Bacterial strain capable of oxidizing elemental sulphur and use thereof for stimulating plant growth

Abstract

The present invention provides a new bacterial strain of the genus Variovorax capable of oxidising elemental sulphur, generating sulphate. When added to a soil, the bacterium can transform the elemental sulphur present into sulphate, the main soluble form of sulphur that can be absorbed by roots, providing plants with more sulphur available for their metabolic needs, stimulating their growth, and the yield of their crops. The use of the bacterium is proposed, optionally with added elemental sulphur, to stimulate plant growth and / or to act as a biostimulant for plants, as well as to modify or restore soils, especially alkaline, limestone, or saline soils, since the activity of the bacterium generates a reduction in pH, enrichment with sulphates, structural modifications, an increase in porosity, solubilisation of phosphorus salts, and other modifications.

Description

[0001] DESCRIPTION

[0002] Bacterial strain capable of oxidizing elemental sulfur and its use to promote plant growth

[0003] Technical Sector

[0004] The present invention relates to the field of microbiology, particularly bacteriology, and its applications, especially in agriculture and soil restoration. More specifically, the invention relates to a novel strain of the genus Variovorax capable of oxidizing elemental sulfur and its use in promoting plant growth.

[0005] Background of the Invention

[0006] Sulfur is an important nutrient for higher plants. They absorb it from the soil primarily in the form of sulfate, from where it is transported to the leaves and reduced to sulfite. It is then transformed into sulfur by the chloroplasts and subsequently metabolized to the amino acid cysteine, from which another important amino acid, methionine, is formed. These two amino acids are structural and functional components of proteins and enzymes, are vitally important for living organisms, and together contribute 11 to 31% of the total organic sulfur in the soil.

[0007] Thus, sulfur plays an essential role in the development and growth of plants, and even in the animals that ingest them. In addition to being involved in the construction of proteins, it is essential for the formation of chlorophyll (as it is the main constituent of one of the enzymes necessary for its formation), it is essential in the synthesis of oils in plants (especially in crops destined to obtain oil) and it is active in nitrogen metabolism.

[0008] Sulfur is a ubiquitous and abundant element on Earth, but its availability is insufficient to sustain plant growth. The main terrestrial sources of sulfur are volcanoes and certain rocks; marine reservoirs are ocean sediments and seawater. The proportion of sulfur used in agriculture is minuscule compared to the amount found in natural sources and generated by human activity (fossil fuels and industrial gases). Like nitrogen and phosphorus, sulfur is an element subject to various processes and transformations in nature, which constitute the sulfur cycle.

[0009] A few years ago, a significant contribution of sulfur to arable soils was the deposition of this element through acid rain, generated by the accumulation of sulfurous gases in the atmosphere, associated with the excessive use of petroleum products in industrial production, the global population explosion, and the intensity of agricultural practices, both in plant cultivation and livestock raising. All of these factors in the past had a negative impact on the chemical composition and quality of the global atmosphere, causing the greenhouse effect, which has been a determining factor in global climate change. In response to the adverse effects that this change has had on ecosystems, legislation was created that still regulates gas emissions into the atmosphere.And one of the chemical elements that was considered highly polluting was sulfur (S), to which rigorous regulation of use was applied, leading to a significant reduction in sulfur deposition from the atmosphere over the last 20 years.

[0010] The reduction in sulfur gas emissions has decreased acid rain, creating an imbalance in the sulfur cycle and in the element's uptake in the soil. This deficit, coupled with the continued practice of intensive agriculture, in which organic matter is scarce, inevitably leads to sulfur deficiency in agricultural soils. In addition, sulfur-free fertilizers began to be used, a situation that over the years, combined with the circumstances described above, has resulted in a deficiency of this nutrient in arable soils.

[0011] Thus, several countries have reported sulfur deficiency in agricultural soils in recent years, associating it with low production of various crops. In China, in 1997, 30% of that country's agricultural soil (approximately 40 million hectares) was found to be sulfur deficient, with the deficit estimated at 1.2 million tons per year. It was projected that by 2013 the requirement would rise to 2.4 million tons per year.

[0012] A lack of sulfur in plants causes a physiological imbalance, which is reflected at the agronomic level, although symptoms may vary among plant species. In general, deficient plants are smaller and grow slowly; since sulfur is not easily translocated from more mature leaves to younger leaves, sulfur deficiency is usually first manifested in the latter. For example, in corn, sulfur deficiency appears as interveinal chlorosis in young leaves; in wheat, the entire plant becomes pale, while younger leaves are more chlorotic. Some plants also have more pronounced sulfur requirements, as is the case, for example, with plants of the Brassicaceae family, such as those of the Brassica genus in particular (cabbage, cabbage, broccoli, cauliflower, etc.).), plants that reduce crop yield and the quality of harvested products when they have suffered from a sulfur deficiency during their growth.

[0013] Sulfur deficiency in arable soils generated the need to incorporate sulfur addition practices as a fertilizer in soils where intensive agriculture is practiced, this need being only behind those of nitrogen (N), phosphorus (P) and potassium (K).

[0014] Some of the agronomic aspects that are improved with the use of sulfur as a fertilizer include, for example, an increase in the concentration of protein, amino acids, and vitamins in forage, which positively impacts the nutrition of animals destined for human consumption. In a study conducted in Iran with three varieties of wheat, they found that fertilizing with sulfur increased grain production, protein concentration, and baking quality. In oilseeds, sulfur fertilization stimulates growth and improves productivity. Evaluations in vegetable crops have shown that achieving a balance of sulfur and nitrogen leads to greater quality and uniformity of vegetables, increased resistance to cold, increased tolerance to drought and salts, better control of soil pathogens, and an increase in the decomposition rate of plant residues and green manure.

[0015] Thus, sufficient sulfur in the plant maintains its productivity by aiding in the efficient use of other essential nutrients such as N, P, and K; it also improves defense against pathogen attack and is even important for maintaining crop quality.

[0016] Therefore, the proper use of sulfur leads to improved food quality and quantity, which would help counteract the food insecurity anticipated in the coming years, resulting from food losses due to climate change, population explosion, and water scarcity. Therefore, it is vitally important to monitor the sulfur content of arable soils and, if sulfur is deficient, to establish sulfur addition strategies necessary to move toward sufficient food production. And, when properly designing these strategies, the bioavailability of sulfur to plants must be taken into account.

[0017] The bioavailability of sulfur in the soil depends on multiple factors (including chemical, physical, and biological processes, as well as very important factors such as pH and soil type), which determine whether the transformation of sulfur forms that are not assimilable by plants into sulfate ions takes place, which is the main form in which sulfur can be absorbed by plants.

[0018] There are basically two forms of this element in the soil: the organic form, which represents more than 90% of the total existing reserve, but which is not available as such for use by plants, which need the intervention of soil bacteria and fungi for the mobilization of inorganic sulfate from said organic compounds, but the speed of transformation of organic forms into usable forms does not exceed 2% per year; and the inorganic form, as sulfate ions (SCU). 2- ), sulfides (S 2'), elemental sulfur (S°), sulfite (SO 2 '), thiosulfate (S2Ü3 2 ') and tetrathionate (S4Ü6 2 '), which can be found in soils combined with calcium, magnesium, potassium, sodium and ammonium.

[0019] Of all these forms, as already mentioned, the main form of sulfur in the soil available for plant uptake is sulfate ions. The current availability of free sulfate is insufficient to meet plant growth needs, especially in agricultural soils, where the decline in acid rain, the continued practice of intensive agriculture, and the use of sulfur-free fertilizers have resulted in sulfur deficiency in arable soils.

[0020] Due to this need, techniques have been developed to increase the levels of sulfur forms available in the soil for plant absorption, which can then be used by the plants to meet their metabolic needs.

[0021] Traditionally, the practices of adding sulfur to soils in agriculture have been carried out from compounds that mainly resulted in the generation of sulfate ions (the form of sulfur absorbed by the roots) and vary from very slightly soluble (agricultural gypsum) to very soluble (ammonium sulfate, magnesium sulfate, etc.).

[0022] Sulfate ion, which is soluble in water, is the form of sulfur most easily assimilated by plant roots. However, since it is present in soil solution, it is also susceptible to leaching to deeper horizons, where roots are no longer present, or even being completely eliminated from the soil profile by deep drainage. Therefore, one of the limitations of the aforementioned types of fertilizers or additives based on sulfate ion precursors is the natural leaching that occurs in soils: the movement of nutrients by infiltration and percolation water through the soil, which causes their loss at depth. Leaching therefore produces the displacement of soluble or dispersible substances (clay, salts, iron, humus, sulfate ions, etc.) and occurs to a greater extent in humid climates.It causes the upper soil horizons to lose their nutrients, carried away by water, and even become more acidic, as insoluble compounds such as aluminum are left behind. This can sometimes even cause toxicity. A large amount of fertilizers is also lost. Excessive irrigation and the use of highly acidic fertilizers contribute to this phenomenon, which, in the case of the addition of sulfur in the form of sulfate ion, results in the loss of said nutrient.

[0023] Another way of adding sulfur is through the addition of elemental sulfur, which is usually in the form of insoluble and hydrophobic particles, difficult to absorb through the roots, and for its absorption it must be transformed naturally and progressively in the soil into the sulfate ion. This oxidation process of elemental sulfur, as well as sulfides, sulfites, thiosulfates or tetrathionates, to give rise to sulfates, can occur through the action of different microorganisms present in the soil, mainly of the genera Thiobacillus, Acidithiobacillus, Pseudomonas, Arthrobacter, Bacillus and some fungi. Thiobacteria, for example, (such as, for example, Acidithiobacillus thiooxidans) present in the soil catalyze a natural biochemical reaction in which sulfuric acid is formally generated (which can amend alkaline soils) and also energy used in the metabolic process of the thiobacteria themselves: thiobacteria

[0024] S + O2 + H2O2 - > SO4 2 ' + 2H + + Energía

[0025] Unlike the use of techniques that add sulphur in the form of sulphates, the use of elemental sulphur in fertilization has the added value of its progressive transformation into the form that plants can assimilate, sulphate, avoiding losses through leaching because elemental sulphur is insoluble in water, and the supply of sulphate occurs during practically the entire vegetative cycle, through controlled release, determined by the availability of sulphate in the soil.Furthermore, it results in more porous and oxygenated soils, improves the efficiency of use of essential plant nutrients such as nitrogen and phosphorus, helping to solubilise insoluble phosphorus salts present in the soil by the action of the sulphuric acid formed, also providing an indirect nutritional value as a soil amendment (especially alkaline, calcareous and saline soils) and favouring the assimilation of microelements that are absorbed in the form of sulphates (iron, copper, zinc, etc.).

