Nucleic acid amplification product test method, primer composition and kit

Abstract

Provided in the present application are a nucleic acid amplification product test method, a primer composition and a kit. The primer composition comprises: a first primer group, the first primer group comprising a forward primer and a reverse primer, the first primer group comprising at least one modified primer, and the 5' end of the modified primer being provided with a labeled fluorescent group or a quenching group; and a probe, the probe being adapted to complementarily pair with the 5' end of the modified primer, the 3' end of the probe being provided with a quenching group or a fluorescent group, and the quenching group being adapted to quench the fluorescent group.

Description

Nucleic acid amplification product detection method, primer combination and kit Technical Field

[0001] The present invention relates to the fields of biomedicine and nucleic acid detection. Specifically, the present application relates to a primer composition, a kit and a method for detecting nucleic acid amplification products. Background Art

[0002] In the field of biological sample analysis and molecular diagnostic technology, amplification of target genes or nucleotide fragments is a commonly used technical means to ensure that the detection method has sufficient sensitivity and specificity. Polymerase chain reaction (PCR) is one of the most commonly used methods, which can quickly amplify target nucleic acid molecules in vitro or in test tubes for qualitative and quantitative detection. PCR uses variable temperature cycles, and under the enzymatic action of polymerase, double-stranded DNA (dsDNA) completes thermal denaturation, primer annealing, and complementary chain extension synthesis. Repeated variable temperature cycles can generate exponentially growing PCR end products, and the amplification factor is determined by the number of variable temperature cycles. Real-time PCR, also known as fluorescent quantitative PCR, is an improved PCR method that uses an optical detection system to monitor the accumulated concentration of PCR products in real time to achieve quantitative detection of target genes or nucleotide fragments.

[0003] However, a drawback of PCR is that each cycle requires a thermal cycler to heat the DNA to induce thermal denaturation. During this process, double-stranded DNA is unwound into free single-stranded DNA, allowing synthesis under the action of primers and polymerase. This intermittent reaction can affect the efficiency of DNA synthesis and the speed of amplification. To overcome these limitations and shortcomings of PCR, isothermal nucleic acid amplification technology has emerged. This technology can rapidly amplify target DNA or RNA fragments at a constant temperature without the need for a thermal cycler, greatly simplifying the complexity of nucleic acid detection protocols and having important implications for point-of-care testing.

[0004] Common isothermal amplification techniques include loop-mediated amplification (LAMP), rolling circle amplification (RCA), strand displacement amplification (SDA), multiple displacement amplification (MDA), recombinase polymerase amplification (RPA), transcription-mediated amplification (TMA), single primer isothermal amplification (SPIA), and helicase-dependent amplification (HDA). These techniques do not rely on temperature cycling to alter DNA conformation; instead, most employ a polymerase-mediated strand displacement mechanism to release the template strand and anneal primers. Polymerase-mediated strand displacement is a widely used technique in nucleic acid amplification reactions, mimicking the in vivo nucleic acid replication process. This displacement reaction can be performed over a wide temperature range and is simple to perform. In recent years, nucleic acid strand displacement reactions have gained widespread application in various fields of molecular biology, particularly in signal amplification and biosensor detection. However, this technique still has significant limitations in achieving specific co-detection of multiple targets.

[0005] Therefore, there is an urgent need in the art to develop a universal method suitable for detecting isothermal amplification products of nucleic acids.

[0006] Summary of the Invention

[0007] This application is filed by the inventor based on the following findings:

[0008] Isothermal amplification technology is a type of method used to rapidly amplify nucleic acid fragments at a certain constant temperature, aiming to overcome the limitations and shortcomings of PCR technology. LAMP is an important representative of isothermal amplification technology, suitable for low-cost and immediate nucleic acid diagnosis. At present, probe-based LAMP product detection methods exhibit their own unique characteristics due to their different detection principles. However, due to the complexity of the LAMP technology itself, the design of efficient probes has become quite challenging. In particular, some probes, such as assimilated probes-LAMP, DARQ and MERT-LAMP, have low specificity, which may lead to a high number of false positives in the test results. In addition, existing probe-based labeling methods usually only support single labeling or a single detection scheme (end point detection or real-time detection), and therefore lack versatility.

[0009] The purpose of this application is to solve at least one of the problems of the prior art.

[0010] To this end, in a first aspect of the present application, a primer composition is provided. According to an embodiment of the present application, the primer composition comprises: a first primer set, comprising an upstream primer and a downstream primer, wherein the first primer set includes at least one modified primer, wherein the 5' end of the modified primer has a labeled fluorescent group or a quencher group; and a probe, wherein the probe is suitable for complementary pairing with the 5' end of the modified primer, and the 3' end of the probe has a quencher group or a fluorescent group; wherein the quencher group is suitable for quenching the fluorescent group.

[0011] According to the embodiments of the present application, the use of the primer composition for nucleic acid amplification product detection can improve detection specificity, sensitivity and accuracy.

[0012] In some examples, the first primer set can be used as an inner primer or a turnaround primer to introduce a stem-loop product in loop-mediated amplification and initiate a self-extension amplification reaction.

[0013] In other examples, the first primer set can be used as loop primers or acceleration primers to pair with and extend the stem-loop product in loop-mediated amplification, thereby accelerating the self-extension amplification reaction.

[0014] In other examples, "the quencher group is suitable for quenching the fluorescent group" means that the quencher group in the primer composition is designed to interact with the fluorescent group to extinguish the fluorescent signal of the fluorescent group under certain conditions. For example, the so-called "certain conditions" include the complementary pairing of the modified primer and the probe at 20-45°C. At this time, the modified primer and the probe form a fluorescence-quenched double-stranded DNA (dsDNA) probe, and the fluorescence signal is quenched, and no fluorescence signal is generated.

[0015] According to an embodiment of the present application, the primer composition further includes at least one of the following technical features:

[0016] According to an embodiment of the present application, the modified primer has a quenching group at its 5' end and the probe has a fluorescent group at its 3' end. In other examples of the present application, the modified primer has a fluorescent group at its 5' end and the probe has a quenching group at its 3' end.

[0017] According to an embodiment of the present application, the modification is selected from at least one of the first three nucleotides at the 5' end or the 3' end.

[0018] In some examples of the present application, the quencher group is located at the 5' end of the modified primer and can be modified at any nucleotide between the first and third nucleotides from the 5' end. The fluorescent group is located at the 3' end of the probe and can be modified at any nucleotide between the first and third nucleotides from the 3' end.

[0019] In other examples of the present application, the fluorescent group is located at the 5' end of the modified primer and can be modified at any nucleotide between the first and third nucleotides from the 5' end. The quencher group is located at the 3' end of the probe and can be modified at any nucleotide between the first and third nucleotides from the 3' end.

[0020] According to an embodiment of the present application, the probe is single-stranded DNA.

[0021] According to an embodiment of the present application, the upstream primer of the first primer set has a nucleotide sequence as shown in SEQ ID NO: 1 to 3;

[0022] CTGCACTTACACCGCAAACCCGAACCCATGCTTCAGTC (SEQ ID NO: 1);

[0023] TTGCAGCATTGTTAGCAGGATTGGGAGCCTTGAATACACC (SEQ ID NO: 2);

[0024] TAAGCAGTTGGTGGTGCAGGAACCATGAGAAGTATGACAACA (SEQ ID NO: 3).

[0025] According to an embodiment of the present application, the downstream primers in the first primer set have nucleotide sequences as shown in SEQ ID NOs: 4 to 6;

[0026] CGGCACAGGCACTAGTACTGCAAAACCAGCTACTTTATCATTGT(SEQ ID NO:4);

[0027] TGCTACAACTTCCTCAAGGAACACGAGAAGAGGCTTGACTG (SEQ ID NO: 5);

[0028] CCTGGCCAAGGTCATCCATGTGGACTGTGGTCATGAGT (SEQ ID NO: 6).

[0029] According to an embodiment of the present application, the primer composition further includes a second primer set, which includes an upstream primer and a downstream primer. According to an embodiment of the present application, the second primer set is an outer primer (or displacement primer) used to displace the inner primer extension chain in the early stage of loop-mediated amplification, thereby promoting the formation of stem-loop products.

[0030] According to an embodiment of the present application, the upstream primer in the second primer set has a nucleotide sequence as shown in SEQ ID NO: 7 to 9;

[0031] TGTAGTTGTGATCAACTCCG (SEQ ID NO:7);

[0032] TCATATGGGTTGCAACTGA(SEQ ID NO:8);

[0033] ATGTTCGTCATGGGTGTG (SEQ ID NO:9).

[0034] According to an embodiment of the present application, the downstream primers in the second primer set have nucleotide sequences as shown in SEQ ID NOs: 10 to 12;

[0035] TCTTGGAAGCGACAACAA(SEQ ID NO:10);

[0036] TTGCGACTACGTGATGAG(SEQ ID NO:11);

[0037] ATCCACAGTCTTCTGGGT (SEQ ID NO: 12).

[0038] According to an embodiment of the present application, the primer composition further includes: a third primer set, and the third primer set includes an upstream primer and a downstream primer.

