Peptide having skin whitening activity and uses thereof

Abstract

A peptide of the present invention exhibits skin whitening activity by inhibiting melanin synthesis in melanocytes and inhibiting melanosome migration. Accordingly, the peptide of the present invention can be used as an active ingredient in drugs for the treatment or prevention of hyperpigmentation diseases caused by excessive deposition of melanosomes, or as an active ingredient in cosmetics for skin whitening.

Description

Peptides with skin whitening activity and their uses

[0001] [Cross-citation with related applications]

[0002] This application claims the benefit of priority from Korean Patent Application No. 10-2023-0138102, filed October 16, 2023, the entire contents of which are incorporated herein by reference.

[0003] [Technical Field]

[0004] The present invention relates to a peptide having skin whitening activity and its use.

[0005] Cutaneous melanin exists in the skin, hair follicles, and eyes, and plays an important role in protecting the skin from ultraviolet rays. However, excessive melanin formation can cause hyperpigmentation diseases such as melasma, freckles, and liver spots, which can lead to mental stress and a decline in quality of life. Melanin is mainly synthesized in melanocytes, which are located between or beneath the basal layer of the epidermis and in hair follicles. Melanin is synthesized in melanosomes, which are organelles within melanocytes. These melanosomes then travel to nearby keratinocytes via dendrites, and when the keratinocytes rise to the epidermis, they reveal skin color. Melanin starts from L-tyrosine and is synthesized sequentially from L-tyrosine to DOPA, DOPAquinone, DOPAchrome, and DHI (5,6-dihydroxyindole), ultimately forming melanin. The reaction of generating DOPA from L-tyrosine and DOPAquinone from DOPA is catalyzed by tyrosinase, and tyrosinase is known to be the most essential enzyme in melanin formation. In addition, the enzymes TRP1 (Tyrosinase-related protein 1) and TRP2 (Tyrosinase-related protein 2) are also involved in the synthesis of the above-mentioned melanin.

[0006] The mechanism by which melanosomes containing melanin move from melanocytes to keratinocytes is not precisely understood, but it is known that melanosomes move to the dendrites of melanocytes, from which they are released into the extracellular space, followed by membrane fusion and phagocytosis between the melanosomes and keratinocytes. Melanophilin, Rab27a, and myosin 5a proteins are known to be involved in the movement of melanosomes to the dendrites of melanocytes. Rab27a recognizes and binds to melanosomes, and melanophilin links Rab27a to myosin 5a, a cytoskeletal protein within the cell. In this way, melanosomes form a complex with Rab27a, melanophilin, and myosin 5a proteins and move to the terminal portion of the dendrite, ultimately being delivered to keratinocytes (J. Biochem. 2012;151(4):343-351, Lysosome-Related Organelles M Fukuda, Tohoku University, Sendai, Miyagi, Japan 2016 Elsevier Inc)

[0007] PCT International Patent Publication No. WO2020 / 153819 discloses a polypeptide that inhibits the activity of tyrosinase, a key enzyme in the melanin synthesis pathway, and its use for skin whitening. Furthermore, Korean Patent No. 10-1869783 describes a peptide that inhibits melanin production and tyrosinase activity, and its use for skin whitening. The development of skin whitening agents to date has focused on inhibiting the activity of tyrosinase, a key enzyme in melanin synthesis. However, to achieve synergistic skin whitening effects through various action points, the development of skin whitening agents with different mechanisms of action and action points is necessary.

[0008] [Prior Art Literature]

[0009] [Patent Document]

[0010] WO 2020 / 153819

[0011] Republic of Korea Patent No. 10-1869783

[0012] The present inventors have conducted research efforts to develop a more improved peptide with skin whitening activity, and as a result, the inventors have experimentally proven that the novel peptide they have developed not only inhibits the synthesis of melanin in melanocytes but also has the activity of inhibiting the movement of melanosomes, and thus can be developed as a treatment for skin whitening and hyperpigmentation diseases, thereby completing the present invention.

[0013] Accordingly, the purpose of the present invention is to provide a novel peptide having skin whitening activity.

[0014] Another object of the present invention is to provide a skin whitening composition comprising a peptide having the above-described activity as an active ingredient.

[0015] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating hyperpigmentation disease, which comprises a peptide having the above-described activity as an active ingredient.

[0016] Another object of the present invention is to provide a cosmetic composition for skin whitening comprising a peptide having the above-described activity as an active ingredient.

[0017] To achieve the above purpose,

[0018] One aspect of the present invention provides a peptide comprising the amino acid sequence of SEQ ID NO: 1.

