mRNA vaccine against respiratory syncytial virus

Abstract

Related to the field of prevention and treatment of respiratory diseases, and disclosed a method for preparing a preventive mRNA vaccine against human respiratory syncytial virus. In some embodiments, the mRNA vaccine comprises an antigen-encoding mRNA and lipid nanoparticles. In some embodiments, the mRNA sequence utilizes an improved 5'UTR / 3'UTR sequence and codon optimization methods for efficient translation of the target protein. In some embodiments, the mRNA vaccine expresses an RSV F protein that is used as an antigen, wherein the sequence of the RSV F protein is optimized to achieve stable RSV pre-F protein expression. After immunization, the mRNA vaccine induces high levels of RSV F protein-specific binding antibody titer and neutralizing antibody titer in mice.

Description

MRNA VACCINE AGAINST RESPIRATORY SYNCYTIAL VIRUSTECHNICAL FIELD

[0001] The present application relates to the field of treatment of respiratory diseases, and particularly to an mRNA vaccine against respiratory syncytial virus.

[0002] CROSS REFERENCE TO RELATED APPLICATIONS

[0003] This application claims priority to Chinese Application Serial No. 202311457136.0, filed on November 3, 2023, which is incorporated by reference herein in its entirety for all purposes.

[0004] SEQUENCE LISTING

[0005] The Sequence Listing XML associated with this application is provided in XML file format and is hereby incorporated by reference into the specification. The name of the XML file containing the Sequence Listing XML is NSBC_001_01US_ST26. The XML file is 37.748 bytes in size, was created on June 24, 2024, and is being submitted electronically via USTPO Patent Center.BACKGROUND

[0006] Respiratory syncytial virus (RSV) is a common respiratory virus of the family Paramyxoviridae, and a major pathogen causing lower respiratory infections (LRIs) in infants, the elderly, and the immunocompromised patients. There is only one serotype of RSV, including subtypes A and B, and the strains of both subtypes can cause infections. RSV infection is a global epidemic with seasonality. Globally, RSV causes more than 336,000 hospitalizations and 14,000 deaths in the elderly population every year. It is estimated that in 2015 alone, there were 33,100,000 cases of lower respiratory infections caused by RSV among infants under 5 years old worldwide, resulting in 3,200,000 hospitalizations and nearly 60,000 deaths. Among them, 1,400,000 infants under 6 months old were hospitalized and more than 27,000 deaths have occurred.

[0007] At present, there is still no specific treatment for RSV infection in clinics, and prevention plays a key role in RSV management. Prevention by immunization against RSV is mainly achieved by passive prevention (antibody drugs) or active prevention (preventive vaccines) . The  choices of antigens of the RSV vaccines and antibody drugs are mainly focused on the F protein. F protein mediates the fusion of the virus to the cell membrane, thus promoting the entry of the virus into the host cell. The coding region of F protein is conservative. Neutralizing antibodies induced by F protein can inhibit the infection caused by both RSV sub-serotypes A and B. F protein is a type I transmembrane glycoprotein, which is initially translated into an inactive single polypeptide precursor F0 having a length of about 574 amino acids. During the maturation of F protein, the signal peptide and the p27 polypeptide will be excised, and F2 will be connected with F1 polypeptide through two disulfide bonds. Three F2-F1 heterodimers are oligomerized to form pre-F, which is anchored to the viral envelope by a transmembrane domain (TM) . In the entry of RSV into the cells, the F protein in pre-fusion conformation (pre-F) is rearranged into the F protein in post-fusion conformation (post-F) , and the exposed fusion peptide (FP) of the pre-fusion conformation can bind to the cell membrane and promote the fusion of the viral envelope to the cell membrane.

[0008] The antigen epitopes also changes when F protein changes from pre-F to post-F. The antigen epitopes I, II, III, and IV are present in both pre-F and post-F, whereas the epitopes and V are only exposed in the pre-F. Experimental results have shown that the neutralizing antibody induced by specific epitopes and V unique to pre-F have higher neutralizing activity. Particularly, the titer of the neutralizing antibody induced by the epitope is 10-100 times that of the neutralizing antibody induced by the epitope II. That is, pre-F can induce stronger neutralizing immune response, compared with post-F. Therefore, the pre-F conformation of F protein is a preferred antigen configuration for vaccine candidates.

