Construction and use of new crispr-cas12b-based base editor

Abstract

Provided are a new CRISPR-Cas12b-based base editor and the use thereof in gene expression and / or protein evolution. The base editor uses a fusion protein comprising a deaminase, a Cas protein mutant dBhCas12b and a uracil glycosylase inhibitor domain UGI, wherein the deaminase is located at the N-terminus of dBhCas12b, and comprises cytidine deaminase CDA as shown in SEQ ID NO. 1 or adenosine base editor ABE8e as shown in SEQ ID NO. 2, and the uracil glycosylase inhibitor domain UGI is located at the C-terminus of dBhCas12b, and has an amino acid sequence as shown in SEQ ID NO. 4. Compared with an original sequence as shown in SEQ ID NO. 3, dBhCas12b has mutations comprising the following: aspartic acid at position 574, glutamic acid at position 828 and aspartic acid at position 952 are mutated into alanine A.

Description

Construction and application of a novel CRISPR-Cas12b-based base editor Technical Field

[0001] The present invention relates to the construction and application of a new CRISPR-Cas12b-based base editor, and belongs to the field of genetic engineering technology. Background Art

[0002] Base editors (BE), as the application of CRISPR-Cas as the third-generation gene editing technology, can directly induce the conversion of C to T or A to G through the deamination action of deaminases without relying on double-stranded DNA breaks (DSBs), and are widely used in animal and plant cells.

[0003] However, current BE schemes have a short editing window in application, with the existing BE editing window being approximately 5–6 nt (Highly efficient DSB-free base editing for streptomycetes with CRISPR-BEST; MACBETH: Multiplex automated Corynebacterium glutamicum base editing method; Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage; Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems). This means that at most 2–3 amino acid mutations can be produced. To broaden the BE editing window, Zong et al. (Efficient C-to-T base editing in plants using a fusion of nCas9 and human APOBEC3A) extended the BE editing window from 5 nt to 17 nt in plants by combining human APOBEC3A with Cas9. Banno et al. (Deaminase-mediated multiplex genome editing in Escherichia coli) achieved simultaneous editing of 41 sites in Escherichia coli by constructing four sgRNAs, but their BE window was only 5nt. Patent CN 116685684 A discloses the construction of a BE system in animal cells by inactivating mutations in BhCas12b. There is no research in the prior art on constructing a system with a broadened BE window in microorganisms.

[0004] Summary of the Invention

[0005] To solve the above technical problems, the present invention constructs BE systems based on dBhCas12b. These systems can work in Bacillus subtilis and Escherichia coli and have an extended editing window. The system can reflect great application value in various aspects of metabolic engineering, protein engineering and genetic engineering.

[0006] The first object of the present invention is to provide a fusion protein comprising a deaminase and a Cas protein mutant dBhCas12b; the deaminase is located at the N-terminus of the Cas protein mutant dBhCas12b;

[0007] Compared with the original sequence, the dBhCas12b has mutations at the following sites: aspartic acid at position 574, glutamic acid at position 828, and aspartic acid at position 952 have mutated to alanine A; the amino acid sequence of the original sequence is shown in SEQ ID NO.3;

[0008] The deaminase includes cytidine deaminase CDA or adenosine base editor ABE8e.

[0009] In one embodiment of the present invention, the amino acid sequence of the cytidine deaminase CDA is shown in SEQ ID NO.1.

[0010] In one embodiment of the present invention, the amino acid sequence of the adenosine base editor ABE8e is shown as SEQ ID NO.2.

[0011] In one embodiment of the present invention, the fusion protein further comprises a uracil glycosylase inhibitor domain UGI.

[0012] In one embodiment of the present invention, the uracil glycosylase inhibitor domain UGI is located at the C-terminus of the Cas protein mutant dBhCas12b.

[0013] In one embodiment of the present invention, the amino acid sequence of the uracil glycosylase inhibitor domain UGI is shown in SEQ ID NO.4.

[0014] In one embodiment of the present invention, the cytidine deaminase CDA is connected to the Cas protein mutant dBhCas12b through the connexin 1, and the Cas protein mutant dBhCas12b is connected to the uracil glycosylase inhibitor (UGI) domain through the connexin 2; the amino acid sequence of the connexin 1 of the CDA and dBhCas12b is (GSAASR) n The amino acid sequence of the connecting protein of dBhCas12b and UGI is (GPKKKRKVGT) n , wherein n is independently an integer from 1 to 30.

[0015] In one embodiment, the amino acid sequence of the connexin 1 of CDA and dBhCas12b is GSAASR; the amino acid sequence of the connexin 2 of dBhCas12b and UGI is GPKKKRKVGT.

[0016] The second object of the present invention is to provide a gene encoding the above fusion protein.

[0017] The third object of the present invention is to provide a vector containing the above fusion protein gene.

[0018] The starting plasmid of the vector includes but is not limited to plasmid pAX01.

[0019] The fourth object of the present invention is to provide a recombinant cell containing the gene of the fusion protein or the vector.

[0020] In one embodiment of the present invention, the recombinant cell comprises Bacillus subtilis or Escherichia coli.

[0021] In one embodiment of the present invention, the Bacillus subtilis includes B. subtilis 168.

[0022] In one embodiment of the present invention, the Escherichia coli includes E. coli JM109 or E. coli BL21 (DE3).

[0023] The fifth object of the present invention is to provide the use of the fusion protein, or the gene, or the plasmid, or the recombinant cell in gene expression and / or protein evolution.

[0024] In one embodiment, the application is to use the fusion protein, or the gene, or the plasmid, or the recombinant cell for mutation of RBS.