[0019] Another aspect of the present invention provides a skin whitening composition comprising the peptide as an active ingredient.

[0020] Another aspect of the present invention provides a pharmaceutical composition for preventing or treating hyperpigmentation disease, comprising the peptide as an active ingredient.

[0021] Another aspect of the present invention provides a cosmetic composition for skin whitening comprising the peptide as an active ingredient.

[0022] The present invention is described in detail below.

[0023] 1. Peptides and their activities

[0024] According to one aspect of the present invention, a peptide comprising an amino acid sequence disclosed in SEQ ID NO: 1 is provided.

[0025] [Amino acid sequence of sequence number 1]

[0026] THTISR (Thr-His-Thr-Ile-Ser-Arg)

[0027] As used herein, the term “peptide” means a linear molecule formed by amino acid residues being linked to each other by peptide bonds.

[0028] The peptide comprising the amino acid sequence of SEQ ID NO: 1 of the present invention may be used without modification, but a variant or fragment of an amino acid having a different sequence by deletion, insertion, substitution, or a combination thereof of amino acid residues may be used within a range that does not affect the original activity of the peptide, such as skin whitening activity.

[0029] The peptide of the present invention can be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, etc., within a range that does not change its activity.

[0030] The peptide of the present invention includes a peptide comprising an amino acid sequence substantially identical to a peptide comprising an amino acid sequence of SEQ ID NO: 1, and a variant or active fragment thereof. The substantially identical amino acid sequence refers to an amino acid sequence having a sequence identity of 75% or more, for example, 80% or more, 85% or more, 90% or more, 95% or more, or 97% or more, with the amino acid sequence of SEQ ID NO: 1. In addition, the peptide may additionally include a targeting sequence, a tag, a labeled residue, an amino acid sequence manufactured for a specific purpose to increase half-life or peptide stability.

[0031] The peptide of the present invention may be modified at the N-terminus and / or C-terminus to select a portion of the amino acid sequence and increase its activity. Such N-terminus and / or C-terminus modifications can significantly improve the stability of the peptide of the present invention, for example, increasing the half-life of the peptide when administered in vivo. The term "stability" encompasses not only in vivo stability, which protects the peptide of the present invention from attack by in vivo protein-cleaving enzymes, but also storage stability (e.g., room temperature storage stability).

[0032] The above N-terminal modification may be a modification in which a protecting group selected from the group consisting of an acetyl group, a fluoreonylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG) is bonded to the N-terminus of the peptide. The above C-terminal modification may be a modification in which a hydroxyl group (-OH), an amino group (-NH2), an azide (-NHNH2), or the like is bonded to the C-terminus of the peptide, but is not limited thereto.

[0033] The peptide of the present invention can be prepared by various methods widely known in the art to which the present invention pertains. For example, the peptide of the present invention can be prepared by chemical synthesis methods known in the art, particularly solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85:2149-54 (1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd ed., Pierce Chem. Co.: Rockford, 111 (1984)) or liquid-phase synthesis techniques (US Patent No. 5,516,891).

[0034] The peptide of the present invention has skin whitening activity and preventive or therapeutic activity for hyperpigmentation diseases.

[0035] The peptide of the present invention has an activity of inhibiting the synthesis of melanin in melanocytes.

[0036] In the signaling pathway of melanin synthesis enhanced by α-MSH in melanocytes, MITF (Microphthalmia-associated transcript factor) acts as a key positive transcription factor for melanin synthesis, and CREB (cAMP-response element binding protein) is known to be a transcription factor that promotes the expression of MITF (EXPERIMENTAL AND THERAPEUTIC MEDICINE 20: 173-185, 2020).

[0037] In one embodiment, the peptide of the present invention inhibits an increase in the phosphorylation level of CREB in melanocytes under conditions in which melanin synthesis is induced (promoted).

[0038] The peptide of the present invention has an activity of inhibiting the movement of melanosomes in melanocytes under conditions in which melanin synthesis is induced (promoted).

[0039] In one embodiment, the induction of melanin synthesis may be induced by α-MSH.

[0040] Melanosomes produced in melanocytes move to the ends of the dendrites of melanocytes, are released from the melanocytes, and are incorporated into adjacent keratinocytes, ultimately being delivered to keratinocytes. It is known that factors such as Rab27a, MYO5A (myosin VA), and MLPH (Melanophilin) ​​are involved in the movement of melanosomes in melanocytes (J. Biochem. 2012;151(4):343-351, Lysosome-Related Organelles M Fukuda, Tohoku University, Sendai, Miyagi, Japan 2016 Elsevier Inc).