[0039] According to an embodiment of the present application, the third primer set includes at least one modified primer, and the 5' end of the modified primer has a quenching group.

[0040] In some examples of the present application, the third primer set can be used as a loop primer or an acceleration primer to pair with and extend the stem-loop product in loop-mediated amplification, thereby accelerating the self-extension amplification reaction.

[0041] In other examples of the present application, the third primer set can be used as an inner primer or a turn-around primer to introduce a stem-loop product in loop-mediated amplification and initiate a self-extension amplification reaction.

[0042] According to an embodiment of the present application, the upstream primer in the third primer set has a nucleotide sequence as shown in SEQ ID NOs: 13 to 15;

[0043] CGTTTAAAAACGATTGTGCATCAGC (SEQ ID NO: 13);

[0044] CGGGTGCCAATGTGATCTTTT (SEQ ID NO: 14);

[0045] AGGCATTGCTGATGATCTTGAG (SEQ ID NO: 15).

[0046] According to an embodiment of the present application, the downstream primers in the third primer set have nucleotide sequences as shown in SEQ ID NOs: 16 to 18;

[0047] ATGTCGTATACAGGGCTTTTGACA (SEQ ID NO: 16);

[0048] ATTGCCAAAAGGCTTCTACGC (SEQ ID NO: 17);

[0049] ACAACTTTGGTATCGTGGAAGG (SEQ ID NO: 18).

[0050] According to an embodiment of the present application, the quenching group is selected from at least one of BHQ1, BHQ2, BHQ3, MGB, BBQ 650, Dabcyl, DBQ1, TAMRA and Eclipse; the fluorescent group is selected from at least one of FAM, HEX, ROX, Cy5, Atto 425, TET, JOE, VIC, R6G, Yakima Yellow, Quasar 570, Quasar 670, Cy3, NED, Cy5.5, Cy7, TexasRed, Atto 590, IRDye 650 and IRDye 750.

[0051] According to an embodiment of the present application, the length of the probe is selected from 5 to 20 bp. In some examples, the length of the probe is selected from 8 to 12 bp. Specifically, the length of the probe can be 8, 9, 10, 11 or 12 bp.

[0052] According to an embodiment of the present application, the probe has a nucleotide sequence as shown in SEQ ID NO: 19 to 21;

[0053] GTGTAAGTGCAG (SEQ ID NO: 19);

[0054] GAAGTTGTAGCA (SEQ ID NO: 20);

[0055] ACCAACTGCTTA (SEQ ID NO: 21).

[0056] According to an embodiment of the present application, at least one sequence in the modified primer includes at least one special nucleotide or modifying group. According to an embodiment of the present application, the purpose of adding the special nucleotide or modifying group is to change the half-melting temperature (Tm value) of the sequence or to improve the stability and specificity of complementary chain pairing.

[0057] According to an embodiment of the present application, at least one of the probes includes at least one of the special nucleotides or modification groups.

[0058] According to an embodiment of the present application, the special nucleotide includes at least one selected from locked nucleic acid, peptide nucleic acid, ribonucleotide, and deoxyinosinic acid. In some examples, the so-called special nucleotide includes but is not limited to the above-mentioned ones. Generally speaking, nucleotides that can increase the stability and specificity of complementary chain pairing are applicable.

[0059] According to embodiments of the present application, the modifying group includes at least one selected from a phosphate group, a methyl group, and a sugar group. In some examples, the modifying groups include, but are not limited to, those mentioned above. Generally speaking, nucleotides that can increase the stability and specificity of complementary chain pairing are applicable, such as zinc finger structures.

[0060] In a second aspect of the present application, a kit is provided. According to an embodiment of the present application, the kit comprises: the primer combination described in the first aspect of the present application or any embodiment of the present application. The kit has the advantages of portability and low cost.

[0061] According to an embodiment of the present application, the above-mentioned kit further includes at least one of the following technical features:

[0062] According to an embodiment of the present application, the kit further comprises at least one selected from the group consisting of a strand displacement DNA polymerase, a reverse transcriptase, a ribonuclease inhibitor, a uracil-DNA glycosylase, dNTPs, dUTPs, a pyrophosphatase, a proofreading enzyme, a protective agent, a reducing agent, and a crowding agent. In some examples, the uracil-DNA glycosylase and dUTP are used to reduce contamination of the amplified product.

[0063] In other examples, the kit may also include an enhancer, constant volume water, or instructions, etc. The enhancer is more effective in detecting nucleic acid products rich in GC sequences.

[0064] According to an embodiment of the present application, the strand-displacing DNA polymerase does not have 3'→5' exonuclease activity.

[0065] According to an embodiment of the present application, the strand displacement DNA polymerase comprises a member selected from Bst 3.0 DNA polymerase, Bst 2.0 At least one of DNA polymerase, Bst 2.0 HotStart DNA polymerase, Bst II Pro DNA polymerase, and HotStart Bst 4.2 DNA polymerase. In some examples, the kit includes a buffer compatible with the strand-displacing DNA polymerase.

[0066] According to an embodiment of the present application, the reverse transcriptase comprises a member selected from RTx reverse transcriptase, At least one of: a ThermoStable III reverse transcriptase and a ThermoStable V reverse transcriptase. In some examples, the kit includes a buffer compatible with the reverse transcriptase.

[0067] According to an embodiment of the present application, the uracil-DNA glycosylase includes at least one selected from Antarctic thermosensitive uracil-DNA glycosylase and temperature-sensitive uracil-DNA glycosylase.

[0068] According to an embodiment of the present application, the proofreading enzyme has 3'→5' exonuclease activity.

[0069] According to an embodiment of the present application, the proofreading enzyme comprises at least one selected from Pfu DNA polymerase, Q5U DNA polymerase, Q6U DNA polymerase and KOD DNA polymerase. The proofreading enzyme can overcome the problem of reduced amplification efficiency caused by base mismatch.

[0070] In some cases, the kit includes a buffer compatible with the proofreading enzyme.

[0071] According to an embodiment of the present application, the protective agent includes at least one selected from bovine serum albumin, casein, trehalose, pululan, sucrose, maltose, glycine, proline, sodium azide, and thimerosal. In some examples, the addition of the protective agent can protect enzyme activity and make the kit performance more stable.

[0072] According to an embodiment of the present application, the protective agent is bovine serum albumin. In some examples, selecting bovine serum albumin as the protective agent can make the reaction system more stable.

[0073] According to an embodiment of the present application, the reducing agent includes at least one selected from dithiothreitol, β-mercaptoethanol and glutathione.

[0074] According to an embodiment of the present application, the crowding agent includes at least one selected from polyethylene glycol, polysucrose and dextran.

[0075] According to an embodiment of the present application, the kit further comprises at least one selected from an enzyme buffer and a surfactant.

[0076] In a third aspect, the present application provides a method for detecting nucleic acid amplification products. According to an embodiment of the present application, the method comprises: using a nucleic acid sample to be detected as a template, performing an amplification reaction using the primer combination described in the first aspect or the kit described in the second aspect of the present application; and detecting a signal from the amplified product.

[0077] According to the embodiments of the present application, the method for detecting nucleic acid amplification products can accurately display the progress of the amplification reaction (real-time detection) and the final detection result (endpoint detection), with a high signal-to-noise ratio and a significant difference between negative and positive amplification results. Moreover, multiple detections can be performed in the same reaction.

[0078] According to an embodiment of the present application, the above method further includes at least one of the following technical features:

[0079] According to an embodiment of the present application, the nucleic acid sample to be detected includes at least one selected from nasopharyngeal swabs, alveolar lavage fluid, genital tract swabs, whole blood, plasma, serum, saliva, sputum, urine, lymph, tears, sweat, tissue, hair, feces, bacterial fluid, virus culture fluid, water, soil, aerosol, condensed water, oil depot, biological sample and environmental sample.

[0080] According to an embodiment of the present application, the amplification reaction includes at least one selected from loop-mediated amplification, recombinase polymerase amplification, cross primer amplification, helicase amplification and rolling circle amplification.

[0081] According to an embodiment of the present application, the amplification reaction is loop-mediated amplification.

[0082] According to an embodiment of the present application, the amplification reaction is performed in an amplification reaction system.

[0083] According to an embodiment of the present application, the concentration of the strand-displacing DNA polymerase in the amplification reaction system is 0.1 to 0.8 U / μL. In some examples, the concentration of the strand-displacing DNA polymerase is optionally 0.1 U / μL, 0.2 U / μL, 0.3 U / μL, 0.4 U / μL, 0.5 U / μL, 0.6 U / μL, 0.7 U / μL, or 0.8 U / μL.

[0084] According to an embodiment of the present application, the concentration of the strand displacement DNA polymerase in the amplification reaction system is 0.2-0.6 U / μL.

[0085] According to an embodiment of the present application, the concentration of the strand displacement DNA polymerase in the amplification reaction system is 0.3-0.5 U / μL.