[0026] The other pathway for transforming sulfur-containing compounds into soluble forms usable by plants, involving microorganisms, is called mineralization. Mineralization is the conversion, through the action of microbiota present in the soil, of organic sulfur from residual organic matter from crops and livestock manure, giving rise to sulfate ions available to plants. Immobilization, on the other hand, is the opposite process, where microbiota transform available sulfur into unavailable organic sulfur. The immobilization process can also occur when the soil is acidic, which promotes sulfate immobilization by iron and aluminum oxides, as well as binding to positively charged sites such as clays.

[0027] Mineralization is an important process for plants, as organic sulfur compounds, particularly sulfonates and sulfate esters, can constitute more than 90% of the total sulfur present in a soil, especially if the soil has been used for agricultural or livestock purposes. Since the sulfur contained in these compounds is not available to plants, they depend entirely on soil microorganisms (primarily bacteria and fungi) for their mineralization.

[0028] In experiments carried out with different fertilization regimes of wheat (Schmalenberger et al., Environ Microbiol. 2008 Jun 10(6): 1486- 1500), the importance of α-sulfonates in the nutrition of desulfonating bacteria has been verified and also that the distribution of genera and species of desulfonating bacteria present in the growth soil of a plant varies greatly depending on the fertilization regime used and the level of inorganic sulfate present in the fertilizers, although it is noteworthy that several strains of the isolated desulfonating bacteria were from the genera Varíovorax and Polaromonas.

[0029] The mobilization of sulfate from aromatic and aliphatic sulfonates is catalyzed by a monooxygenase-like enzyme complex encoded by the ssu cluster. For the desulfonation of aromatic compounds such as arylsulfonates, ssu must be complemented by the as / RABC cluster, which includes the asfA enzyme. This enzyme is not only important for its activity, but also because it is used as a marker of the sulfonatase activity of various soil bacteria such as Varíovorax, Polaromonas, Acidovorax and phyhodococcus, and also in phylogeny studies of bacteria capable of mobilizing aromatic sulfonates, studies in which the analysis of 16S rRNA is also common, although it has been proposed to complement or replace it with the house-keeping gene rpoB, which encodes a protein (the beta subunit of RNA-directed RNA polymerase) and of which there is a single copy in each genome (Vos et al., PLOS ONE 7(2): e30600, https: / / doi.org / 10.1371 / journal.pone.0030600). These studies have expanded the diversity of beta-proteobactea, the class of Gram-negative bacteria to which the genera Varíovorax and Acidovorax belong, as well as Thiobacillus, a genus from which many members have disappeared and been reclassified into others due to genetic studies.

[0030] In fact, the family Comamonadaceae was a family created for organisms belonging to the same rRNA complex as Acidovorax (Willems et al., International Journal of Systematic and Evolutionary Microbiology, vol 41 (3): 445-450), which included the genera Comamonas, Acidovorax, Hydrogenophaga, Xylophilus and Varíovorax, as well as some species of Aquaspirillium and pathogenic Pseudomonas, which are very closely related genotypically, although quite diverse phenotypically. With the creation of the family, the genus Varíovorax was also created, to which the organism previously known as Alcaligenes paradoxus was transferred, becoming known as Varíovorax paradoxus. Several more species of the same genus are currently known, such as: V. boronicumulans, V. beijingensis, V. defluvii, V. dokdonensis, V. ginsengisoli, V. gossypii, V. guangxiensis, V. humicola, V. paradoxus, V. rhizosphaerae, V. robiniae, V. soli, V. ureilyticus.

[0031] Both the complete genome sequence of a strain of Varíovorax paradoxus, strain S110, and an extensive metabolic analysis of it are now available (Han et al., Journal of Bacteriology 2011 , 193(5):1183-1190). This strain and other species in the same genus are considered plant growth-promoting rhizobacteria that are good candidates for agrobiotechnological applications including the remediation of degraded soils and increased crop production, such as biofertilizer and biopesticide. It is also presented as a model of possible bacterial symbiosis with other microorganisms, being a common symbiont in the rhizosphere, capable of protecting plants by acting on toxic contaminants, promoting stress tolerance and resistance to diseases, and aiding in the uptake of various nutrients.Among the compounds it can metabolize are alkyl / arylsulfonates, as well as sulfur metabolites associated with petroleum. Its genome contains an alkane monooxygenase gene, ssuD (which enables its activity on alkylsulfonates) and another gene for the oxidoreductase asfA (which allows it to metabolize arylsulfonates). During the metabolism of sulfur compounds, sulfite is generated, which can be assimilated by certain associated microorganisms or reduced to hydrogen sulfide. The desulfurization of sulfonates is a critical factor in the growth-promoting effect of V. paradoxus, and the genus Variovorax is cited in the article as a key player in the mineralization of sulfur bound to carbon, contributing to its cycling in the soil between organic and inorganic forms.

[0032] Bacteria of the genus Varíovorax in general, and some specific strains in particular, have been proposed for various agrobiotechnological applications, sometimes in association with other microorganisms. Thus, for example, document W02020170244A1 , which deals with growth-promoting microorganisms and compositions containing them, as well as their use to promote the health, growth and yield of crops or to enhance traits such as yield, insect control, resistance to diseases, drought or herbicides, mentions a bacterium of the genus Varíovorax as a possible microorganism to be used for these purposes.

[0033] Document CN110079471A describes the V. paradoxus strain A06, with CTCC deposit number M 2018693, which has a growth-promoting effect, improving yield, fertilizer efficacy, and plant resistance. The study is carried out in the rhizosphere of legumes, where hydrogen is introduced for the isolated cultivation of hydrogen-oxidizing bacteria. The taxonomic study of the bacteria includes the identification of 16S rDNA.

[0034] Document CN102747019B, in turn, describes a strain of Varíovorax sp., deposited under CGMCC No. 5623, that can fix nitrogen and grows using insoluble phosphate as a phosphorus source, thereby improving fertilizer utilization and facilitating fertilizer absorption and root development. It also mentions its positive growth-promoting effect on peanuts.

[0035] The specific use of Variovorax strains as fertilizers, or in combination with fertilizers, has also been disclosed in various documents. Document CN107759362A describes a fertilizer composed of an organic component (including, among others, Chinese medicine residues, humic acid, and diatoms), an inorganic component (with potassium nitrate, urea, potassium dihydrogen phosphate, potassium sulfate, and others), and a functional bacterium, which may be, among others, of the Variovorax genus.

[0036] In other documents, the bacteria themselves are the main component of fertilizer, which is defined as a microbial fertilizer. This is the case in document CN 102603371, in which the proposed fertilizer must contain hydrogen-oxidizing bacteria (hydroxidobacteria) and may be their fermentation liquor, or may also contain peat moss. The bacteria may be of the genera Flavobacterium, Pseudomonas, Alcaligenes, or Burkholderia, or mixtures thereof, with Variovorax paradoxus being cited as one of the possible bacteria to be used.

[0037] Along similar lines, document KR20180024795A describes a natural fertilizer comprising natural microorganisms as an effective ingredient and an additive capable of enhancing the effect of the microorganisms, maximizing their growth-promoting effect. Guano and a surfactant are cited as possible additional ingredients. Variovorax is mentioned among the possible effective microorganisms.

[0038] Document RU2735429C1 also relates to bacterial fertilizers, which have a growth-stimulating effect on plants under unfavorable conditions, comprising bacterial cells and nutrient medium residues, the bacterial component being a mixture of Pseudomonas oryzihabitans B3S (RCAM deposit number 04752) and Variovorax paradoxus AV-10 (RCAM deposit number 04753).

[0039] The association of Variovorax with other microorganisms to impart beneficial properties to target plants, especially crop plants, can be described in various other publications. WO2017127535A1 , for example, describes a microbial consortium that can be composed of at least two bacteria (one of which can be Variovorax ginseng (solí)), and that can be used as a plant growth medium, or applied as a seed coating, influencing potential traits of interest such as modulating disease resistance, drought tolerance, heat tolerance, cold tolerance, salinity tolerance, metal tolerance, herbicide tolerance, chemical tolerance, improved water use efficiency, improved nitrogen use efficiency, pest and pathogen resistance, and various other traits of agronomic interest.

[0040] The reduction of pathogens in the soil has also been reported for bacteria of the genus Varíovorax in general, whole or lysed, together with intracellular components of yeasts inhabiting the rhizosphere, as can be seen in WO2012037352A2, in which the described compositions may also contain fertilizers.

[0041] Soil conditioning, either by degradation due to excessive fertilizer use or to reduce undesirable components, is also one of the properties for which the use of bacteria of the genus Varíovorax has been suggested. For example, document CN 115340420A describes a soil conditioner for reducing heavy metal content in crops, a conditioner that is also a fertilizer containing as main elements residual biogas and livestock and poultry droppings, ammonium nitrate and various sulfates, as well as bacteria, specifically Bacillus mecilaginosus and Varíovorax. Document CN111154691 A describes a Varíovorax strain capable of degrading chitin and cellulose, the strain with deposit number CGMCC No. 116908, which is a strain that can also convert insoluble phosphate into soluble phosphate in a targeted manner, improving the quality of soils degraded by excessive fertilizer use, also improving the immunocompetence of plants.

[0042] In addition to their use as fertilizer, or in combination with fertilizers, bacteria of the genus Varíovorax have also been described as plant biostimulants or as components of microorganism stimulants with properties of interest, as can be found in document WO2022097152A1, which describes the Varíovorax STS16 strain, which appears to promote the degradation of the herbicides Linuron or Diuron.