[0041] In one embodiment, the peptide of the present invention has the activity of inhibiting the up-regulation of the expression levels of melanosome transport-related factors Rab27a, MYO5A (myosin VA), and MLPH (Melanophilin) ​​in melanocytes under conditions in which melanin synthesis is promoted.

[0042] As described above, the peptide of the present invention can exhibit skin whitening activity and preventive or therapeutic effects on hyperpigmentation diseases through its activity of inhibiting the synthesis of melanin in melanocytes and inhibiting the movement of melanosomes.

[0043] 2. Composition for skin whitening, composition for preventing, treating or improving hyperpigmentation disease

[0044] In another aspect of the present invention, a skin whitening composition is provided, which comprises a peptide having an amino acid sequence of SEQ ID NO: 1 as an active ingredient.

[0045] The peptide comprising the amino acid sequence of sequence number 1 of the present invention has skin whitening activity through the above-described mechanism.

[0046] In another aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating hyperpigmentation disease, comprising a peptide comprising the amino acid sequence of SEQ ID NO: 1 as an active ingredient.

[0047] In one embodiment, a pharmaceutical composition comprising the peptide of the present invention as an active ingredient inhibits the synthesis of melanin in melanocytes or inhibits the movement of melanosomes.

[0048] In one embodiment, a pharmaceutical composition comprising the peptide of the present invention as an active ingredient inhibits, in melanocytes under conditions in which melanin synthesis is promoted, (i) an increase in the phosphorylation level of CREB (cAMP Response Element-Binding Protein), (ii) an increase in the expression level of MITF (Microphthalmia-associated transcriptian factor), TYR (Tyrosinase), or TYRP1 (Tyrosinase-related protein 1), or (iii) an increase in the expression level of Rab27a, MYO5A, or MLPH (Melanophilin).

[0049] The term “hyperpigmentation disease” as used herein refers to a disease caused by an excessive increase in the amount of melanin in the skin.

[0050] Thus, skin color darkens due to an excessive increase in melanin levels. Causes of hyperpigmentation include, but are not limited to, exposure to sunlight, skin inflammation (post-inflammatory hyperpigmentation) such as acne, trauma, hormonal imbalances, and medications.

[0051] In one embodiment, the hyperpigmentation condition may be melasma, freckles, age-related pigmentation, solar lentigo, or post-inflammatory hyperpigmentation of the skin. The post-inflammatory hyperpigmentation of the skin may be hyperpigmentation resulting from trauma, ultraviolet rays, or an inflammatory skin condition such as acne.

[0052] The pharmaceutical composition of the present invention may contain a therapeutically effective amount of a peptide comprising the amino acid of sequence number 1 of the present invention.

[0053] The above term “therapeutically effective amount” means an amount sufficient for the peptide, which is an active ingredient of the pharmaceutical composition of the present invention, to achieve its activity or efficacy, for example, an amount sufficient to achieve efficacy in treating or preventing hyperpigmentation disease.

[0054] The term "prevention" as used herein means reducing the risk of developing a disease or disorder, and means any action that inhibits or delays the onset of a disease by preventing the disease or one or more of its clinical symptoms from progressing.

[0055] The term "treatment" as used herein means alleviating a disease or disorder, and includes any action that improves or beneficially alters the symptoms of a disease by arresting or reducing the progression of the disease or one or more of its clinical symptoms.

[0056] In the present invention, prevention or treatment of hyperpigmentation disease may be to remove the cause of hyperpigmentation in the skin or to inhibit progression to hyperpigmentation, and specifically, may be to inhibit incorporation of melanosomes into keratinocytes or to promote decomposition of melanosomes.

[0057] The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.

[0058] The pharmaceutically acceptable carriers mentioned above are those commonly used in formulations, and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0059] The pharmaceutical composition of the present invention may additionally include, in addition to the above ingredients, a lubricant, a wetting agent, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, etc., but is not limited thereto.

[0060] Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington: The Science and Practice of Pharmacy, (19th ed., 1995, Williams & Wilkins).

[0061] The pharmaceutical composition of the present invention may be administered by any suitable route for treating hyperpigmentation diseases, for example, orally or parenterally, and in the case of parenteral administration, may be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, topical administration, transdermal administration, etc. Since the pharmaceutical composition of the present invention has an activity for preventing or treating hyperpigmentation diseases of the skin, it is preferably applied by topical administration such as application to the skin.