[0025] In one embodiment, the application is to use the fusion protein, or the gene, or the plasmid, or the recombinant cell to target a target protein and mutate the target protein.

[0026] Beneficial effects of the present invention:

[0027] (1) The editing window of the base editing element CDA-dBhCas12b-UGI-UGI in Bacillus subtilis reached 19 nt, and the editing window of the base editing element ABE8e-dBhCas12b in Bacillus subtilis reached 14 nt, which are 3.8 and 2.33 times that of existing microbial base editors, respectively;

[0028] The editing window of the base editing element CDA-dBhCas12b-UGI in Escherichia coli reaches 63nt, which is 12.8 times that of existing microbial base editors.

[0029] (2) The application of base editing elements in the diversified gene expression of Bacillus subtilis was provided. The RBS mutation was performed using the base editing element CDA-dBhCas12b-UGI-UGI, and a mutant with an eGFP expression level increased by 68.1 times compared with the control was constructed, achieving diversified gene expression.

[0030] (3) The application of base editing elements in protein evolution was provided. The base editor CDA-dBhCas12b-UGI was used to perform directed evolution of TatABC, and a mutant with sfGFP fluorescence intensity expression increased 6.49 times compared with the wild type was obtained. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1: Investigation of the knockout performance of CRISPR-Cas12b in B. subtilis, a: Schematic diagram of the working process of CRISPR-Cas12b; b: Schematic diagram of the plasmid construction of CRISPR-AaCas12b; c: Knockout efficiency of CRISPR-AaCas12b for sacA; d: Schematic diagram of the plasmid construction of CRISPR-BhCas12b; e: Knockout efficiency of CRISPR-BhCas12b for sacA; f: Knockout efficiency of CRISPR-BhCas12b for aprE.

[0032] Figure 2: Determination of key candidate sites affecting BhCas12b nuclease activity, a: Alignment of primary sequences of Cas12b from different sources; b: Schematic diagram of the organizational structure of BhCas12b; c: Schematic diagram of the docking of BhCas12b and sgRNA; d: Schematic diagram of the process for rapid identification of key nuclease active sites of BhCas12b using a probe plasmid for knocking out sacA; e.g., the effect of alanine mutations at key sites (D574, E828, D952) on the efficiency of sacA knockout.

[0033] Figure 3: Verification of CRISPR-dBhCas12b's ability to inhibit gene expression in B. subtilis, a: Schematic diagram of the construction of CRISPR-dBhCas12b in B. subtilis; b: Effects of CRISPR-dBhCas12b on host biomass when expressed or not; c: Effects of CRISPR-dBhCas12b expression on the total fluorescence intensity produced by the host; d: Effects of CRISPR-dBhCas12b expression on the unit fluorescence intensity produced by the host.

[0034] Figure 4: Verification of CRISPR-dBhCas12b inhibiting promoter transcription initiation in B. subtilis, a: Schematic diagram of the construction of CRISPR-dBhCas12b for inhibiting promoter transcription initiation in B. subtilis; bg: Unit fluorescence intensity measurement reflects the effect of CRISPR-dBhCas12b expression on promoter transcription initiation activity.

[0035] Figure 5: Construction and verification of the dBhCas12b-based BE system in B. subtilis, a: Construction of different CBE systems based on dBhCas12b; b: Investigation of the editing performance of different CBE systems on different genes (pksA and pksC); c: Investigation of the editing performance of CBE-d on different genes (pksE and pksG); d: Construction of the ABE system based on dBhCas12b; e: Investigation of the editing performance of the ABE system on the sigE gene; In Figures 5b and 5c, the first 4 bases at the 5' end (left side) are the corresponding PAM sequences; the light-colored T represents a C to T mutation.

[0036] Figure 6: Application of the dBhCas12b-based CBE system in gene expression diversification, a: Schematic diagram of the process of the dBhCas12b-based CBE system in diversifying expression element RBS and screening high-intensity RBS; b: Using the CBE system to diversify the RBS elements of eGFP and then screen for RBS mutants with high-intensity eGFP expression.

[0037] Figure 7: Construction and verification of the dBhCas12b-based CBE system in E. coli, a: Schematic diagram of the construction of the CBE system in E. coli and the mutant screening process; b: Population sequencing results of the CBE system editing different sites of the rpsE gene in E. coli; c: Monoclonal sequencing results of editing different sites of rpsE on ampicillin plates; d: Monoclonal sequencing results of editing different sites of rpsE on spectinomycin plates; e: Growth conditions of different rpsE mutants under 100 μg / ml spectinomycin conditions; f: Identification results of the mutation sites of different rpsE mutants.

[0038] Figure 8: Investigation of the editing performance of CBE systems composed of different dCas proteins in E. coli, a: Selection of gene targets of different CBE systems; b: Investigation of the editing performance of the CBE system composed of dBhCas12b in different genes; c: Investigation of the editing performance of the CBE system composed of dFnCas12a in different genes; b: Investigation of the editing performance of the CBE system composed of dSpCas9 in different genes; b: Effect of CBE systems composed of different dCas proteins on the growth of E. coli.

[0039] Figure 9: Application of the dBhCas12b-based CBE system in protein evolution in E. coli, a: Schematic diagram of the organizational structure of the TatABC gene complex; b: Construction of the system for screening highly active TacABC mutants and its process diagram; c: Total periplasmic fluorescence level of different TatABC mutants; d: Biomass of different TatABC mutants; e: Unit periplasmic fluorescence level produced by different TatABC mutants; f: Direct view of the fluorescence intensity of different TatABC mutants under blue light irradiation. DETAILED DESCRIPTION

[0040] The reagents in the following examples were purchased from Shenggong Bioengineering (Shanghai) Co., Ltd.