[0043] Plant biostimulants are a relatively new product category, the definition and regulations for their use not yet fully developed. Plant biostimulants are considered to be compounds or microorganisms, as well as compositions containing them, that help plants improve and regulate their physiological and biochemical processes, stimulating plant nutrition processes independently of the nutrient content of the composition they are part of (which differentiates them from fertilizers). These are generally based on two fundamental aspects: achieving a product based on a complex matrix, where the importance lies in the balance of substances supplied, and also ensuring that the active ingredient of that product is a catalyst, substrate, or reagent in a metabolic reaction.

[0044] Therefore, a biostimulant seeks to shift the natural biochemical reactions of plants toward one or more of the traits it is intended to promote, thereby improving one of the following aspects: a) improved nutrient use efficiency; b) better tolerance to abiotic stress; c) achieving crop quality characteristics.

[0045] In this way, biostimulants are not used to replace fertilizers, but can be used in conjunction with each other to achieve greater and better plant growth, since they provide additional protection against various types of stress, use fertilizer nutrients more efficiently, and improve their absorption.

[0046] Biostimulants can help address the inefficiencies in the field that persist today despite improved production practices. These products provide higher yields and quality, helping farmers produce more with less.

[0047] Each biostimulant can be formulated to produce different effects in one type of crop or another. Their specific uses can vary depending on the needs at hand:

[0048] • Increase crop tolerance to overcome abiotic stresses.

[0049] • Facilitate nutrient assimilation, translocation and use.

[0050] • Improve the efficiency of plant metabolism to induce yield increases and improve yield quality.

[0051] • Improve quality attributes: increase in sugars, color, harvest quality, size, etc.

[0052] • Improve soil fertility, especially by promoting the development of soil microorganisms.

[0053] • Achieving more efficient water use. Agricultural biostimulants therefore help address some of the most important challenges facing global agriculture in the coming years. A notable example is feeding a growing population, which requires increases in crop yields, which can be boosted by biostimulants. Extreme temperatures, water shortages, salinity, and other stresses related to climate change require resilient crops to optimize their yields. Along these lines, agricultural biostimulants increase plant tolerance to the adverse effects of abiotic stress, helping to protect and improve soil health by promoting the development of beneficial soil microorganisms. Healthy soil retains water more effectively and better resists erosion.Furthermore, biostimulation minimizes the use of chemicals because, by strengthening the plant's defenses, it is healthier and stronger to fight pests and diseases. It saves money and prevents waste.

[0054] On the other hand, agricultural biostimulants can improve the quality parameters of fruits and vegetables. Higher quality means greater profits for farmers and healthier and more nutritious food for consumers.

[0055] In general, biostimulants are considered to be grouped into the following categories:

[0056] - Humic and fulvic acids (natural constituents of the upper layer of the soil, humus, resulting from the decomposition of living beings, humic acids being the substances extracted from the soil humus that coagulate when treated with a strong base and fulvic acids being the part that remains soluble, while the part of the humus insoluble in alkali is called humin).

[0057] - Amino acids and peptide mixtures obtained from protein hydrolysis, as well as other nitrogenous substances such as betaines, polyamines and non-protein amino acids

[0058] Extracts of algae and plants or purified compounds such as laminarin polysaccharides, alginate and carrageenan.

[0059] Chitosans (in polymeric or oligomeric form) and other biopolymers.

[0060] Inorganic compounds (such as aluminum, cobalt, sodium, selenium or silicon, present both in the soil and in plants as different inorganic salts and as insoluble forms).

[0061] Beneficial fungi, such as mycorrhizal fungi and beneficial bacteria. Within the above classification, bacteria interact with plants in all possible ways. As with fungi, this interaction can range from parasitism to mutualism. Bacteria's niches extend from the soil to the interior of plant cells, with intermediate locations such as the rhizosphere. These associations can be permanent or temporary, and some are transmitted via seed. Their influence on the plant is diverse, from biogeochemical cycles, nutrient provision, increased nutrient use efficiency, induction of disease resistance, improved tolerance to abiotic and biotic stress, and even modulation of plant morphogenesis.

[0062] The new regulations regarding fertilizers and biostimulants for use in the European Union currently include a section on microorganisms beneficial to the soil. The current list includes: Azotobacter spp., mycorrhizal fungi; Fihizobium spp., and Azospirillum spp.

[0063] Being such a new and innovative sector (until a year ago there was no recognized definition of Biostimulant in the European Union), this list does not yet include sulfur-oxidizing bacteria or ferrooxidans, of the Acidithiobacillus genus, or other genera related to functions in the soil related to sulfur or phosphate, despite being essential microorganisms in the transformation of nutrients blocked in the soil, of the sulfate and phosphate type.

[0064] Although these microorganisms are not represented as such, the standard contemplates the possibility of including new organisms once they have been characterized and demonstrated to be effective for the stated purposes. For this reason, it is of particular interest to introduce into the agricultural market another sustainable, ecological tool with proven efficacy and benefits not only for crops but also for soils.

[0065] The use of natural, non-genetically modified microorganisms requires a scientific investment in the process of research, fermentation, and development, which is probably equivalent to the investment required for the search for genetically modified microorganisms or other synthetic fungicides. However, the use of these microorganisms has the enormous advantage of being able to perform functions currently unattainable by the most recent recombinant technology, CRISPR-Cas, due to the involvement of complex functioning and regulation gene systems. Furthermore, since these are natural soil microorganisms, there would be no regulatory barriers to their use, which do exist, notably, in Europe for all genetically modified organisms.

[0066] For all these reasons, it would be interesting to have a naturally occurring microorganism capable of promoting plant growth and that could be used as a biostimulant. In particular, given the existing need to monitor the sulfur content of arable soils and, in the event of a deficiency of this element, to establish strategies for its addition necessary to advance toward sufficient food production, it would be interesting for said microorganism to facilitate the use of elemental sulfur by plants, whether it is found naturally in the soil or is supplied to the soil in the form of elemental sulfur particles. As previously discussed, said microorganism should also preferably exhibit other properties sought in biostimulants.

[0067] The present invention provides a solution to that problem.

[0068] Explanation of the Invention

[0069] The present invention provides a bacterium of the genus Variovorax capable of oxidizing elemental sulfur (S°), giving rise to sulfate (SCU). 2- ), the main form of sulfur absorbable by plant roots. Therefore, by being present in the soil in which a plant grows, especially in the hydrosphere, it helps meet the plant's sulfur needs, increasing its availability so that the plant can use it as a nutrient. It also promotes the absorption and utilization of any added fertilizers, resulting in a positive growth-promoting effect for the plant and increasing crop yields. Thus, it is a plant growth-promoting bacterium.

[0070] The present invention can be considered an alternative to the use of thiobacteria, in which the bacteria used is a plant growth promoting bacterium that is part of the microorganisms naturally present in the hydrosphere of plants, for whose strains various effects have been described that can be considered biostimulants. The invention is based on the discovery of a strain of Varíovorax, isolated from nature, which, as can be seen below in the Examples section, exhibits this property. Specifically, this is strain AFSI 2.2, deposited in the Spanish Type Culture Collection (CECT) (Building 3 CUE, Parc Cientific Universitat de Valencia, Professor Agustín Escardino, 9 -46980 Paterna, Valencia, Spain) on 10 / 25 / 2022 with CECT number 30738, the depositor being Azufrera y Fertilizantes Pallaras, SAU.

[0071] This strain was obtained from a study in accordance with Royal Decree 124 / 2017, authorized by the General Directorate of Biodiversity, Forests and Desertification of the Ministry for Ecological Transition and the Demographic Challenge with number ESNC86, which granted authorization for access to Spanish genetic resources from wild taxa for the obtaining of native microorganisms from Spanish soils capable of solubilizing soil nutrients unavailable to plants, for the development of solutions that avoid chemical fertilization with soluble nutrients that can be leached, improving the effectiveness of fertilizers. Specifically, the AFSI 2.2 strain was isolated from the farm where the Azufrera y Fertilizantes Pallaras SAU (AFEPASA) facilities are located in Constant! , in the province of Tarragona.

[0072] The amplification and sequencing assays of the DNA that gives rise to the 16S rRNA (SEQ ID NO:1) and the comparison of the sequence with 16S ribosomal RNA sequences of other bacteria and archaea indicated that the bacterium is of the genus Varíovorax, which was confirmed when the search was carried out by comparing the aforementioned sequence with nucleotide sequences in general or when the search was carried out with a fragment of the rpoB gene also identified in the bacterium, as detailed below.

[0073] The discovery of this strain, with the indicated characteristic, was surprising because, as discussed in the previous section, no strains of the genus Variovorax were known to be capable of oxidizing elemental sulfur to sulfate. Until now, the main activity of bacteria of this genus on sulfur compounds was the release of sulfate from organic sulfur compounds, alkylsulfonates and / or alkylsulfonates. The AsfA gene, which encodes the enzyme involved in the transformation of alkylsulfonates, is one of the most commonly used genes for taxonomic studies of bacteria of this genus. However, the tests carried out show that one of the strains isolated in the aforementioned study, AFSI 2.2, is capable of oxidizing sulfur to sulfate.Furthermore, trials carried out with different horticultural plants (understanding horticulture as the activity aimed at the production of vegetables, both in large and small farms, considering vegetables as: legumes and greens, fruits, flowers and aromatic herbs) and with a cereal, wheat, show a biostimulant capacity for plant growth when added to irrigation water, the increase being generally greater when added together with elemental sulfur.

[0074] As previously discussed, the addition of sulfur in elemental form to alleviate sulfur deficiency in soils, as opposed to adding it directly in the form of sulfates, has several advantages, including avoiding losses due to leaching because it is insoluble in water. The bacteria of the present invention, when added to soil, directly to the root ball of the plant, or to the nutrient solution used to irrigate plants in hydroponic cultivation, enable or contribute to the presence of sufficient microorganisms in said soil, or in the plant's growing conditions, to lead to the transformation of said sulfur into the form that can be assimilated by plants, sulfate.This transformation is progressive, occurring throughout the vegetative cycle and is also, to a certain extent, controlled because, as there is a chemical equilibrium in the reaction, whenever there is a deficit of sulfates (which will be favored by their absorption by the roots of the plants to cover their metabolic needs), the reaction will shift in the direction of producing a greater quantity of said anion.