[0062] The dosage of the pharmaceutical composition may be, but is not limited to, 0.0001 μg to 100 mg, 0.001 μg to 100 mg, 0.01 μg to 100 mg, 0.1 μg to 100 mg, or 1.0 μg to 1000 mg per day, and may be prescribed in various ways depending on factors such as the formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity.

[0063] The pharmaceutical composition of the present invention can be manufactured in a unit dose form or can be manufactured by inserting it into a multi-dose container by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method that can be easily performed by a person having ordinary skill in the art to which the present invention pertains, and the method can be performed. In this case, the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granules, tablet or capsule, and may additionally include a dispersing agent or stabilizer.

[0064] The pharmaceutical composition of the present invention may be a topical skin preparation. The topical skin preparation is a preparation that can be applied to the outside of the skin and used. When the pharmaceutical composition of the present invention is used as a topical skin preparation, it may be applied to the skin, specifically, to an area of ​​the skin where hyperpigmentation has occurred. The topical skin preparation may be a cream, a gel, an ointment, a skin emulsifier, a skin suspension, a transdermal patch, a drug-containing bandage, a lotion, or a combination thereof. The topical skin preparation may be appropriately mixed with ingredients commonly used in topical skin preparations such as cosmetics or pharmaceuticals, such as aqueous ingredients, oily ingredients, powder ingredients, alcohols, moisturizers, thickeners, UV absorbers, whitening agents, preservatives, antioxidants, surfactants, fragrances, colorants, various skin nutrients, or a combination thereof, as needed. The above skin external preparation may also appropriately contain metal sequestrants such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid; caffeine, tannin, bellapamil, licorice extract, glabridin, hot water extract of the fruit of Kalin; various herbal medicines; tocopheryl acetate, glycyrrhizic acid, tranexamic acid and derivatives or salts thereof; and sugars such as vitamin C, magnesium ascorbic acid phosphate, ascorbic acid glucoside, arbutin, kojic acid, glucose, fructose, and trehalose.

[0065] In another aspect of the present invention, the present invention provides a cosmetic composition for skin whitening comprising a peptide having an amino acid sequence of SEQ ID NO: 1 as an active ingredient.

[0066] In one embodiment, a cosmetic composition comprising the peptide of the present invention as an active ingredient inhibits the synthesis of melanin in melanocytes or inhibits the movement of melanosomes.

[0067] In one embodiment, a cosmetic composition comprising the peptide of the present invention as an active ingredient inhibits, in melanocytes under conditions in which melanin synthesis is induced, (i) an increase in the phosphorylation level of CREB (cAMP Response Element-Binding Protein), (ii) an increase in the expression level of MITF (Microphthalmia-associated transcriptian factor), TYR (Tyrosinase), or TYRP1 (Tyrosinase-related protein 1), or (iii) an increase in the expression level of Rab27a, MYO5A, or MLPH (Melanophilin).

[0068] The above cosmetic composition may be prepared in any formulation commonly manufactured in the technical field to which the present invention pertains, and may be a topical skin preparation. For example, it may be formulated as a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleanser, oil, powder foundation, emulsion foundation, wax foundation, and spray, but is not limited thereto.

[0069] The above cosmetic composition can be manufactured in various forms such as a solution, sol-gel, emulsion, oil, wax, aerosol, etc., such as a flexible toner, a nourishing toner, a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray, a powder, a hair tonic, a hair cream, a hair lotion, a hair shampoo, a hair rinse, a hair conditioner, a hair spray, a hair aerosol, a pomade, a gel, etc., but is not limited thereto.

[0070] The cosmetic composition of the present invention may include other additives such as excipients and carriers, and it is possible to apply and mix as much as necessary the usual ingredients mixed in general skin cosmetics.

[0071] When the formulation of the above cosmetic composition is in the form of a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component.

[0072] When the formulation of the above cosmetic composition is in the form of a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, a propellant such as chlorofluorohydrocarbon, propane / butane or dimethyl ether may be additionally included, but is not limited thereto.

[0073] When the formulation of the above cosmetic composition is in the form of a solution or emulsion, a solvent, a solubilizer or an emulsifier may be used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan.

[0074] When the formulation of the above cosmetic composition is in the form of a suspension, a liquid diluent such as water, ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethyl sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth, etc. can be used as a carrier component.

[0075] When the formulation of the above cosmetic composition is a surfactant-containing cleansing, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester may be used as a carrier component.