[0041] (1) Culture medium

[0042] LB medium (g·L -1 ): Tryptone 10; Yeast extract 5; Sodium chloride (NaCl) 10.

[0043] SPI medium (g·L -1 ): Formulation reference: Construction and application of an efficient dual-base editing platform for Bacillus subtilis evolution employing programmable base conversion.

[0044] (2) B. subtilis 168 plasmid transformation method

[0045] Pick a single colony of B. subtilis 168 and inoculate it into 2 mL of SPI medium. Incubate it at 37°C with a shaker for 12-14 hours. Take 100 μL of the culture and inoculate it into 5 mL of SPI medium. Incubate it at 37°C with a shaker for 4-5 hours before measuring the OD. 600 When OD 600 When the concentration was about 1.0, 200 μL of bacterial solution was transferred to 2 mL of SPI medium and incubated at 37°C and 100 r·min -1 Incubate on a shaker for 1.5 h; add 20 μL of 100× EGTA (ethylene glycol bis(α-aminoethyl ether) tetraacetic acid) solution to the tube and shake at 37°C and 100 r·min - 1After incubation on a shaker for 10 minutes, aliquot 500 μL into each 1.5 mL centrifuge tube; add 10 μg of the plasmid verified by sequencing to the tube, pipette to mix, and place at 37°C, 100 rpm. -1 Incubate the cells in a shaker for 2 h. After incubation, pipette about 200 μL of the bacterial solution and evenly spread it on the corresponding selective plates, and incubate overnight at 37°C for 12-14 h.

[0046] (III) B. subtilis 168 genome integration method (taking pAX-CDA-dBhCas12b-UGI-UGI as an example)

[0047] First, primers lacA-dCas9-F and lacA-dCas9-R described in Table 2 were used to amplify the target gene CDA-dBhCas12b-UGI-UGI and the homology arms of the lacA integration site on both sides (upstream homology arm 800bp; downstream homology arm 691bp) and the chloramphenicol resistance gene. Then, the target fragment was purified for standby use. According to the above method, B. subtilis competence was made and the purified fragment was transformed into it, and the recovery culture was carried out for 2h. Finally, the recovered bacterial solution was evenly spread on the chloramphenicol screening LB plate. The grown clones were used as templates for PCR target fragments to identify positive clones.

[0048] (IV) Determination of Monoclonal Editing Efficiency

[0049] For monoclonal sequencing: After gene editing is completed, the mixed editing solution is diluted and spread onto a plate containing the corresponding antibiotic. PCR is performed using the monoclonal clone as a template and the PCR product is sequenced to identify the editing efficiency.

[0050] (V) Determination of population editing efficiency

[0051] For population sequencing: After gene editing is completed, the edited mixed culture is aspirated as a template, the mutation location is amplified with customized primers, and the mixture is used for sequencing. The chromatogram generated by sequencing is analyzed using the software BEAT to give the editing frequency.

[0052] (6) Extraction method of periplasmic protein

[0053] 1) Centrifuge the cells to be treated at 3500-4500 rpm and 4°C for 10 min, discard the supernatant, and wash the cells once with PBS. 2) Add 40 mM arginine solution, pH 9.0 (HCl to adjust pH) at a ratio of 1:40 (v / v), mix by gentle pipetting, and incubate on ice at 4°C for 30 min. (Cells are easily lysed in this step; excessive shear force from pipetting or prolonged treatment time can release intracellular proteins, resulting in a higher final result.) 3) Centrifuge at 4500 rpm and 4°C for 10 min, collect the supernatant (the periplasmic fraction), resuspend and wash the precipitate (1-3 times) with PBS (the intracellular fraction).

[0054] (VII) Primers and sequences, strains, and sgRNA sequences involved in the present invention

[0055] Table 1 Primers used in the present invention and their nucleotide sequences

[0056] Table 2 The strains involved in the present invention

[0057] Table 3 sgRNAs and nucleotide sequences involved in the present invention

[0058] Example 1: Modification and verification of dBhCas12b

[0059] (1) Investigation of gene editing efficiency of CRISPR-Cas12b from different sources in B. subtilis

[0060] The working principle of CRISPR-Cas12b is shown in Figure 1a.

[0061] Construction of gene knockout plasmid

[0062] The specific construction method is as follows: First, using AaCas12b (gene synthesized by Anshengda), BhCas12b (gene synthesized by Anshengda) and pHT-AIO-sacA (construction method reference: Hao et al. Front. Bioeng. Biotechnol, 2020, 8: 524676) as templates, primers AaCas12b-F / AaCas12b-R, BhCas12b-F / BhCas12b-R, BhCas12b-bF / BhCas12b-bR and AaCas12b-bF / AaCas12b-bR were used to amplify the AaCas12b gene, BhCas12b gene and their corresponding backbones respectively. After the amplified fragment was determined by nucleic acid electrophoresis gel, the fragment was template digested for about 2 to 3 hours (DpnI, Takara). The digested fragment product was then purified (using a kit: DNA fragment purification, Kangwei Century) to remove impurities. Subsequently, the fragments were combined in pairs using the ABclonal DNA recombination kit to obtain recombinant plasmids: pHT-AaCas12b and pHT-BhCas12b. Using pHT-AIO-sacA, pHT-AaCas12b, and pHT-BhCas12b as templates, primers sacAT-bF / sacAT-bR and sacAT-F / sacAT-R were used to amplify the backbone of the sacA homology arm and the homology arm of sacA, respectively. The fragments were then digested, purified, and assembled (as above) to obtain the recombinant plasmids pHT-AaCas12b-sacAT and pHT-BhCas12b-sacAT. Finally, using AasgRNA (gene synthesized by Anshengda), BhsgRNA (gene synthesized by Anshengda), pHT-AaCas12b-sacAT and pHT-BhCas12b-sacAT as templates, primers AasgRNA-F / AasgRNA-R, BhsgRNA-F / BhsgRNA-R, AasgRNA-bF / AasgRNA-bR and BhsgRNA-bF / BhsgRNA-bR were used to amplify AasgRNA, BhsgRNA and their corresponding backbones respectively. These fragments were then digested, purified and assembled to obtain the final knockout plasmids pHT-AaCas12b-AIO and pHT-BhCas12b-AIO.