[0075] In addition to the direct nutritional value provided by the sulfate formed, this process provides indirect nutritional value as a soil amendment, promoting the assimilation of microelements within an optimal pH range. Along with the significant reduction in pH and conductivity, the sulfate ion serves as a vehicle for plants to incorporate microelements, absorbed in the form of sulfates (iron, copper, zinc, etc.). The efficiency of other essential plant nutrients, particularly nitrogen and phosphorus, is also improved, as the formation of sulfate helps solubilize insoluble phosphorus salts present in the soil through the action of the sulfuric acid formed, which will be in equilibrium with the sulfate. Regarding nitrogen, as previously mentioned, a balance between sulfur and nitrogen has been shown to be essential for better assimilation of the latter, avoiding the common losses due to evaporation.For all these reasons, a composition comprising the bacteria of the invention is also an aspect of the invention. Said composition may comprise, among others, at least one additional biostimulant. And, optionally, the composition may also comprise elemental sulfur.

[0076] The properties of the strain, which results in an increase in the yield of plants grown in a substrate to which the bacteria of the present invention has been added, allow the use of the bacteria of the invention, or of a composition comprising it, to promote plant growth and / or act as a biostimulant for the same to be considered as part of the invention. Due to the properties of the bacteria of the present invention, these effects will be favored in the presence of sulfur, so it is preferred that elemental sulfur be present in the soil in which the plant grows or in the nutrient solution administered to a plant in hydroponic cultivation.

[0077] The invention may be particularly useful for the cultivation of plants with especially high sulfur requirements, as is often the case with plants of the Brassicaceae family, such as those of the Brassica genus, such as the different varieties of the Brassica oleracea species (for example, cabbage (Brassica oleracea var. capitata), so-called broccoli (Brassica oleracea var. italica Plenck) or cauliflower (Brassica oleracea var. botrytis)).

[0078] It is also worth noting that, as it is a process that consumes oxygen, the transformation of elemental sulfur into sulfate contributes to more porous soils and promotes their oxygenation. This is also aided by the greater spherical volume of the sulfate ion, which is greater than that of elemental sulfur, thus widening the space occupied by the latter. Furthermore, this process favors the improvement of alkaline, calcareous, and saline soils, due to the significant reduction in pH and conductivity that occurs.

[0079] Therefore, the invention may also be useful for soil modification, amendment, and / or restoration, enabling the enrichment of a soil in sulfur salts, or also for the modification of properties such as pH, conductivity, or porosity. Thus, another aspect of the present invention is a method for the modification and / or restoration of a soil comprising at least one step of adding to the soil a bacterium of the present invention or a composition comprising a bacterium of the present invention. The modification produced in the soil may be, for example, an enrichment in sulfur salts, solubilization of phosphorus salts, a decrease in pH, an increase in conductivity, an increase in porosity, or mixtures of the foregoing.

[0080] Possible ways of carrying out the invention are explained in greater detail below.

[0081] Brief description of the drawings

[0082] Fig. 1 shows a plate with bromocresol purple, where the right area appears lighter in color (yellow in the original) due to the change in the original purple color caused by the action of the bacteria growing in that area.

[0083] Fig. 2 shows the results obtained in a greenhouse trial with broccoli, with respect to the weight of edible parts (panel A) and the height of the plants (panel B), in control plants (leftmost bar of each graph, filled in black), treated with the strain of the invention (middle bar, filled with vertical lines) and treated with the strain and elemental sulfur (rightmost bar of each graph, filled with horizontal lines). Each bar represents the mean of 8 plants. The standard deviation is also represented. Different letters above the bars indicate statistically significant differences between treatment groups.

[0084] Fig. 3 shows the results obtained in a greenhouse cabbage trial, with respect to plant height, in control plants (leftmost bar of each graph, filled in black) or treated with the strain of the invention (rightmost bar of each graph, filled with vertical lines, marked "AFSI 2.2"). Each bar represents the mean of 18 plants. The standard deviation is also represented. Different letters above the bars indicate statistically significant differences between the two treatment groups.

[0085] Fig. 4 shows the results obtained in a greenhouse trial with wheat, with respect to the weight of the cut plants (panel A) and the height of the whole plants (panel B), in control plants (leftmost bar of each graph) or treated with the strain of the invention (rightmost bar of each graph, marked "AFSI 2.2"). Each bar represents the mean of 12 plants. The standard deviation is also represented. Different letters above the bars indicate statistically significant differences between the two treatment groups. Fig. 5 shows the results obtained in a greenhouse trial with radish, with respect to the weight of the edible pieces (panel A) and the height of the whole plants (panel B), in control plants (leftmost bar of each graph) or treated with the strain of the invention (rightmost bar of each graph, marked "AFSI 2.2"). Each bar represents the mean of 12 plants. The standard deviation is also represented.Different letters above the bars indicate statistically significant differences between the two treatment groups.

[0086] Fig. 6 shows the results obtained for zucchini production harvested after outdoor cultivation of 40 control plants (leftmost bar of each graph) or 40 plants treated with the strain of the invention (rightmost bar of each graph, labeled "AFSI 2.2"). The standard deviation is also represented. Different letters above the bars indicate statistically significant differences between the two treatment groups.

[0087] Fig. 7 shows the results obtained in an outdoor broccoli cultivation trial, with respect to the weight of edible parts, in control plants (leftmost bar of the graph, filled in black), treated with the strain of the invention (middle bar of the graph, filled with vertical lines and marked "2. AFSI 2.2") or treated with the strain and sulfur supplementation (middle bar of the graph, filled with horizontal lines and marked "3. AFSI 2.2 + S"). Each bar represents the mean of 51 plants. The standard deviation is also represented. Different letters above the bars indicate statistically significant differences between the two treatment groups.

[0088] Fig. 8 shows the results obtained in an outdoor lettuce cultivation trial, with respect to plant vigor, in control plants (leftmost bar of the graph, filled in black), treated with the strain of the invention (middle bar of the graph, filled with vertical lines and marked "2.AFSI 2.2") or treated with the strain and with sulfur supply (middle bar of the graph, filled with horizontal lines and marked "3.AFSI 2.2 + S"). Each bar represents the mean of 12 plants. The standard deviation is also represented. Different letters above the bars indicate significant statistical differences between the two treatment groups. Preferred embodiments of the invention

[0089] As previously mentioned, the invention relates to a bacterium of the genus Varíovorax, characterized in that it is capable of transforming elemental sulfur into sulfate (SO4 2-). The bacteria also has the ability to promote plant growth.

[0090] Preferably, it is a bacterium that: a) comprises in its genome a DNA fragment with the sequence of SEQ ID NO:2 or a sequence that has a sequence identity with SEQ ID NO:2 greater than

[0091] 97%, 97.50%, 98.00%, 98.10%, 98.20%, 98.30%, 98.40%, 98.50%, 98.60%,

[0092] 98.70%, 98.80%, 98.90%, 99.00%, 99.05%, 99.10%, 99.15%, 99.20%, 99.25%

[0093] 99.30%, 99.35%, 99.40%, 99.45%, 99.50%, 99.60%, 99.65%, 99.70%, 99.75%

[0094] 99.80%, 99.85%, 99.90%, 99.91%, 99.92%, 99.93%, 99.94%, 99.95%, 99.96%

[0095] 99.97%, 99.98%, 99.99% or 99.995%; and / or b) comprises in its genome a DNA fragment with the sequence of SEQ ID NO:3; and / or c) comprises in its genome a DNA fragment with the sequence of SEQ ID NO:4, and / or d) comprises in its genome a DNA fragment with the sequence of SEQ ID NO:5.

[0096] As shown in Example 1, the bacterium also comprises in its genome a DNA fragment with the sequence SEQ ID NO:1.

[0097] The DNA fragment with the sequence SEQ ID NO:2, corresponding to a fragment of the rpoB gene, has a percentage of sequence identity with a fragment of the complete sequence of Varíovorax sp. RKNM96 of 96.58%, being the highest percentage of identity found when making a sequence comparison; therefore, the sequence of that fragment, by itself, is sufficient to characterize the bacterium of the present invention and distinguish it from any other. The sequence of SEQ ID NO:3, for its part, also corresponds to the rpoB gene but much broader, comprising the complete coding sequence of the product of that gene (the protein of SEQ ID NO:6), also characterizes the bacterium of the present invention.They also characterize the bacteria, and represent an alternative for this, the sequence of SEQ ID NO:4 and / or the sequence of SEQ ID NO:5, which together appear to represent the complete genome of the bacteria, so that any of them, or the verification of the presence of both, also allows the bacteria of the present invention to be identified. The DNA fragment with the sequence of SEQ ID NO:1 , for its part, corresponds to the 16S ribosomal RNA DNA of the bacteria of the present invention and characterizes it in combination with any of the previous ones, particularly complementing SEQ ID NO:2 or SEQ ID NO:3.

[0098] Any of the sequences SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, which are specific to the bacteria of the present invention and are not found in an identical form in another organism, can be used to identify the bacteria of the present invention, either individually or by combining the verification of the presence of combinations thereof. Thus, a method for identifying the presence of a bacterium of the invention in a sample or for identifying that a bacterium is the bacterium of the invention and not another, could include the step of verifying the presence of one of the sequences SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5 or combinations thereof. For greater security, the verification of the presence of one or more of these sequences could be combined with the verification of the presence of a DNA fragment with SEQ ID NO:1. For this purpose, the methodologies described below in Example 1 can be followed.Primers 27F 5' agagtttgatcctggctcag 3' (SEQ ID NO:9) and 1522R 5' aaggaggtgatccanccrca 3' (SEQ ID NO:10) can also be used for 16S rRNA DNA and Univ_rpoB_ deg 5' ggytwygaagtncghgacgtdca 3' (SEQ ID NO:11) and Univ_rpoB_R_deg 5' tgacgytgcatgttbgmrcccatma 3' (SEQ ID NO:12) for the rpoB gene for amplification by PCR or preferably, massive or next-generation sequencing techniques such as those of Illumina® (San Diego, California, USA: https: / / www.illumina.com), or any other method known to those skilled in the art that allows identifying the presence of a DNA fragment, with a known sequence, in a sample.

