as required and tolerated by the patient, the degree and amount of therapeutic effect generated after each administration (e.g., effect on tumor size or growth), and the like. The formulations should provide a sufficient quantity of active agent to effectively treat, prevent or ameliorate conditions, diseases or symptoms.

[0142] In alternative embodiments, pharmaceutical formulations for oral administration are in a daily amount of between about 1 to 100 or more mg per kilogram of body weight per day. Lower dosages can be used, in contrast to administration orally, into the blood stream, into a body cavity or into a lumen of an organ. Substantially higher dosages can be used in topical or oral administration or administering by powders, spray or inhalation. Actual methods for preparing parenterally or non-parenterally administrable formulations will be known or apparent to those skilled in the art and are described in more detail in such publications as Remington: The Science and Practice of Pharmacy, 21st ed., 2005.

[0143] Various studies have reported successful mammalian dosing using complementary nucleic acid sequences. For example, Esau C., et al., (2006) Cell Metabolism, 3(2):87-98 reported dosing of normal mice with intraperitoneal doses of miR-122 antisense oligonucleotide ranging from 12.5 to 75 mg / kg twice weekly for 4 weeks. The mice appeared healthy and normal at the end of treatment, with no loss of body weight or reduced food intake. Plasma transaminase levels were in the normal range (AST % 45, ALT % 35) for all doses with the exception of the 75 mg / kg dose of miR-122 ASO, which showed a very mild increase in ALT and AST levels. They concluded that 50mg / kg was an effective, non-toxic dose. Another study by Krtitzfeldt J., et al., (2005) Nature 438, 685-689, injected anatgomirs to silence miR-122 in mice using a total dose of 80, 160 or 240 mg per kg body weight. The highest dose resulted in a complete loss of miR-122 signal. In yet another study, locked nucleic acids (“LNAs”) were successfully applied in primates to silence miR-122. Elmen J., et al., (2008) Nature 452, 896-899, report that efficient silencing of miR-122 was achieved in primates by three doses of 10 mg kg-1 LNA-antimiR, leading to a long-lasting and reversible decrease in total plasma cholesterol without any evidence for LNA- associated toxicities or histopathological changes in the study animals.

[0144] Combination Therapies

[0145] In some embodiments, the methods described herein can include co-administration with other drugs or pharmaceuticals. For example, the inhibitory nucleic acids can be co-administered with drugs for treating or reducing risk of a disorder described herein.

[0146] In some embodiments, the methods further include administering an anti-cancer treatment. In some embodiments, the anti-cancer treatment comprises a chemotherapeutic agent.

[0147] As used herein, the term “therapeutic agent” and “chemotherapeutic agent” can refer to one or more pro-apoptotic, cytostatic and / or cytotoxic agents, for example specifically including agents utilized and / or recommended for use in treating one or more diseases, disorders or conditions associated with undesirable cell proliferation. In many embodiments, chemotherapeutic agents are useful in the treatment of cancer. In some embodiments, a chemotherapeutic agent may be or comprise one or more alkylating agents, one or more anthracyclines, one or more cytoskeletal disruptors (e.g. microtubule targeting agents such as taxanes, maytansine and analogs thereof, of), one or more epothilones, one or more histone deacetylase inhibitors HDACs), one or more topoisomerase inhibitors (e.g., inhibitors of topoisomerase I and / or topoisomerase II), one or more kinase inhibitors, one or more nucleotide analogs or nucleotide precursor analogs, one or more peptide antibiotics, one or more platinumbased agents, one or more retinoids, one or more vinca alkaloids, and / or one or more analogs of one or more of the following (i.e., that share a relevant anti-proliferative activity). In some embodiments, a chemotherapeutic agent may be utilized in the context of an antibody-drug conjugate.

[0148] In some embodiments, the chemotherapeutic agent comprises vincristine, prednisone, dexamethasone, busulfan, cisplatin, carboplatin, paclitaxel, docetaxel, nab-paclitaxel, altretamine, capecitabine, cyclophosphamide, etoposide (vp-16), gemcitabine, ifosfamide, irinotecan (cpt-11), liposomal doxorubicin, melphalan, pemetrexed, topotecan, vinorelbine, goserelin, leuprolide, tamoxifen, letrozole, anastrozole, exemestane, bevacizumab, olaparib, rucaparib, niraparib, nivolumab, pembrolizumab, durvalumab, atezolizumab, radioisotopes, monomethyl auristatin E (MMAE; e.g., vedotin), calicheamicins, deruxtecan, DM1, and any combinations thereof.

[0149] EXAMPLES

[0150] The disclosure is further described in the following examples, which do not limit the scope of the disclosure described in the claims.

[0151] Cell lines and cell culture

[0152] All cell lines were cultured at 37°C under 5% CO2 and 20% O2. Most cancer lines used were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Gibco #11995073) supplemented with 10% fetal bovine serum (Sigma #F2442), 100 units / ml Penicillin-Streptomycin (Gibco #15140122), and 2mM L-glutamine (Gibco #25030081).

[0153] Datamining analysis

[0154] A list of genes encoding metabolic enzymes and transporters (which are referred to as MetGene) was curated from the Kyoto Encyclopedia of Genes and Genomes (KEGG). First, it was identified which of the genes in MetGenes have differential essentiality, i.e., their CRISPR / Cas9 KO of that gene is lethal to some of the cancer cell lines but not to others. These genes were identified by mining a pan-cancer dependency dataset8(Post-Chronos_ Combined Achilles and Sanger SCORE Chronos data using Harmonia) from Broad Institute. The standard deviation (formula: A / {S(x-x)2 / (n-l); where x: mean of essentiality of a gene across cell lines, n: the number of total cell lines) of the essentiality of each MetGene across the different cell lines from all solid cancer cell lines (572) from 25 different lineages were determined, high standard deviation values indicating high differential essentiality.

[0155] For each MetGene hit, it was next set to identify genes whose mRNA expression level (transcript per million) predicts how essential the MetGene was in a given cell line. To this end, Pearson Correlation values were determinedfor all genes (17386) with a given MetGene across all 572 cells, cross-referencing gene essentiality values with RNAseq values from the CCLE8RNA sequence dataset. FIG. 1C shows the Pearson correlation between the dependency of UXS1 and the expression of all the genes in solid cancer lines. CRJSPR / Cas9-mediated genome editing

[0156] Guide RNA sequences were obtained from a published guide sequence library62and cloned into the lentiCRISPR v2 (pLCv2) construct63(Table 2). Lentivirus was produced in HEK293T cells by co-transfecting plasmid pLentiCRISPR v2 containing guide sequence of interest with the Delta-Vpr packaging plasmids and VSV-G envelope plasmid using X-tremeGENE 9 transfection reagent (Roche). Lentivirus containing media was harvested 48 hours after transfection, and virus titer was determined. Target cells were infected with lentivirus in the presence of 10 ug / ml polybrene with a multiplicity of infection (MOI) less than 1 to avoid the non-specific toxicity of Cas9. Infected cells were selected with media containing puromycin (1-2 ug / ml) for 4-5 days to ensure a full selection of cells.

[0157] Table 2. Guide sequences and DNA constructs Cell viability assay

[0158] Cell viability was measured using CellTiter-Glo 2.0 (Promega) reagent according to manufacturer instructions for 96 well plates. The plates were read using the Synergy HT MultiDetection Microplate Reader.

[0159] Relative viability measurements post CRISPR-Cas9 mediated gene KO

[0160] Cells were plated to 6-well plate and infected with lentiviruses containing CTRL (non-targeting guide) or guides containing the gene of interest. Infected cells were selected with media containing puromycin (1-2 ug / ml) for 4 days. At 5 days post infection, fully selected cells were counted and plated to 96-well plates (each condition with 3-6 technical replicates). CTRL and KO cells (typically 500-1000 cells / well; depending on the growth rate of cell-line) were plated at equal seeding density to 96-well plates with media containing puromycin (0.5-1 ug / ml; to ensure selection pressure) for comparable baseline CTG values across conditions. To determine relative viability, CTG measurements were taken at two-time points. The baseline (first) time point was measured the day after cells were plated in 96 well plates, and the second time point was typically taken five days after baseline measurement. The fold changes in viable cells were calculated for each condition (day 5 CTG / baseline CTG). These fold changes were then normalized to that of the same cells with non-targeting control guide (CTRL) to obtain relative viability following KO of the gene of interest (UXS1).

[0161] For double knock-out (DKO) experiments, cells were plated to 6-well plates and infected with lentiviruses containing pLCv2 CTRL or guides targeting either UGDH / SLC35D1 and selected with puromycin (1-2 ug / ml). Upon complete selection (5-6 days) the cells were infected with pMD154 lentivirus containing CTRL guides or guides targeting UXS1 to induce UXS1 KO. Cells were selected with hygromycin (500 ug / ml) for 5 days and double KO cells were plated to 96-well plates with media containing hygromycin (typically 500-1000 cells / well; depending on the growth rate of cell-line) in 6 technical replicates. To determine relative viability, CTG measurements were taken at two-time points. The baseline (first) time point was measured the day after cells were plated in 96 well plates, and the second time point was typically taken five days after baseline measurement. The fold changes in viable cells were calculated for each condition (day 5 CTG / baseline CTG). These fold changes were then normalized to that of the same cells with non-targeting control guide (CTRL). CRJSPR resistant UXS1 molecular cloning and rescue experiment

[0162] A CRISPR-resistant version of UXSl-gl (CR UXS1) was designed by introducing three silent mutations: 1 mutation in the Protospacer Adjacent Motif (PAM) sequence and two mutations in the seed sequence (GCTCCTGGCCTCCACGTCTGAAG (SEQ ID NO: 15)). It was synthesized by GenScript with the addition of Notl and HP Al restriction sites. CR UXS1 was digested with Notl and HP Al and ligated into the expression vector pLV-EFla-IRES-Blast. Lentiviruses were produced as described above, containing blank pLV vector or pLV-CR UXS1.

[0163] To confirm whether preventing targeting of UXS1 with UXSl-gl rescues the toxic effect of UXS1 gl, the effect of UXS1 KO was assessed in cells expressing pLV-Blank or pLV-CR UXS1. First, cells were transduced with lentivirus containing pLV-Blank or pLV-CR UXS1 and cells with blasticidin were selected for six days. At seven days post first infection, pLV-Blank and pLV-CR UXS1 cells were infected with lentivirus containing pLCV2 CTRL (or UXSl-gl or UXSl-g2) and cells selected with puromycin for five days. 6 days post-second infection, cells were counted and plated to 96 well plates at identical cell density (500 cells / well). Baseline seeding density was measured by performing a CTG measurement at day seven post-second infection. Subsequently, viability was measured 12 days post the second infection to determine relative cell growth over five days.

[0164] Cell cycle analysis

[0165] Cells were grown to sub-confluency. Cells were tiypsinized, fixed in pre-chilled 70% ethanol in PBS, and stored at -20°C overnight. The following day cells were centrifuged and incubated with 50ug / ml of propidium iodide with 0.1 mg / ml RNAse A in PBS containing 0.05% TritonX-100 for 45 minutes. Cells were then centrifuged and resuspended in PBS and were analyzed on a Biorad ZE5 cell analyzer where at least 10,000 events were assessed. These were analyzed for cell cycle distribution using a univariate model (Watson pragmatic) in FlowJo (vl0.8.1).