[0063] Verification of gene knockout efficiency

[0064] The constructed knockout plasmids (pHT-AaCas12b-AIO and pHT-BhCas12b-AIO) were transformed into B. subtilis 168. The grown clones were picked and cultured in fresh LB liquid medium for 12 hours. The cultured culture was then diluted (about 10 5 After a single clone has grown, use the corresponding colony PCR primers to amplify both ends of the knockout site to confirm the knockout.

[0065] The results showed that when the endogenous gene sacA was knocked out, the editing efficiency of CRISPR-AaCas12b was only 1 / 23 (Figure 1c), while the editing efficiency of CRISPR-BhCas12b was as high as 18 / 18 (Figure 1e). When the endogenous gene aprE was knocked out, the knockout efficiency of CRISPR-BhCas12b for aprE was as high as 10 / 10 (Figure 1f).

[0066] (2) Design and modification of dBhCas12b

[0067] Confirmation of candidate key active sites of BhCas12b

[0068] The primary sequences of Cas12b from Alicyclobacillus acidoterrestris, Alicyclobacillus acidiphilus, and Bacillus hisashii were homologously aligned, and the alignment results are shown in Figure 2a. According to the structural region diagrams of AacCas12b, AaCas12b, and BhCas12b (references: Liu, L. et al. C2c1-sgRNA complex structure reveals RNA-guided DNA cleavage mechanism. Mol. Cell 65, 310-322 (2017); Strecker, J. et al. Engineering of CRISPR-Cas12b for human genome editing. Nat. Commun. 10, 212 (2019); Teng, F. et al. Repurposing CRISPR-Cas12b for mammalian genome engineering. Cell Discov. 4, 63 (2018).) and the crystallization results of AacCas12b (PDB: 5WQE), we divided the different structural domains of BhCas12b, and its structural organization diagram is shown in Figure 2b. BhCas12b was further docked with the sgRNA molecule (GTTCTGTCTTTTGGTCAGGACAACCGTCTAGCTATAAGTGCTGCAGGGTGTGAGAAACTCCTATTGCTGGACGATGTCTCTTACGAGGCATTAGCACCATTTTCTATACACCGGGAGGCATTTTTTTT), and the molecular docking results are shown in Figure 2c.

[0069] Construction of dBhCas12b and screening and verification of gene knockout efficiency

[0070] The schematic diagram of dBhCas12b screening is shown in Figure 2d.

[0071] Using primers D574A-F / D574A-R in Table 2 and plasmid pHT-BhCas12b-AIO as a template, inverse PCR was performed to construct the plasmid pHT-BhCas12b(D574A)-AIO containing the targeted sacA gene;

[0072] Using primers E828A-F / E828A-R in Table 2 and plasmid pHT-BhCas12b(D574A)-AIO as a template, the above-mentioned site (E828) of BhCas12b(D574A) was mutated to alanine A by inverse PCR to obtain the plasmid pHT-BhCas12b(D574A / E828A)-AIO containing the double combination mutant dBhCas12b(D574A / E828A);

[0073] Using primers D952A-F / D952A-R in Table 2 and plasmid pHT-BhCas12b(D574A / E828A)-AIO as template, the above-mentioned site (D952) of BhCas12b(D574A / E828A) was mutated to alanine A by inverse PCR to obtain plasmid pHT-BhCas12b(D574A / E828A / D952A)-AIO containing the triple combination mutant dBhCas12b(D574A / E828A / D952A).

[0074] The plasmids pHT-BhCas12b(D574A)-AIO, pHT-BhCas12b(D574A / E828A)-AIO, and pHT-BhCas12b(D574A / E828A / D952A)-AIO were respectively transformed into Bacillus subtilis, and the sacA gene knockout efficiency was verified. The results showed that the knockout efficiency of dBhCas12b(D574A) was 13% (Figure 2e); the knockout efficiency of dBhCas12b(D574A, E828A) was 8.69% (Figure 2f); and the knockout efficiency of dBhCas12b(D574A, E828A, D952A) was 0 (Figure 2g).

[0075] (3) Inhibition of transcription elongation by CRISPR-dBhCas12b

[0076] The flowchart of CRISPR-dBhCas12b inhibition of transcription elongation is shown in Figure 3a.