[0099] In that sense, it should be noted that, as used herein, the expressions “with the sequence of” or “whose sequence is” referring to a DNA fragment or a DNA molecule and followed by “SEQ ID NO:2, indicate that the DNA fragment or DNA molecule is represented by the nucleotide sequence identified by said “SEQ ID NO:”, that is, even if the DNA fragment or DNA molecule is or could be double-stranded, the nucleotide sequence identified by that “SEQ ID NO:” is the nucleotide sequence of one of the strands, indicated from the 5' end and 3' end, the sequence of the other strand being deducible from the complementarity rules relating to DNA molecules. The expression “a DNA fragment”, in turn, does not necessarily refer to a DNA fragment cleaved or separated from a larger molecule, but rather to a specific part or section of a DNA molecule.

[0100] More preferably, the bacterium is specifically the strain isolated by the present inventors, that is, the bacterium is the strain deposited in the Spanish Type Culture Collection (CECT) with the number CECT 30738.

[0101] The invention also relates to a composition comprising the bacteria of the invention. The concentration of the bacteria in said composition may vary depending on the plant to which the composition is to be administered and the characteristics of the soil in which it is growing, but indicative values ​​may be those in the concentration range of 10 6 - 10 8 CFU / ml (colony forming units per milliliter), particularly the value 10 8 CFU / ml.

[0102] The bacterium of the present invention possesses biostimulant properties, promoting the growth and yield of cultivated plants when present in the growing soil or nutrient supply medium. This bacterium triggers the transformation of elemental sulfur into sulfate, which promotes the absorption of sulfur in this soluble form by the bacteria. It therefore possesses biostimulant properties, as it stimulates a natural process, promoting plant growth and development, but without providing nutrients in itself. However, the compositions of the present invention may also comprise one or more additional biostimulants.Examples of possible biostimulants that may be present in the compositions of the present invention are humic acids and / or fulvic acids, amino acids, protein hydrolysis peptides, algae extracts, laminarin polysaccharides, alginate, carrageenan, polymeric chitosan, a chitosan oligomer, elemental aluminum, an aluminum salt, elemental cobalt, a cobalt salt, elemental sodium, a sodium salt, elemental selenium, a selenium salt, elemental silicon, a silicon salt, a mycorrhizal fungus, another biostimulant bacteria, or mixtures of the foregoing.

[0103] Fulvic acids, for example, promote plant growth and development, so they can be interesting when that is the trait that is desired to promote, also having the advantage of their solubility in alkaline solutions. Humic acids, for their part, are often applied to improve soil structure, so they can be interesting components of the compositions of the present invention, particularly when the composition is used in a method of the present invention for the modification and / or recovery of a soil. A mixture thereof can also be used in the same composition, which is a preferred embodiment of the compositions of the present invention, particularly when elemental sulfur is also present in the same composition. Preferred embodiments are also possible those that incorporate other additional biostimulants, such as any of those mentioned in the previous paragraph.

[0104] Other biostimulants, such as those from the group of amino acids, protein hydrolysis peptides, algae extracts (such as, for example, from the Chlorella genus), laminarin polysaccharides, alginate, carrageenan, polymeric chitosan and / or chitosan oligomers, may be suitable when, in addition to the biostimulant effect, the aim is to enrich the soil with organic matter. As in the case of the previous ones, the presence of one or more of them in a composition of the present invention is compatible with the presence of any other biostimulant or other additional component, such as elemental sulfur or another inorganic sulfur compound.

[0105] As for possible additional biostimulant microorganisms, thiobacteria, which can collaborate with the bacteria of the invention in the oxidation of elemental sulfur to sulfate, are particularly suitable for the purposes of the invention. Some of them have additional properties suitable for the purposes of the present invention, such as, for example, Acidithiobacillus ferrooxidans (which metabolizes iron and sulfur, producing sulfate), Acidithiobacillus thiooxidans (which metabolizes elemental sulfur, producing sulfate). Mycorrhizal fungi, which are associated with roots, may also be suitable, among which arbuscular mycorrhizal fungi, belonging to the Glomeromycetes class, are commonly used as biostimulants.

[0106] Preferably, whether or not there are one or more additional biostimulants, a composition of the present invention will also comprise elemental sulfur, but this is not essential, since, where elemental sulfur exists in the soil, the bacteria of the invention will facilitate its oxidation to sulfate, without the need for additional input. Sulfur may be, for example, in the form of granules, powder, or pellets. The compositions of the present invention may comprise any other additional components, whether or not additional biostimulants and / or elemental sulfur are present, especially if these are common components of compositions for agricultural or agronomic use.Possible additional components of interest may be, for example, phytosanitary products, one or more fertilizers or one or more inorganic sulfur compounds other than elemental sulfur, such as sulfur trioxide (SO3) or even some sulfate salt, since, although the bacteria of the invention favor the oxidation of elemental sulfur into sulfate ion, the invention is not incompatible with the presence of sulfates, or other sulfur compounds, in the same composition as the bacteria of the present invention.

[0107] It is preferred that the bacteria of the present invention be supplied with the irrigation water of the plant or, in the case of hydroponic crops, with the solution with which they supply the nutrients to the plants, so it is preferred that the compositions of the present invention be aqueous compositions, but any other compositions are equally included within the scope of the present invention, as long as they comprise the bacteria of the present invention.

[0108] Also included within the scope of the present invention are solid compositions comprising the bacteria of the present invention, which can be applied to the plants by placing them next to or near them on the soil surface or even applied in a layer of soil, preferably in the upper humus layer. The solid compositions will be administered to the soil as non-particulate solids or, preferably, in the form of particles, which can be in the form of granules of different sizes, or be in the form of pellets or powder. A granule is understood to be a small aggregate, normally in the form of a dry sphere, with an average size between 0.05 and 7 mm. A powder, on the other hand, is formed by more or less fine solid particles, usually with an average size between 30 and 500 µm, normally obtained by crystallization, drying, precipitation or grinding.A pellet, on the other hand, is a cylindrical aggregate, usually manufactured by compression and extrusion, with an average size of between 0.5 and 3 cm.

[0109] When the bacteria of the present invention are administered in the irrigation water, or when the composition of the present invention, in any of the possible embodiments related to its possible components, is in the form of irrigation water, as well as when a bacterium of the invention or a composition of the invention is used as a biostimulant or as part of a process of the invention for modifying, amending, recovering or bioremediating a soil, irrigation can be produced by any of the usual methodologies: surface or gravity (including irrigation by furrows, by boards or beds, by strips, by spreading by mouths, by tree pit, by facing from a ditch located on a slope that has small outlets, and irrigation by ponds), sprinkling, microsprinkling, drip, jets, hydroponic irrigation,misting and spraying (including drone-based methods with cameras and sensors specific to the needs of each area and the state of the vegetation), underground (e.g., by humidifiers placed under the plant)... Even in specific cases, direct injection can be used, for example into the root ball, as in some of the examples shown below.

[0110] The present invention is compatible with its use to promote growth and / or act as a biostimulant (promoting that or any other interesting characteristic, particularly yield or a factor influencing quality) of any plant. Horticultural or cereal plants are preferred, for example, those used in the Examples described below: broccoli (Brassica oleracea var. italica), cabbage (Brassica oleracea var. capitata), radish (Flaphanus sativos, also belonging to the Brassicaceaé family), lettuce (Lactuca sativa), zucchini (Cucurbita pepo), or wheat as a cereal (Triticum aestivum or Triticum vulgare, as well as other wheat species, such as Triticum spelta, Triticum durum, Triticum dicoccum or even Fagopyrum esculentum, known as buckwheat, or also hybrid varieties).Plants of the Brassicaceae family in general, and those of the Brassica genus in particular, as explained above, are also a possible preferred embodiment of plant for the use of the present invention.

[0111] In both the use of the bacteria of the present invention, or of a composition comprising it, to promote plant growth and / or act as a biostimulant therefor, and in the method of the present invention for the modification, amendment, recovery or bioremediation of soil, the bacteria of the invention or the composition of the invention may be administered in a single dose or in more than one dose, separated in time; this last alternative is the one chosen in the Examples presented below. As previously mentioned, elemental sulfur may or may not also be administered. If elemental sulfur is also administered, it may be done simultaneously with the bacteria of the present invention, preferably as part of the same composition, or it may be administered in doses different from those used to administer the bacteria of the present invention or a composition of the present invention.Preferably, if they are administered in separate doses, they will be spaced apart in time. Also preferably, if more than one dose of elemental sulfur and more than one dose of the bacteria of the present invention or of a composition of the present invention are administered, they will be alternated, as in the last test in the Examples herein. The time interval between the doses may be, for example, one week, as in said test, or a different one that is considered more appropriate depending on the specific conditions of the soil and / or the plants being grown.

[0112] It can thus be said that possible embodiments of the use of the present invention are those in which elemental sulfur is administered to the plant. These include the alternatives of administering them jointly and simultaneously (for example, in the same composition) or that the elemental sulfur is administered separately, in a different composition and separated in time, such that elemental sulfur is administered to the plant in one or more doses different from the administration dose(s) of the bacteria of the present invention or a composition of the present invention which, in that case, will not comprise elemental sulfur. Thus, the elemental sulfur and the bacteria of the present invention can be administered in the same composition or in different compositions and can be administered simultaneously or separated in time.

[0113] Similarly, in one possible embodiment, the method of the present invention may comprise one or more steps in which elemental sulfur is administered to the soil. Possible embodiments thereof are those in which the sulfur is administered together with the bacteria of the present invention (which is compatible with supplying the soil with a composition of the present invention comprising elemental sulfur), or those in which they are administered separately, preferably separated in time. A preferred embodiment of the method of the invention is one in which elemental sulfur is administered in one or more step(s) different from the step(s) of administering the bacteria of the present invention or a composition of the present invention lacking elemental sulfur.Within that possible embodiment, if there is more than one step of administering elemental sulfur and more than one step of administering the bacteria of the present invention, it is preferred that they alternate.

[0114] Also included within the scope of the present invention and possible embodiments of the use of the present invention or the method thereof are those in which there are more than one dose / steps of administration of bacteria of the present invention and at least two of them are consecutive, without it being necessary for there to be a sulfur administration step between them, as in the first tests of Example 2 herein. There may also be a single sulfur administration step and, regardless of whether or not there is sulfur administration, a single bacteria administration step.

[0115] Other possible combinations are also within the scope of the present invention.

[0116] Below are some Examples that will illustrate in greater detail the present invention and its possible embodiments.