[0009] In recent years, with the in-depth study on the structure, function, and stabilization strategy of the RSV pre-F protein, monoclonal antibodies and RSV vaccines with RSV pre-F protein as the target protein are developed constantly, and some products have achieved good results. Compared with recombinant protein vaccines, the antigen produced by mRNA vaccines is translated in the host cell, thereby avoiding any impacts on the pre-fusion conformation during the manufacturing process. Moreover, the mRNA production line is highly versatile. However, limitations in intracellular stability and transcription efficiency present challenges to known mRNA vaccines and thus an improved RSV mRNA vaccine is needed.SUMMARY

[0010] The present application provides an mRNA vaccine for preventing RSV infection, which mainly comprises an mRNA encoding an RSV antigen protein and lipid nanoparticles. The mRNA vaccine provided in the present application produces a good immune response in mice immunized therewith.

[0011] In one aspect, the disclosure provides a messenger ribonucleic acid (mRNA) comprising a nucleic acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, or 100%identity to the sequence set forth in SEQ ID NO: 15, 16, 17, or 18. In some embodiments of the mRNA of the disclosure, the nucleic acid sequence has 100%identity to the sequence set forth in SEQ ID NO: 15. In some embodiments of the mRNA of the disclosure, the nucleic acid sequence has 100%identity to the sequence set forth in SEQ ID NO: 16. In some embodiments of the mRNA of the disclosure, the nucleic acid sequence comprises a 5’ untranslated region (UTR) . In some embodiments of the mRNA of the disclosure, the 5’ UTR has 100%identity to the sequence set forth in SEQ ID NO: 17. In some embodiments of the mRNA of the disclosure, the 5’ UTR has a length of less than 1,000, 500, 300, 200, 150, 100, or 90 nucleotides. In some embodiments of the mRNA of the disclosure, the nucleic acid sequence comprises a 3’ untranslated region (UTR) . In some embodiments of the mRNA of the disclosure, the 3’ UTR has 100%identity to the sequence set forth in SEQ ID NO: 18. In some embodiments of the mRNA of the disclosure, the 3’ UTR has a length of less than 1,000, 500, 300, 200, 150, 100, or 90 nucleotides.

[0012] In some embodiments of the mRNA of the disclosure, the mRNA comprises a codon optimized sequence that encodes a pre-fusion form of a respiratory syncytial virus (RSV) F protein variant. In some embodiments of the mRNA of the disclosure, the F protein variant comprises or consists of a polypeptide sequence having at least 80%, at least 85%, or at least 90%identity to SEQ ID NO: 8. In some embodiments of the mRNA of the disclosure, the F protein variant comprises or consists of a polypeptide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or 100%identity to SEQ ID NO: 9. In some embodiments of the mRNA of the disclosure, the F protein variant comprises or consists of a polypeptide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%,  or 100%identity to SEQ ID NO: 13. In some embodiments of the mRNA of the disclosure, the F protein variant comprises or consists of SEQ ID NO: 8 with the following modifications: S46G, E92D, P102A, replacing N104-V144 with GS, A149C, S155C, S190F, V207L, S215P, S290C, L373R, I379V, M447V, Y458C, K465Q, and deletion of C550-N574. In some embodiments of the mRNA of the disclosure, the F protein variant comprises or consists of a polypeptide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98%identity to SEQ ID NO: 8 with the following modifications: S46G, E92D, P102A, replacing N104-V144 with GS, A149C, S155C, S190F, V207L, S215P, S290C, L373R, I379V, M447V, Y458C, K465Q, and deletion of C550-N574. In some embodiments of the mRNA of the disclosure, the F protein variant comprises a modification that replaces C550-N574 with QPRFAAA (SEQ ID NO. 21). In some embodiments of the mRNA of the disclosure, the F protein variant comprises or consists of a polypeptide sequence having about 86%identity to SEQ ID NO: 8.

[0013] In some embodiments of the mRNA of the disclosure, the mRNA comprises a polyadenylic acid (poly (A) ) sequence. In some embodiments, the poly (A) sequence comprises the sequence set forth in SEQ ID NO: 6.

[0014] In some embodiments of the mRNA of the disclosure, the mRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 19 or SEQ ID NO: 20.