[0077] Construction of CRISPR-dBhCas12b expression strain

[0078] The obtained BhCas12b (D574A, E828A, D952A) mutant was integrated into the lacA site of B. subtilis to obtain the recombinant strain BS1, in which the expression of BhCas12b (D574A, E828A, D952A) was regulated by the xylose promoter; for the construction of the sgRNA integration vector: using pUC57-sgRNA (synthesized by Jin Weizhi) and pDGT-P43-GFP as templates, primers pDG-sgRNA-F / pDG-sgRNA-R and pDG-sgRNA-bF / pDG-sgRNA-bR were used to amplify the sgRNA (constitutive expression of the Pveg promoter) and its corresponding backbone, respectively. The two fragments were then digested, purified, and assembled to finally generate the recombinant integration plasmid pDG-sgRNA. Fifteen sgRNAs targeting eGFP were designed (sgRNA sequences refer to Table 4, G1-G15), and inverse PCR was performed to construct integration vectors targeting eGFP using primers G1-F / G1-R, G2-F / G2-R, G3-F / G3-R, G4-F / G4-R, G5-F / G5-R, G6-F / G6-R, G7-F / G7-R, G8-F / G8-R, G9-F / G9-R, G10-F / G10-R, G11-F / G11-R, G12-F / G12-R, G13-F / G13-R, G14-F / G14-R, and G15-F / G15-R in Table 2, respectively. These sgRNA expression cassettes were then amplified and integrated into the amyE site of the BS1 strain, generating 15 recombinant strains containing CRISPRi, BS2-BS16 (Figure 3a).

[0079] Construction of the eGFP expression plasmid pB-P43-eGFP (reference: Hao et al. Front. Bioeng. Biotechnol., 2020, 8: 524676). pB-P43-eGFP was transformed into BS2-BS16, respectively, to generate recombinant strains BS2_eGFP-BS16_eGFP.

[0080] Detection of eGFP fluorescence intensity by strain fermentation

[0081] The recombinant strain BS2_eGFP-BS16_eGFP was streaked to obtain the corresponding single clones. The obtained single clones were inoculated and cultured overnight (about 12 hours). The next day, the corresponding seed solution was plated at (OD 600The cells were transferred to fresh LB medium (with a concentration of 0.05) (two aliquots per strain; one without xylose and the other with 1% xylose to induce CRISPRi expression) and cultured at 37°C and 200 rpm for approximately 24 hours. The eGFP fluorescence expression of the different strains was then measured.

[0082] The results showed that compared with the control group without xylose addition, inducing the expression of CRISPR-dBhCas12b can significantly increase the biomass of B. subtilis (Figure 3b). Xylose plays two roles in the growth of B. subtilis, acting as both an inducer and a carbon source to increase biomass, and the expression of CRISPR-dBhCas12b can further reduce the total fluorescence intensity of eGFP (Figure 3c) and significantly reduce the unit fluorescence intensity of eGFP (Figure 3d). The specific relative fluorescence intensity is shown in Table 4.

[0083] The above results show that BhCas12b (D574A, E828A, D952A) can effectively bind to the target gene and inhibit its expression, indicating that CRISPRi based on dBhCas12b can be successfully used to target the target gene and hinder the transcription elongation process of RNA polymerase. The composition of BE requires an inactivated version of the Cas protein (dCas) that can only target but not cut DNA.

[0084] Table 4 Inhibitory effect of CRISPR-dBhCas12b on eGFP

[0085] (4) CRISPR-dBhCas12b inhibits transcription initiation

[0086] A schematic diagram of CRISPR-dBhCas12b inhibition of transcription initiation is shown in Figure 4a. Six promoters, P43, PylbP, PrelA, PspoVG, PrpoB, and PsigW, were selected as targets to investigate the inhibitory effect of CRISPR-dBhCas12b (D574A, E828A, D952A) on promoter transcription initiation.

[0087] Method for constructing expression plasmids containing different promoters

[0088] Using pB-P43-eGFP as a template, reverse PCR was performed on the template using the primers PylbP-F / PylbP-R; PrelA-F / PrelA-R; PspoVG-F / PspoVG-R; PrpoB-F / PrpoB-R; PsigW-F / PsigW-R in Table 2. The PCR products were digested, purified, and assembled to finally construct expression plasmids expressing eGFP with different promoters: pB-PylbP-eGFP, pB-PrelA-eGFP, pB-PspoVG-eGFP, pB-PsigW-eGFP, and pB-PrpoB-eGFP.

[0089] Using pDG-sgRNA as a template, the inverse PCR method was used to construct expression cassettes carrying the sgRNA sequences shown in Table 3: P43-1, P43-2, P43-3, P43-4, ylbP-1, ylbP-2, ylbP-3, ylbP-4, relA-1, relA-2, relA-3, relA-4, spoVG-1, spoVG-2, spoVG-3, spoVG-4, rpoB-1, rpoB-2, rpoB-3, sigW-1, and sigW-2. These cassettes targeted the core regions of six different promoters and were integrated into the amyE site of BS1 to obtain recombinant strains BS17-BS37, thus constructing an integrated CRISPRi system.

[0090] Plasmids expressing eGFP from different promoters were transformed into BS17-BS37, respectively, to investigate the effectiveness of this system in inhibiting eGFP transcription initiation (Figure 4a). Comparison of eGFP unit fluorescence revealed that CRISPR-dBhCas12b was able to efficiently inhibit transcription initiation activity from different promoters, with inhibition rates ranging from 18% to 99% (Figures 4b-g).

[0091] The above results show that the BhCas12b (D574A, E828A, D952A) / sgRNA complex can effectively bind to the core region of the promoter, thereby inhibiting the initiation of transcription of the promoter, indicating that the CRISPRi system based on BhCas12b (D574A, E828A, D952A) can inhibit gene expression from both the initiation of transcription and the elongation of transcription. It provides an effective gene target location function for the construction of BE systems based on different deaminases.