[0166] Immunoblots

[0167] Cell lysates were harvested using RIPA buffer (Boston Bioproducts) with protease inhibitors (cOmplete, Roche) and phosphatase inhibitors (Cell signaling technology). Harvested proteins were denatured in 6x Laemmli buffer (Boston Bioproducts) and boiled at 90°C for 5 minutes. Samples were loaded at equal concentrations and analyzed by standard SDS-PAGE western blotting techniques. Protein levels were detected using HRP-conjugated secondary antibodies and chemiluminescent substrates (Pierce ECL or Pico PLUS). It was found that not boiling the samples before gel electrophoresis was necessary to detect UXS1 protein.

[0168] Cell death rescue experiments

[0169] Cells were infected with lentiviruses containing CTRL (non-targeting guide) or UXSl-gl in 6 well format. Infected cells were selected with puromycin (2pg / ml) for three days. Four days post-infection, the selected cells were plated to two separate 96 well plates in 3 technical replicate wells at seeding density -500 cells / well. Alternately, UXS1 iKO cells were induced with doxycycline treatment for 48 hours and 5 days after induction, cells were plated to two separate 96 well plates in 3 technical replicate wells at seeding density -500 cells / well. Baseline CTG measurements were taken at 24 hours after seeding from one set of 96 well plates. Cells in other plates were either untreated or treated with Z-VAD-FMK or Necrostatin orFerrostatin-1 at indicated concentrations. Cell viability was then measured five days after drug treatment (day 9 post-infection / induction). Relative viability was then determined by calculating fold change in viability (day9 / baseline CTG) for UXSl-gl and CTRL.

[0170] Sulfated Glycosaminoglycan (sGAG) and Hyaluronic acid (HA) quantification

[0171] A549 cells were infected with lentiviruses (pLentiCRISPR V2-based) containing CTRL (nontargeting guide) or UGDH-gl and selected using puromycin (2pg / ml). 6 days after selection these cells were infected with lentiviruses (pMD154 based) which express only the guides (CTRL, UXSl-gl, or UXSl-g2) two induce double knock-out (as mentioned in methods above). These cells were selected with Hygromycin (500pg / ml) for 5 days. On day 6 0.5X106cells were plated in 6 well plate for each condition in media without phenol red. Conditioned media (CM) were collected 48 hours after seeding the cells and cells plated in technical replicate plates were counted for each condition for normalization. CM samples were centrifuged at lOOOxg to remove any cell debris.

[0172] For HA quantification, Supernatants were used for quantification using a Competitive-ELISA detection method (Biomatik, catalog# EKF57990) in which HAs in the sample competes for sites on the biotinylated detection antibody, along with the use of a standard to verify the results. Manufacturer protocols were followed.

[0173] For sGAG quantification, Cells were digested with papain using tissue digestion kit (AMSbio; catalog# 280560-TDK) to remove protein portion of the proteoglycans per manufacturer protocol. The digested samples were assayed for sGAGs using sulfated Glycosaminoglycan quantification kit (AMSbio; catalog# 280560-N), that uses 1, 9-dimethylmethylene blue (DMMB) dye that binds to sulfated glycosaminoglycans and the shift in absorption spectrum due to this binding can be measured at 520nm. Manufacturer protocol was followed. Chondroitin Sulfate (Bovine Trachea) was used as a standard.

[0174] Metabolomics: UDPGA quantification by LC-MS / MS

[0175] A549 cells were infected with lentiviruses containing either CTRL or UGDH-gl or UXS1 glin biological triplicates. Cells were selected with Puromycin for five days. Cells at indicated timepoints were washed thrice with ice-cold PBS and extracted on dry ice on 1ml 80% methanol containing 500nM internal standards (Metabolomics Amino Acid Mix Standard; Cambridge Isotope Laboratories). Cell extracts were collected using a cell scraper and transferred to a microcentrifuge tube. Samples were vortexed for 15 minutes at 4°C and centrifuged at 18000 x g for 10 minutes at 4°C. Supernatants were transferred to a new microcentrifuge tube and stored at -80°C until analysis. These samples were then dry evaporated using vacuum centrifugation. Polar metabolite profiling was performed on dried polar extracts at the Whitehead metabolite profiling core facility. It was performed on a QExactive orbitrap mass spectrometer equipped with an ion Max source and a HESI II probe coupled with a Dionex Ultimate 3000 HPLC system containing SeQuant® ZIC®- pHILIC analytical column. Relative quantitation of polar metabolites, including UDPGA, was performed with XCalibur QuanBrowser 2.2 and TraceFinder 4.1 (both Thermo Fischer Scientific) using a 5ppm mass tolerance and referencing an in-house library of chemical standards.

[0176] Transcriptomic analysis

[0177] A549 cells were infected in 6 well plates in biological triplicate (n=3) with lentivirus containing pLCV2 CTRL or UXSl-gl. Cells were selected for five days, and cell pellets were harvested seven days post-infection (timepoint was chosen such that UXS1 KO cells do not start undergoing a significant level of cell death). Total RNA was isolated using the Qiagen RNAeasy kit per manufacturer extraction protocol. BGI Americas Corporation performed sample quality control, cDNA library preparation, and sequencing. The pair end sequencing was performed on the DNBseq platform (BGI Americas Corporation) with ~20 million reads per sample. The reads were aligned and mapped to the human genome and were normalized to the transcripts per million (TPM) for each sample.

[0178] The differentially expressed transcripts obtained through RNA-seq between control and UXS1 KO conditions were compared to curated gene sets from online pathway databases, publications in PubMed, and knowledge of domain experts using the GSEA tool. The results from GSEA are evaluated based on the Normalized enrichment score (NES). Since GSEA accounts for differences in gene set size and in correlations between gene sets and the expression dataset, the NES can be used to compare analysis results across gene sets.

[0179] Generation of doxycycline Inducible UXS1 KO system

[0180] To generate a doxycycline-inducible CRISPR / Cas9 mediated UXS1 knockout system, UXSl-g2 was cloned into TLCv2 plasmid60to prepare an all-in-one inducible system. U6 promoter in this plasmid drives constitutive expression of UXSl-g2, and the addition of doxycycline induces Cas9-2A-eGFP. A549 cells were infected with lentiviruses containing the plasmid mentioned above, and the cells were selected with Puromycin (2 ug / ml) for five days. The selected cells were then diluted to 0.3 cells per 150pl for single-cell sorting and plated in 96 well plates (150pl / well). Total twelve clones were screened for eGFP expression and loss of UXS1 by immunoblotting, and TLCv2 “Clone 6” (referred to as UXS1 iKO) displayed homogeneous eGFP expression along with UXS1 loss upon doxycycline induction and was hence selected for future experiments. Similarly, H460 and HT1080 cells were infected with the lentiviruses containing the plasmid mentioned above, and single cell clones were isolated that displayed homogeneous eGFP expression along with UXS1 loss upon doxycycline induction. These are referred as ‘H460 UXS1 iKO’ and ‘HT1080 UXS1 iKO’ respectively.

[0181] Doxycycline treatment

[0182] Doxycycline was prepared as a lOOmg / ml stock solution, and aliquots were stored at -80°C. Cells were treated with lOOng / ml doxycycline in DMEM with 10% FBS (regular growth media) for 48 hours. Cells were changed into fresh media after 48 hours of doxycycline induction.

[0183] [U-I3C]-glucose labeling experiments

[0184] A549 cells were transduced with lentivirus containing pLCv2 UGDH-gl. Cells were completely selected with Puromycin for 5 days, were changed into fresh media and seeded for the experiment in 10cm dishes at 70% confluency. UXS1 iKO and control iKO cells were induced with doxycycline (lOOng / ml) in separate 10cm dishes. Cells were changed into fresh media after 48 hours. 5 days post induction, cells were seeded for the experiment in 10cm dishes at 70% confluency. For13C labeling, [U-13C] Glucose (CLM-1396, Cambridge Isotope Laboratories; 4.5g / L) was added in glucose-free DMEM (C# 11966025) supplemented with 10% FBS, 1% P / S, ImM Pyruvate. 24 hours post seeding, cells were changed into media with [U-13C] Glucose and the metabolites were isolated from the cells at indicated timepoints.

[0185] To isolate metabolites, medium was removed, cells were washed 2 times with ice cold IX PBS, and plates were covered in a total of 3ml of LC-MS grade 80:20 methanol: Water. Plates were scraped on dry ice and lysates were collected into 15ml conical tubes. Lysates were vortexed for 10 minutes at 4°C and centrifuged at 16,000 x g for 10 minutes at 4°C. Supernatants were dried down in a benchtop Vacuum Concentrator. Dried pellets were stored at -80°C until they were run on LC-MS.

[0186] A QExactive Plus quadrupole orbitrap mass spectrometer (Thermo Fisher Scientific) equipped with an Ion Max source and a HESI II probe coupled to a Vanquish Horizon UHPLC System (Thermo Fisher Scientific) was used to perform LC-MS experiments. Prior to operation, the instrument underwent mass calibration for positive and negative ion mode using Calmix (Thermo Fisher Scientific) every 7 days. Dried samples were re-suspended in 200 uL of HPLC water and 2 uL of re-suspended polar metabolite samples were injected into a SeQuant ZIC- pHILIC 5pm 150 x 2.1 mm analytical column equipped with a 2.1 x 20 mm guard column (Millipore Sigma). The column oven was held at 25°C and the autosampler tray was held at 4°C. Buffer A was comprised of 20 mM ammonium carbonate, 0.1% ammonium hydroxide. Buffer B was comprised of 100% acetonitrile. The chromatographic gradient was run at a flow rate of 0.150 mL / min as follows: 0-20 min: linear gradient from 80-20% B; 20-20.5 min: linear gradient from 20-80% B; 20.5- 28 min: hold at 80% B. The mass spectrometer was operated in full-scan, polarity switching mode, and targeted selected ion monitoring (tSIM), negative mode, for UDP- xylose (m / z: 535.0371) and 13C5-UDP -xylose (m / z: 540.0539). The spray voltage set to 4.0 kV, the heated capillary at 350°C, and the HESI probe at 35O°C. The sheath gas flow was 10 units, the auxiliary gas flow was 2 units, and the sweep gas flow was 1 unit. MS data was collected in a range of m / z = 55-825. The resolution was set at 70,000, the AGC target at 1x106, and the maximum injection time at 20 msec. The rate of production of UDPGA and UDP-xylose (FIGs. 2C, 2E, and 2K) is quantified on the basis of respective standard curves and depicted in picomoles per million cells.