[0076] When the formulation of the above cosmetic composition is a hair shampoo, base ingredients for forming a shampoo, such as a thickener, a surfactant, a viscosity modifier, a moisturizer, a pH modifier, a preservative, and essential oils, may be mixed with the peptide of the present invention. CDE may be used as the thickener, LES, which is an anionic surfactant, and coco betaine, which is an amphoteric surfactant, polyquat may be used as the viscosity modifier, glycerin may be used as the moisturizer, and citric acid or sodium hydroxide may be used as the pH modifier. Grapefruit extract or the like may be used as the preservative, and in addition, essential oils such as cedarwood, peppermint, and rosemary, as well as silk amino acids, pentaol, or vitamin E may be added.

[0077] The ingredients included in the above cosmetic composition may further include, in addition to the peptide of the present invention and the carrier component as active ingredients, ingredients commonly used in cosmetic compositions, such as conventional auxiliary agents such as antioxidants, stabilizers, solubilizers, vitamins, pigments, and fragrances, but are not limited thereto.

[0078] The peptide of the present invention can be included in the above-described composition, pharmaceutical composition or cosmetic composition at a concentration of 0.01 μM to 1000 μM, specifically, the peptide of the present invention can be included in a concentration of 0.01 μM to 1000 μM; 0.05 μM to 800 μM, 0.05 μM to 700 μM, 0.05 μM to 600 μM, 0.05 μM to 500 μM, 0.05 μM to 300 μM, 0.05 μM to 200 μM; 0.1 μM to 800 μM, 0.1 μM to 700 μM, 0.1 μM to 600 μM, 0.1 μM to 500 μM, 0.1 μM to 300 μM, 0.1 μM to 200 μM; It may be included at a concentration of, but is not limited to, 1 μM to 800 μM, 1 μM to 700 μM, 1 μM to 600 μM, 1 μM to 500 μM, 1 μM to 300 μM, 1 μM to 200 μM; 5 μM to 800 μM, 5 μM to 700 μM, 5 μM to 600 μM, 5 μM to 500 μM, 5 μM to 300 μM, or 5 μM to 200 μM.

[0079] 3. Uses of the peptide of the present invention

[0080] In another aspect of the present invention, a peptide comprising the amino acid sequence of SEQ ID NO: 1 is provided for use in skin whitening, or for preventing, treating or improving hyperpigmentation diseases.

[0081] In another aspect of the present invention, a skin whitening method is provided, comprising administering to a subject in need of skin whitening a peptide comprising an amino acid sequence of SEQ ID NO: 1 or a composition comprising the peptide.

[0082] In another aspect of the present invention, a method for preventing or treating hyperpigmentation disease is provided, comprising administering to a subject in need of prevention or treatment of hyperpigmentation disease a peptide comprising the amino acid sequence of SEQ ID NO: 1 or a composition comprising the peptide.

[0083] In another aspect of the present invention, there is provided a use of a peptide comprising the amino acid sequence of SEQ ID NO: 1 for the manufacture of a medicament for the prevention or treatment of hyperpigmentation diseases.

[0084] In another aspect of the present invention, the use of a peptide comprising the amino acid sequence of SEQ ID NO: 1 for the manufacture of cosmetics for skin whitening is provided.

[0085] The peptide of the present invention exhibits skin whitening activity by inhibiting melanin synthesis in melanocytes and melanosome transport. Therefore, the peptide of the present invention can be used as an active ingredient in a drug for treating or preventing hyperpigmentation caused by excessive melanosome deposition, or as an effective ingredient in a skin whitening cosmetic.

[0086] However, the effects of the present invention are not limited to the effects mentioned above, and other effects not mentioned will be clearly understood by those skilled in the art from the description below.

[0087] Figure 1 shows the results of measuring melanin content after treating B16F10 cells with α-MSH, the peptide of Preparation Example 1, and arbutin.

[0088] Figure 2 shows the results of measuring the phosphorylation level of CREB after treating B16F10 cells with α-MSH, the peptide of Preparation Example 1, and arbutin. The band values ​​are calculated by comparing the densitometry result of the p-CREB band with the densitometry result of the actin band, which is the loading control, and then showing the relative expression level with the control as 1.

[0089] Figure 3 shows the results of measuring the expression levels of genes of MITF, TYR, TYRP1, which are factors related to melanin production, and MYO5A, MLPH, which are factors related to melanosome movement, by RT-PCR after treating B16F10 cells with α-MSH, the peptide of Preparation Example 1, and arbutin. The band values ​​are calculated by comparing the band densitometry results of each marker with the densitometry results of the GAPDH band, which is a loading control, and then showing the relative expression level with the control as 1.