[0117] Examples

[0118] Example 1. Isolation, selection, characterization

[0119] 1.1. Isolation of microorganisms

[0120] Within the framework of the study in accordance with Royal Decree 124 / 2017, authorized by the General Directorate of Biodiversity, Forests and Desertification of the Ministry for Ecological Transition and the Demographic Challenge with number ESNC86, samples of wild soil were taken from the facilities of the applicant, Azufrera y Fertilizantes Pallarés SAU (hereinafter abbreviated as AFEPASA), located in the Constantí industrial estate, in the province of Tarragona, an area particularly rich in elemental sulfur.

[0121] In addition to starting from a soil very rich in sulfur, which in itself shapes microbial populations, enhancing those involved in the sulfur cycle, for the isolation a procedure was carried out that has been known for years consisting of enriching the soil sample in a medium containing elemental sulfur, to enhance the development of sulfur-oxidizing bacterial communities and be able to select them, thus facilitating the detection of sulfur-oxidizing bacteria.

[0122] Thus, to carry out the isolation, based on a soil enrichment approach in sulfur-oxidizing bacteria, aliquots of the soil samples were suspended in water and kept under stirring for 2 h, after which dilutions of the soil samples were prepared up to 10 -6. From the last three dilutions, 100 microliters were seeded in Erlenmeyer flasks. For this purpose, Erlenmeyer flasks were arranged with three different media, two containing elemental S: liquid Twin Pack broth containing micronized elemental S with the addition of dispersant and the same medium with the addition of liquid S at 85% purity, and also another liquid medium, Thiosulfate Medium:

[0123] Medium sulfur: TWIN PACK Broth

[0124] Ingredients g / Liter

[0125] Part A

[0126] KH2PO4 3 g

[0127] MgSO4-7 H2O 0.5 g

[0128] (NH4)2SO40.3 g

[0129] CaCl2-2 H2O 0.250 g

[0130] FeCls'6 H2O 0.02 g

[0131] Part B

[0132] Elemental sulfur 10 g final pH (25°C) 4.8±0.2

[0133] Thiosulfate medium

[0134] Ingredients a / liter

[0135] Na2S2C>3 5 gr

[0136] KH2PO40.1 gr

[0137] NaHCO30.2 gr

[0138] NH4CI 0.1 gr

[0139] The Erlenmeyer flasks were placed under constant shaking at 160 rpm and 28°C, incubating for 25 days. After this, an aliquot of each culture was removed and inoculated again into another batch of Erlenmeyer flasks with the same culture medium, incubating them for another 25 days under the same conditions.

[0140] From these last cultures, aliquots were seeded in Petri dishes with solid thiosulfate culture medium, adding 1.5% agar and traces of bromcresol purple as an indicator, colonies that turned the medium from purple to yellow (Fig. 1), due to the production of acid as a consequence of the oxidation of thiosulfate, which indicated that the isolated strain corresponded to sulfur-oxidizing bacteria. This culture medium is typically used in the detection and isolation of sulfur-oxidizing bacteria, since by using elemental sulfur or thiosulfate as an energy source they produce sulfuric acid that turns the pH of the medium towards acidic values ​​that are detected by the indicator (bromcresol purple), according to the protocols and procedures established in Veerender et al., 2014 Progressive Research 104-107; Reddy et al., 2018 Int J Curr Microbiol App Sci 7: 2639-2644.

[0141] Following the previous procedure, the bacterial strain designated AFSI 2.2 was selected as a bacterium capable of oxidizing elemental sulfur and transforming it into sulfate. As indicated by genome analysis, the bacterium also possesses the ability to oxidize elemental sulfur and transform it into sulfate.

[0142] It was found that trypticase soy agar (TSA) CECT 20 can be used as a bacterial culture medium under aerobic conditions. Incubation time: 48–72 hours. Incubation temperature: 26°C ± 2°C. Resistant to freezing and lyophilization.

[0143] 1.2. Characterization

[0144] The taxonomic classification was entrusted to Secugen SL (Madrid, Spain). For this purpose, total bacterial DNA was obtained from a colony isolated from a culture plate by standard methods using the QIAcube® robot and the QIAamp® DNA Blood Mini kit (Qiagen, Hilden, Germany). From this, the gene that gives rise to 16S rRNA was amplified using the universal primers 16SF1-M13-F17: 5' gtaaaacgacggccagtgastttgatcctggctyag 3' (SEQ ID NO:7) and 1492-M13-R19: 5' ggaaacagctatgaccatgcggttaccttgttacgactt 3' (SEQ ID NO:8) under the following PCR conditions: 95°C 15 min: (95°C 30 s + 56°C 40 s + 72°C 1 min) x 35 + 72°C 8 min + 4 o, using TaqGoId® polymerase from Applied Biosystems (Massachusetts, USA). Sequencing of the amplified fragment was carried out from both ends, using the BigDye 3.1 reagent from Applied Biosystems (Massachusetts, USA), and subsequent capillary electrophoresis in an ABI 3730x1 automatic sequencer (Thermo Fisher Scientific, Alcobendas, Madrid, Spain), obtaining the sequence represented by SEQ ID NO:1. Comparison of the sequence, using the basic local alignment search tool, BLAST (Altschul et al., Journal of Molecular Biology 215 (3): 403-410) of the National Center for Biotechnology Information, NCBI (accessible at: https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&BLAST_SPEC=GeoBlast&PA GE_TYPE=BlastSearch) with the reference sequences existing in the database of 16S ribosomal RNA sequences of other bacteria and archaea ("16S ribosomal RNA sequences (Bacteria and Archaea)", accessible at: https: / / www.ncbi. nlm.nih.gov / nuccore?term=33175%5BBioProject%5D+OR+33317%5BB¡ oProject%5D), indicated that the bacteria is from the genus Varíovorax. The compared fragment showed an identity greater than 99.5% but less than 99.70% (specifically, 99.65%) with a strain of the species Varíovorax paradoxus (specifically strain NBRC 15149), and with an identity greater than 98.5% with other strains of Varíovorax.

[0145] Comparison of SEQ ID NO:1, also using the BLASTN tool, with the nucleotide collection accessible in the standard NCBI databases (which is a non-curated database and therefore with a lower degree of review and control than the previous one), without restrictions regarding the possible coded product, confirmed the ascription of the strain to the genus Varíovorax since, of the first 24 sequences with respect to which a high percentage of identity was found (percentage ranging from 100.00% to 99.58%), only the three strains for which no genus was identified did not appear as members of the genus Varíovorax.

[0146] Subsequently, amplification of a partial sequence of the rpoB gene (SEQ ID NO:2) was carried out at IRNASA-CSIC with the primers Univ_rpoB_F deg 5' ggytwygaagtncghgacgtdca 3' (SEQ ID NO: 11) and Univ_rpoB_R_deg 5' tgacgytgcatgttbgmrcccatma 3' (SEQ ID NO: 12) (Ogier et al., 2019 (BMC Microbiology (2019) 19:171 https: / / doi.org / 10.1186 / s12866-019-1546-z).

[0147] The sequence of SEQ ID NO:2, confirmed again the assignment of the strain to the genus Varíovorax. This sequence showed a high percentage of identity with sequences corresponding to the rpoB gene of strains of the genus Varíovorax, the highest percentages being those corresponding to the strains Varíovorax sp. RKNM96 (96.58%), Varíovorax sp. PMC12 (96.32%), Varíovorax sp. PDNC026 (96.32%), Varíovorax sp. PAMC26660 (96.32%) and Varíovorax paradoxus EPS (96.32%).

[0148] For genome sequencing, bacterial DNA was extracted using the Qiagen MagAttract HMW DNA kit (Qiagen Iberia, Las Rozas, Spain). The preparation was enriched with the Short Fragment Eliminator reagent from Oxford Nanopore, ON (Oxford, UK). DNA sequencing was performed using ON technology: libraries were generated using the SKQ-LSK114 kit and labeled by ligation with barcoc / ng FSQK-NBD114.96 was sequenced with the MinlON equipment in a FLO-MIN114 vR10.4.1 flow cell at a sequencing speed of 400 bp / s, obtaining 560.4 Mb of sequence. The reads were reanalyzed with “Super accurate” quality and an average quality of 20.4 was obtained. A duplex type analysis was performed to obtain higher quality reads. Reads that do not contribute to the duplex type reads are selected and added to the duplex reads to perform the assembly after eliminating reads with a quality lower than 11. The quality analysis was done with the Nanoplot software version 1.36.2 (De Coster, W. (2018). NanoPlot. In GitHub repository. https: / / github.com / wdecoster / NanoPlot).

[0149] From the genome sequencing, the sequences SEQ ID N0:4 and SEQ ID N0:5 were obtained.

[0150] This sequence was automatically annotated using SEED viewer and the RAST 2.0 server (Rapid Annotation using Subsystem Technology) [Azid et al 2008 BMC Genomics 9, 75; Overbeek et al 2014 Nucleic Acid Resarch 42, D206-2014]. According to the data from this analysis, the sequence has a size of 6,096,876 base pairs and a G+C content of 66.2, presenting 2 contigs (SEQ ID NO:4 and SEQ ID NO:5) and 5808 coding sequences, and the number of RNAs was 57.

[0151] Likewise, the genome sequence was also annotated and analyzed with the AntiSMASH server (Marnix et al., 2011 Nucleic Acid Research doi: 10.1093 / nar / gkr466) to analyze the existence of secondary metabolite biosynthesis gene clusters. The results of these analyses revealed the presence of genes involved in plant growth promotion mechanisms such as the presence of auxins and siderophores such as Variochelina A and B as well as genes encoding terpenes, which supports the good agronomic performance of the strain in the tests carried out, as shown in Example 2.