[0187] Immunocytochemistry

[0188] Cells were plated on poly-D-lysine (PDL) coated coverslips kept in 12-well tissue culture plates. On day seven post lentiviral infection, the coverslips were rinsed once with PBS and fixed with 4% paraformaldehyde in PBS for 15 minutes at room temperature. The coverslips were then rinsed three times with PBS, and the cells were permeabilized with 0.2% TritonX-100 v / v in PBS for 15 mins at room temperature. Coverslips were washed three times and blocked in 4% horse serum for 1 hour at room temperature. The coverslips were incubated in the primary antibody at 4°C overnight, rinsed three times with PBS, and then incubated with secondary antibody for 45 minutes at room temperature in the dark along with Phalloidin-iFluor488 (Abeam). Coverslips were then washed three times with PBS and mounted on the slides using ProLong Gold Antifade mountant containing DAPI. Images were acquired on the Nikon Eclipse Ti2 confocal microscope. Raw images were opened in ImageJ and processed similarly for all experimental conditions. Golgi area measurement was carried out using ImageJ (1.53q). Identical thresholding was performed on the golgi-stained images. Stained Golgi pixel area per cell was calculated using ‘measure’ function in imageJ.

[0189] Transmission Electron Microscopy (TEM)

[0190] Cell cultures of A549 control and UXS1 KO (day7 post infection) in plates were processed and analyzed at the University of Massachusetts Medical School Electron Microscopy core facility according to standard procedures. Samples were fixed by adding equal volume 2.5% glutaraldehyde / 1.6% paraformaldehyde in 0.1 M Sodium Cacodylate buffer pH 7. to the culture plates after half the media was removed. The cell cultures were allowed to stabilize in this solution for 10 min, then all the media / glutaraldehyde was removed and fresh 2.5% glutaraldehyde / 1.6% paraformaldehyde in the same buffer was added and the cells were allowed to fix for 60 min. at room temperature. After this primary fixation, the cells were rinsed three times in fresh fixation buffer for 10 min. each time and were secondarily fix with 1.0% osmium tetroxide in ddH2O for Ihr at room temperature. The cell cultures were then washed again three times in ddH2O and then scraped into pellets. The cells were dehydrated through a graded series of ethanol (10% to 100%; 3 changes). Samples were then infiltrated first with two changes of 100% Propylene Oxide and then with a 50% / 50% propylene oxide / SPI-Pon 812 resin mixture. The following day five changes of fresh 100% SPI-Pon 812 resin were performed before the samples were polymerized at 68°C in embedding molds. The samples were then trimmed for TEM. 70nm thin sections were placed on gold support grids and contrasted with Lead citrate and Uranyl acetate. Sections were examined using the CM 10 with 80Kv accelerating voltage and images were captured using a Gatan TEM CCD camera.

[0191] Subcellular Fractionation

[0192] Cells cultured in 10 cm plates were harvested at 80% confluency. Cells were trypsinized and washed with ice cold PBS twice. 2x106 cells were resuspended in 400pl of ice cold digitonin buffer (150mM NaCl, 50mM HEPES pH 7.4, 50pg / ml digitonin (Sigma)) containing protease inhibitors at room temperature for 10 mins. This has been shown to disrupt plasma membrane via cholesterol interaction, while preserving organellar membrane integrity, allowing organellar metabolite measurements64,65. The cells were then centrifuged at 2000xg to pellet the cells. The supernatant was collected as the ‘cytosolic’ fraction. 400pl of RIP A buffer containing protease inhibitors were added to the cell pellet and was incubated at 4°C for 10 mins to disrupt organellar membranes. This was then subjected to centrifugation at 7000xg for 10 mins and the supernatant was collected as the ‘organellar’ fraction. 200pl of each of the ‘cytosolic’ and ‘organellar’ fraction was saved for running immunoblots and 800pl of methanol (Millipore Sigma) was added to the rest of 200pl fractions to extract the metabolites. Metabolite samples were stored at -80°C until analysis.

[0193] Quantification of UDPGA using GC-MS

[0194] 600 pl of cell extracts were dried in a vacuum evaporator (Thermo SPD11 IV). Dry residues were derivatized using 50 pl of N-methyl-N-(trimethylsilyl) trifluoroacetamide (MilliporeSigma) and 20 pl of pyridine (MilliporeSigma) for 3 hours at 37°C and allowed to complete at room temperature for another 5 hours. Split mode with 1 :5 ratio was used to inject 1 pl of the sample into the Agilent 5977B gas-chromatograph interfaced with an Agilent 7890B mass selective detector. The capillary column was Agilent HP-5MS UI (30 m x 0.25 mm internal diameter x 0.25 pm film thickness). Helium was supplied as a carrier gas at a constant flow of 1 ml / min. The oven temperature conditions were as follows: started at 80 °C, held for 1 min, increased at 7 °C / min to 285 °C. The inlet, ion source and transfer line were heated to 230, 280 and 250 °C, respectively. The mass detector performed 3 scans per second in the range from 30 to 500 m / z, electron impact ionization energy 70 eV. UDPGA was detected as three fragments matching the spectra and retention time of the reference compound. Corresponding peaks eluted at 17, 24.5 and 25.8 minutes and were quantified using ions m / z 217, 217 and 299, respectively. The most abundant among the three correlated ions / fragments (m / z 299 at minutes 25.8) was used for quantification. Peak integration and quantification of peak areas were done using MassHunter software (Agilent v.10.1).

[0195] N-glycan and O-glycan profiling and composition analysis

[0196] For glycan profiling and composition analyses, protein extracts (120 pg) were lyophilized, reduced in a 25 mM dithiothreitol solution (Sigma-Aldrich, St. Louis, MO) at 50 °C for 90 min, and then alkylated with a 65 mM iodoacetamide solution for 90 min at room temperature in the dark. Samples were dialyzed against 50 mM ammonium bicarbonate for 24 hours at 4°C, lyophilized, and incubated with 1 mL of 50 pg / mL TPCK -treated trypsin (Sigma-Aldrich) at 37°C overnight. The digested peptides were then purified using a Sep-Pak C18 (200-mg) cartridge (Waters Corp., Milford, MA), lyophilized, and incubated with 2 pL (500 units / pL) of PNGase-F (New England Biolabs, Ipswich, MA) in 200 pL of 50 mM ammonium bicarbonate at 37°C for 4 hours. The mixture was further incubated with 3 pL of PNGase-F at 37°C overnight. O-glycans were released from O-glycopeptides by reductive P-elimination, 1 M NaOH with 50 mM NaBFk held at 50°C for 18 hours. The released N-glycans and O-glycans were purified over a Sep-Pak Cl 8 (200-mg) cartridge. The flow-through and wash fraction containing the released glycans were collected, pooled, and lyophilized.

[0197] Purified glycans were then permethylated by incubation with 1 mL of a NaOH: dimethyl sulfoxide slurry solution and 500 pL of methyl iodide (Sigma-Aldrich) for 30 min with vigorous shaking. One mL of chloroform and 3 mL of Milli-Q water were then added, and the mixture was briefly vortexed to wash the chloroform fraction. The wash step was repeated three times. The chloroform fraction was dried, dissolved in 200 mL of 50% methanol, and loaded into a Sep-Pak C18 (200-mg) cartridge. The eluted fraction was lyophilized and dissolved in 10 pL of 75% methanol from which 1 pL was mixed with 1 pL 2,5-dihydroxybenzoic acid (Sigma- Aldrich; 5 mg / mL in 50% acetonitrile with 0.1% trifluoroacetic acid) and spotted on a matrix- assisted laser desorption / ionization polished steel target plate (Bruker Daltonics, Bremen, Germany). Mass spectrometry data were acquired on an UltraFl extreme matrix-assisted laser desorption / ionization-time-of-flight mass spectrometer (Bruker Daltonics). Reflective, positive mode was used, and data was recorded between m / z 500 and 6000. The mass spectrometry glycan profiles were acquired by aggregating at least 10,000 laser shots. Mass peaks were manually annotated and assigned to a particular N and O-glycan composition when a match was found.

[0198] EGF stimulation of UXS1 iKO cells

[0199] UXS1 iKO and control iKO cells were induced with doxycycline (lOOng / ml) in separate wells of 6 well plates. Cells were changed into fresh media after 48 hours. 6 days post induction, cells were serum starved overnight using DMEM media without serum. The next day cells were stimulated with lOOng / ml of EGF, and protein lysates were harvested 5min, lOmin, 1 min, and 30min after EGF stimulation. As a negative control, UXS1 and control iKO cells were also pretreated with 5pM Erlotinib for 30 mins and harvested 5 mins after EGF stimulation. Harvested proteins were denatured in 6x Laemmli buffer (Boston Bioproducts) and boiled at 90°C for 5 minutes. Samples were loaded at equal concentrations and analyzed by standard SDS-PAGE western blotting techniques as described before in this section.

[0200] EGFR surface quantitation

[0201] The evaluation of EGFR surface expression on UXS1 iKO cells was performed by flow cytometry. Cells were washed with ice cold FACS buffer (10% FBS, 0.1% NaN3 in PBS). IxlO6cells were incubated with 10 pl of Human EGFR Fluorescein-conjugated Antibody (R&D systems) in dark for 30 minutes at room temperature. Cells were then centrifuged (300xg) and washed three times with ice-cold FACS buffer to remove any unbound antibody. Cells were resuspended in 400ul of FACS buffer and immediately analyzed on a Biorad ZE5 cell analyzer where at least 10,000 events were assessed and plotted using FlowJo (vl0.8.1).

[0202] Inducible UXS1 KO Xenograft models

[0203] The research project has been reviewed by the institutional Animal Care and Use Committee (IACUC) at the University of Massachusetts Medical School and complied with all ethical regulations. To establish inducible UXS1 KO xenograft models, 2.5 X 106A549 UXS1 iKO or H460 UXS1 iKO or HT1080 UXS1 iKO cells were injected subcutaneously into the right flank of female athymic nude mice in a total of lOOul of PBS at six weeks of age. In each of the three experiments, tumors were allowed to grow until the mean tumor volume of each group was 200- 250mm3(A549: 14 days, H460: 11 days, HT1080: 7 days), upon which point mice were divided into two groups in a manner that each group had comparable average tumor volumes, and dox induction started in one of the groups via doxycycline chow (TD.01306) to induce Cas9 expression for UXS1 KO. There were 12 animals for every condition except one animal was excluded from the study due to no visible tumor in A549 xenograft experiment.

[0204] The A549 xenograft experiment had total four arms. 1. Control 2. Cisplatin 3. UXS1 KO 4. UXS1 KO+ Cisplatin. The UXS1 KO arms (3 and 4) were put on Doxycycline containing diet as described and the first two arms were continued on regular control diet (Prolab® 5P76) upon randomization. The cisplatin arms (2 and 4) were administered 4 mg / kg cisplatin via intravenous (i.v.) tail vein injections once a week for a total of three weeks. H460 and HT1080 xenograft experiments had two arms each. Similarly, UXS1 KO arm were put on Doxycycline containing diet (TD.01306) and the control arm were continued on regular control diet (Prolab® 5P76). Tumors were measured every 2-3 days using a vernier caliper and the tumor volume was calculated using the formula 4 / 3TI X (length x width x depth) / 2. Mice were monitored regularly for appearance and body weight throughout the experiment. The endpoint for survival data calculation was set to the tumor size of 2000mm3. Upon reaching the endpoint, animals were euthanized, and the tumors were isolated, and snap-frozen for further analysis.