[0086] According to an embodiment of the present application, the concentration of the reverse transcriptase in the amplification reaction system is 0.2 to 2 U / μL. In some examples, the reverse transcriptase concentration is optionally 0.2 U / μL, 0.3 U / μL, 0.4 U / μL, 0.5 U / μL, 0.6 U / μL, 0.7 U / μL, 0.8 U / μL, 0.9 U / μL, 1 U / μL, 1.1 U / μL, 1.2 U / μL, 1.3 U / μL, 1.4 U / μL, 1.5 U / μL, 1.6 U / μL, 1.7 U / μL, 1.8 U / μL, 1.9 U / μL, or 2 U / μL.

[0087] According to an embodiment of the present application, the concentration of the reverse transcriptase in the amplification reaction system is 0.4 to 1.6 U / μL.

[0088] According to an embodiment of the present application, the concentration of the ribonuclease inhibitor in the amplification reaction system is 0.2-1.2 U / μL.

[0089] According to an embodiment of the present application, the concentration of the ribonuclease inhibitor in the amplification reaction system is 0.5-0.9 U / μL.

[0090] According to an embodiment of the present application, the concentration of the uracil-DNA glycosylase in the amplification reaction system is 0.01 to 0.1 U / μL.

[0091] According to an embodiment of the present application, the concentration of the uracil-DNA glycosylase in the amplification reaction system is 0.02 to 0.05 U / μL.

[0092] According to an embodiment of the present application, in the amplification reaction system, the molar ratio of dUTP to dTTP is 0:10 to 10:0. In some examples, the molar ratio of dUTP to dTTP is optionally 1:9, 2:8, 3:7, 4:6, 5:5, 6:4, 7:3, 8:2, or 9:1.

[0093] According to an embodiment of the present application, in the amplification reaction system, the molar ratio of dUTP to dTTP is 2:8 to 8:2.

[0094] According to an embodiment of the present application, the concentration of the proofreading enzyme in the amplification reaction system is 0.001 to 0.1 U / μL. In some examples, the concentration of the proofreading enzyme is optionally 0.001 U / μL, 0.01 U / μL, 0.02 U / μL, 0.03 U / μL, 0.04 U / μL, 0.05 U / μL, 0.06 U / μL, 0.07 U / μL, 0.08 U / μL, 0.09 U / μL, or 0.1 U / μL.

[0095] According to an embodiment of the present application, the concentration of the proofreading enzyme in the amplification reaction system is 0.005-0.05 U / μL.

[0096] According to an embodiment of the present application, the concentration of bovine serum albumin in the amplification reaction system is 0.1 to 25 μg / μL. In some examples, the concentration of bovine serum albumin is optionally 0.1 μg / μL, 1 μg / μL, 2 μg / μL, 3 μg / μL, 4 μg / μL, 5 μg / μL, 6 μg / μL, 7 μg / μL, 8 μg / μL, 9 μg / μL, 10 μg / μL, 11 μg / μL, 12 μg / μL, 13 μg / μL, 14 μg / μL, 15 μg / μL, 16 μg / μL, 17 μg / μL, 18 μg / μL, 19 μg / μL, 20 μg / μL, 21 μg / μL, 22 μg / μL, 23 μg / μL, 24 μg / μL, or 25 μg / μL.

[0097] According to an embodiment of the present application, the concentration of the bovine serum albumin in the amplification reaction system is 0.5 to 15 μg / μL.

[0098] According to an embodiment of the present application, prior to the amplification reaction, the primer composition is further subjected to an annealing reaction, and the annealing reaction is performed at 20-45° C. At this reaction temperature, the modified primer and the probe complement each other to form a fluorescence-quenched double-stranded DNA (dsDNA) probe, which is the starting point of the reaction and does not contain a fluorescent signal.

[0099] According to the embodiments of the present application, the annealing reaction is performed at 40° C. The inventors have finally determined that the optimal annealing temperature is 40° C. after comprehensively considering the signal-to-noise ratio of the fluorescence signal and the time required for amplification.

[0100] According to an embodiment of the present application, the amplification reaction is carried out at 60-68°C. At this reaction temperature, the modified primer and the probe complementary strands unravel to form two single-stranded DNAs (ssDNA). The modified primer binds to the amplification primer, generating a fluorescent signal.

[0101] According to the embodiments of the present application, the amplification reaction is carried out at 65° C. The inventors have finally determined that the optimal amplification temperature is 65° C. after comprehensively considering the signal-to-noise ratio of the fluorescence signal and the time required for amplification.

[0102] According to an embodiment of the present application, in the amplification reaction system, the molar ratio of the modified primer to the probe is 1:1.2 to 1:1.5. Generally speaking, the amount of probe input does not exceed the maximum amount that allows it to completely pair with the modified primer to form a fluorescence-quenched dsDNA probe within the temperature range, and is usually less than the amount of the modified primer input. In some examples, the molar ratio of the modified primer to the probe is 1:1.2, 1:1.3, 1:1.4, or 1:1.5.

[0103] According to an embodiment of the present application, prior to the amplification reaction, the nucleic acid sample to be tested is pretreated; the pretreatment includes mixing a sample release agent with the nucleic acid sample to be tested. In some examples of the present application, the sample release agent can be a commercial kit purchased from a manufacturer such as Shenzhen MGI Intelligent Manufacturing Co., Ltd. (MGI Intelligent Manufacturing, catalog number: 1000027692).

[0104] In other examples of the present application, the pretreatment of the nucleic acid sample to be tested includes extracting DNA or RNA from the nucleic acid sample, and the extraction method includes but is not limited to sample release agent direct extraction method, RNA or DNA magnetic bead extraction method, RNA or DNA silica gel mold centrifugal column extraction method, etc.

[0105] Additional aspects and advantages of the present invention will be set forth in part in the description which follows and, in part, will be obvious from the description which follows, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0106] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the following description of the embodiments with reference to the accompanying drawings, in which:

[0107] FIG1 is a schematic diagram of the loop-mediated isothermal amplification (LAMP) reaction principle according to one embodiment of the present application;

[0108] FIG2 is a schematic diagram of a LAMP non-sequence-specific labeling method according to one embodiment of the present application;

[0109] FIG3 is a schematic diagram of a LAMP sequence-specific multi-target labeling method according to one embodiment of the present application;

[0110] FIG4 is a schematic diagram of a primer composition and a probe according to one embodiment of the present application;

[0111] FIG5 is a schematic diagram of a double-stranded probe labeling principle and detection scheme according to one embodiment of the present application;

[0112] FIG6 is a schematic diagram of the first and second groups of annealing and melting temperature test results according to one embodiment of the present application;

[0113] FIG7 is a schematic diagram of the third and fourth groups of annealing and melting temperature test results according to one embodiment of the present application;

[0114] FIG8 is a schematic diagram of the real-time detection results of ORF and N gene single complexes according to one embodiment of the present application;

[0115] FIG9 is a schematic diagram of the results of dual real-time detection of ORF and N genes and triple real-time detection of ORF, N, and GAPDH genes according to one embodiment of the present application;

[0116] FIG10 is a schematic diagram of the results of single-end point detection of ORF, N, and GAPDH genes under stimulation with a portable ultraviolet light source according to one embodiment of the present application;

[0117] FIG11 is a schematic diagram of a dual-channel LAMP real-time signal curve (Bori FQD-96A raw data) according to one embodiment of the present application;

[0118] FIG12 is a schematic diagram of fluorescence signal images of a 96-well PCR plate endpoint method according to one embodiment of the present application; wherein A: dark field fluorescence image; B: bright field fluorescence image;

[0119] FIG13 is a schematic diagram of real-time detection results at 60° C., 62° C., and 65° C. according to one embodiment of the present application.

[0120] The above figures are for illustrative purposes only and are not intended to limit the scope of the present invention. In the accompanying drawings, the dimensions of some components may be exaggerated and not drawn to scale for illustrative purposes. The dimensions and relative dimensions do not necessarily correspond to actual dimensions in the practice of the present invention. DETAILED DESCRIPTION

[0121] definition

[0122] As used herein, unless otherwise indicated, the singular forms "a," "an," and the like include plural referents (more than one); "a set" or "a plurality" refers to two or more.

[0123] In this document, unless otherwise specified, the terms “include” or “comprising” are open expressions, that is, including the contents specified in the present invention but not excluding other contents.

[0124] In this document, unless otherwise specified, the terms "first", "second", "third", "fourth", etc. are used for descriptive purposes only and are not to be understood as indicating or implying relative importance or implicitly indicating the number of technical features indicated; features specified as "first", "second", etc. may explicitly or implicitly include one or more of the said features.

[0125] In this document, primers, probes or nucleic acid fragments are all written from left to right in the 5' to 3' direction.

[0126] Herein, dNTPs include four natural nucleotides, such as dATP, dTTP, dGTP and dCTP, and also include mutants of natural nucleotides.