[0090] Figure 4 shows the results of Western blot analysis of the expression levels of MITF, Tyrosinase, and TYRP1, which are factors related to melanin production, and Rab27a and Melanophilin, which are factors related to melanosome movement, after treating B16F10 cells with α-MSH, the peptide of Preparation Example 1, and arbutin. The band values ​​are calculated by comparing the band densitometry results of each marker with the densitometry results of the Actin band, which is a loading control, and then showing the relative expression level with the control as 1.

[0091] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples specifically illustrate the present invention, and the content of the present invention is not limited by the following examples.

[0092] Manufacturing Example 1: Manufacturing of peptides

[0093] A peptide having the amino acid sequence of SEQ ID NO: 1 shown in Table 1 below was synthesized using an automatic peptide synthesizer (Milligen 9050, Millipore, USA), and the synthesized peptide was purified using C18 reverse-phase high-performance liquid chromatography (HPLC) (Waters Associates, USA). The column used was ACQUITY UPLC BEH300 C18 (2.1 mm Х 100 mm, 1.7 μm, Waters Co, USA).

[0094] Amino acid sequence of the peptide sequence 1THTISR (Thr-His-Thr-Ile-Ser-Arg)

[0095] The efficacy of the peptide of sequence number 1 manufactured above was evaluated through the following experiment.

[0096] Experimental Example 1: Melanin Content Analysis

[0097] It was confirmed whether the peptide of sequence number 1 manufactured in the above manufacturing example 1 inhibits melanin synthesis in melanocytes.

[0098] 7 x 10 B16F10 mouse melanoma cells 4 The cells were seeded in a 6-well cell culture plate at a density of 10 cells / well and cultured for 24 hours. Subsequently, the culture medium was replaced with 2% FBS, and 200 ng / mL α-MSH (α-Melanocyte-stimulating hormone) and the peptide prepared in Manufacturing Example 1 were treated and incubated for 72 hours. The positive control group was treated with 200 ng / mL α-MSH and 500 μM arbutin. After harvesting the cultured cells, cell lysate was prepared by treating with 1 N NaOH. The absorbance at a wavelength of 450 nm was measured using a spectrophotometer.

[0099] As can be seen from the melanin content analysis results in Fig. 1, the melanin content in B16F10 cells increased by α-MSH treatment, and it was confirmed that the melanin content that had increased by treatment with the peptide of Preparation Example 1 decreased in a concentration-dependent manner.

[0100] Experimental Example 2: Analysis of the regulation of MITF expression, a transcription factor involved in melanin formation.

[0101] The effect of the peptide of sequence number 1 manufactured in the above manufacturing example 1 on the regulation of expression of MITF (Microphthalmia-associated transcript factor), a transcription factor for melanin synthesis, in melanocytes under conditions where melanin synthesis is promoted was confirmed by measuring the phosphorylation level of CREB (cAMP Response Element-Binding Protein). It is known that CREB acts as a transcription factor for MITF in the signal transduction pathway of melanin synthesis promotion by α-MSH in melanocytes and is involved in the regulation of expression (EXPERIMENTAL AND THERAPEUTIC MEDICINE 20: 173-185, 2020).

[0102] B16F10 mouse melanoma cells were cultured at 3 x 10 5Cells were seeded in 6-well cell culture plates at a density of 10 cells / well and cultured for 24 hours. Subsequently, the medium was replaced with serum-free medium and incubated for 24 hours. 200 ng / mL α-MSH and the peptide of Preparation Example 1 were treated and incubated for 10 minutes. The positive control group was treated with 200 ng / mL α-MSH and 500 μM arbutin. After washing with PBS, cell lysates were prepared by treating with lysis buffer, and BCA was quantified to prepare equal amounts of protein samples. Electrophoresis was performed on the prepared cell lysates and protein samples using a 10% SDS-PAGE gel. Proteins separated by SDS PAGE were transferred to PVDF membranes and blocked with 5% skim milk for 30 minutes at room temperature. Primary antibodies against p-CREB (Cell Signaling, USA) and actin (Santa Cruz, USA) were diluted 1:1000 in 3% BSA and reacted with PVDF membranes at 4°C for 16 hours. The membranes were washed three times for 15 minutes each with 0.1% PBS-T (0.1% Tween-20 in PBS). Subsequently, secondary antibodies (Jackson ImmunoResearch, USA) were diluted 1:2000 in 5% skim milk and reacted for 1 hour at room temperature. The membranes were washed three times for 15 minutes each with 0.1% PBS-T (0.1% Tween-20 in PBS). After treatment with ECL solution (GE Healthcare, USA), the expression level was analyzed using ImageQuant 800 (Cytiva, USA) equipment.