[0015] In some embodiments of the mRNA of the disclosure, the mRNA comprises a 5’-cap structure. In some embodiments, the 5’-cap structure is m7G (5') ppp (5') (2'-OMeA) p. In some embodiments, the 5’-cap structure is added by capping enzymes. In some embodiments, the capping enzymes comprise vaccinia capping enzyme and 2'-O-methyltransferase.

[0016] In some embodiments of the mRNA of the disclosure, the mRNA comprises a chemical modification. In some embodiments, at least one uridine in the mRNA is replaced by N1-methyl-pseudouridine (m1ψ) . In some embodiments, all uridines are replaced by N1-methyl-pseudouridines (m1ψ) .

[0017] In one aspect, the disclosure provides an mRNA comprising a nucleic acid sequence encoding a respiratory syncytial virus (RSV) F protein variant, where the RSV F protein variant comprises an amino acid sequence having 100%identity to the sequence set forth in SEQ ID NO: 13.

[0018] In one aspect, the disclosure provides an mRNA comprising a nucleic acid sequence encoding a respiratory syncytial virus (RSV) F protein variant, where the RSV F protein variant comprises an amino acid sequence having 100%identity to the sequence set forth in SEQ ID NO: 21.

[0019] In some embodiments of the mRNA of the disclosure, the mRNA comprises a nucleic acid sequence encoding an RSV F protein variant, where the RSV F protein variant comprises an amino acid sequence having 100%identity to the sequence set forth in SEQ ID NO: 9.

[0020] In some embodiments of the mRNA of the disclosure, the mRNA comprises a nucleic acid sequence encoding an RSV F protein variant, where the RSV F protein variant comprises the amino acid sequence set forth in SEQ ID NO: 21, where the RSV F protein variant induces a higher titer of RSV neutralizing antibody than a comparable RSV F protein variant without the amino acid sequence set forth in SEQ ID NO: 21.

[0021] In some embodiments of the mRNA of the disclosure, the mRNA comprises a 5’ untranslated region (UTR) having 100%identity to the sequence set forth in SEQ ID NO: 17. In some embodiments, the 5’ UTR has a length of less than 1,000, 500, 300, 200, 150, 100, or 90 nucleotides.

[0022] In some embodiments of the mRNA of the disclosure, the mRNA comprises a 3’ untranslated region (UTR) and the 3’ UTR has 100%identity to the sequence set forth in SEQ ID NO: 18. In some embodiments, the 3’ UTR has a length of less than 1,000, 500, 300, 200, 150, 100, or 90 nucleotides.

[0023] In some embodiments of the mRNA of the disclosure, the mRNA comprises a codon optimized sequence that encodes a pre-fusion form of an RSV F protein variant.

[0024] In one aspect, the disclosure provides a respiratory syncytial virus (RSV) F protein variant comprising an amino acid sequence having 100%identity to the sequence set forth in SEQ ID NO: 13 or SEQ ID NO: 21. In some embodiments of the RSV F protein variant of the disclosure, the RSV F protein variant comprises an amino acid sequence having 100%identity to the sequence set forth in SEQ ID NO: 9.

[0025] In one aspect, the disclosure provides a pharmaceutical composition comprising a therapeutically effective amount of an mRNA of the disclosure and a pharmaceutically  acceptable excipient. In some embodiments, the pharmaceutical composition is a vaccine.

[0026] In some embodiments of the pharmaceutical composition of the disclosure, the pharmaceutically acceptable excipient comprises a lipid nanoparticle, where the mRNA is formulated in the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises an ionizable cationic lipid, a neutral lipid, a sterol, and a PEGylated lipid. In some embodiments, the weight ratio of the mRNA to the lipid nanoparticle is 1: 5 to 1: 50. In some embodiments, the molar ratio of the ionizable cationic lipid: neutral lipid: sterol: PEGylated lipid is (20-65) : (5-25): (30-50) : (0.5-3) .