[0127] In this article, the term "loop-mediated amplification (LAMP)" is used as an effective alternative to PCR. It is a rapid and efficient self-circulating strand displacement amplification technology developed by Eiken Chemical Co., Ltd. in Japan in 2000 (DOI: 10.1093 / nar / 28.12.e63). This technology uses specially designed primer combinations to construct intermediate products with specific structures through multiple bidirectional strand displacements. These intermediates can form multiple primer annealing sites, thereby initiating superexponential amplification and DNA self-extension (Figure 1). LAMP utilizes a polymerase with strong displacement activity to achieve rapid extension and replication of DNA double strands under mild isothermal conditions (typically a constant temperature between 60 and 68°C). Due to its stable amplification performance and simple operation, LAMP technology has been widely used in infectious disease diagnosis, genetic screening, prenatal diagnosis, cancer detection, environmental monitoring, and other fields. Furthermore, LAMP technology can be combined with reverse transcriptase to detect RNA targets such as influenza virus, Ebola virus, and dengue virus.

[0128] LAMP technology is generally considered to have high specificity and high sensitivity that are no less than PCR, but the main challenge of LAMP technology in low-cost or instant diagnostic applications is how to get rid of cumbersome operations and dependence on complex instruments and equipment as much as possible while achieving nucleic acid amplification detection. In addition, the available detection mechanisms commonly used in LAMP technology are not easy to implement multiple operations, so that it is difficult to achieve the purpose of distinguishing multiple targets in a single (tube) reaction. For example, for typing gene mutations or identifying different variants of pathogens. In contrast, real-time PCR is based on multiple technologies of multicolor fluorescent labeling, which can detect 2-4 targets in each reaction (such as TaqMan hydrolysis probes, molecular beacons, scorpion probes and other labeling methods). In addition, the detection method used by most existing LAMP technologies is a non-sequence-specific labeling method, which is not highly specific to the target DNA and can easily cause false positive test results. These detection methods include magnesium pyrophosphate precipitation turbidity measurement, gel electrophoresis, calcium / magnesium ion metal indicators, pH colorimetric colorimetry, melting and annealing curve analysis, labeling with embedded fluorescent dyes (such as EvaGreen, PicoGreen, SYBR Green series, SYTO series, etc.), pyrophosphate conversion bioluminescence or electrochemiluminescence, etc. Due to the use of a large number of primer combinations with different lengths and Tm (semi-melting temperature, Melting temperature) values, LAMP technology has a greater risk of primer dimers or primer self-extension. If the non-sequence-specific labeling methods listed above are used, false positive results are likely to occur (Figure 2). In contrast, sequence-specific labeling methods have better performance by using target-specific probes or modified primers as recognition elements. Sequence-specific labeling methods can accurately identify amplicons and are not affected by non-specific products. In addition, sequence-specific labeling methods allow for simultaneous labeling and identification of multiple target genes or nucleotide fragments in a single test, making it easy to achieve single-tube multiplex detection.

[0129] Herein, Primer-Q refers to a primer / probe containing a quencher group, and Primer-P refers to a primer / probe containing a fluorescent group.

[0130] Existing technology

[0131] The sequence-specific labeling methods currently used in LAMP technology (Figure 3) mainly include fluorescence of loop primer upon self-dequenching, HyBeacon probe, guanine quenching probe, graphene oxide based fluorescence resonance energy transfer (GO-FRET), detection of amplification by release of quenching (DARQ), quenching of unincorporated amplification signal reporters (QUASR), one-step strand displacement probe (OSD), molecular beacon (MB), light cycler probe, assimilating probe, mediator displacement probe, etc. Different labeling methods are divided into two technical solutions: endpoint detection and real-time detection.

[0132] Self-quenching ring primers use fluorescent groups that can self-quench to modify ring primers. No additional fluorescent molecules are required, so this is a quenching mechanism based on a non-FRET (Fluorescence resonance energy transfer) effect. The quenching mechanism of the labeling group inside the primer is still unclear, and it may be related to the interaction of the nucleoside bases around the group. During the amplification process, the modified primer is incorporated into the double-stranded amplicon, resulting in a dequenching effect, which causes fluorescence enhancement. The main challenge of this technology is the need to match a fluorescent group that shows high self-quenching and a primer sequence suitable for modification with the fluorescent group. This method has only been reported for single-target labeling, and multiple detection is temporarily not possible.

[0133] Unlike self-quenching loop primers, HyBeacon probes are non-extensible reporter molecules and are located between the inner primers FIP and BIP sequences. They are usually detected using a melting / annealing curve after LAMP termination and can usually only perform single-target labeling.

[0134] Guanine-quenched probes are typically modified with a fluorescent group at the cytosine (C) residue at the 5' end. When the probe anneals to the target sequence, fluorescence is quenched by electron transfer between the fluorescent group and the complementary guanine (G) residue. A significant disadvantage of this approach is that signal generation is highly dependent on the target sequence; the fluorescent group must be attached to a cytosine (C) for effective quenching in the target-probe complex. Furthermore, the signal of the free probe may be affected by any nearby guanine bases.

[0135] GO-FRET is achieved through the FRET quenching effect between the fluorescent group on the probe and GO. The single-stranded probe is adsorbed to the GO surface through π-π interaction, and the fluorescence is quenched due to the close proximity between the fluorescent group and GO. After LAMP is terminated, the fluorescent probe hybridizes with the amplicon, making GO unable to approach the nucleotide base, and thus the quenched fluorescence signal is restored. The LAMP product is added to the probe-GO mixture. In the case of a positive LAMP reaction, the probe preferentially binds to the amplicon, resulting in the recovery of the fluorescence signal within 10 minutes. The disadvantage of this method is that it is necessary to open the lid and transfer the product after LAMP, which is very easy to cause contamination of the amplicon. However, due to the effective FRET between GO and the group, the fluorescence signal quenching efficiency is high, which is an advantage of this detection method.

[0136] The DARQ probe, consisting of a modified FIP primer and an additional oligonucleotide (Fd probe) complementary to the 5'-end overhang of the FIP primer, is a double-stranded quenched reporter probe used for real-time detection. The FIP primer is modified with a fluorescent group or quencher at its 5' end and annealed with the Fd probe, which is also modified with a quencher or fluorescent group at its 3' end. The newly synthesized product strand hybridizes with the Fd probe and serves as a template for subsequent primer extension. Primer extension at the 3' end of the newly synthesized strand results in displacement of the Fd probe and release of the fluorescent quencher, leading to signal enhancement. The double-stranded quenched reporter probe is typically doped with unmodified normal primers at a specific ratio (generally 1:10) to participate in the amplification reaction. Tanner et al. first reported the DARQ probe and its real-time detection method, applying it to singleplex and quadruplex real-time detection using model systems including Escherichia coli, Caenorhabditis elegans, HeLa cells, lambda, and hBRCA1 DNA. However, the amplification curves exhibited inconsistent shapes and deviated significantly from S-curves. Moreover, due to the excessive number of primers and probes in the system, non-template amplification occurred in multiplex detection, which reduced the specificity of the method to a certain extent (DOI: 10.2144 / 0000113902).

[0137] The QUASR method is specifically designed for LAMP endpoint detection. Similar to DARQ, the QUASR method utilizes a primer modified with a fluorescent group at its 5' end and a short quencher probe of approximately 7-13 nucleotides in length modified at its 3' end. The 3' end of the short quencher probe is complementary to the 5' end of the modified primer, and the half-melting temperature (Tm) of the double-stranded quencher reporter probe formed before amplification initiation must be significantly lower than the LAMP temperature (e.g., below 50°C) to ensure that the short quencher probe is free ssDNA after LAMP initiation, thereby avoiding any impact on amplification speed and efficiency. After LAMP termination, the reaction is cooled to room temperature. The still free 5'-end fluorescently modified primer (if present) and the short quencher probe will hybridize again, at which point no fluorescent signal will be emitted due to the quenching effect. Once the target DNA is amplified, the 5'-end fluorescently modified primer is incorporated into the amplicon, making it inaccessible to the short quencher probe. Therefore, the fluorescent signal remains bright and can be observed visually using a UV light source. Ball et al. applied the QUASR method to dual-endpoint detection of West Nile virus and Chikungunya virus, using a smartphone as the detection terminal to read the results (DOI: 10.1021 / acs.analchem.5b04054). Currently, due to the use of color-based visual judgment methods, QUASR-based endpoint detection solutions only support dual detection and cannot yet perform accurate quantitative analysis.

[0138] The OSD probe method involves two complementary probes: a target-binding probe containing a fluorescent group at its 5' or 3' end, and a second oligonucleotide modified with a quencher group at its 3' or 5' end. The target-binding probe is 10 to 11 bases longer than the second oligonucleotide, resulting in a higher binding enthalpy between the target-binding probe and the amplicon. According to Le Chatelier's principle, a toehold-mediated strand displacement reaction is induced in the target-binding probe during target DNA amplification, leading to the separation of the fluorescent group and the quencher group, resulting in an increase in fluorescence intensity. Due to its thermodynamic properties, the probe is sensitive to single mismatches in the target amplicon, allowing OSD probes to distinguish SNPs in LAMP amplicons with a high signal-to-noise ratio. LAMP-OSD has been applied to SNP detection in the mutant BRAF allele (V600E) in the presence of the wild-type gene. The analytical sensitivity for detecting the mutant allele (V600E) was 20 copies per reaction. The main disadvantage of this method is that LAMP-OSD requires careful design of the sequence of the analytical probe, because the binding enthalpy between different sequences must be calculated and balanced to ensure that the toehold-mediated strand displacement reaction occurs smoothly.