[0152] The genome sequence was also analyzed to determine the taxonomic affiliation of strain AFSI 2.2 and its precise identification, for which the average nucleotide identity (ANIb) was analyzed using the JSpecies server [Ritcher and Mora, 2009, PNAS 106, 19126-19131; Ritcher et al., 2016; Bioinformatics 32(6), 929-931], Digital DNA-DNA hybridization (dDDH) values ​​were also calculated using the GGDC server (DSMZ genome-to-genome distance calculator (GGDC 2.1) (http: / / ggdc.dsmz.de / ggdc.php / ). These values ​​were calculated using formula 2 on the GGDC website. The ANIb and dDDH values ​​of strain AFSI2.2 were calculated relative to the type strains of the phylogenetically closest Variovorax species. The ANIb results (Table 1) show that strain AFSI 2.2 is phylogenetically closest to V. paradoxus with 88.46% ANIb. The ANIb values ​​of AFSI 2.2 with respect to the rest of related species of the genus Variovorax range between 78.91-87.97%. Regarding the dDDH values, the AFSI 2.2 strain presents 43.30% with respect to the phylogenetically closest species, V. paradoxus, and lower values ​​with respect to the other Variovorax species studied. These values ​​are much lower than the threshold values ​​recommended for the differentiation of bacterial species, which are ANIb values ​​lower than 95-96% and a dDDH value lower than 70% [Goris et al., 2007; Ritcher and Mora, 2009].

[0153] Therefore, the AFSI 2.2 strain belongs to a new species within the Variovorax genus, not yet described to science, which ensures its uniqueness and novelty.

[0154] Table 1. AN Ib values ​​of strain AFSI 2.2 relative to phylogenetically related Variovorax species

[0155] Variovorax Variovorax Variovorax Variovorax Variovorax Variovorax sp. boromcumulans guangxiensis paradoxus soli NBRC beijmgensis 502

[0156] AFSI2.2 g oss yP" NBRC 103145 DSM 27352 NBRC 15149 106424 [T]

[0157] Variovorax sp *83 14 85 17 84 88 89 51 79 22 88 62

[0158] AFSI2 ' 2 (55.23) (41.72) (45.48) (47.88) (35.03) (73.61)

[0159] Variovorax 83 06 *85 49 90 37 84 67 78 45 83 39 gossypii (53.92) (40.63) (47.38) (40.87) (31.10) (57.52)

[0160] Variovorax 84.00 84.88 85.89 85.05 78.87 84.80 boronicumulans *

[0161] NBRC 103145 (66.65) (65.07) (73.86) (69.00) (57.17) (70.89)

[0162] Variovorax 83.88 89.85 85.80 84.91 78.75 84.68 guangxiensis *

[0163] DSM 27352 (65.93) (69.73) (67.87) (69.46) (53.06) (69.33)

[0164] Variovorax 88.46 84.01 85.06 84.96 78.75 93.70 paradoxus *

[0165] NBRC 15149 (74.39) (64.09) (67.34) (73.86) (57.21) (84.41) / . 78.91 78.61 79.73 79.49 79.55 79.44

[0166] Variovorax solí *

[0167] NBRC 106424 (63 1 1) (56.33) (65.04) (66.26) (66.74) (66.99)

[0168] Variovorax 87.97 83.05 85.09 84.92 93.65 79.09 beijingensis *

[0169] 502 [T] (66.95) (53.71) (40.90) (43.88) (49.85) (34.08)

[0170] 1.3. Deposit of biological material in accordance with the Budapest Treaty

[0171] The bacterial strain AFSI 2.2, whose isolation and characterization are disclosed in this application, was deposited with the Spanish Type Culture Collection (CECT), Pare Cientific Universitat de Valéncia, Professor Agustín Escardino, 9, 46980 Paterna, Valencia, Spain, under the conditions of the Budapest Treaty, with Azufrera y Fertilizantes Pallares, SAU, with registered address at Avda. The date of deposit and the assigned number are as follows:

[0172] Example 2. Tests with plants

[0173] To test the effect of adding the isolated and selected strain, AFSI 2.2, crop trials were conducted on several plants, both in greenhouses and outdoors, and AFSI 2.2 was added to irrigation water, which either lacked or also included elemental sulfur. The specific trials conducted are described below.

[0174] 2.1. Broccoli in a greenhouse

[0175] A greenhouse trial was conducted under uncontrolled environmental conditions (greenhouse conditions dictated by outdoor environmental conditions) to evaluate the efficacy of the AFSI 2.2 bacterium as a sulfur oxidizer and its effect on broccoli plants. The trial ran from October 2020 to January 2021, using control plants that received neither the bacteria nor elemental sulfur.

[0176] Twenty-four seedlings (8 plants per treatment) of the Parthenon variety, approximately 10 cm in diameter, were transplanted into 22 cm high and 22 cm diameter pots purchased from Babyplant (Santomera, Murcia). The pots were placed on two different tables, with 4 pots of each treatment on each table. The plants were allowed to grow for a week, with drip irrigation directed to the root ball at 1-3 liters of water / day, applied every 24 hours. The plants were then maintained under the same conditions, except that treatment was started according to the schedule indicated in Table 2 below:

[0177] Table 2.- Greenhouse broccoli trial regime

[0178] - Application A: Microsul 40S (AFEPASA) mixed in water at 0.02% v / v. Total nutrients supplied: 0.4 g elemental sulfur + 0.02 g iron chelate. 50 ml applied to the root ball by syringe. No additional NPK (nitrogen, phosphorus, potassium) fertilizer was applied.

[0179] - Application B: 40 ml of AFSI 2.2 bacteria suspension in water were prepared, at a concentration of 10 6 CFU / ml. 1 ml of the suspension was applied to each pot, using a syringe, directly to the root ball.

[0180] - Application C: 40 ml of AFSI 2.2 bacteria suspension in water were prepared, at a concentration of 10 6 CFU / ml. 1 ml of the suspension was applied to each pot, using a syringe, directly to the root ball.

[0181] - Assessment and cutting: The height of each plant was measured (in centimeters), the piece was cut at ground level and the entire piece was weighed (in grams) and then the head was cut (which would be equivalent to the edible piece) and weighed (in grams).

[0182] The results obtained regarding the height and weight of the edible piece are shown in Fig. 2, where the average value of the 8 pots of each treatment can be seen, as well as the standard deviation.

[0183] As can be seen in the figure, applying the AFSI 2.2 bacteria increases the weight of the broccoli head; adding elemental sulfur also increases the weight of the head compared to the control. Height increases with the application of the AFSI 2.2 bacteria, but the effect is greater if an elemental sulfur supplement is also applied.

[0184] 2.2. Cabbage in a greenhouse

[0185] The greenhouse trial in section 2.1 was repeated to evaluate the efficacy of the AFSI 2.2 bacteria as a growth biostimulant for cabbage plants, specifically the Green Lunar F1 variety, purchased from Babyplant (Santomera, Murcia). The trial was carried out from February 2022 to May 2022, using control plants that received neither bacteria nor elemental sulfur. For each treatment, 18 pots measuring 22 cm in height and 22 cm in diameter (6 pots x 3 tables) were used, into which seedlings of approximately 10 cm were transplanted. The trial began on February 1, 2022, and a treatment and irrigation regime similar to that followed in section 2.1 was followed, except for the addition of phosphate and nitrogen in the first application, the application in which sulfur was supplied, as can be seen in Table 3 below:

[0186] Table 3.- Greenhouse cabbage trial regime

[0187] - Application A: Soil preparation for all plants, including those in the control group: o Microsul 40S (AFEPASA) mixed in water at 0.02% v / v. Total nutrients supplied: 0.4 g of elemental sulfur + 0.02 g of iron chelate. 50 ml applied by syringe to the root ball. o Tricalcium phosphate: mixed in water at 10% w / v. Total nutrients supplied: 0.05 g of phosphorus and 0.22 g of calcium (CaO). Applied by syringe to the root ball. o Stilo Verde (SIPCAM Iberia, Valencia, Spain) mixed in water at 0.5% v / v. Total nutrients supplied: 0.2 g of nitrogen. Applied by syringe to the root ball

[0188] - Applications B, C, D, E and F: 60 ml of AFSI 2.2 bacteria suspension in water were prepared, at a concentration of 10 8 CFU / ml. 1 ml of the suspension was applied to each pot of the AFSI2.2 treatment, using a syringe directly to the root ball.

[0189] - Assessment and cutting: The height of each plant was measured (in centimeters).

[0190] The results obtained regarding the height and weight of the edible piece are shown in Fig. 3, where the average value of the 18 pots of each treatment can be seen, as well as the standard deviation.

[0191] As can be seen in the figure, when applying the AFSI 2.2 bacteria, an increase in the growth of the cabbage plant, valued as height, is observed.

[0192] 2.3. Radish and wheat in a greenhouse

[0193] The greenhouse trial in section 2.2 was repeated to evaluate the efficacy of the AFSI 2.2 bacterium as a growth biostimulant for wheat (Hybiza variety) and radish (round red variety) plants, both purchased as seeds from Fito (Barcelona, ​​Spain: www.semillasfito.es) and sown on 3 February 2022. The trial was carried out from June 2022 to September 2022. Twelve pots (6 pots x 2 tables) were used for each treatment. Treatment started on 17 June 2022 and followed a treatment regime similar to that followed in section 2.2, as shown in Table 4 below:

[0194] Table 4.- Greenhouse test regime with radish and wheat

[0195] - Transplant: to pots 22 cm high and 22 cm in diameter.

[0196] - Application A: Soil preparation for all plants, including those in the control group: o Microsul 40S (AFEPASA) mixed in water at 0.02% v / v. Total nutrients supplied: 0.4 g of elemental sulfur + 0.02 g of iron chelate. 50 ml applied by syringe to the root ball. o Tricalcium phosphate: mixed in water at 10% w / v. Total nutrients supplied: 0.05 g of phosphorus and 0.22 g of calcium (CaO). Applied by syringe to the root ball. o Potassium nitrate mixed in water at 0.1% w / v. Total nutrients supplied: 0.007 g of nitrogen and 0.012 g of potassium (K2O). Applied by syringe to the root ball

[0197] - Applications B and D: 60 ml of AFSI 2.2 bacteria suspension in water were prepared, at a concentration of 10 8 CFU / ml. 1 ml of the suspension was applied to each pot of the AFSI2.2 treatment using a syringe, pointing at the root ball.

[0198] - Applications C and E: For all plants, including those in the control group: Potassium nitrate mixed in water at 0.1% w / v. Total nutrients supplied: 0.007 g of nitrogen and 0.012 g of potassium (K2O). Applied by syringe to the root ball.

[0199] - Evaluation and cutting: The height of each complete plant was measured (in centimeters), the piece was cut at ground level and the entire piece was weighed (in grams) and then, in the case of the radish, the part that would be equivalent to the edible piece was cut and weighed (in grams).