[0205] Processing of human breast and lung tissues for UGDH protein quantification

[0206] All human breast and lung normal and cancer tissues were obtained from de-identified patients with informed consent from the University of Massachusetts Medical School Biorepository and Tissue bank using procedures conducted under an Institutional Review Board (IRB) approved protocol. All tissue samples were snap-frozen in liquid nitrogen immediately after surgical removal and stored at -80°C. The frozen tissues were homogenized in RIPA buffer (Boston Bioproducts) containing protease inhibitors (cOmplete, Roche) and phosphatase inhibitors (Cell signaling technology). Supernatants containing proteins were collected after centrifugation at 13000 x g at 4°C for 10 minutes. Protein samples were normalized using the Pierce BCA assay kit (Thermofisher Scientific). Samples were analyzed by standard SDS-PAGE western blotting techniques. Protein levels were detected using HRP-conjugated secondary antibodies and chemiluminescent substrates (Pierce ECL or Pico PLUS). Induction of chemo-resistance in H2170 andMDAMB23l cells

[0207] Resistant versions of the H2170 and MDAMB231 cell lines were derived from parental cells by continuous exposure to increasing concentrations of the chemo-drugs. H2170 cells were exposed to (Gemcitabine, starting dose: 4nM end dose: 12pM; SN38, start dose: 5nM end dose: lOnM; Paclitaxel, starting dose: 0.004nM end dose: 0.012nM; Mitomycin C, starting dose: 30nM end dose: 60nM; Cisplatin starting dose: 360nM end dose 600nM) and MDAMB231 cells were exposed to (Cisplatin, starting dose: 1.5pM end dose: 3pM ;Paclitaxel, starting dose: O. lnM end dose: 0.4nM). Dose-response studies of chemotherapeutics were carried out over 72 hours to assess IC50 values. H2170 and MDAMB231 cells were grown in chemo-drugs for 2 and 3 months respectively. IC50 concentrations were reassessed in each cell line. CRISPR / Cas9 KO experiments using these lines were performed in the absence of chemotherapeutics.

[0208] Patient derived Organoids

[0209] Deidentified tumor tissues of freshly resected biopsies from patients with TNBC were obtained from UMass Cancer Center Tumor Bank. These tumors were digested using gentleMACS Dissociator and tumor dissociation kit (Miltenyi Biotech). The digested tumors were washed using lx phosphate-buffered saline, and partially digested tumor pieces were embedded into reduced growth factor basement membrane extract (BME) (R&D systems). For passaging, the organoids were dissociated using TrypLE™ Express Enzyme (Gibco) and cultured in organoid media. The organoid media is described here66. The drug-resistant organoids were derived from parental organoids by culturing them in cisplatin (starting dose lOnM, final dose luM) for 4 weeks.

[0210] Lentiviral infection in Organoids

[0211] The organoids were dissociated from the plate by adding TrypLE™ Express and disrupting the BME droplets with P1000 pipette. They were incubated in TrypLE™ Express at 37°C for 15 mins. After dissociation cells were centrifuged at 350xg at room temperature for 5 mins and resuspended in 1ml of organoid media. After counting, equal numbers of cells were distributed in separate eppendorf tubes and centrifuged at 300xg to collect cell pellets. 250ul of pre-titered lentiviral supernatants were added to each condition to ensure equal transduced units / ml along with 1 pl of polybrene (2.5pg / ml). These cell / lentivirus mixes were transferred to separate wells of ultra-low attachment 48 well plates (Sciencell). The cells were spin-infected by centrifuging at 600xg at room temperature for 60 mins. The cells were then incubated for 6 hours in cell culture incubator at 37°C. They were transferred to eppendorf tubes and centrifuged (350xg) at room temperature for 5 mins. Supernatants were discarded and the cells were re-suspended in BME (R&D systems). Infected organoid cells were then seeded in BME droplets in 48 well plates. Infected cells were selected with Puromycin (0.5pg / ml) 24 hours after seeding into BME droplets. Cell viability was measured seven days post infection using CellTiter-Glo® 3D (Promega) reagent according to manufacturer instructions.

[0212] RNA interference mediated knock-down (KD) of UXS1

[0213] TRC lentiviruses were obtained for UXS1 shRNAs from Umass Chan Medical school RNAi core. A549 cells were transduced in 6-well plates with the TRC lentiviruses for either shGFP, shEmpty_vector or shUXSl in the presence of 10 ug / ml polybrene with a multiplicity of infection (MOI) less than 1. Infected cells were selected with media containing puromycin (2 ug / ml) for 4 days. Upon complete selection, the cells were plated to 96-well plates. To determine relative viability, CTG measurements were taken at two time points. The baseline (first) time point was measured the day after cells were plated in 96 well plates, and the second time point was taken five days after baseline measurement. The fold changes in viable cells were calculated for each condition (day 5 CTG / baseline CTG). These fold changes were then normalized to that of the same cells with shGFP to obtain relative viability following KD of our gene of interest (UXS1).

[0214] Data preparation and Statistics

[0215] All experiments showing relative viability; each condition was measured in at least three technical replicates within each experiment. Unless otherwise indicated, each experiment was repeated at least three times (represented by individual points in graphs). LC-MS UDPGA quantitation, transcriptomic analysis, FACS analysis were performed in biological triplicates. Data are presented as mean ± standard deviation. Statistics were calculated using a two-tailed Student’ s t-test. P<0.05 was considered statically significant, and data marked with statical significance as follows: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, NS: not significant (unless otherwise mentioned). Statistics and graphs were prepared using Microsoft Excel and Graphpad Prism. Bliss independence values (Fig 4n) were calculated using standard formula of Ec = Ea + Eb - Ea x Eb. A bliss independence score that equals 1.0 indicates additive effect, greater than 1.0 indicates antagonistic effect, and less than 1.0 indicates a synergistic effect.

[0216] Example 1 - Identifying UXS1 as a candidate detoxifier

[0217] It was explored whether candidate detoxifying enzymes might be identified, and whether it is required for cell survival only in the cells where its substrate is produced at high levels (FIG.1A). First, based on the notion that the detoxifying enzyme would be required in some cells but not others, the DEPMAP database of cancer cell line dependency7was utilized to identify metabolic enzymes with differential essentiality: they are required for the survival of some cancer lines but not others. This was determined by a standard deviation metric (formula: {S(x- x)2 / (n-l)) based data mining of gene dependency scores for all metabolic genes (determined via CRISPR / Cas9 pooled screen7across 572 different cancer cell lines across 25 solid tumor lineages. The selenium detoxifying enzyme ‘SEPHS2’3was near the top of this list, supporting the notion that detoxifying enzymes can have varying essentiality across lines (FIG. 5A).

[0218] Following the kitchen sink model, it was then determined whether these enzymes' essentiality (as determined in the Cancer Dependency Map8in each cell line) correlates with the expression level of an upstream enzyme(s) producing the putatively toxic metabolite. It was found that for one of these variably essential enzymes, UXS1 (FIG. 5B), the immediate upstream enzyme UGDH was the gene whose expression correlated the most with whether a cell required UXS1 or not (FIGs.lB-lD). This raised the possibility that the product of UGDH - UDP-glucuronic acid (UDPGA) - is a toxic metabolite so that only the cells expressing high UGDH and thus producing high UDPGA would be dependent on UXS1 for detoxification.

[0219] To confirm the UGDH expression-dependent requirement of UXS1 suggested by the data mining, CRISPR-Cas9 knock-out (KO) of UXS1 was lentivirally transduced in 19 cancer cell lines of different tissue origin with varying levels of UGDH mRNA expression. Loss of UXS1 was detrimental only to cell lines expressing high UGDH (FIGs.lE-lF, FIG. 5C). Furthermore, in these sensitive lines, which included the lung adenocarcinoma line A549 and the colorectal adenocarcinoma line DLD1, overexpression of UXS1 with CRISPR-resistant silent mutations against UXSl-g2 fully rescued against the toxicity from UXSl-g2 but not from UXSl-gl, verifying that the toxicity from UXS1 KO is on-target (FIG.1G, FIGs. 5D-5G). A UXS1 doxycycline(dox)-inducible KO (iKO) line was generated (FIGs. 5H-5I) which revealed that UXS1 loss leads to cell cycle defects and cell death consistent with apoptosis (FIGs.lH-11, FIGs. 6A-6D). Thus, UXS1 disruption selectively kills only those cancer cells with high expression levels of UGDH.

[0220] Example 2 - UXS1 prevents toxic UDPGA accumulation

[0221] Two potential mechanisms for UXS1 toxicity were considered: 1) that accumulation of its substrate may be toxic, as suggested by the kitchen sink model, or 2) that loss of downstream product may be detrimental. To this end, the known biological functions of this pathway was considered. UGDH produces the sugar nucleotide UDP-glucuronic acid (UDPGA), the substrate of UXS19. UDPGA is used in glycosylation reactions which add glucuronic acid to proteoglycans and glycoproteins in the Golgi apparatus10 14. It is also a key substrate for reactions performed by UDP-glucuronosyltransferases (UGTs) to conjugate glucuronic acid to xenobiotics (such as chemotherapeutic compounds), aiding in their deactivation and secretion, a process referred to as ‘glucuronidation’13‘19. UXS1 converts UDPGA to UDP -xylose, another sugar nucleotide precursor for glycosylation used in proteoglycans (FIG.1D)10 13. Thus, excessive UDPGA could introduce aberrant changes in the Golgi or the glucuronidation system; alternatively, the loss of xylose sugar modifications could be detrimental to cells.

[0222] To determine whether overabundance of UDPGA or loss of xylose modifications is the cause for toxicity, intracellular levels of UDPGA was first measured by LC-MS following UXS1 ablation. As expected, UXS1 disruption, but not UGDH loss, caused about 70-fold accumulation of UDPGA in a time-dependent manner, while several other UDP-sugars were not substantially impacted (FIG.2A). Using U-13C glucose labeling, it was confirmed that UXS1 KO resulted in the complete ablation of UDP -xylose formation (FIGs. 2B-2C, FIG.7H). Next, to test the kitchen-sink model (FIG.2D), UGDH was disrupted to prevent UDPGA production (FIG.2E), which completely protected both A549 and DLD1 cells against the toxic effects of UXS1 loss (FIGs.2F-2G, FIGs.7A-7B). Similarly, 4MU, a drug that depletes UDPGA by consuming it for 4MU glucuronidation20’22, also rescued these cells from UXS1 loss toxicity (FIG.2H). Cell lines expressing low, medium, or high UGDH levels were examined (CAKH / ASPC1 / A549) and corresponding increasing degrees of UDPGA accumulation was found following UXS1 KO, which correlated with increasing toxicity (FIG.7C, FIG.1E). Glucose is an upstream input for UDPGA biosynthesis, and it was found that glucose levels directly modulate sensitivity to UXS1 KO, further supporting UDPGA accumulation as the culprit for toxicity (FIG.7D). Directly treating UDPGA can also induce toxicity but at high concentrations, likely due to its low cell permeability (FIG.7E). Finally, otherwise insensitive, low UGDH expressing cells were sensitized to UXS1 loss toxicity by overexpressing UGDH (FIGs.2I-2J, FIGs.7F-7G). Taken together, along with the ‘kitchen sink’ rescue, multiple lines of evidence were provided that cells expressing high UGDH depend on UXS1 expressly to prevent the toxic overaccumulation of UDPGA.