[0139] A molecular beacon is a target-specific dual-labeled probe that is modified with a fluorescent group and a quencher at each end of its chain. Its 3' end is complementary to its 5' end, allowing the probe to spontaneously form a hairpin structure. In the absence of an amplicon, the molecular beacon exists in a closed loop due to intramolecular hybridization between the 5' and 3' ends. As a result, the fluorescent group and the quencher are very close, resulting in fluorescence quenching. In the presence of an amplicon, the probe hybridizes with the amplicon, causing the loop to open, separating the fluorophore and quencher, and resulting in fluorescence release (Figure 3). The hairpin structure is unstable under LAMP conditions, and background fluorescence can affect the signal-to-noise ratio and detection performance. Locked nucleic acids (LNA) are generally used to improve the thermal stability of molecular beacons and reduce background fluorescence signals, but the synthesis cost is high.

[0140] Similar to DARQ, the assimilation probe consists of two partially complementary oligonucleotides: a fluorescent probe and a quencher probe. The fluorescent probe is designed by modifying the 5' end of the loop primer (LF or LB) with a universal oligonucleotide (F strand) with a fluorescent group. The quencher probe (Q strand) is complementary to the F strand and labeled with a quencher group at its 3' end. In the absence of target DNA, the fluorescence is quenched when the fluorescent and quencher probes hybridize and come into close proximity. In the presence of target DNA, after LAMP is initiated, newly synthesized DNA displaces the quencher probe, releasing a fluorescent signal.

[0141] The various probe-based LAMP methods mentioned above exhibit different characteristics due to their different principles. Among these methods, the probe design of OSD probes, molecular beacons, Q probe-LAMP, assimilation probe-LAMP, and TaqMan-LAMP is relatively difficult. Although the probe-based LAMP method has greatly improved the specificity of detection, the specificity of assimilation probe-LAMP, DARQ, and MERT-LAMP is relatively low compared with other methods. In addition, the several labeling methods introduced above either only support single labeling or only support a single detection scheme (end point detection or real-time detection). Each has certain technical limitations or design difficulties and is not universal.

[0142] Nucleic acid amplification product detection method

[0143] Based on the deficiencies of existing technologies in detecting nucleic acid amplification products, this application proposes a method for detecting nucleic acid amplification products. The method comprises: using a nucleic acid sample to be detected as a template, performing an amplification reaction using the primer composition described in the first aspect or any embodiment of this application, or the kit described in the second aspect or any embodiment of this application; and detecting a signal from the amplified product.

[0144] The method described in this application is applicable to chain displacement amplification, and can also be designed for other similar chain displacement amplification methods, such as recombinase polymerase amplification, cross primer amplification, rolling circle amplification or other derivatives and variants of loop-mediated amplification (such as droplet digital loop-mediated amplification), as well as new amplification methods that may appear in the future. It is particularly suitable for LAMP or RT-LAMP (reverse transcription-loop-mediated amplification), and has the advantages of simplicity, rapidity, sensitivity and accuracy in single-step, closed-tube, multiple nucleic acid amplification product detection. In addition, this method can simultaneously meet both endpoint detection and real-time detection technical solutions, and the minimum detection limit (LoD) of a single target can reach less than 10 copies per reaction.

[0145] In one example of the present application, the primer composition referred to in the present application can also be used in combination or mixed with other labeling methods to detect nucleic acid amplification products, such as molecular beacons, ribonuclease cleavage primers or CRISPR cleavage probes, endonuclease probes, etc.

[0146] In one example of the present application, as shown in Figures 4 and 5, a nucleic acid sample to be detected is used as a template, and a loop-mediated amplification is performed with a specific amplification primer, wherein the 5' end of at least one inner primer or loop primer of a single target or multiple targets involved in the amplification is all single-end modified with a quenching group, and a sequence that is complementary to the 5' end of the modified primer and single-end modified with a fluorescent group at the 3' end is used as a fluorescent probe. Within a certain temperature range (20-45°C), it forms a fluorescence-quenched double-stranded probe with the modified primer to mark the consumption of the modified primer in the loop-mediated amplification. Before the amplification is started, the consumption of the modified primer is zero, and the fluorescent probe fluorescent signal is completely quenched due to pairing to form a double-stranded probe. At this time, the fluorescent signal is at the lowest level; after the amplification is started, the consumption of the modified primer gradually increases until it is insufficient to pair all the fluorescent probes to form double-stranded probes. Therefore, the fluorescent probe in the free ssDNA state gradually increases, causing the fluorescent signal to increase, until the modified primer is completely consumed and the fluorescent probe is completely converted into free ssDNA, at which time the fluorescent signal reaches saturation.

[0147] Since the modified primer is usually an inner primer or a loop primer, the amount of input in the amplification reaction is usually large, and it can fully participate in the amplification reaction, so the consumption is also large. The detection method using the above-mentioned labeling principle can truthfully display the progress of the amplification reaction and the final test result, and the signal-to-noise ratio has a relative advantage, and the difference between the negative and positive test results is more significant. In addition, once the target DNA is amplified, the inner primer or the loop primer will be specifically incorporated into the amplicon under the action of the chain displacement polymerase, so the specificity of the detection method can be guaranteed. When it is necessary to detect multiple target DNAs, at least one inner primer or loop primer corresponding to each of the multiple targets can be modified and labeled with a complementary fluorescent probe, and the different emission wavelengths of the labeled fluorescent group are distinguished and set, so that multiple detection can be achieved in the same reaction. In addition, the detection method of the present application can simultaneously meet both endpoint detection and real-time detection technology, and is suitable for nucleic acid rapid detection applications under different scenarios.

[0148] For ease of understanding, the endpoint detection method and real-time detection method of the nucleic acid amplification product described in this application are described in detail below.

[0149] (1) End point detection method

[0150] A. Template Preparation: Collect and preserve nucleic acid samples. Prepare the template solution for testing based on different nucleic acid sample types, such as RNA, cDNA, or dsDNA. Sample processing methods include direct extraction with a sample release agent, RNA or DNA magnetic bead extraction, RNA or DNA silica gel spin column extraction, and reverse transcription of RNA samples into cDNA. Depending on the sample processing requirements for different throughputs, experimental operations can be performed manually or using automated platforms.

[0151] B. Prepare the amplification reaction solution: synthesize the specific primer set and probe according to the method described above, and prepare the loop-mediated amplification detection kit. The kit may include two forms of liquid reagents and solid reagents, or may include both forms at the same time, wherein the solid reagent is prepared and produced by a process including freeze-drying, air-drying, etc., and the appearance includes various types such as spherical, square, thin film, special shape, granular, dry powder or amorphous. Dilute or redissolve the solution into a solution according to the preset volume and concentration, mix it with the template solution to be detected to form an amplification reaction solution, or directly add the template solution to redissolve it to form an amplification reaction solution of preset volume and concentration. The above amplification reaction solution preparation process can be performed manually or on an automated platform.

[0152] C. On-board amplification: The amplification reaction solution is heated in situ or transferred to a device, equipment, or environment with a constant temperature incubation function, including but not limited to a water bath, metal bath, oven, hot plate, thermal cycler, resistance heater, semiconductor thermoelectric device, magnetothermal device, photothermal device, or biological or chemical heating device. This allows the amplification reaction solution, containing sufficient template, to fully undergo loop-mediated amplification under suitable temperature conditions (typically a constant temperature between 60 and 68°C). Amplification reaction solutions containing template at or below the detection limit have a certain probability of not undergoing loop-mediated amplification. The template content in the same reaction is positively correlated with the probability of amplification. The time required to complete amplification varies depending on the type and amount of template, as well as the performance of the primer set and probe, ranging from 5 to 60 minutes.

[0153] D. Endpoint detection: Lower the temperature of the amplification reaction solution to a lower temperature range and illuminate it with a suitable excitation light source (such as ultraviolet light or an excitation light source of each wavelength corresponding to the detection channel). Use an optical sensor or the naked eye to determine the intensity and color of the emitted fluorescent signal. After comparing it with the no-template control (NTC) amplification reaction solution, calculate the light intensity threshold and determine the amplification result. Determine whether the target on the template is detected based on the light intensity (if the endpoint light intensity or the change in endpoint light intensity is significantly enhanced compared to the NTC, it is determined to be a positive result, indicating detection; if it is not significantly enhanced, it is determined to be a negative result, indicating non-detection). Determine the type of amplification target detected based on the color (different fluorescent-labeled primers correspond to different types of amplification targets).

[0154] (2) Real-time detection method

[0155] A. Template Preparation: Collect and preserve nucleic acid samples. Prepare the template solution for testing based on different nucleic acid sample types, such as RNA, cDNA, or dsDNA. Sample processing methods include direct extraction with a sample release agent, RNA or DNA magnetic bead extraction, RNA or DNA silica gel spin column extraction, and reverse transcription of RNA samples into cDNA. Depending on the sample processing requirements for different throughputs, experimental operations can be performed manually or using automated platforms.