[0092] Example 2 Design and Validation of Cytosine Base Editors (CBEs) in B. subtilis

[0093] The structure of the CBE system based on dBhCas12b is shown in Figure 5a.

[0094] Construction of dBhCas12b-CDA (primers and sequences refer to Table 1):

[0095] The dBhCas12b was cloned into the downstream of the xylose promoter of the pAX01 vector using primers pAX-dBhCas12b-F / pAX-dBhCas12b-R and pAX-dBhCas12b-bF / pAX-dBhCas12b-bR to construct pAX-dBhCas12b. The CDA deaminase gene was amplified using primers pAX-cCDA-F / pAX-cCDA-R and pAX-cCDA-bF / pAX-cCDA-bR and cloned into the C-terminus of dBhCas12b to obtain the integration vector pAX-dBhCas12b-CDA.

[0096] Construction of CDA-dBhCas12b, CDA-dBhCas12b-UGI, and CDA-dBhCas12b-UGI-UGI (primers and sequences refer to Table 1):

[0097] Using primers pAX-nCDA-F / pAX-nCDA-R and pAX-nCDA-bF / pAX-nCDA-bR, with pUC-CDA and pAX-dBhCas12b as templates, CDA was ligated to the N-terminus of dBhCas12b to construct the integration vector pAX-CDA-dBhCas12b. Using primers pAX-UGI-F / pAX-UGI-R and pAX-UGI-bF / pAX-UGI-bR, with pUC-UGI and pAX-CDA-dBhCas12b as templates, the UGI gene was amplified and cloned into the C-terminus of CDA-dBhCas12b to obtain the integration vector pAX-CDA-dBhCas12b-UGI. Using pAX-CDA-dBhCas12b-UGI as a template, one copy of UGI was added to obtain the vector plasmid pAX-CDA-dBhCas12b-UGI-UGI.

[0098] Construction of CBE system integration strains based on different dBhCas12b:

[0099] Following the above method, engineered dBhCas12b was fused to CDA at different positions to obtain four different CBE structures, the construction of which is shown in Figure 5a. These different CBEs were integrated into B. subtilis 168 and named BS38-BS41, respectively.

[0100] Edit performance verification:

[0101] 1. Construction of target plasmid

[0102] The sgRNA expression cassette was constructed using primers pksA-F / pksA-R shown in Table 1 and ligated into the plasmid pHYT. After sequencing verification, the pksA editing target plasmid was obtained and named pHY-pksA;

[0103] The construction of pksC, pksE, and pksG was the same as above, except that the primers were replaced with pksC-F / pksC-R, pksE-F / pksE-R, and pksG-F / pksG-R. After sequencing verification, the pksC, pksE, and pksG editing target plasmids were obtained and named pHY-pksC, pHY-pksE, and pHY-pksG, respectively.

[0104] 2. Verification of editing performance of four CBE systems

[0105] The plasmids pHY-pksA and pHY-pksC obtained in step 1 were transformed into BS38-BS41, respectively, and induced with xylose at 37°C and 200 rpm. The gene editing performance of pksA and pksC was detected by first-generation Sanger sequencing.

[0106] The plasmids pHY-pksE and pHY-pksG obtained in step 1 were transformed into BS38-BS41 and induced with xylose at 37°C and 200 rpm. The gene editing performance of pksE and pksG was detected by first-generation Sanger sequencing.

[0107] The results showed that the CBE structured in configuration d (Figure 5a) produced excellent editing performance, with an editing window of up to 16 nt for pksA and pksC (Figure 5b). The editing efficiency of pksA and pksC in other configurations was lower, with configuration c showing an editing window of 16 nt but only 20%; configurations a and b showed no detectable editing efficiency. Furthermore, further validation of the pksE and pksG genes revealed that configuration d could extend the editing window of pksE and pksG to 19 nt (Figure 5c).

[0108] Example 3: Design and validation of the adenine base editor ABE8e-dBhCas12b in B. subtilis

[0109] The structure of the adenine base editor ABE8e-dBhCas12b is shown in Figure 5d.

[0110] The specific method is the same as in Example 2, except that ABE8e is amplified with primers ABE8e-F / ABE8e-R and connected to the N-terminus of dBhCas12b to form ABE8e-dBhCas12b (Figure 5d). The ABE8e-dBhCas12b expression cassette (xylose induction) is then integrated into the lacA site of B. subtilis to form a recombinant strain BS42 (Figure 5d). Using sigE as the verification gene, the target plasmids pHY-sigE1, pHY-sigE2 and pHY-sigE3 are constructed using sgRNAs (sigE-E1, sigE-E2 and sigE-E3) shown in Table 4.

[0111] The results are shown in Figure 5e. The ABE system composed of dBhCas12b produced a high editing efficiency (100%) within a wider editing window (14nt, A6-A19).

[0112] Example 4: Application of dBhCas12b-based CBE for diversified gene expression in B. subtilis

[0113] To demonstrate the advantages of the BE with a broadened editing window developed in this study, we used CBE to construct an RBS+Spacer (RS) library to diversify the expression of target genes.

[0114] First, the above-mentioned recombinant strain BS41 was used as the starting strain to construct a customized RS sequence G on the plasmid pB-P43-eGFP. 15 (15 consecutive Gs) were used to express eGFP, and then the sgRNA targeting RS was integrated into the above plasmid to form a complete probe plasmid pB-P43-eGFPsgRNA ( Figure 6 a).

[0115] The above probe plasmid was transformed into BS41 to verify its ability to edit RS sequence and thus regulate gene expression.