[0223] To further investigate the potential impacts of losing UDP-xylose production upon UXS1 KO, sulfated glycosaminoglycans, glycosylation moi eties on proteoglycans were examined which require xylose as well as glucuronic acid residues for their production23. UXS1 KO cells had decreased levels of total sulfated GAGs, indicating a consequence of loss of UDP-xylose production (FIGs. 8A-8B). Also as expected, UGDH KO or UGDH / UXS1 double KO also resulted in a similar degree of loss of sulfated GAGs. As the latter two conditions are nontoxic, this supported that loss of sulfated GAGs are not responsible for the toxicity of UXS1 KO. Hyaluronic acids, the predominant non-sulfated proteoglycans, were additionally examined which require glucuronic acid but not xylose residues in their production23. UGDH KO or UGDH / UXS1 double KO, the two conditions that preclude UDPGA production, resulted in loss of HAs, whereas UXS1 KO, which loses UDP-xylose but gains UDPGA, did not result in significant changes (FIGs. 8C-8D). This argued against changes in HAs mediating the toxicity of UXS1 loss. However, it cannot be ruled out that changes to proteoglycans caused by UXS1 loss could impact other aspects of tumor biology. Proteoglycans are key components of the extracellular matrix that interact with cell surface proteins and their dysregulation may impact various aspects such as cell adhesion and migration, and cancer cell sternness24'26.

[0224] Intriguingly, in UXS1 KO cells, along with a loss of UDP-xylose production, the rate of production of UDPGA was dramatically increased, implying increased activity of UGDH (FIG.2K, FIGs.7H-7L). This is in line with previous reports that indicate that UDP-xylose can allosterically inhibit UGDH as a negative feedback loop27'30. Thus, these results support the model that the observed accumulation of UDPGA in UXS1 KO cells is the combination of lost clearance of UDPGA by UXS1 and higher activity of UGDH (FIG.2L). This explains why loss of UXS1, which turns over UDPGA at a relatively low rate (FIG.2C), results in such a massive increase in UDPGA (FIG.2A). Example 3 - Excess UDPGA disrupts Golgi function

[0225] To try to understand why UDPGA accumulation upon UXS1 loss may be toxic to cells, next-generation sequencing of mRNA from cancer cells subjected to UXS1 KO was performed. Gene set enrichment analysis indicated an induction of various Golgi function-related genes, and a depletion of cell cycle and DNA repair / damage response genes following UXS1 KO in cancer cells (FIG.3A, FIGs.9I-9J). Looking closely at the Golgi-related genes, induction of various Golgi posttranslational modification genes was observed, such as N-linked glycosyltransferases and Golgi trafficking genes such as COP-I vesicular transport genes. Included in the signature was ARF4, a known Golgi stress response gene31,32, and it was verified that ARF4 protein levels are induced upon UXS1 KO (FIG. 9A).

[0226] Overall, this transcriptional response suggested that the toxicity of UXS1 loss / UDPGA accumulation specifically involves the Golgi, which was congruent with UDPGA being a glycosylation precursor and UXS1 being a Golgi resident enzyme. Surprisingly, the loss of UXS1 dramatically altered the morphology of the Golgi apparatus. Instead of being confined to a single region, loss of UXS1 resulted in an aberrant dispersal of the cis-, trans-, and medial components of the Golgi apparatus to multiple regions throughout the cell body, as indicated by immunolabeling and verified by electron microscopy (FIGs.3B-3D, FIGs.lOA-lOD). Meanwhile, the endoplasmic reticulum (ER) appeared intact, and cells did not show signs of ER stress (FIGs.lOE-lOG). Importantly, the UDPGA-depleting 4MU or preemptive UGDH KO rescued the normal Golgi morphology in UXS1 KO cells, demonstrating that the Golgi transformation occurred due to UDPGA accumulation (FIG.3E, FIG.10H). To determine whether UXS 1 KO alters Golgi glycosylation processes, the N-linked (FIG. 3F) and O-linked (FIG. 9F) glycosylation profiles of A549 cells were analyzed upon UXS1 loss. While these analyses show relative abundances of each species and thus do not inform of gross intracellular glycosylation level of each condition, they demonstrate that there are overall changes in glycosylation patterns upon UXS1 loss. While the relative abundance of oligomannose and paucimannose glycans decreased, sialylated and rare complex glycans with poly lac-nac extensions increased upon UXS1 loss (FIGs. 9B-9E). These results indicate that the accumulation of UDPGA following the loss of UXS 1 alters both the structure and function of the Golgi apparatus. Interestingly, the majority of UDPGA accumulation occurs in the cytosol (FIGs.llC-llD), and overexpression the Golgi UDPGA transporter SLC35D133does not impact UXS1 KO toxicity (FIGs. 11A-11B), suggesting that excess UDPGA impacts the Golgi from the cytosolic side.

[0227] The Golgi apparatus is the gateway for the terminal glycomodifications and trafficking for cell surface proteins such as growth factor receptors and other surface markers that play essential roles in cancer biology3435. Therefore, it was examined whether cell surface proteins have changes in mobility which are commonly associated with glycosylation defects36-38. Various cell surface receptors (EGFR, CD44, FGFR1, FGFR4, IGF1R) which are key upstream components of signaling cascades39-42were examined. It was found that loss of UXS1 caused increased gel migration in all of these receptors, suggesting their defective glycosylation36-38, as is seen by treating cells with the glycosidase PNGase36(FIG.3G). In most cases protein levels were also significantly decreased, which may be due to degradation, misfolding and / or decreased stability known to occur for mis-glycosylated proteins43-45. These results suggested that the Golgi dysfunction caused by UXS1 loss has a far-reaching consequence of preventing the proper maturation of essential cell surface glycoproteins.

[0228] Among these, EGFR is an upstream oncogenic signaling component that is required for the proliferation and survival of cancers such as Non-Small Cell Lung Carcinoma (NSCLC) and glioblastoma46-48, and RNA sequencing of UXS1 KO cells suggested a profile of impaired EGFR signaling (FIGs.9I-9J). Therefore, EGFR was looked at more closely as an example surface protein that is impaired due to UDPGA-induced Golgi dysfunction. Immunolabeling of EGFR strikingly showed that it is absent at the plasma membrane following KO of UXS1, with decreased overall levels (FIGs.3H-3I, FIGs.lOI-lOK). The ability of UXS1 iKO cells to respond to EGF mitogen was next examined. Cells lacking UXS1 could not properly respond to EGF, not undergoing autophosphorylation of EGF, which is the canonical initial step in the EGFR signaling cascade (FIG.3J). Furthermore, the cells lacked the characteristic phosphorylation of Akt and ERK, which is a standard downstream manifestation of EGFR activation. While these results demonstrate effects on EGFR and its downstream signaling, the general effects of UXS1 KO across cell various surface receptors (FIG.3G) suggest that cancer cells have in effect been ‘silenced’ in their ability to respond to various extracellular cues. Thus, while EGFR loss is likely to be highly detrimental to the cancer cells, it is unlikely to be the sole culprit, and it was proposed that death may occur from a global deregulation of cell surface proteins. The downregulation of cell cycle genes that were observed in the RNA-SEQ was also considered. Golgi fragmentation occurs during mitosis, thus a mitotic block could indirectly account for the golgi-related pathologies that was observed. However, propidium iodide based fluorescence-activated cell sorting (FACS) cell cycle analyses of UXS1 iKO cells indicate that the S phase population is increased while G2 population (which includes M phase cells) is decreased (FIGs.6B-6C). Accumulation of M phase as marked by phospho-Histone-H3 was not observed (FIG.9G). It was found that serum starvation- induced block of cell cycle progression block does not enhance and instead slightly decreases Golgi dispersion upon UXS1 iKO (FIG.9H) Overall, it is unlikely that UXS1 KO causes the Golgi dispersion phenotype via cell cycle defects. Rather, the downregulation of various cell cycle genes may be a consequence of the ‘silencing’ of mitogenic surface receptors such as EGFR, which can drive cell cycle progressi •on 39 ’ 49.

[0229] Example 4 - UXS1 as a cancer-selective target

[0230] The consequences of UXS1 loss were examined in the in vivo context of a tumor. To examine effects of disruption of UXS1 in an already formed tumor, dox-inducible UXS1 KO was utilized in three subcutaneous xenograft models (A549 and H460, both UGDH-high, nonsmall cell lung cancer lines; and HT1080, a UGDH-low fibrosarcoma line), where dox was administered on timepoints where average tumor sizes were at least 200mm3 (FIGs.l2A-12C). For both UGDH-high lines, induction of UXS1 loss resulted in a significant stunting of tumor growth (and regression in H460), and extended median survival by 27 days for A549, and 50 days for H460 (FIGs. 4A-4B, 4D-4E, FIGs.l2E-12F). A ~40-fold intracellular accumulation of UDPGA (FIG. 12H) and induction of ARF4, a Golgi stress marker (FIG.121) was observed in A549 iKO tumors. On the other hand, despite efficient induced KO (FIGs.l2D, 12G), UXS1 loss in the UGDH-low HT1080 tumors had no effect on tumor growth and overall survival (FIGs.4C, 4F). Collectively, these experiments demonstrate a therapeutic potential for targeting UXS1 that depends on the high-UGDH status of the tumor.

[0231] For UXS1 to be an ideal cancer target, it should demonstrate cancer cell-selective toxicity. Recently, UGDH itself was examined in cancer contexts: it was elevated in some subtypes of lung and breast cancers which correlated with poor prognosis50-52, suggesting UGDH as a cancer target53,54. In the kitchen sink model (FIGs.2A-2L), UGDH is not a cancer target per se but a biomarker and functional determinant for which cells will require UDPGA detoxification via UXS1 . Importantly, comparing tumors and adjacent normal tissues, it was observed that UGDH is elevated in lung and breast cancers compared to normal tissues, suggesting that UXS1 targeting would hurt cancer cells but not normal cells (FIGs.4G-4H, FIGs.l3A-13B). RNA-SEQ database comparison of UGDH transcript abundance across tumor types and normal organs also indicates that UGDH may be elevated in multiple tumors relative to normal tissues (FIG.13C). The variability of UGDH expression across the solid tumor lines (FIG.1C) and tumors (FIG.13C) suggest that the applicability of targeting UXS1 may depend both on the cancer type and on a patient-by-patient basis. Overall low protein levels of UGDH expression were confirmed across various patient normal liver, kidney, and colon tissues, suggesting that targeting UXS1 would not cause toxic UDPGA accumulation in organs (FIG.13F). Finally, UGDH expression and UXS1 essentiality were compared across a panel of noncancer (primary or immortalized) cells. Normal cells express lower levels of the ‘faucet’ UGDH than the UXS1 KO sensitive cancer cells, and they are also insensitive to the KO of UXS1 as predicted (FIG.4I, FIGs.l3D-13E and FIG.5J). Collectively, these findings suggest a therapeutic window for UXS1 targeting. Nonetheless, UXS1 KO mice are embryonic lethal35, which may indicate importance for UXS1 detoxification or downstream proteoglycan function (UDP-xylose) in a developmental and / or organismal context. Thus, as some important normal cells may depend on UXS1, examination of patient toxicity will be an important concern in future therapies targeting UXS1.