[0103] As can be seen from the results of the analysis of the phosphorylation level of CREB in Fig. 2, the phosphorylation level of CREB increased by α-MSH treatment, and it was confirmed that the increased phosphorylation level of CREB decreased in a concentration-dependent manner by treatment with the peptide of Preparation Example 1.

[0104] Experimental Example 3: Expression Analysis of Factors Related to Melanin Formation and Melanosome Movement - mRNA Expression Analysis Using RT-PCR

[0105] The effect of the peptide of sequence number 1 manufactured in the above manufacturing example 1 on the expression of factors related to melanin synthesis in melanocytes, MITF (Microphthalmia-associated transcriptian factor), TYR (Tyrosinase), TYRP1 (Tyrosinase-related protein 1), and factors related to melanosome movement, MYO5A (myosin VA) and MLPH (Melanophilin), was confirmed by measuring the mRNA expression level using RT-PCR.

[0106] 5 x 10 B16F10 mouse melanoma cells 4Cells were seeded in 6-well cell culture plates at a density of 10 cells / well and cultured for 24 hours. Subsequently, the culture medium containing 2% FBS was replaced, and 200 ng / mL α-MSH and the peptide of Preparation Example 1 were treated, and incubated for 72 hours. The positive control group was treated with 200 ng / mL α-MSH and 500 μM arbutin. After washing with PBS, RNA was isolated by treating with 300 μL of easy blue (intron, Korea). The isolated RNA was quantified, and cDNA synthesis was performed using a cDNA synthesis kit (enzynomics, Korea). PCR was performed using the primers in Table 2 and PCR premix (enzynomics, Korea). The PCR reaction products were electrophoresed on a 1.5% agarose gel. Bands were measured using a Bio-Rad gel image system.

[0107] Primer name sequence (5' → 3') Sequence number MITF Forward (5') CCAGCCTGGCGATCATGTCAT (3') 2MITF Reverse (5') GGTCTGGACAGGAGTTGCTG (3') 3TYR Forward (5') GGCCAGCTTTCAGGCAGAGG (3') 4TYR Reverse (5') TGGTGCTTCATGGGCAAAAT (3') 5TYRP1 Forward (5') TCTGTGAAGGTGTGCAGGAG (3') 6TYRP1 Reverse (5') CCGAAACAGAGTGGAAGGTT (3') 7MYO5A Forward (5') TTCTACATTGTGGGCGCCAT (3') 8MYO5A Reverse (5') TCCTCCAGGTTGGTCAATCG (3') 9MLPH Forward (5') ACGATGTCAGGGGCAAACAT (3') 10MLPH Reverse(5') CTCCTCTGTGTCAGCACTGG (3')11GAPDH Forward(5') GGTGTGAACGGATTTGGCCGTATTG (3')12GAPDH Reverse(5') CCGTTGAATTTGCCGTGAGTGGAGT (3')13

[0108] As can be seen from the results of Fig. 3, the expression of MITF, TYR, and TYRP1 genes, which are factors related to melanin production, and MYO5A and MLPH genes, which are factors related to melanosome movement, increased by α-MSH treatment, and it was confirmed that the expression levels of the increased genes decreased again by treatment with the peptide of Preparation Example 1.

[0109] Experimental Example 4: Expression Analysis of Factors Related to Melanin Formation and Melanosome Movement - Protein Expression Analysis Using Western Blot

[0110] The effect of the peptide of sequence number 1 manufactured in the above manufacturing example 1 on the expression of factors related to melanin synthesis in melanocytes, such as MITF (Microphthalmia-associated transcriptant factor), tyrosinase (TYR), TYRP1 (Tyrosinase-related protein 1), and factors related to melanosome movement, such as Rab27a and melanophilin, was confirmed through measurement of protein expression levels using Western blot.

[0111] 7 x 10 B16F10 mouse melanoma cells 4Cells were seeded in 6-well cell culture plates at a density of 10 cells / well and cultured for 24 hours. Subsequently, the culture medium containing 2% FBS was replaced, and 200 ng / mL α-MSH and the peptide of Preparation Example 1 were treated, and incubated for 72 hours. At this time, the positive control group was treated with 200 ng / mL α-MSH and 500 μM arbutin. After washing with PBS, cell lysate was prepared by treating with lysis buffer, and the same amount of protein sample was prepared by BCA quantitation. Electrophoresis was performed on the prepared cell lysate and protein sample using 10% SDS-PAGE gel. The proteins separated by SDS PAGE were transferred to a PVDF membrane and blocked with 5% skim milk for 30 minutes at room temperature. Primary antibodies against MITF, TYR, TYRP1, Rab27a, and melanophilin (Cell signaling, USA) and primary antibodies against actin (Santa Cruz, USA) were diluted 1:1000 in 3% BSA and incubated with PVDF membranes at 4°C for 16 h. The membranes were washed three times for 15 min each with 0.1% PBS-T (0.1% Tween-20 in PBS). Subsequently, secondary antibodies (Jackson ImmunoResearch, USA) were diluted 1:2000 in 5% skim milk and incubated for 1 h at room temperature. The membranes were washed three times for 15 min each with 0.1% PBS-T (0.1% Tween-20 in PBS). After treatment with ECL solution (GE Healthcare, USA), the expression level was analyzed using ImageQuant 800 (Cytiva, USA) equipment.