[0116] Specific conditions and methods for culture, induction and detection

[0117] First, the probe plasmid was transformed into BS41 (referring to the standard B. subtilis transformation protocol mentioned above). Single colonies were isolated and cultured in LB medium containing 1% xylose for approximately 12 hours. Additionally, wild-type B. subtilis 168 and pB-P43-eGFP without sgRNA were used as negative controls.

[0118] Individuals with significant fluorescence differences were identified and sequenced, ultimately resulting in a RS mutant with a 68.1-fold increase in eGFP expression compared to the control ( FIG6 b ). The RS sequence and fluorescence intensity are shown in Table 5 .

[0119] Table 5 eGFP fluorescence intensity produced by different RS mutations

[0120] Example 5: Design and Verification of CBE Based on dBhCas12b in E. coli

[0121] In order to investigate the universality of dBhCas12b-based BE among different hosts, E. coli BL21 (DE3) was selected as the host, and the gene rpsE encoding a small ribosomal subunit protein uS5 involved in translation was used as the target gene for further verification.

[0122] Using the vector pAX-CDA-dBhCas12b-UGI and the vector pKD46 obtained according to the method of Example 2 as templates, the fusion gene CDA-dBhCas12b-UGI was cloned into the vector pKD46 under the arabinose promoter (P araBAD ) downstream and replaced the original gene to form the recombinant plasmid pKD-P araBAD -CDA-dBhCas12b-UGI. At the same time, the constitutively expressed sgRNA expression cassette (P veg -sgRNA) cloned into plasmid pKD-P araBAD -CDA-dBhCas12b-UGI (fragment assembly method refers to Example 1), and finally an all-in-one (AIO) plasmid pKD-CDA-dBhCas12b-UGI is formed. Primers and related sequences are referred to Tables 1 and 2.

[0123] The mutation frequency was identified by transforming the "AIO" plasmid pKD-CDA-dBhCas12b-UGI, inducing editing with arabinose, and finally sequencing the single clone or population. The process diagram is shown in Figure 7a. Specifically, the editing plasmid pKD-CDA-dBhCas12b-UGI was first transformed into Escherichia coli BL21 (DE3) by chemical transformation (heat shock method); then a single clone of appropriate size was picked and transferred to fresh LB medium for about 3 to 4 hours, and then 50% (g / ml) arabinose was added to the system to induce editing for about 12 hours; finally, the edited culture was divided into two parts: one was directly used as a PCR template to amplify the target mutation region using customized primers, and the PCR product was sequenced (population sequencing); the other sample was diluted (10 5The diluted culture was then evenly plated onto LB plates containing ampicillin. After clones grew, single clones were randomly selected as templates, and customized primers were used to amplify the target mutation region. The PCR products were then sequenced to identify the mutation efficiency (single clone sequencing). Four sites on rpsE (rpsE1, rpsE2, rpsE3, and rpsE4) were selected as targets, and their population editing efficiency was determined by culture, induction, and sequencing (refer to the population sequencing description above). The results showed that CBE achieved high editing efficiency (editing efficiency ranged from 3% to 98%) within a wide editing window (42 nt) (Figure 7b).

[0124] Next, we evaluated the CBE editing performance at the single-clone level, and the results were similar to those from population sequencing (Figure 7c). Appropriate mutations in rpsE, which encodes a small ribosomal subunit protein involved in translation, uS5, can generate E. coli naturally resistant to spectinomycin. We plated the edited cultures onto plates containing spectinomycin and found that only cultures with edits to rpsE3 and rpsE4 grew. We randomly selected 10 clones from each plate for sequencing. The mutational trends were similar to those observed in population sequencing, with the widest editing window reaching 63 nt (Figure 7d). Single clones randomly selected from these plates were examined for growth under high concentrations of spectinomycin. Growth of these clones was essentially identical to that of the control (E. coli BL21(DE3) empty host), indicating that these mutant clones conferred spectinomycin resistance (Figure 7e). Sequencing of these clones ultimately identified the specific mutation sites (Figure 7f).

[0125] Example 6: Comparison of CBE editing performance with different dCas constructs

[0126] In order to compare the editing performance of CBEs composed of different Cas proteins, dBhCas12b, dFnCas12a (derived from Francisella novicida U112) and dSpCas9 (derived from Streptococcus pyogenes) were selected to construct CBE. Specific construction method: Using primers dCas12a-F / dCas12a-R and dCas12a-bF / dCas12a-bR, pLCx-dFnCas12a and pKD-CDA-dBhCas12b-UGI were used as templates to amplify dFnCas12a and the corresponding backbone, respectively. The two fragments were then digested, purified and assembled according to the method of Example 1 to obtain the recombinant plasmid pKD-CDA-dFnCas12a-UGI. Similarly, the process of constructing pKD-CDA-dSpCas9-UGI is similar to that of constructing pKD-CDA-dFnCas12a-UGI. For different CBEs, we selected 10 targets each to compare their editing performance (Figure 8a). By comparison, we found that the CBE based on dBhCas12b has a wider editing window (42 nt) and higher efficiency (editing efficiency spans 2% to 91%, Figure 8b). However, the CBE based on dFnCas12a has low editing efficiency (editing efficiency of most sites is less than 30%) and a narrow window (only C8-C10, approximately 3 nt, Figure 8c); the CBE based on dSpCas9 has high editing efficiency (editing efficiency of most sites is between 60% and 100%) and a narrow window (approximately 7 nt, Figure 8d). To investigate the effects of CBEs composed of different dCas proteins on E. coli growth, we compared the inhibition of cell growth by dCas-CBE expression at the same time. The results showed that the CBEs composed of the three dCas proteins had no significant inhibitory effect on E. coli growth (Figure 8e).