[0200] The results obtained regarding the height and weight of the cut plant (in wheat) and the height of the cut plant and the weight of the edible part (radish) are shown in Fig. 4 and 5, respectively, where the average value of the 12 pots of each treatment can be seen in each bar, as well as the standard deviation.

[0201] As can be seen in the figure, applying the AFSI 2.2 bacteria increases both height and weight, with the effect being particularly pronounced on the weight of cut wheat plants.

[0202] 2.4. Broccoli, lettuce, and zucchini outdoors

[0203] A trial was conducted on field-grown plants outdoors to confirm the efficacy of the AFSI 2.2 bacteria as a biostimulant. It was administered in liquid form along with the irrigation water and its effect on zucchini, broccoli, and lettuce plants was evaluated.

[0204] In all cases, whether the soil was planted with control plants or plants treated with AFSI 2.2 bacteria, a sulfate-free organic fertilizer was applied to the growing soil one week before transplanting, to reproduce the usual growing conditions of these plants as closely as possible. This pre-transplant application consisted of a dose of 5 kg / ha of UREA PRILL (ICL Iberia, Totana, Spain), which represents a total application of 2.3 kg of nitrogen per hectare (ha).

[0205] In all cases, one week after the pre-transplant application, approximately 10 cm seedlings of each of the indicated species were transplanted into the soil in their corresponding crop fields to begin the trial. Sulfur applications were made using drip irrigation, while the bacteria were applied directly to the root ball by syringe. The plants were allowed to grow for a total of 105 days, after which they were harvested and the harvested products were evaluated. The specifics of the trial for each plant are indicated below.

[0206] 2.4.1. Zucchini.

[0207] - Variety: Icarus (supplied by Babyplant, Santomera, Murcia, Spain) Trial location: Torre Pacheco (Murcia, Spain)

[0208] Number of plants: 40 plants per treatment: control (without applying AFSI bacteria)

[0209] 2.2) or AFSI 2.2 (with application of AFSI 2.2 bacteria)

[0210] Planting density: 11,111 plants / Ha Trial period: January to May 2022

[0211] Treatment regimen: see Table 5

[0212] Table 5.- Outdoor zucchini trial regime

[0213] - Applications A, B and C: 60 ml of AFSI 2.2 bacteria suspension in water were prepared, at a concentration of 10 8 CFU / ml. 1 ml of the suspension was applied directly to the root ball of each plant using a syringe.

[0214] - Assessment and harvest: The commercial product portion of each plant was harvested and the total zucchini production was calculated by extrapolating it to kilograms / hectare (kg / Ha).

[0215] The results obtained are shown in Fig. 6, which represents production and standard deviation. As can be seen in this figure, applying the AFSI 2.2 bacteria increases the amount of zucchini produced.

[0216] 2.4.2. Broccoli.

[0217] - Variety: Parthenon (supplied by Babyplant, Santomera, Murcia, Spain) Trial location: Murcia, Spain

[0218] Number of plants: 51 plants per treatment: control (without applying AFSI 2.2 bacteria), AFSI 2.2 (with application of AFSI 2.2 bacteria) and AFSI 2.2 +S (with application of AFSI 2.2 bacteria and elemental sulfur)

[0219] Trial period: January to May 2022 Treatment regimen: see Table 6

[0220] Table 6.- Outdoor broccoli trial regime

[0221] - Applications A, C, and E: Organosul 40S (AFEPASA) mixed in water at 0.02% v / v. Total nutrients supplied: 0.2 g elemental sulfur + 0.04 g humic extract. Applied via drip irrigation.

[0222] - Applications B, D and F: A suspension of AFSI 2.2 bacteria in water was prepared at a concentration of 10 8CFU / ml. 1 ml of the suspension was applied directly to the root ball of each plant using a syringe.

[0223] - Assessment and harvest: The part corresponding to each plant's commercial product (the pellet, which is the edible part) was harvested and the harvested part of each plant was weighed.

[0224] The results obtained are shown in Fig. 7, which represents the mean value of the weights obtained and the standard deviation. As can be seen in this figure, applying the AFSI 2.2 bacteria increases the weight of the edible portion of the broccoli plants, with the increase being greater if a source of elemental sulfur is also applied along with the bacteria.

[0225] 2.4.3. Lettuce.

[0226] - Variety: Iceberg (supplied by Babyplant, Santomera, Murcia, Spain)

[0227] Location of the test: Xilxes, Castellón, Spain

[0228] Number of plants: 12 plants per treatment: control (without applying AFSI bacteria)

[0229] 2.2), AFSI 2.2 (with application of AFSI 2.2 bacteria) and AFSI 2.2 +S (with application of AFSI 2.2 bacteria and elemental sulfur)

[0230] Trial period: January to May 2022

[0231] Treatment regimen: see Table 7

[0232] Table 7.- Outdoor lettuce trial regime

[0233] - Applications A, C and E: Organosul 40S (AFEPASA) mixed in water at 0.02% v / v. Total nutrients supplied: 0.2 g elemental sulfur + 0.04 g humic extract. Applied by drip irrigation. - Applications B, D and F: A suspension of AFSI 2.2 bacteria in water was prepared at a concentration of 10 8 CFU / ml. 1 ml of the suspension was applied directly to the root ball of each plant using a syringe.

[0234] - Assessment and harvest: The vigor of each plant was measured, grams per bud, and the average value was calculated for each treatment group.

[0235] The results obtained are shown in Fig. 8, which represents the mean of the values ​​obtained in each group, as well as the standard deviation. As can be seen in this figure, applying the AFSI 2.2 bacteria increases the vigor of the lettuce plants, with the increase being greater if a source of elemental sulfur is also applied along with the bacteria.

[0236] It can be concluded that treatment with AFSI 2.2 generally improves the growth of the plants to which it is applied and / or their yield with respect to the part of the plant that is harvested, an effect that is generally favored when elemental sulfur is also administered, although the need or convenience of this additional treatment may be determined by the soil conditions and the needs of each plant.

Claims

CLAIMS 1. A bacterium of the genus Variovorax, characterized by its ability to transform elemental sulfur into sulfate.

2. The bacterium according to claim 1, comprising in its genome: a DNA fragment of SEQ ID NO 2 or a fragment whose sequence has an identity greater than 97%, 97.50%, 98.00%, 98.10%, 98.20%, 98.30%, 98.40%, 98.50%, 98.60%, 98.70%, 98.80%, 98.90%, 99.00%, 99.05% 99.10%, 99.15%, 99.20%, 99.25%, 99.30%, 99.35%, 99.40%, 99.45% 99.50%, 99.60%, 99.65%, 99.70%, 99.75%, 99.80%, 99.85%, 99.90% 99.91%, 99.92%, 99.93%, 99.94%, 99.95%, 99.96%, 99.97%, 99.98% 99.99% or 99.995% with SEQ ID NO:2; and / or a DNA fragment of SEQ ID NO:3; and / or a DNA fragment of SEQ ID NO:4, and / or a DNA fragment of SEQ ID NO:5, 3. The bacterium according to claim 2, comprising in its genome a DNA fragment of SEQ ID NO:

1.

4. The bacterium according to any one of claims 1 to 3, which is the bacterium deposited in the Spanish Collection of Type Cultures (CECT) with the number CECT 30738.

5. The bacterium according to any one of claims 1 to 4, which has the ability to promote plant growth.

6. A composition comprising the bacteria of any one of claims 1 to 5.

7. The composition of claim 6, comprising at least one biostimulant in addition to the bacteria.

8. The composition of claim 7, comprising at least one additional biostimulant selected from the group of humic acids, fulvic acids, amino acids, protein hydrolysis peptides, algae extracts, laminarin polysaccharides, alginate, carrageenan, polymeric chitosan, a chitosan oligomer, elemental aluminum, an aluminum salt, elemental cobalt, a cobalt salt, elemental sodium, a sodium salt, elemental selenium, a selenium salt, elemental silicon, a silicon salt, a mycorrhizal fungus, a biostimulant bacterium, or mixtures thereof.

9. The composition of any one of claims 6 to 8, which is an aqueous composition.

10. The composition of any one of claims 6 to 8, which is in the form of a non-particulate solid or in the form of granules, powder or pellets.

11. The composition of any one of claims 6 to 10, additionally comprising elemental sulfur.

12. Use of the bacteria of any one of claims 1 to 5 or of a composition of any one of claims 6 to 11, to promote the growth of a plant and / or act as a biostimulant thereof.

13. Use according to claim 12, wherein the plant is a horticultural plant or a cereal.

14. Use according to claim 13, wherein the plant is selected from the group of broccoli, cabbage, radish, lettuce, zucchini or wheat.

15. Use according to claim 13, wherein the plant belongs to the Brassicaceae family.

16. Use according to any one of claims 12 to 15, wherein the composition is the irrigation water of the plant or the nutrient solution of a plant in hydroponic cultivation or is mixed with them for administration to the plant.

17. Use according to any one of claims 12 to 16, wherein elemental sulfur is present in the plant growth soil or in the nutrient solution administered to a plant in hydroponic culture.

18. Use according to any one of claims 12 to 16, wherein elemental sulfur is administered to the plant in one or more doses different from the administration dose(s) of the bacteria of any one of claims 1 to 5 or the composition of any one of claims 6 to 11.

19. A method for the modification and / or recovery of a soil, comprising at least one step in which the soil is provided with a bacterium of any one of claims 1 to 5 or a composition of any one of claims 6 to 11.

20. The method according to claim 19, wherein the soil is alkaline, calcareous and / or saline.

21. The method according to any one of claims 19 or 20, wherein the soil modification is selected from the group of enrichment in sulfur salts, solubilization of phosphorus salts, decrease in pH, increase in conductivity, increase in porosity, or mixtures of the above.

22. The method according to any one of claims 19 to 21, comprising one or more steps in which elemental sulfur is administered to the soil.

23. The method according to claim 22, wherein the soil is provided with a composition of claim 10.

24. The method according to claim 22, wherein the elemental sulfur is administered in one or more step(s) different from the step(s) of administering the bacteria of any one of claims 1 to 5 or of a composition of any one of claims 6 to 10.

Images