[0027] In some embodiments of the pharmaceutical composition of the disclosure, the pharmaceutical composition has one or more of the following features: i) the ionizable cationic lipid is any one or more selected from the group consisting of: ( (4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (2-hexyldecanoate) , 1-octylnonyl 8- [ (2-hydroxyethyl) [6-O-6- (undecanyloxy) hexyl] amino] -octoate, (dilinoleyl) methyl 4- (N, N-dimethylamino) butyrate, 1, 2-dioleyloxy-3-dimethylaminopropane, 1, 1'- ( (2- (4- (2- ( (2- (bis (2-hydroxydodecanyl) amino) ethyl) (2-hydroxydodecanyl) amino) ethyl) piperazin-1-yl) ethyl) azanediyl) bis (dodecan-2-ol) , and 1, 2-dilinoleyloxy-3-dimethylamino propane; ii) the neutral lipid is any one or more selected from the group consisting of: 1, 2-distearoyl-sn-glycero-3-phosphorylcholine, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine, and dipalmitoylphosphatidylcholine; iii) the sterol is cholesterol or its naturally occurring derivative; and / or iv) the PEGylated lipid is any one or more selected from the group consisting of: methoxy poly (ethylene glycol) ditetradecylacetamide, 1‐ (monomethoxy‐polyethylene glycol) ‐2 ,3‐dimyristoyl-sn-glycerol, poly (ethylene glycol) -distearoylphosphatidylethanolamine, poly (ethylene glycol) -distearoyl-sn-glycero-3-phosphocoline, poly (ethylene glycol) -diacylglycerol, methoxy poly (ethylene glycol) -ditetradecylamine, poly (ethylene glycol) -phosphatidylethanolamine, and PEG-succinate-diacylglycerol.