[0127] Example 7: Application of dBhCas12b-CBE in protein evolution in E. coli

[0128] To highlight the application of the novel E. coli-based BE (pKD-CDA-dBhCas12b-UGI) constructed in this study for protein evolution, we selected TatABC as the target for evolution to improve E. coli's ability to secrete exogenous proteins. We first selected 22 targets on TatABC (10 targets for TatA, 5 targets for TatB, and 7 targets for TatC) to construct a mini-sgRNA library for evolving TatABC (Figure 9a). Specific construction process: First, the corresponding sgRNA sequences targeting TatABC were designed according to CHOPCHOP (http: / / chopchop.cbu.uib.no / ); then, primers A1-F / A1-R, A2-F / A2-R, A3-F / A3-R, A4-F / A4-R, A5-F / A5-R, A6-F / A6-R, A7-F / A7-R, A8-F / A8-R, A9-F / A9-R, A10-F / A10-R, B1-F / B1-R, B2-F / B2-R, B3-F / B3-R in Primer Table 2 were used. -F / B3-R, B4-F / B4-R, B5-F / B5-R, C1-F / C1-R, C2-F / C2-R, C3-F / C3-R, C4-F / C4-R, C5-F / C5-R, C6-F / C6-R and C7-F / C7-R, using pKD-CDA-dBhCas12b-UGI-rpsE1sg as a template, construct different sgRNAs targeting TatABC (sgRNA sequences refer to Table 4), and the above plasmids are transformed into Escherichia coli JM109, and TatABC mutations are performed according to the method described in Example 5. Subsequently, the sfGFP expression plasmid is transformed into Escherichia coli JM109 containing different TatABC mutations. According to the process of Figure 9b, the secretory expression amount of sfGFP is detected by the above-mentioned periplasmic protein extraction method, and mutants with enhanced TatABC secretion ability are screened. The mutants and their fluorescence intensities are shown in Table 6. Screening and comparison based on total secretion fluorescence intensity (Figure 9c), total OD (Figure 9d), and unit secretion fluorescence intensity (Figure 9e) ultimately identified a mutant with a 6.49-fold increase in secretion capacity compared to the wild-type. Furthermore, by illuminating these mutants under a blue light microscope, it was visually observed that the best mutant, C7-2, had the strongest ability to secrete sfGFP (Figure 9f).

[0129] Table 6 Fluorescence intensity of sfGFP secreted by different Tat mutants

[0130] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A fusion protein comprising a deaminase and a Cas protein mutant dBhCas12b; The deaminase is located at the N-terminus of the Cas protein mutant dBhCas12b; Compared with the original sequence, the Cas protein mutant dBhCas12b has the following mutations: aspartic acid at position 574, glutamic acid at position 828, and aspartic acid at position 952 are mutated to alanine A; the amino acid sequence of the original sequence is shown in SEQ ID NO.3; The deaminase includes cytidine deaminase CDA or adenosine base editor ABE8e; the amino acid sequence of the cytidine deaminase CDA is shown in SEQ ID NO.1; the amino acid sequence of the adenosine base editor ABE8e is shown in SEQ ID NO.

2.

2. The fusion protein according to claim 1, characterized in that The fusion protein also contains a uracil glycosylase inhibitor domain UGI.

3. The fusion protein according to claim 2, characterized in that The amino acid sequence of the uracil glycosylase inhibitor domain UGI is shown in SEQ ID NO.

4.

4. The fusion protein according to claim 2, characterized in that The uracil glycosylase inhibitor domain UGI is located at the C-terminus of the Cas protein mutant dBhCas12b.

5. The fusion protein according to any one of claims 2-3, characterized in that: The cytidine deaminase CDA is connected to the Cas protein mutant dBhCas12b through the connecting protein 1, and the Cas protein mutant dBhCas12b is connected to the uracil glycosylase inhibitor (UGI) domain through the connecting protein 2; The amino acid sequence of the connecting protein 1 of the CDA and dBhCas12b is (GSAASR) n ; The amino acid sequence of the connecting protein of dBhCas12b and UGI is (GPKKKRKVGT) n , wherein n is independently an integer from 1 to 30.

6. A gene encoding the fusion protein according to any one of claims 1 to 5.

7. An expression vector containing the gene according to claim 6.

8. A recombinant cell containing the gene according to claim 6 or the expression vector according to claim 7.

9. The recombinant cell according to claim 8, characterized in that The recombinant cell includes Bacillus subtilis or Escherichia coli.

10. The recombinant cell according to claim 9, characterized in that The recombinant cell is Bacillus subtilis 168.

11. The recombinant cell according to claim 9, characterized in that The recombinant cell is Escherichia coli BL21 (DE3).

12. Use of the fusion protein according to any one of claims 1 to 5, or the gene according to claim 6, or the expression vector according to claim 7, or the recombinant cell according to any one of claims 8 to 11 in gene expression and / or protein evolution.

13. The use according to claim 12, characterized in that: The application is to use the fusion protein according to any one of claims 1 to 5, or the gene according to claim 6, or the expression vector according to claim 7, or the recombinant cell according to any one of claims 8 to 11 for mutation of RBS.

14. The use according to claim 12, characterized in that: The application is to use the fusion protein of any one of claims 1 to 5, or the gene of claim 6, or the expression vector of claim 7, or the recombinant cell of any one of claims 8 to 11 to target a target protein and mutate the target protein.

Images