[0112] As can be seen from the results of the experiment, Fig. 4, the expression of MITF, TYR, and TYRP1, which are factors related to melanin production, and Rab27a and Melanophilin, which are factors related to melanosome movement, increased by α-MSH treatment, and it was confirmed that the increased expression levels of the above proteins decreased again by treatment with the peptide of Preparation Example 1.

[0113] Although representative embodiments of the present application have been described above as examples, the scope of the present application is not limited to the specific embodiments described above, and a person with ordinary knowledge in the relevant field will be able to make appropriate changes within the scope described in the claims of the present application.

Claims

1. A peptide comprising the amino acid sequence of sequence number 1.

2. A skin whitening composition comprising the peptide of claim 1 as an active ingredient.

3. A pharmaceutical composition for preventing or treating hyperpigmentation disease, comprising the peptide of claim 1 as an active ingredient.

4. In claim 3, A pharmaceutical composition for preventing or treating hyperpigmentation disease, wherein the peptide (i) inhibits the synthesis of melanin in melanocytes, or (ii) inhibits the movement of melanosomes.

5. In claim 4, The above peptide is in melanocytes where melanin synthesis is induced. (i) Inhibition of increase in phosphorylation level of CREB (cAMP Response Element-Binding Protein), (ii) inhibition of the increase in the expression level of MITF (Microphthalmia-associated transcript factor), TYR (Tyrosinase), or TYRP1 (Tyrosinase-related protein 1), or (iii) A pharmaceutical composition for preventing or treating hyperpigmentation disease, which has an activity of inhibiting an increase in the expression level of Rab27a, MYO5A, or MLPH (Melanophilin).

6. In claim 3, A pharmaceutical composition for preventing or treating hyperpigmentation disease, wherein the hyperpigmentation disease is a disease caused by an excessive increase in the amount of melanin in the skin.

7. In claim 3, A pharmaceutical composition for preventing or treating hyperpigmentation disease, wherein the hyperpigmentation disease is a melasma, freckle, senile pigmentation, solar lentigo, or hyperpigmentation occurring after inflammation of the skin.

8. In claim 3, The pharmaceutical composition above is a pharmaceutical composition for the prevention or treatment of hyperpigmentation disease, which is an external skin agent.

9. A cosmetic composition for skin whitening comprising the peptide of claim 1 as an active ingredient.

10. In claim 9, A cosmetic composition for skin whitening, wherein the peptide (i) inhibits the synthesis of melanin in melanocytes, or (ii) inhibits the movement of melanosomes.

11. In claim 10, The above peptide is in melanocytes where melanin synthesis is induced. (i) Inhibition of increase in phosphorylation level of CREB (cAMP Response Element-Binding Protein), (ii) inhibition of the increase in the expression level of MITF (Microphthalmia-associated transcript factor), TYR (Tyrosinase), or TYRP1 (Tyrosinase-related protein 1), or (iii) A cosmetic composition for skin whitening having an activity of inhibiting an increase in the expression level of Rab27a, MYO5A, or MLPH (Melanophilin).

12. In claim 9, The above cosmetic composition is a skin whitening cosmetic composition that is an external skin agent.

13. In claim 12, A cosmetic composition for skin whitening, wherein the cosmetic composition is in one or more formulations selected from the group consisting of a solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, a surfactant-containing cleanser, an oil, a powder foundation, an emulsion foundation, a wax foundation, and a spray.

14. A method for preventing or treating hyperpigmentation disease, comprising administering the peptide of claim 1 or a composition comprising the peptide to a subject in need of prevention or treatment of hyperpigmentation disease.

15. In claim 14, A method for preventing or treating hyperpigmentation disease, wherein the hyperpigmentation disease is a melasma, freckle, age-related pigmentation, solar lentigo, or hyperpigmentation occurring after inflammation of the skin.

Images