[0028] In some embodiments of the pharmaceutical composition of the disclosure, the features of the pharmaceutical composition may comprise at least one of i) the ionizable cationic lipid is any one or more selected from the group consisting of: ( (4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (2-hexyldecanoate) , 1-octylnonyl 8- [ (2-hydroxyethyl) [6-O-6-  (undecanyloxy) hexyl] amino] -octoate, (dilinoleyl) methyl 4- (N, N-dimethylamino) butyrate, 1, 2-dioleyloxy-3-dimethylaminopropane, 1, 1'- ( (2- (4- (2- ( (2- (bis (2-hydroxydodecanyl) amino) ethyl) (2 -hydroxydodecanyl) amino) ethyl) piperazin-1-yl) ethyl) azanediyl) bis (dodecan-2-ol) , and 1, 2-dilinoleyloxy-3-dimethylamino propane, ii) the neutral lipid is any one or more selected from the group consisting of: 1, 2-distearoyl-sn-glycero-3-phosphorylcholine, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine, and dipalmitoylphosphatidylcholine, iii) the sterol is cholesterol or its naturally occurring derivative, iv) the PEGylated lipid is any one or more selected from the group consisting of: methoxy poly (ethylene glycol) ditetradecylacetamide, 1- (monomethoxy-polyethylene glycol) -2, 3-dimyristoyl-sn-glycerol, poly (ethylene glycol) -distearoylphosphatidylethanolamine, poly (ethylene glycol) -distearoyl-sn-glycero-3-phosphocoline, poly (ethylene glycol) -diacylglycerol, methoxy poly (ethylene glycol) -ditetradecylamine, poly (ethylene glycol) -phosphatidylethanolamine, and PEG-succinate-diacylglycerol. In one embodiment, the pharmaceutical composition includes i) the ionizable cationic lipid is any one or more selected from the group consisting of: ( (4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (2-hexyldecanoate) , 1-octylnonyl 8- [ (2-hydroxyethyl) [6-O-6- (undecanyloxy) hexyl] amino] -octoate, (dilinoleyl) methyl 4- (N, N-dimethylamino) butyrate, 1, 2-dioleyloxy-3-dimethylaminopropane, 1, 1'- ( (2- (4- (2- ( (2- (bis (2-hydroxydodecanyl) amino) ethyl) (2-hydroxydodecanyl) amino) ethyl) piperazin-1-yl) ethyl) azanediyl) bis (dodecan-2-ol) , and 1, 2-dilinoleyloxy-3-dimethylamino propane. In one embodiment, the pharmaceutical composition includes ii) the neutral lipid is any one or more selected from the group consisting of: 1, 2-distearoyl-sn-glycero-3-phosphorylcholine, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine, and dipalmitoylphosphatidylcholine. In one embodiment, the pharmaceutical composition includes iii) the sterol is cholesterol or its naturally occurring derivative. In one embodiment, the pharmaceutical composition includes iv) the PEGylated lipid is any one or more selected from the group consisting of: methoxy poly (ethylene glycol) ditetradecylacetamide, 1- (monomethoxy-polyethylene glycol) -2, 3-dimyristoyl-sn-glycerol, poly (ethylene glycol) -distearoylphosphatidylethanolamine, poly (ethylene glycol) -distearoyl-sn-glycero-3-phosphocoline, poly (ethylene glycol) -diacylglycerol, methoxy poly (ethylene glycol) -ditetradecylamine, poly (ethylene glycol) -phosphatidylethanolamine, and  PEG-succinate-diacylglycerol. In one embodiment, the pharmaceutical composition includes i) the ionizable cationic lipid is any one or more selected from the group consisting of: ( (4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (2-hexyldecanoate) , 1-octylnonyl 8- [ (2-hydroxyethyl) [6-O-6- (undecanyloxy) hexyl] amino] -octoate, (dilinoleyl) methyl 4- (N, N-dimethylamino) butyrate, 1, 2-dioleyloxy-3-dimethylaminopropane, 1, 1'- ( (2- (4- (2- ( (2- (bis (2-hydroxydodecanyl) amino) ethyl) (2-hydroxydodecanyl) amino) ethyl) piperazin-1-yl) ethyl) azanediyl) bis (dodecan-2-ol) , and 1, 2-dilinoleyloxy-3-dimethylamino propane, ii) the neutral lipid is any one or more selected from the group consisting of: 1, 2-distearoyl-sn-glycero-3-phosphorylcholine, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine, and dipalmitoylphosphatidylcholine. In one embodiment, the pharmaceutical composition includes i) the ionizable cationic lipid is any one or more selected from the group consisting of: ( (4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (2-hexyldecanoate) , 1-octylnonyl 8- [ (2-hydroxyethyl) [6-O-6- (undecanyloxy) hexyl] amino] -octoate, (dilinoleyl) methyl 4- (N, N-dimethylamino) butyrate, 1, 2-dioleyloxy-3-dimethylaminopropane, 1, 1'- ( (2- (4- (2- ( (2- (bis (2-hydroxydodecanyl) amino) ethyl) (2-hydroxydodecanyl) amino) ethyl) piperazin-1-yl) ethyl) azanediyl) bis (dodecan-2-ol) , and 1, 2-dilinoleyloxy-3-dimethylamino propane, iii) the sterol is cholesterol or its naturally occurring derivative. In one embodiment, the pharmaceutical composition includes i) the ionizable cationic lipid is any one or more selected from the group consisting of: ( (4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (2-hexyldecanoate) , 1-octylnonyl 8- [ (2-hydroxyethyl) [6-O-6- (undecanyloxy) hexyl] amino] -octoate, (dilinoleyl) methyl 4 -(N, N-dimethylamino) butyrate, 1, 2-dioleyloxy-3-dimethylaminopropane, 1, 1'- ( (2- (4- (2- ( (2-(bis (2-hydroxydodecanyl) amino) ethyl) (2-hydroxydodecanyl) amino) ethyl) piperazin-1-yl) ethyl) azanediyl) bis (dodecan-2-ol) , and 1, 2-dilinoleyloxy-3-dimethylamino propane, iv) the PEGylated lipid is any one or more selected from the group consisting of: methoxy poly (ethylene glycol) ditetradecylacetamide, 1- (monomethoxy-polyethylene glycol) -2, 3-dimyristoyl-sn-glycerol, poly (ethylene glycol) -distearoylphosphatidylethanolamine, poly (ethylene glycol) -distearoyl-sn-glycero-3-phosphocoline, poly (ethylene glycol) -diacylglycerol, methoxy poly (ethylene glycol) -ditetradecylamine, poly (ethylene glycol) -phosphatidylethanolamine, and PEG-succinate-diacylglycerol. In one embodiment, the pharmaceutical composition includes ii)  the neutral lipid is any one or more selected from the group consisting of: 1, 2-distearoyl-sn-glycero-3-phosphorylcholine, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine, and dipalmitoylphosphatidylcholine, iii) the sterol is cholesterol or its naturally occurring derivative. In one embodiment, the pharmaceutical composition includes ii) the neutral lipid is any one or more selected from the group consisting of: 1, 2-distearoyl-sn-glycero-3-phosphorylcholine, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine, and dipalmitoylphosphatidylcholine, iv) the PEGylated lipid is any one or more selected from the group consisting of: methoxy poly (ethylene glycol) ditetradecylacetamide, 1- (monomethoxy-polyethylene glycol) -2, 3-dimyristoyl-sn-glycerol, poly (ethylene glycol) -distearoylphosphatidylethanolamine, poly (ethylene glycol) -distearoyl-sn-glycero-3-phosphocoline, poly (ethylene glycol) -diacylglycerol, methoxy poly (ethylene glycol) -ditetradecylamine, poly (ethylene glycol) -phosphatidylethanolamine, and PEG-succinate-diacylglycerol. In one embodiment, the pharmaceutical composition includes iii) the sterol is cholesterol or its naturally occurring derivative, iv) the PEGylated lipid is any one or more selected from the group consisting of: methoxy poly (ethylene glycol) ditetradecylacetamide, 1- (monomethoxy-polyethylene glycol) -2, 3-dimyristoyl-sn-glycerol, poly (ethylene glycol) -distearoylphosphatidylethanolamine, poly (ethylene glycol) -distearoyl-sn-glycero-3-phosphocoline, poly (ethylene glycol) -diacylglycerol, methoxy poly (ethylene glycol) -ditetradecylamine, poly (ethylene glycol) -phosphatidylethanolamine, and PEG-succinate-diacylglycerol. In one embodiment, the pharmaceutical composition includes i) the ionizable cationic lipid is any one or more selected from the group consisting of: ( (4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (2-hexyldecanoate) , 1-octylnonyl 8- [ (2-hydroxyethyl) [6-O-6- (undecanyloxy) hexyl] amino] -octoate, (dilinoleyl) methyl 4- (N, N-dimethylamino) butyrate, 1, 2-dioleyloxy-3-dimethylaminopropane, 1, 1'- ( (2- (4- (2- ( (2- (bis (2-hydroxydodecanyl) amino) ethyl) (2-hydroxydodecanyl) amino) ethyl) piperazin-1-yl) ethyl) azanediyl) bis (dodecan-2-ol) , and 1, 2-dilinoleyloxy-3-dimethylamino propane, ii) the neutral lipid is any one or more selected from the group consisting of: 1, 2-distearoyl-sn-glycero-3-phosphorylcholine, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine, and dipalmitoylphosphatidylcholine, iii) the sterol is cholesterol or its naturally occurring derivative. In one embodiment, the pharmaceutical composition includes i) the ionizable cationic lipid is any  one or more selected from the group consisting of: ( (4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (2-hexyldecanoate) , 1-octylnonyl 8- [ (2-hydroxyethyl) [6-O-6- (undecanyloxy) hexyl] amino] -octoate, (dilinoleyl) methyl 4- (N, N-dimethylamino) butyrate, 1, 2-dioleyloxy-3-dimethylaminopropane, 