[0156] B. Prepare the amplification reaction solution: synthesize the specific primer set and probe according to the method described above, and prepare the loop-mediated amplification detection kit. The kit may include two forms of liquid reagents and solid reagents, or may include both forms at the same time, wherein the solid reagent is prepared and produced by a process including freeze-drying, air-drying, etc., and the appearance includes various types such as spherical, square, thin film, special shape, granular, dry powder or amorphous. Dilute or redissolve the solution into a solution according to the preset volume and concentration and mix it with the template solution to be detected to form an amplification reaction solution, or directly add the template solution to redissolve to form an amplification reaction solution of preset volume and concentration. The above amplification reaction solution preparation process can be performed manually or on an automated platform.

[0157] C. Real-time detection program setting: Different real-time detection programs are set according to the different types of samples to be detected. A separate reverse transcription program can be set for RNA samples, or the reaction temperature can be increased and combined with the loop-mediated amplification program into a single-step program. Normally, the temperature of the reverse transcription program is a constant temperature in the range of 40 to 65°C, which lasts for 2 to 20 minutes, and the temperature of the loop-mediated amplification program is a constant temperature in the range of 60 to 68°C, which lasts for 10 to 40 minutes. During this period, several fluorescence signal reading points can be set (the number is adjusted according to the time and performance requirements of the test kit, and considering the limitations of the real-time signal processing algorithm, it is usually 5 to 40 times), and the reading temperature is a constant temperature in the range of 20 to 68°C (this temperature can ensure that the fluorescent probe of the nucleotide length is paired with the modified primer to form a fluorescence-quenched double-stranded probe to mark the consumption of the modified primer in the loop-mediated amplification), and the reading time is greater than or equal to the inherent minimum time required by the equipment. The setting of the fluorescence signal detection channel is the same as that of the conventional multi-channel real-time fluorescence PCR program. The detection channel with the fluorescent probe wavelength supported by the hardware and software of the real-time detection equipment and corresponding to each sample to be detected in the amplification reaction solution is selected. For example, 1 to 4 detection channels such as FAM, HEX (VIC), ROX, CY5, etc. are selected for real-time signal acquisition.

[0158] D. On-device amplification: The amplification reaction solution is heated in situ and monitored in real time, or transferred to a device or apparatus equipped with constant temperature incubation and real-time detection capabilities to run the real-time detection process. This includes, but is not limited to, real-time fluorescence PCR instruments, various miniaturized nucleic acid detection devices, and custom-built fluorescence detection platforms, such as the ThermoFisher ABI 7500, Shanghai Hongshi SLAN-96S, Hangzhou Biori QuantGene 9600, and MGI GenCase. Amplification reaction solutions containing sufficient template content undergo full loop-mediated amplification under appropriate temperature conditions. Amplification reaction solutions containing template content below or equal to the detection limit have a certain probability of not undergoing loop-mediated amplification. The template content in a given reaction is positively correlated with the probability of amplification. The time required to complete amplification varies depending on the type and quantity of template, the performance of the primer set and probe, and the hardware and software performance of the equipment performing the real-time detection process, ranging from 5 to 90 minutes. Simultaneously with signal acquisition, the real-time detection signal data is recorded or saved.

[0159] E. Real-time Signal Processing: The recorded real-time detection signal data is processed using the equipment or device's accompanying software, which may also utilize a real-time signal algorithm developed by the inventors. This data is processed to calculate and determine the amplification results, obtaining parameters of interest related to the amplification reaction. This step can be performed after or concurrently with step D.

[0160] In some examples, since the modified primers are usually inner primers or loop primers with a larger input amount, the variation in their consumption is relatively large, and the difference in the generated fluorescent signals is relatively significant, so a relatively high signal-to-noise ratio can be obtained. In addition, since the 5' end of the modified primers is all modified with a quenching group, the input amount of the paired fluorescent probe modified at the 3' end can be relatively reduced, and the working concentration can be adjusted together with the modified primer according to the input amount ratio of different target primer groups, which has less interference with the amplification system. In addition, since the fluorescent probe can be separated from the modified primer to form a free ssDNA probe according to the difference between the actual reaction temperature and the semi-melting temperature of the probe during the amplification process, it will not cause competition or inhibition to the normal primer amplification, and will not interfere with the amplification efficiency and detection performance. In addition, once the target DNA is amplified, the inner primer or loop primer will be specifically incorporated into the amplicon under the action of the polymerase with chain displacement activity, so the specificity of the detection method can be guaranteed. When multiple target DNAs need to be detected, at least one inner primer or loop primer corresponding to each of the multiple targets can be modified and labeled with complementary fluorescent probes. Different emission wavelengths of the labeled fluorescent groups can be used to distinguish and set them, thereby enabling multiple detections in the same reaction. More importantly, the detection method of this application can simultaneously meet both endpoint detection and real-time detection technical solutions, making it suitable for rapid nucleic acid detection applications in different scenarios.

[0161] The embodiments of the present invention will be described in more detail below, and examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and are intended to be used to explain the present invention, but are not to be construed as limiting the present invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in this area or according to the product specifications. Reagents or instruments used that do not specify the manufacturer are conventional products that can be obtained commercially.

[0162] Example 1: Real-time detection solution optimal reading temperature test

[0163] In this embodiment, in order to obtain the best performance of the real-time detection solution, it is necessary to balance the signal-to-noise ratio of the fluorescent signal and the time required for amplification. According to the degree of difference between the amplification reaction temperature and the reading temperature, it is necessary to prefer the reading temperature with the best signal-to-noise ratio. At the same time, in order to minimize the heating and cooling time caused by the temperature difference, it is necessary to optimize the real-time detection program, reduce the number of signal readings, or minimize the difference between the amplification reaction temperature and the reading temperature. The test kit needs to optimize the semi-melting temperature of the double-stranded probe and test the signal-to-noise ratio under different reading temperature conditions. In this way, the most reasonable primer set and probe sequence design scheme can be obtained.

[0164] After completing the design and synthesis of primer sets and probe sequences, the optimal reading temperature and corresponding signal-to-noise ratio of the double-stranded probe can be tested. The testing platform is the Shanghai Hongshi SLAN-96S real-time fluorescence PCR instrument. Based on the working concentration of 25 μL amplification reaction solution, the synthetic Vibrio fluvii toxR gene-modified primers and FAM-modified fluorescent probe, and the novel coronavirus N gene-modified primers and HEX-modified fluorescent probe were tested separately.

[0165] The test sequence is:

[0166] toxR-BIP-Q:BHQ1-TCACCCGGATCTCACGTCGTCGGTGTGCATTCCACCATA

[0167] toxR-BIPc-P:ATCCGGGTGA-FAM

[0168] N-BIP-Q: BHQ1-TGCTACAACTTCCTCAAGGAACACGAGAAGAGGCTTGACTG

[0169] N-BIPc-P:GAAGTTGTAGCA-HEX

[0170] The input amounts of the modified primer and modified fluorescent probe were 1.6 μM and 1 μM respectively.

[0171] The test temperature program was divided into four groups: the first group was annealed at 20°C and melted at 75°C; the second group was annealed at 35°C and melted at 65°C; the third group was annealed at 40°C and melted at 65°C; and the fourth group was annealed at 45°C and melted at 65°C. Each group was repeated three times, and the fluorescence signal intensity during annealing and melting was recorded for each tube. Three replicates of toxR and N were tested in each group.

[0172] From the test results (Figure 7), it can be seen that at 20°C, 35°C and 40°C, the annealing signal intensity is not much different, indicating that the reading temperature will not significantly affect the signal-to-noise ratio within this temperature range. At the same time, at 65°C and 75°C, the melting signal intensity is not much different, and both are more than 10 times different from the annealing signal, indicating that the amplification reaction can be carried out within this temperature range without being affected by the interference of double-stranded probes, and it can ensure that the positive result signal is significantly enhanced compared to the negative result signal. In addition, at 45°C, the annealing signal changed significantly, increasing from about 750 to about 1150, resulting in a decrease in the signal-to-noise ratio, so the reading temperature should not be set in this range. Therefore, considering the fluorescence signal-to-noise ratio and the time required for amplification, the optimal reading temperature and amplification temperature can be set to 40°C and 65°C.

[0173] Example 2: Single and multiplex detection of novel coronavirus

[0174] In this example, to verify the feasibility of the above-mentioned double-stranded probe loop-mediated amplification single and multiplex detection technology solutions, this example adopts a real-time detection solution, independently designs primer sets and fluorescent probe sequences, and uses fluorescent probes with different fluorescence wavelengths to label the novel coronavirus ORF gene, N gene, and human GAPDH gene internal primers. The MGI self-developed loop-mediated amplification system is formulated to perform single-channel and multi-channel real-time detection of test samples. The total volume of the detection system is 30μL, which contains 12μL of test sample template. The primer sets and probe sequences included in the kit developed for novel coronavirus detection are as follows:

[0175] The primer combination used in this example is an independently designed sequence and synthesized by Sangon Biotechnology Co., Ltd.