[0232] It was explored why UGDH, which imposes a detoxification burden, might be upregulated in cancer cells in the first place. Higher levels of UGDH were correlated with a worse prognosis in triple-negative breast cancer patients that received chemotherapy56. Proteomic studies also found that UGDH was elevated in chemo-resistant cells as compared to chemo-naive or untreated cells in the context of lung and ovarian cancer57-58. This suggested a rationale for why UGDH may be elevated in cancer: its upregulation could provide an advantage in chemoresistance, which would be in line with the known function of its product UDPGA, as a substrate for the xenobiotic clearance mechanism of glucuronidation. Indeed, examining how UGDH expression correlates with drug resistance across cancer cell lines, it was found that an elevated expression of UGDH correlated with increased resistance to many drugs, including staple chemotherapeutics such as doxorubicin, paclitaxel, and gemcitabine (FIG.4J). It was also examined whether exposure to and / or selection in chemotherapeutics itself results in induction of UGDH. Persister populations were formed of lung cancer line (H2170), triple negative breast cancer line (MDAMB231), and patient derived organoids (TPN1 and TPN2) through cisplatin exposure; these displayed both robust induction of UGDH and sensitization to UXS1 KO (FIGs.4K-4M, FIGs.l4A-14I) compared to their parental counterparts. Chemotherapy in the A549 inducible xenograft model induces UGDH in tumors (FIGs. 4O-4P) and synergizes with UXS1 iKO to regress tumor growth (FIG.4N). The same chemotherapy regimen does not induce UGDH in normal mouse tissues (FIGs.l2J-12K), suggesting a method to increase the therapeutic window for targeting cancer cells via UXS 1. These findings suggest that UXS 1 targeting may be particularly damaging to chemoresistant subpopulations of cancer cells, or to cancer cells being treated with chemotherapeutics, due to their induction of UGDH.

[0233] Example 5 - Implications of proteoglycan alterations downstream of UGDH or UXS1

[0234] The sequential products of UGDH and UXS1 are the sugar nucleotides UDP-glucuronic acid and 4 UDP -xylose (FIG. ID). These act as glucuronic acid and xylose sugar donors in glycosylation. Both glucuronic acid and xylose units are required components in sulfated glycosaminoglycans, negatively charged polysaccharides that are attached to core proteins to form secreted proteoglycans forming extracellular material such as in connective tissue or one of several transmembrane surface proteoglycans. Meanwhile, glucuronic acid but not xylose units are required to produce hyaluronic acid, the predominant species of non-sulfated glycosaminoglycans, which is a key component of biological lubricant and structural fluids (e g., synovial fluid).

[0235] It was observed that UGDH KO or UGDH / UXS1 double KO, but not UXS1 KO, resulted in a significant decrease in total hyaluronic acid levels (FIGs. 8C-8D). This is consistent with glucuronic acid (but not xylose) being required in hyaluronic acids. As UXS1 KO does not decrease HA species, this argues against the loss of HA, contributing to the toxicity of UXS 1 loss.

[0236] Meanwhile, UGDH KO, UXS1 KO, or double UGDH / UXS1 KO all result in a significant drop in total sulfated proteoglycans in A549 cells (with an insignificant trend for loss in DLD1). This is consistent with their downstream product UDP -xylose being a component of sulfated glycosaminoglycans. UXS1 KO is toxic, while UGDH or UGDH / UXS1 double KO is not (FIGs. 2F-2G, 7A-7B); the fact that all three of these lower proteoglycans to similar extents but only UXS1 KO is toxic supports that loss of sulfated glycosaminoglycans does not contribute to the toxicity ofUXSl .

[0237] The fact that UXS1 KO toxicity is rescued by conditions that remove UDPGA - preemptive KO of UGDH (FIGs. 2F-2G, 7A-7B), or clearing UDPGA via 4MU (FIG. 2H) - further support that the upstream UDPGA accumulation rather than downstream impacts in proteoglycans cause the acute toxicity of UXS1 loss.

[0238] However, it is important to note that these results do not rule out the possibility that the impacts on proteoglycans resulting from UGDH or UXS1 loss could impact other aspects of the cancer cell aside from viability. Proteoglycans, either as secreted components or as cell surface proteins, are involved in both structural and signaling mechanisms and can play important roles in diverse processes such as cell adhesion, migration, and differentiation. As such, they may play various roles in cancer and tumor progression such as in invasion, migration, chemoresistance, epithelial- mesenchymal transition, and sternness.

[0239] Example 6 - Identifying tumor subsets amenable to UXSl-based therapy

[0240] While UGDH is elevated in multiple tumors and cell lines and generally low across normal tissues and noncancer lines (FIGs. 4G-4H, 13A-13F), high variability can be seen in UGDH expression across both cancer lines and tumors, which will likely impact the antitumor efficacy of strategies that target UXS1. Indeed, in the analyses of the UXS1 KO 40 effect across cancer lines, 7 lines were UGDH high / UXS1 KO sensitive, while 11 lines were UGDH low / UXS1 KO insensitive.

[0241] TCGA analyses suggest that certain cancers - lung, liver, breast, and prostate tend to be UGDH high compared to others (FIG. 13C). These are likely the tumor types for which UXS 1 -targeting strategies would be most appropriate. But even within these tumor types, there is variability in UGDH expression, with both UGDH-high and UGDH-low examples (FIGs. 4G, 13A-13C). Thus, the ideal scenario would be to strategize UXS1 based therapy on both tumor types, but additionally on a patient-by-patient base, such as via analyses of UGDH levels from a tumor biopsy.

[0242] Variability in UGDH expression could pose a potential hurdle in therapy, one that is often observed in other chemotherapeutics - there will likely be cells that are resistant to UXS1 inhibitors, due to low UGDH status, which may survive and repopulate the tumor. A key tool against such a scenario may be the co-administration of chemotherapeutics with UXS1 targeting agents. Importantly, chemotherapeutics are able to induce UGDH in a variety of paradigms (cell lines in culture, patient-derived organoids, xenografts), and even convert UXS1 insensitive lines into sensitive ones. Chemotherapeutics do not appear to induce UGDH in normal tissues in contrast to tumors (FIGs. 12J-12K), and thus a combinatorial chemo + UXS1 inhibitor strategy may allow the targeting of subpopulations that would otherwise be insensitive, either to the chemotherapeutic component, or the UXS1 component (FIG. 4N).

[0243] Example 7 - Safety considerations in targeting UXS1 for cancer therapy

[0244] A cancer- selective dependency of UXS1 was demonstrated based on the elevated expression of UGDH in cancer cells relative to normal cells, which can be synergized with chemotherapy. While the findings provide a promising basis for further investigations into UXS1 as a cancer target, there are safety concerns that should be considered while exploring UXS1 targeting agents. Firstly, the studies cannot rule out that rare but important normal cell subtypes may have high UGDH expression and thus be sensitive to UXS1 loss due to UDPGA overaccumulation. Secondly, UXS1 loss-induced changes to proteoglycans (such as loss of sulfated proteoglycans) may have cell extrinsic consequences that negatively impact the organism, based on the known roles of secreted proteoglycans in various biological processes. Indeed, it should be noted that UXS1 KO is embryonic lethal, although it is unknown whether this is due to UDPGA toxicity or external proteoglycan defects during development. It is also unknown whether this negative impact of UXS1 loss is limited to the development, or whether UXS1 loss would be similarly harmful in an adult organism. Future in vivo experiments with UXS1 inhibitors or conditional whole-body KO models of UXS1 would address these questions and guide subsequent therapeutic strategies. It was noted that incomplete loss of UXS1 via shRNAs still has the cancer-toxic consequences observed with UXS1 KO (FIGs. 14J-14L), suggesting that partial inhibition of UXS1, which may be more tolerable, could still have anticancer effects. There may be a therapeutic window based on the high requirement of cancer cells for UDPGA detoxification, noting that other previously established chemotherapeutics, such as nucleotide antimetabolites or microtubule toxins, also inhibit processes that are essential yet demonstrate practical therapeutic windows. Another strategy to consider would be the administration of proteoglycans along with UXS1 inhibitors, as proteoglycans are bioavailable and can be supplemented orally or via local injection.

[0245] Example 8 - The UDP xylose and UGDH feedback mechanism

[0246] An interesting consideration is that xylose units are relatively rare compared to other units, such as glucuronic acid, being required in small amounts in some sulfated glycosaminoglycans but not present in most glycosylated proteins. Thus, it appears that UXS1 is not needed for a high rate of conversion of UDPGA to UDP-xylose, raising the possibility that some proteoglycans could act as a sink for excess UDPGA not converted to UDP-xylose. However, there were no increases in hyaluronic acid or sulfated proteoglycans (FIGs. 8A-8D), arguing against this possibility.

[0247] An important detail in the relationship between UGDH and UXS1 is that normally, the UDP- xylose produced by UXS1 appears to act to limit the activity of UGDH in a negative feedback loop. It was shown that UDP-xylose is an allosteric feedback inhibitor of UGDH in various species ranging from plants to human. Supporting the presence of a negative feedback loop, UXS1 KO, which eliminates UDP-xylose production (FIG. 2C), results in substantially increased production of UDPGA (FIGs. 2K, 7H), more than can be accounted for by loss of UDPGA clearance from UXS1 (FIGs. 2C, 2K). UXS1 KO is in effect blocking the ‘drain’ for UDPGA removal, but at the same time, amplifying the ‘faucet’ (UGDH activity). This adds an important detail to the UGDH / UXS1 kitchen sink relationship that explains how such a massive accumulation can occur when an only moderately active enzyme is lost (FIG. 2L).

[0248] REFERENCES

[0249] 1 Hanahan, D. & Weinberg, R. A. Hallmarks of cancer: the next generation. Cell 144, 646- 674, doi: 10.1016 / j.cell.2011.02.013 (2011).

[0250] 2 Kim, D. et al. SHMT2 drives glioma cell survival in ischaemia but imposes a dependence on glycine clearance. Nature 520, 363-367, doi: 10.1038 / naturel4363 (2015).

[0251] 3 Carlisle, A. E. et al. Selenium detoxification is required for cancer-cell survival. Nat Metab 2, 603-611, doi: 10.1038 / s42255-020-0224-7 (2020).

[0252] 4 Gomes, A. P. et al. Age-induced accumulation of methylmalonic acid promotes tumour progression. Nature 585, 283-287, doi:10.1038 / s41586-020-2630-0 (2020).

[0253] 5 Lee, N., Spears, M. E., Carlisle, A. E. & Kim, D. Endogenous toxic metabolites and implications in cancer therapy. Oncogene 39, 5709-5720, doi: 10.1038 / s41388-020-01395-9 (2020).