1, 1'- ( (2- (4- (2- ( (2- (bis (2-hydroxydodecanyl) amino) ethyl) (2 -hydroxydodecanyl) amino) ethyl) piperazin-1-yl) ethyl) azanediyl) bis (dodecan-2-ol) , and 1, 2-dilinoleyloxy-3-dimethylamino propane, ii) the neutral lipid is any one or more selected from the group consisting of: 1, 2-distearoyl-sn-glycero-3-phosphorylcholine, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine, and dipalmitoylphosphatidylcholine, iv) the PEGylated lipid is any one or more selected from the group consisting of: methoxy poly (ethylene glycol) ditetradecylacetamide, 1- (monomethoxy-polyethylene glycol) -2, 3-dimyristoyl-sn-glycerol, poly (ethylene glycol) -distearoylphosphatidylethanolamine, poly (ethylene glycol) -distearoyl-sn-glycero-3-phosphocoline, poly (ethylene glycol) -diacylglycerol, methoxy poly (ethylene glycol) -ditetradecylamine, poly (ethylene glycol) -phosphatidylethanolamine, and PEG-succinate-diacylglycerol. In one embodiment, the pharmaceutical composition includes i) the ionizable cationic lipid is any one or more selected from the group consisting of: ( (4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (2-hexyldecanoate) , 1-octylnonyl 8- [ (2-hydroxyethyl) [6-O-6- (undecanyloxy) hexyl] amino] -octoate, (dilinoleyl) methyl 4- (N, N-dimethylamino) butyrate, 1, 2-dioleyloxy-3-dimethylaminopropane, 1, 1'- ( (2- (4- (2- ( (2- (bis (2-hydroxydodecanyl) amino) ethyl) (2-hydroxydodecanyl) amino) ethyl) piperazin-1-yl) ethyl) azanediyl) bis (dodecan-2-ol) , and 1, 2-dilinoleyloxy-3-dimethylamino propane, iii) the sterol is cholesterol or its naturally occurring derivative, iv) the PEGylated lipid is any one or more selected from the group consisting of: methoxy poly (ethylene glycol) ditetradecylacetamide, 1- (monomethoxy-polyethylene glycol) -2, 3-dimyristoyl-sn-glycerol, poly (ethylene glycol) -distearoylphosphatidylethanolamine, poly (ethylene glycol) -distearoyl-sn-glycero-3-phosphocoline, poly (ethylene glycol) -diacylglycerol, methoxy poly (ethylene glycol) -ditetradecylamine, poly (ethylene glycol) -phosphatidylethanolamine, and PEG-succinate-diacylglycerol. In one embodiment, the pharmaceutical composition includes ii) the neutral lipid is any one or more selected from the group consisting of: 1, 2-distearoyl-sn-glycero-3-phosphorylcholine, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine, and  dipalmitoylphosphatidylcholine, iii) the sterol is cholesterol or its naturally occurring derivative, iv) the PEGylated lipid is any one or more selected from the group consisting of: methoxy poly (ethylene glycol) ditetradecylacetamide, 1- (monomethoxy-polyethylene glycol) -2 ,3-dimyristoyl-sn-glycerol, poly (ethylene glycol) -distearoylphosphatidylethanolamine, poly (ethylene glycol) -distearoyl-sn-glycero-3-phosphocoline, poly (ethylene glycol) -diacylglycerol, methoxy poly (ethylene glycol) -ditetradecylamine, poly (ethylene glycol) -phosphatidylethanolamine, and PEG-succinate-diacylglycerol. In one embodiment, the pharmaceutical composition includes i) the ionizable cationic lipid is any one or more selected from the group consisting of: ( (4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (2-hexyldecanoate) , 1-octylnonyl 8- [ (2-hydroxyethyl) [6-O-6- (undecanyloxy) hexyl] amino] -octoate, (dilinoleyl) methyl 4- (N, N-dimethylamino) butyrate, 1, 2-dioleyloxy-3-dimethylaminopropane, 1, 1'- ( (2- (4- (2- ( (2- (bis (2-hydroxydodecanyl) amino) ethyl) (2-hydroxydodecanyl) amino) ethyl) piperazin-1-yl) ethyl) azanediyl) bis (dodecan-2-ol) , and 1, 2-dilinoleyloxy-3-dimethylamino propane, ii) the neutral lipid is any one or more selected from the group consisting of: 1, 2-distearoyl-sn-glycero-3-phosphorylcholine, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine, and dipalmitoylphosphatidylcholine, iii) the sterol is cholesterol or its naturally occurring derivative, iv) the PEGylated lipid is any one or more selected from the group consisting of: methoxy poly (ethylene glycol) ditetradecylacetamide, 1- (monomethoxy-polyethylene glycol) -2, 3-dimyristoyl-sn-glycerol, poly (ethylene glycol) -distearoylphosphatidylethanolamine, poly (ethylene glycol) -distearoyl-sn-glycero-3-phosphocoline, poly (ethylene glycol) -diacylglycerol, methoxy poly (ethylene glycol) -ditetradecylamine, poly (ethylene glycol) -phosphatidylethanolamine, and PEG-succinate-diacylglycerol.