[0176] ORF:

[0177] 2 sequences of outer primers:

[0178] Upstream primer F (F3): TGTAGTTGTGATCAACTCCG,

[0179] Downstream primer R (B3): TCTTGGAAGCGACAACAA;

[0180] 2 inner primer sequences (including 1 modified primer):

[0181] Upstream primer F (FIP): BHQ1-CTGCACTTACACCGCAAACCCGAACCCATGCTTCAGTC,

[0182] Downstream primer R (BIP): CGGCACAGGCACTAGTACTGCAAAACCAGCTACTTTATCATTGT;

[0183] Loop primer 2 sequences:

[0184] Upstream primer F (LF): CGTTTAAAAACGATTGTGCATCAGC,

[0185] Downstream primer R (LB): ATGTCGTATACAGGGCTTTTGACA;

[0186] N:

[0187] 2 sequences of outer primers:

[0188] Upstream primer F (F3): TCATATGGGTTGCAACTGA,

[0189] Downstream primer R (B3): TTGCGACTACGTGATGAG;

[0190] 2 inner primer sequences (including 1 modified primer):

[0191] Upstream primer F (FIP): TTGCAGCATTGTTAGCAGGATTGGGAGCCTTGAATACACC,

[0192] Downstream primer R (BIP): BHQ1-TGCTACAACTTCCTCAAGGAACACGAGAAGAGGCTTGACTG;

[0193] Loop primer 2 sequences:

[0194] Upstream primer F (LF): CGGGTGCCAATGTGATCTTTT,

[0195] Downstream primer R (LB): ATTGCCAAAAGGCTTCTACGC;

[0196] GAPDH:

[0197] 2 sequences of outer primers:

[0198] Upstream primer F (F3): ATGTTCGTCATGGGTGTG,

[0199] Downstream primer R (B3): ATCCACAGTCTTCTGGGT;

[0200] 2 inner primer sequences (including 1 modified primer):

[0201] Upstream primer F (FIP): BHQ2-TAAGCAGTTGGTGGTGCAGGAACCATGAGAAGTATGACAACA,

[0202] Downstream primer R (BIP): CCTGGCCAAGGTCATCCATGTGGACTGTGGTCATGAGT;

[0203] Loop primer 2 sequences:

[0204] Upstream primer F (LF): AGGCATTGCTGATGATCTTGAG,

[0205] Downstream primer R (LB): ACAACTTTGGTATCGTGGAAGG;

[0206] The fluorescent probes used in this example are self-designed sequences and synthesized by Sangon Biotech Co., Ltd. Different fluorescent probes correspond to different modified primers mentioned above, and the sequences are as follows:

[0207] ORF fluorescent probe 1 sequence: GTGTAAGTGCAG-FAM

[0208] N fluorescent probe 1 sequence: GAAGTTGTAGCA-HEX

[0209] GAPDH fluorescent probe 1 sequence: ACCAACTGCTTA-ROX

[0210] Prepare the amplification reaction solution according to the following formula:

[0211] Singleplex detection:

[0212] Table 1 Components of single-plex detection amplification reaction solution

[0213] Multiplex detection:

[0214] Table 2 Multiplex detection amplification reaction solution components

[0215] Transfer the prepared amplification reaction solution to the testing platform, a Shanghai Hongshi SLAN-96S real-time fluorescence PCR instrument, and run the real-time detection program. The detection program is 65°C for 60 minutes, with 20 to 30 fluorescence signal reading points set, with readings taken every 2 to 3 minutes, and the reading temperature set to 40°C. Detection channels are set as follows: FAM channel for ORF gene detection, HEX channel for N gene detection, and ROX channel for GAPDH gene detection. Multiple detection channels are set as a combination of the above channels.

[0216] The results of singleplex real-time detection of the ORF and N genes are shown in Figure 8, the results of dual real-time detection of the ORF and N genes and triple real-time detection of the ORF, N, and GAPDH genes are shown in Figure 9, and the results of singleplex endpoint detection of the ORF, N, and GAPDH genes are shown in Figure 10. The excitation light source is a portable ultraviolet light source, and positive and negative results can be determined based on the dark-field fluorescence intensity and color.

[0217] Example 3: Comparative Validation of Real-Time Detection and End-Point Detection of Loop-Mediated Amplification Based on Dual-Channel Double-Stranded Fluorescent Probe

[0218] In this example, to verify the consistency of the aforementioned real-time detection technology with the endpoint detection technology, a single-channel MGI-developed double-stranded probe system was prepared for detection of nucleic acid templates at varying concentrations. The total volume of the detection system was 30 μl, of which 12 μl contained template. The detection system contained two different fluorescent wavelength probes, modified with FAM and ROX, respectively. The amplification container was a 96-well PCR plate, which contained 10 positive quality controls with 5 different conditions (2 FAM-modified fluorescent probes O-Q2 and O-Q1, 3 ROX-modified fluorescent probes YN-N3, YN, and N3, each with 2 replicates), 10 negative quality controls with 5 different conditions (2 FAM-modified fluorescent probes O-Q2 and O-Q1, 3 ROX-modified fluorescent probes YN-N3, YN, and N3, each with 2 replicates), and 76 low-concentration nucleic acid template test samples with 5 different conditions (2 FAM-modified fluorescent probes O-Q2 and O-Q1, 3 ROX-modified fluorescent probes YN-N3, YN, and N3, each with 8 replicates and 20 replicates). The sample concentration of the preservation solution before extraction of the test samples was 500 copies / mL. The real-time signal acquisition device was a Hangzhou Biori FQD-96A, running the device client software Gene-9660. The acquisition program was set to 25 time points in three phases: pre-acquisition, reverse transcription, and isothermal amplification. Fluorescence signals from both FAM and ROX channels were collected simultaneously. The temperature was set to 30°C during signal acquisition and 65°C during reverse transcription and isothermal amplification. Clicking "Start Run" initiated the acquisition program. Waiting for a certain amount of time until the acquisition program completed 25 acquisition steps and acquired all amplification real-time signal data, the client software Gene-9660 automatically plotted the real-time amplification signal curve shown in Figure 11.

[0219] According to the supporting software, the TTP value data table of the well position distribution of each reaction tube in each 96-well PCR plate can be calculated, as shown in Table 3:

[0220] Table 3. Data table of TTP values ​​of 96-well plate well position distribution obtained by real-time detection in Example 3

[0221] The endpoint detection technique involves transferring the 96-well plate after real-time detection to a custom-built visual inspection platform equipped with a UV excitation light source for fluorescence excitation and imaging of the entire 96-well plate. The resulting dark-field and bright-field fluorescence images are shown in Figure 12.

[0222] Comparing the heat or grayscale distributions in Figure 12 with those in Table 3 shows a correspondence between the two results. This verifies that the results of the loop-mediated amplification real-time detection technology solution based on the dual-channel double-stranded fluorescent probe are consistent with those of the endpoint detection technology solution.

[0223] Example 4: Specific detection of amplification products using locked nucleic acid-doped double-stranded probes

[0224] In this embodiment, parvovirus nucleic acid is used for amplification. A duplex probe is used to detect the product. In the fluorescent chain or quenching chain of the duplex probe, a modification such as a locked nucleic acid or MGB is performed to increase the Tm value of the duplex probe. This allows the duplex probe to have a more stable double-stranded structure when forming a complementary pair, greatly improving its stability during the LAMP reaction. This allows the amplification and detection processes to be carried out simultaneously at a higher temperature, thereby having a higher reaction specificity. In addition, this solution can reduce the temperature difference required for the amplification and detection processes, and reduce the requirements of the overall reaction process on the equipment hardware, so that it can be widely used in scenarios such as immediate and on-site diagnosis.

[0225] 1) The DNA template used is as follows:

[0226] 2) Primers used:

[0227] F3:ACTGGAACCGTGGAGTAC

[0228] B3:CTCTCCTGGCTCTCTTTG

[0229] FIP: CTTTGTGAGTAACGCCAAGTTGGCCAGATACGCCTATTGCA

[0230] BIP: GGTCCGAAATAGAGGCAGACCCTTAATCCAAGTCGTCTCGA

[0231] LF:TTGATTGTTGATTTGCAGTTTC

[0232] LBQ (downstream loop primer containing a quencher):

[0233] BHQ1-TGAGAG / iXNA_C / / iXNA_C / AT / iXNA_C / TTTACTTCTGAAC

[0234] LBP (downstream loop primer 5' end complementary probe containing a fluorescent group):

[0235] GTAAAGATGGCTCTCA-FAM

[0236] / iXNA_C / indicates that base C is modified with a locked nucleic acid.

[0237] 3) The reaction system consists of 0.15 μL Bst polymerase, 3 μL 10× Isothermal Buffer, 1.8 μL MgCl2, 1.3 μL dNTPs, 0.06 μL F3 / B3, 0.48 μL M FIP / BIP, 0.24 μL LF / LBQ, 0.12 μL LBP, and 15 μL nucleic acid template. Vortex to mix and incubate at 60–65°C in a real-time fluorescence quantitative PCR system for 45 min.