[0254] 6 Spears, M. E. et al. De novo sphingolipid biosynthesis necessitates detoxification in cancer cells. Cell Rep 40, 111415, doi:10.1016 / j.celrep.2022.111415 (2022).

[0255] 7 Meyers, R. M. et al. Computational correction of copy number effect improves specificity of CRISPR-Cas9 essentiality screens in cancer cells. Nat Genet 49, 1779-1784, doi: 10.1038 / ng.3984 (2017).

[0256] 8 Barretina, J. et al. The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity. Nature 483, 603-607, doi:10.1038 / naturel 1003 (2012).

[0257] 9 Axelrod, J., Kalckar, H. M., Maxwell, E. S. & Strominger, J. L. Enzymatic formation of uridine diphosphoglucuronic acid. J Biol Chem 224, 79-90 (1957).

[0258] 10 Prydz, K. & Dalen, K. T. Synthesis and sorting of proteoglycans. Journal of cell science 113, 193-205 (2000).

[0259] 11 Weissmann, B. & Meyer, K. The structure of hyalobiuronic acid and of hyaluronic acid from umbilical Cordl, 2. Journal of the american chemical society 76, 1753-1757 (1954).

[0260] 12 Wagner, R. R. & Cynkin, M. A. Glycoprotein biosynthesis. Incorporation of glycosyl groups into endogenous acceptors in a Golgi apparatus-rich fraction of liver. J Biol Chem 246, 143-151 (1971).

[0261] 13 Sugahara, K. & Kitagawa, H. Recent advances in the study of the biosynthesis and functions of sulfated glycosaminoglycans. Curr Opin Struct Biol 10, 518-527, doi : 10.1016 / s0959-440x(00)00125-1 (2000). 14 Turnbull, J. E., Hopwood, J. J. & Gallagher, J. T. A strategy for rapid sequencing of heparan sulfate and heparin saccharides. Proc Natl Acad Sci U S A 96, 2698-2703, doi : 10.1073 / pnas.96.6.2698 ( 1999).

[0262] 15 Dudley, K. H. Stereochemical formulas of beta-D-glucuronides. Drug Metab Dispos 13, 524-526 (1985).

[0263] 16 Radominska-Pandya, A., Bratton, S. M., Redinbo, M. R. & Miley, M. J. The crystal structure of human UDP-glucuronosyltransferase 2B7 C-terminal end is the first mammalian UGT target to be revealed: the significance for human UGTs from both the 1A and 2B families. Drug Metab Rev 42, 133-144, doi: 10.3109 / 03602530903209049 (2010).

[0264] 17 Mackenzie, P. I. et al. Regulation of UDP glucuronosyltransferase genes. Curr Drug Metab 4, 249-257, doi: 10.2174 / 1389200033489442 (2003).

[0265] 18 Nagar, S. & Blanchard, R. L. Pharmacogenetics of uridine diphosphoglucuronosyltransf erase (UGT) 1 A family members and its role in patient response to irinotecan. Drug Metab Rev 38, 393-409, doi: 10.1080 / 03602530600739835 (2006).

[0266] 19 Perera, M. A., Innocenti, F. & Ratain, M. J. Pharmacogenetic testing for uridine diphosphate glucuronosyltransferase 1A1 polymorphisms: are we there yet? Pharmacotherapy 28, 755-768, doi: 10.1592 / phco.28.6.755 (2008).

[0267] 20 Kakizaki, I. et al. A novel mechanism for the inhibition of hyaluronan biosynthesis by 4- methylumbelliferone. J Biol Chem 279, 33281-33289, doi :10.1074 / jbc.M405918200 (2004).

[0268] 21 Kultti, A. et al. 4-Methylumbelliferone inhibits hyaluronan synthesis by depletion of cellular UDP-glucuronic acid and downregulation of hyaluronan synthase 2 and 3. Exp Cell Res 315, 1914-1923, doi: 10.1016 / j.yexcr.2009.03.002 (2009).

[0269] 22 Clarkin, C. E., Allen, S., Wheeler-Jones, C. P., Bastow, E. R. & Pitsillides, A. A.

[0270] Reduced chondrogenic matrix accumulation by 4-methylumbelliferone reveals the potential for selective targeting of UDP -glucose dehydrogenase. Matrix Biol 30, 163-168, doi: 10.1016 / j. matbio.2011.01.002 (2011).

[0271] 23 Kjellen, L. & Lindahl, U. Proteoglycans: structures and interactions. Annu Rev Biochem 60, 443-475, doi:10.1146 / annurev.bi.60.070191.002303 (1991).

[0272] 24 Winkler, J., Abisoye-Ogunniyan, A., Metcalf, K. J. & Werb, Z. Concepts of extracellular matrix remodelling in tumour progression and metastasis. Nat Commun 11, 5120, doi : 10.1038 / s41467-020- 18794-x (2020). 25 Vitale, D. et al. Proteoglycans and glycosaminoglycans as regulators of cancer stem cell function and therapeutic resistance. FEBS J 286, 2870-2882, doi : 10.1111 / febs.14967 (2019).

[0273] 26 Karagiorgou, Z., Fountas, P. N., Manou, D., Knutsen, E. & Theocharis, A. D. Proteoglycans Determine the Dynamic Landscape of EMT and Cancer Cell Sternness. Cancers (Basel) 14, doi : 10.3390 / cancers 14215328 (2022).

[0274] 27 Neufeld, E. F. & Hall, C. W. Inhibition of Udp-D-Glucose Dehydrogenase by Udp-D- Xylose: A Possible Regulatory Mechanism. Biochem Biophys Res Commun 19, 456-461, doi : 10.1016 / 0006-29 lx(65)90146-4 (1965).

[0275] 28 Gainey, P. A. & Phelps, C. F. Interactions of urdine diphosphate glucose dehydrogenase with the inhibitor urdine diphosphate xylose. Biochem J 145, 129-134, doi: 10.1042 / bj 1450129 (1975).

[0276] 29 Beattie, N. R., Keul, N. D., Sidlo, A. M. & Wood, Z. A. Allostery and Hysteresis Are Coupled in Human UDP-Glucose Dehydrogenase. Biochemistry 56, 202-211, doi: 10.102 l / acs.biochem.6b01044 (2017).

[0277] 30 Beattie, N. R., Pioso, B. J., Sidlo, A. M., Keul, N. D. & Wood, Z. A. Hysteresis and Allostery in Human UDP-Glucose Dehydrogenase Require a Flexible Protein Core.

[0278] Biochemistry 57, 6848-6859, doi: 10.1021 / acs. biochem.8b00497 (2018).

[0279] 31 Reiling, J. H. et al. A CREB3-ARF4 signalling pathway mediates the response to Golgi stress and susceptibility to pathogens. Nat Cell Biol 15, 1473-1485, doi: 10.1038 / ncb2865 (2013).

[0280] 32 Ignashkova, T. I. et al. Cell survival and protein secretion associated with Golgi integrity in response to Golgi stress-inducing agents. Traffic 18, 530-544, doi : 10.1111 / tra.12493 (2017).

[0281] 33 Hiraoka, S. et al. Nucleotide- sugar transporter SLC35D1 is critical to chondroitin sulfate synthesis in cartilage and skeletal development in mouse and human. Nat Med 13, 1363-1367, doi: 10.1038 / nml655 (2007).

[0282] 34 Stanley, P. Golgi glycosylation. Cold Spring Harb Perspect Biol 3, doi: 10.1101 / cshperspect.a005199 (2011).

[0283] 35 Varki, A. Factors controlling the glycosylation potential of the Golgi apparatus. Trends Cell Biol 8, 34-40, doi: 10.1016 / s0962-8924(97)01198-7 (1998).

[0284] 36 Tarentino, A. L., Gomez, C. M. & Plummer, T. H., Jr. Deglycosylation of asparagine- linked glycans by peptide:N-glycosidase F. Biochemistry 24, 4665-4671, doi: 10.1021 / bi00338a028 (1985). 7 Unal, E. S., Zhao, R., Qiu, A. & Goldman, I. D. N-linked glycosylation and its impact on the electrophoretic mobility and function of the human proton-coupled folate transporter (HsPCFT). Biochim Biophys Acta 1778, 1407-1414, doi: 10.1016 / j.bbamem.2008.03.009 (2008).

[0285] 38 Contessa, J. N., Bhojani, M. S., Freeze, H. H., Rehemtulla, A. & Lawrence, T. S. Inhibition of N-linked glycosylation disrupts receptor tyrosine kinase signaling in tumor cells. Cancer Res 68, 3803-3809, doi: 10.1158 / 0008-5472.CAN-07-6389 (2008).

[0286] 39 Wee, P. & Wang, Z. Epidermal Growth Factor Receptor Cell Proliferation Signaling Pathways. Cancers (Basel) 9, doi: 10.3390 / cancers9050052 (2017).

[0287] 40 Ornitz, D. M. & Itoh, N. The Fibroblast Growth Factor signaling pathway. Wiley Interdiscip Rev Dev Biol 4, 215-266, doi: 10.1002 / wdev.l76 (2015).

[0288] 41 Hakuno, F. & Takahashi, S. I. IGF1 receptor signaling pathways. J Mol Endocrinol 61, T69-T86, doi:10.1530 / JME-17-0311 (2018).

[0289] 42 Ouhtit, A., Rizeq, B., Saleh, H. A., Rahman, M. M. & Zayed, H. Novel CD44- downstream signaling pathways mediating breast tumor invasion. Int J Biol Sci 14, 1782-1790, doi: 10.7150 / ijbs.23586 (2018).

[0290] 43 Jayaprakash, N. G. & Surolia, A. Role of glycosylation in nucleating protein folding and stability. Biochem J 474, 2333-2347, doi: 10.1042 / BCJ20170111 (2017).

[0291] 44 Lis, H. & Sharon, N. Protein glycosylation. Structural and functional aspects. Eur J Biochem 218, 1-27, doi: 10.1111 / j .1432-1033.1993.tb 18347.x (1993).

[0292] 45 Taylor, E. S., Pol-Fachin, L., Lins, R. D. & Lower, S. K. Conformational stability of the epidermal growth factor (EGF) receptor as influenced by glycosylation, dimerization and EGF hormone binding. Proteins 85, 561-570, doi: 10.1002 / prot.25220 (2017).

[0293] 46 Hatanpaa, K. J., Burma, S., Zhao, D. & Habib, A. A. Epidermal growth factor receptor in glioma: signal transduction, neuropathology, imaging, and radioresistance. Neoplasia 12, 675- 684, doi : 10.1593 / neo.10688 (2010).

[0294] 47 Ohsaki, Y. et al. Epidermal growth factor receptor expression correlates with poor prognosis in non-small cell lung cancer patients with p53 overexpression. Oncol Rep 7, 603-607, doi: 10.3892 / or.7.3.603 (2000).

[0295] 48 Veale, D., Kerr, N., Gibson, G. J., Kelly, P. J. & Harris, A. L. The relationship of quantitative epidermal growth factor receptor expression in non-small cell lung cancer to long term survival. Br J Cancer 68, 162-165, doi: 10.1038 / bjc.1993.306 (1993). 49 Collin de L'hortet, A., Gilgenkrantz, H. & Guidotti, J. E. EGFR: A Master Piece in Gl / S Phase Transition of Liver Regeneration. Int J Hepatol 2012, 476910, doi: 10.1155 / 2012 / 476910 (2012).

[0296] 50 Saha, S. et al. UDP-glucose 6-dehydrogenase expression as a predictor of survival in patients with pulmonary adenocarcinoma. US Oncology 5, e85 (2020).

[0297] 51 Hagiuda, D. et al. Clinicopathological and prognostic significance of nuclear UGDH localization in lung adenocarcinoma. Biomed Res 40, 17-27, doi: 10.2220 / biomedres.40.17 (2019).

[0298] 52 Arnold, J. M. et al. UDP-glucose 6-dehydrogenase regulates hyaluronic acid production and promotes breast cancer progression. Oncogene 39, 3089-3101, doi:10.1038 / s41388-019- 0885-4 (2020).

[0299] 53 Teoh, S. T., Ogrodzinski, M. P. & Lunt, S. Y. UDP-glucose 6-dehydrogenase knockout impairs migration and decreases in vivo metastatic ability of breast cancer cells. Cancer Lett 492, 21-30, doi:10.1016 / j.canlet.2020.07.031 (2020).

[0300] 54 Lin, L. H. et al. Targeting UDP-glucose dehydrogenase inhibits ovarian cancer growth and metastasis. J Cell Mol Med 24, 11883-11902, doi:10.1111 / jcmm.l5808 (2020).

[0301] 55 Tang, T. et al. A mouse knockout library for secreted and transmembrane proteins. Nat Biotechnol 28, 749-755, doi: 10.1038 / nbt,1644 (2010).

[0302] 56 Vitale, D. L. et al. Initial Identification of UDP-Glucose Dehydrogenase as a Prognostic Marker in Breast Cancer Patients, Which Facilitates Epirubicin Resistance and Regulates Hyaluronan Synthesis in MDA-MB-231 Cells. Biomolecules 11, doi: 10.3390 / bioml 1020246 (2021).

[0303] 57 Ahmed, N. et al. Unique proteome signature of post-chemotherapy ovarian cancer ascites-derived tumor cells. Sci Rep 6, 30061, doi: 10.1038 / srep30061 (2016).

[0304] 58 Paul, D. et al. Global proteomic profiling identifies etoposide chemoresistance markers in non-small cell lung carcinoma. J Proteomics 138, 95-105, doi:10.1016 / j.jprot.2016.02.008 (2016).

[0305] 59 Corsello, S. M. et al. Discovering the anti-cancer potential of non-oncology drugs by systematic viability profiling. Nat Cancer 1, 235-248, doi: 10.1038 / s43018-019-0018-6 (2020). 60 Barger, C. J., Branick, C ., Chee, L. & Karpf, A. R. Pan-Cancer Analyses Reveal Genomic Features of FOXM1 Overexpression in Cancer. Cancers (Basel) 11, doi : 10.3390 / cancers 11020251 (2019) .

[0306] 61 Tang, Z. et al. GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res 45, W98-W102, doi:10.1093 / nar / gkx247 (2017).

[0307] 62 Wang, T., Wei, J. J., Sabatini, D. M. & Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science 343, 80-84, doi: 10.1126 / science.1246981 (2014).

[0308] 63 Sanjana, N. E., Shalem, O. & Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods 11, 783-784, doi: 10.1038 / nmeth.3047 (2014).

[0309] 64 Nonnenmacher, Y. et al. Analysis of mitochondrial metabolism in situ: Combining stable isotope labeling with selective permeabilization. Metab Eng 43, 147-155, doi: 10.1016 / j.ymben.2016.12.005 (2017).

[0310] 65 Vercesi, A. E., Bernardes, C. F., Hoffmann, M. E., Gadelha, F. R. & Docampo, R. Digitonin permeabilization does not affect mitochondrial function and allows the determination of the mitochondrial membrane potential of Trypanosoma cruzi in situ. J Biol Chem 266, 14431- 14434 (1991).

[0311] 66 Sachs, N. et al. A Living Biobank of Breast Cancer Organoids Captures Disease Heterogeneity. Cell 172, 373-386 e310, doi:10.1016 / j.cell.2017.11.010 (2018).

Claims

WHAT IS CLAIMED IS:

1. A method of treating a UDGH-high cancer in a subject, the method comprising: administering to the subject a therapeutically effective amount of an inhibitor of UXS1, wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid or a CRISPR / Cas9 complex targeting the UXS1 gene, preferably wherein the subject is diagnosed as having a UDGH-high cancer, thereby treating the UDGH-high cancer.

2. The method of claim 1, wherein the inhibitory nucleic acid comprises a small hairpin RNA (shRNA), antisense oligonucleotide, small nuclear RNA (snRNA), small interfering RNA (siRNA), or a single guide RNA (sgRNA) targeting a UXS1 nucleic acid.

3. The method of claim 2, wherein the inhibitory nucleic acid comprises a small hairpin RNA (shRNA) targeting the UXS1 nucleic acid.

4. The method of claim 2, wherein the inhibitory nucleic acid comprises an antisense oligonucleotide targeting the UXS1 nucleic acid.

5. The method of claim 2, wherein the inhibitor comprises a CRISPR / Cas9 complex targeting the UXS1 gene.

6. The method of any one of claims 1-5, wherein the diagnosing the subject comprises: determining a level of UDGH in a biological sample comprising cancer cells from the subject; comparing the level of UDGH in the biological sample to a reference level, wherein the presence of a level of UDGH in the biological sample above the reference level indicates that the subject has UDGH-high cancer.

7. The method of any one of claims 1-6, wherein the UDGH-high cancer is a lung cancer, liver cancer, breast cancer, or prostate cancer.

8. The method of claim 7, wherein the UDGH-high cancer is a lung cancer.

9. The method of any one of claims 1-8, further comprising administering an anti-cancer treatment.

10. The method of claim 9, wherein the anti-cancer treatment comprises a chemotherapeutic agent.

11. The method of claim 10, wherein the chemotherapeutic agent comprises vincristine, prednisone, dexamethasone, busulfan, cisplatin, carboplatin, paclitaxel, docetaxel, nab- paclitaxel, altretamine, capecitabine, cyclophosphamide, etoposide (vp-16), gemcitabine, ifosfamide, irinotecan (cpt-11), liposomal doxorubicin, melphalan, pemetrexed, topotecan, vinorelbine, goserelin, leuprolide, tamoxifen, letrozole, anastrozole, exemestane, bevacizumab, olaparib, rucaparib, niraparib, nivolumab, pembrolizumab, durvalumab, atezolizumab, radioisotopes, monomethyl auristatin E (MMAE; e.g., vedotin), calicheamicins, deruxtecan, DM1, and any combinations thereof.

12. The method of any one of claims 1-11, wherein the inhibitory nucleic acid inhibits UXS1 by knockdown of the UXS1 gene expression.

13. A method of enhancing response to chemotherapy in a subject, the method comprising: administering to the subject a therapeutically effective amount of an inhibitor of UXS1, wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid targeting UXS1 or a CRISPR / CAS editing complex targeting UXS1, and wherein the subject is diagnosed as having a UDGH-high cancer, thereby enhancing response to chemotherapy in the subject.

14. A method of suppressing tumor growth in a subject, the method comprising: administering to the subject a therapeutically effective amount of an inhibitor of UXS1, wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid targeting UXS1 or a CRISPR / CAS editing complex targeting UXS1, preferably wherein the subject is diagnosed as having a UDGH-high cancer, thereby suppressing tumor growth in the subject.

15. A composition comprising an inhibitor of UXS1, wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid targeting UXS1 or a CRISPR / CAS editing complex targeting UXS1, for use in a method of treating a UDGH-high cancer in a subject, preferably wherein the subject is diagnosed as having a UDGH-high cancer.

16. The composition for the use of claim 15, wherein the inhibitory nucleic acid comprises a small hairpin RNA (shRNA), antisense oligonucleotide, small nuclear RNA (snRNA), small interfering RNA (siRNA), or single guide RNA (sgRNA) targeting a UXS1 nucleic acid.

17. The composition for the use of claim 16, wherein the inhibitory nucleic acid comprises a small hairpin RNA (shRNA) targeting the UXS1 nucleic acid.

18. The composition for the use of claim 16, wherein the inhibitory nucleic acid comprises an antisense oligonucleotide targeting the UXS1 nucleic acid.

19. The composition for the use of claim 16, wherein the inhibitor comprises a CRISPR / CAS editing complex targeting UXS1.

20. The composition for the use of any one of claims 15-19, wherein the subject has been diagnosed by a method comprising: determining a level of UDGH in a biological sample comprising cancer cells from the subject; comparing the level of UDGH in the biological sample to a reference level, wherein the presence of a level of UDGH in the biological sample above the reference level indicates that the subject has UDGH-high cancer.

21. The composition for the use of any one of claims 15-20, wherein the UDGH-high cancer is a lung cancer, liver cancer, breast cancer, or prostate cancer.

22. The composition for the use of claim 21 , wherein the UDGH-high cancer is a lung cancer.

23. The composition for the use of any one of claims 15-22, further comprising administering an anti-cancer treatment.

24. The composition for the use of claim 23, wherein the anti-cancer treatment comprises a chemotherapeutic agent.

25. The composition for the use of claim 24, wherein the chemotherapeutic agent comprises vincristine, prednisone, dexamethasone, busulfan, cisplatin, carboplatin, paclitaxel, docetaxel, nab-paclitaxel, altretamine, capecitabine, cyclophosphamide, etoposide (vp- 16), gemcitabine, ifosfamide, irinotecan (cpt-11), liposomal doxorubicin, melphalan, pemetrexed, topotecan, vinorelbine, goserelin, leuprolide, tamoxifen, letrozole, anastrozole, exemestane, bevacizumab, olaparib, rucaparib, niraparib, nivolumab, pembrolizumab, durvalumab, atezolizumab, radioisotopes, monomethyl auristatin E (MMAE), calicheamicins, deruxtecan, DM1, and any combinations thereof.

26. The composition for the use of any one of claims 15-25, wherein the inhibitory nucleic acid inhibits UXS1 by knockdown of the UXS1 gene expression.

27. A composition comprising a therapeutically effective amount of an inhibitor of UXS1, wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid targeting UXS1 or a CRISPR / CAS editing complex targeting UXS 1 for use in method of enhancing response to chemotherapy in a subject, preferably wherein the subject is diagnosed as having a UDGH-high cancer, thereby enhancing response to chemotherapy in the subject.

28. A composition comprising an inhibitor of UXS1, wherein the inhibitor of UXS1 comprises an inhibitory nucleic acid targeting UXS1 or of a CRISPR / CAS editing complex targeting UXS1, for use in suppressing tumor growth in a subject, preferablywherein the subject is diagnosed as having a UDGH-high cancer, thereby suppressing tumor growth in the subject.

Images