[0238] 4) Reaction results

[0239] After forming a double-stranded probe, LBQ and LBP exhibit excellent stability, with a Tm value exceeding 60°C, close to the optimal temperature for amplification reactions. In negative samples, the primers do not bind to the template, and the reaction system undergoes no amplification. Therefore, LBQ and LBP remain bound, and no fluorescence signal is generated. In positive samples, the primers bind to the template, and amplification proceeds under the action of Bst polymerase. At this time, the LBQ and LBP products are extended by the strand displacement activity of Bst polymerase, and the fluorophore and quencher separate, resulting in an increase in the fluorescence signal.

[0240] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. A primer composition, characterized in that include: A first primer set, wherein the first primer set includes an upstream primer and a downstream primer, and the first primer set includes at least one modified primer, wherein the 5' end of the modified primer has a labeled fluorescent group or a quenching group; and A probe, wherein the probe is suitable for complementary pairing with the 5' end of the modified primer, and the 3' end of the probe has a quenching group or a fluorescent group; Wherein, the quenching group is suitable for quenching the fluorescent group.

2. The primer composition according to claim 1, characterized in that The 5' end of the modified primer has a quenching group; the 3' end of the probe has a fluorescent group.

3. The primer composition according to claim 1, characterized in that The modification is selected from at least one of the first three nucleotides at the 5' end or the 3' end.

4. The primer composition according to claim 1, characterized in that The probe is single-stranded DNA.

5. The primer composition according to claim 1, characterized in that The upstream primer in the first primer set has a nucleotide sequence as shown in SEQ ID NOs: 1 to 3; The downstream primers in the first primer set have nucleotide sequences as shown in SEQ ID NOs: 4-6.

6. The primer composition according to claim 1, characterized in that The primer composition further includes a second primer set including an upstream primer and a downstream primer.

7. The primer composition according to claim 6, characterized in that The upstream primers in the second primer set have nucleotide sequences as shown in SEQ ID NOs: 7 to 9; The downstream primers in the second primer set have nucleotide sequences as shown in SEQ ID NOs: 10-12.

8. The primer composition according to claim 1, characterized in that The primer composition further includes: a third primer set, wherein the third primer set includes an upstream primer and a downstream primer.

9. The primer composition according to claim 8, characterized in that The third primer set includes at least one modified primer, and the 5' end of the modified primer has a quenching group.

10. The primer composition according to claim 8, characterized in that The upstream primers in the third primer set have nucleotide sequences as shown in SEQ ID NOs: 13 to 15; The downstream primers in the third primer set have nucleotide sequences as shown in SEQ ID NOs: 16-18.

11. The primer composition according to claim 1, characterized in that The quenching group is selected from at least one of BHQ1, BHQ2, BHQ3, MGB, BBQ 650, Dabcyl, DBQ1, TAMRA, and Eclipse; The fluorescent group is selected from at least one of FAM, HEX, ROX, CY5Cy5, Atto 425, TET, JOE, VIC, R6G, Yakima Yellow, Quasar570, Quasar670, Cy3, NED, Cy5.5, Cy7, Texas Red, Atto 590, IR Dye 650 and IR Dye 750.

12. The primer composition according to claim 1, characterized in that The length of the probe is selected from 5 to 20 bp.

13. The primer composition according to claim 12, characterized in that The probe has a nucleotide sequence as shown in SEQ ID NOs: 19-21.

14. The primer composition according to claim 1, 6 or 7, characterized in that: At least one sequence in the modified primer includes at least one special nucleotide or modification group; Optionally, at least one of the probes comprises at least one of the special nucleotides or modification groups; Preferably, the special nucleotide comprises at least one selected from locked nucleic acid, peptide nucleic acid, ribonucleotide and deoxyinosinic acid; Preferably, the modification group includes at least one selected from a phosphate group, a methyl group and a glycosyl group.

15. A kit, characterized in that: include: The primer composition according to any one of claims 1 to 14.

16. The kit according to claim 15, characterized in that The method further comprises at least one selected from the group consisting of strand displacement DNA polymerase, reverse transcriptase, ribonuclease inhibitor, uracil-DNA glycosylase, dNTP, dUTP, pyrophosphatase, proofreading enzyme, protecting agent, reducing agent and crowding agent.

17. The kit according to claim 16, characterized in that The strand displacement DNA polymerase does not have 3'→5' exonuclease activity; Preferably, the strand displacement DNA polymerase comprises a member selected from the group consisting of Bst 3.0 DNA polymerase, Bst 2.0 at least one of DNA polymerase, Bst 2.0 HotStart DNA polymerase, Bst II Pro DNA polymerase, and HotStart Bst 4.2 DNA polymerase; Optionally, the reverse transcriptase comprises a member selected from RTx reverse transcriptase, at least one of III reverse transcriptase and ThermoStable V reverse transcriptase; Optionally, the uracil-DNA glycosylase comprises at least one selected from Antarctic thermosensitive uracil-DNA glycosylase and temperature-sensitive uracil-DNA glycosylase.

18. The kit according to claim 16, characterized in that The proofreading enzyme has 3'→5' exonuclease activity; Preferably, the proofreading enzyme comprises at least one selected from Pfu DNA polymerase, Q5U DNA polymerase, Q6U DNA polymerase and KOD DNA polymerase.

19. The kit according to claim 16, characterized in that The protective agent comprises at least one selected from bovine serum albumin, casein, trehalose, pululan, sucrose, maltose, glycine, proline, sodium azide and thimerosal; Preferably, the protective agent is bovine serum albumin; Optionally, the reducing agent comprises at least one selected from dithiothreitol, β-mercaptoethanol and glutathione; Optionally, the crowding agent comprises at least one selected from polyethylene glycol, polysucrose and dextran.

20. The kit according to claim 15, characterized in that The method further comprises at least one selected from an enzyme buffer and a surfactant.

21. A method for detecting nucleic acid amplification products, characterized in that: include: Using the nucleic acid sample to be detected as a template, an amplification reaction is performed using the primer composition of any one of claims 1 to 14 or the kit of any one of claims 15 to 20; The amplified product was subjected to signal detection.

22. The method according to claim 21, characterized in that The amplification reaction comprises at least one selected from loop-mediated amplification, recombinase polymerase amplification, cross primer amplification, helicase amplification and rolling circle amplification; Preferably, the amplification reaction is loop-mediated amplification.

23. The method according to claim 21, characterized in that The amplification reaction is carried out in an amplification reaction system, and the concentration of the strand displacement DNA polymerase in the amplification reaction system is 0.1 to 0.8 U / μL; Preferably, the concentration of the strand displacement DNA polymerase in the amplification reaction system is 0.2 to 0.6 U / μL; More preferably, the concentration of the strand displacement DNA polymerase in the amplification reaction system is 0.3-0.5 U / μL.

24. The method according to claim 21, characterized in that The amplification reaction is carried out in an amplification reaction system, and the concentration of reverse transcriptase in the amplification reaction system is 0.2-2 U / μL; Preferably, the concentration of the reverse transcriptase in the amplification reaction system is 0.4-1.6 U / μL.

25. The method according to claim 21, characterized in that The amplification reaction is carried out in an amplification reaction system, and the concentration of the ribonuclease inhibitor in the amplification reaction system is 0.2-1.2 U / μL; Preferably, the concentration of the ribonuclease inhibitor in the amplification reaction system is 0.5-0.9 U / μL.

26. The method according to claim 21, characterized in that The amplification reaction is carried out in an amplification reaction system, and the concentration of uracil-DNA glycosylase in the amplification reaction system is 0.01-0.1 U / μL; Preferably, the concentration of the uracil-DNA glycosylase in the amplification reaction system is 0.02-0.05 U / μL.

27. The method according to claim 21, characterized in that The amplification reaction is carried out in an amplification reaction system, in which the molar ratio of dUTP to dTTP is 0:10 to 10:0; Preferably, the molar ratio of dUTP to dTTP is 2:8 to 8:

2.

28. The method according to claim 21, characterized in that The amplification reaction is carried out in an amplification reaction system, and the concentration of the proofreading enzyme in the amplification reaction system is 0.001-0.1 U / μL; Preferably, the concentration of the proofreading enzyme in the amplification reaction system is 0.005-0.05 U / μL.

29. The method according to claim 21, characterized in that The amplification reaction is carried out in an amplification reaction system, and the concentration of bovine serum albumin in the amplification reaction system is 0.1 to 25 μg / μL; Preferably, the concentration of the bovine serum albumin in the amplification reaction system is 0.5-15 μg / μL.

30. The method according to claim 21, characterized in that Before the amplification reaction, the primer combination is further subjected to an annealing reaction, wherein the annealing reaction is performed at 20 to 45° C.; Optionally, the annealing reaction is carried out at 40°C; Optionally, the amplification reaction is carried out at 60-68°C; Preferably, the amplification reaction is carried out at 65°C.

31. The method according to claim 21, characterized in that The amplification reaction is carried out in an amplification reaction system, in which the molar ratio of the modified primer to the probe is 1:1.2 to 1:1.5.

Images