[0029] In some embodiments of the pharmaceutical composition of the disclosure, the ionizable cationic lipid is ( (4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (2-hexyldecanoate) , the neutral lipid is 1, 2-distearoyl-sn-glycero-3-phosphorylcholine, the sterol is cholesterol; and the PEGylated lipid is methoxy poly (ethylene glycol) ditetradecylacetamide.

[0030] In one aspect, the disclosure provides a method, the method comprising administering to a subject a pharmaceutical composition of the disclosure in an amount effective to induce an  immune response against RSV infection in the subject. In some embodiments of the method of the disclosure, the subject is human. In some embodiments of the method of the disclosure, the immune response elicits neutralizing antibodies in the subject. In some embodiments of the method of the disclosure, the pharmaceutical produces an RSV F protein in pre-fusion conformation in the subject.

[0031] The present application provides an mRNA, which comprises an mRNA of an RSV pre-F protein variant. The RSV pre-F protein variant is any one selected from: (a) a protein having the following mutations compared with the wild-type RSV F protein: S46G, E92D, P102A, deletion of N104-V144 and insertion of GS, A149C, S155C, S190F, V207L, S215P, S290C, L373R, I379V, M447V, Y458C, K465Q, and deletion of C550-N574, and having the functions of RSV pre-F protein, where the wild-type RSV F protein has an amino acid sequence as shown in SEQ ID NO. 8; and (b) a protein having 80%-90%sequence homology to the wild-type RSV F protein, having 90%or higher sequence homology to the variant in (a) , and having the functions of RSV pre-F protein.

[0032] The present application further provides an RSV pre-F protein variant, which is any one selected from: (a) a protein having the following mutations compared with the wild-type RSV F protein: S46G, E92D, P102A, deletion of N104-V144 and insertion of GS, A149C, S155C, S190F, V207L, S215P, S290C, L373R, I379V, M447V, Y458C, K465Q, and deletion of C550-N574, and having the functions of RSV pre-F protein, where the wild-type RSV F protein has an amino acid sequence as shown in SEQ ID NO. 8; and (b) a protein having 80%-90%sequence homology to the wild-type RSV F protein, having 90%or higher sequence homology to the variant in (a) , and having the functions of RSV pre-F protein.

[0033] The present application further provides a biological composition, which is any one selected from: (a) a polynucleotide encoding the RSV pre-F protein variant according to embodiment 6 or 7; (b) a nucleic acid construct comprising the polynucleotide in (a) ; and (c) a host cell comprising the nucleic acid construct in (b) or having the polynucleotide in (a) integrated in the genome.

[0034] The present application further provides a lipid nanoparticle-mRNA complex. The lipid nanoparticle-mRNA complex comprises the mRNA as described above and lipid nanoparticles,  where the mRNA is loaded in the lipid nanoparticles.

[0035] The present application further provides use of the mRNA or the lipid nanoparticle-mRNA complex in the preparation of drugs for treating respiratory diseases or the preparation of RSV pre-F protein variants. In some embodiments, the respiratory diseases are caused by RSV viruses.

[0036] The present application further provides use of the mRNA, the RSV pre-F protein variant, the biological composition or the lipid nanoparticle-mRNA complex in the preparation of drugs. Preferably, the drugs are vaccines, more preferably, the vaccines are used for preventing respiratory diseases, and further preferably, the respiratory diseases are caused by RSV viruses.

[0037] The present application further provides a pharmaceutical composition, which comprises an effective amount of the mRNA, the RSV pre-F protein variant, the biological composition, or the lipid nanoparticle-mRNA complex.

[0038] The beneficial effects of the mRNA vaccine proposed in this specification include, but are not limited to: (1) The mRNA sequence provided in the present application adopts a self-developed 5'UTR / 3'UTR sequence and codon optimization mode, to realize efficient translation of the target protein. (2) To induce a high level of neutralizing antibody, this mRNA vaccine expresses an RSV F protein that is used as an antigen, where the sequence of the protein is optimized, so that stable RSV pre-F protein is expressed. After mice are immunized, the mRNA vaccine induces the production of high-level RSV F protein-specific binding antibody titer and neutralizing antibody titer in mice.BRIEF DESCRIPTION OF THE DRAWINGS

[0039] The present application will be further illustrated by way of exemplary embodiments that will be described in detail with reference to the attached drawings. These embodiments are not limiting. In the drawings:

[0040] Fig. 1A schematically shows the plasmid pNR-RSV-F map according to some embodiments of the present application.

[0041] Fig. 1B schematically shows the preparation of an mRNA according to some embodiments of the present application.

[0042] Fig. 2 shows an agarose gel electrophoretogram for detecting a linearized plasmid according to some embodiments of the present application, where the circular plasmid pNR-2 (Lane 1) or pNR-3 (Lane 3) and the product pNR-2-BsaI (Lane 2) or pNR-3-BsaI (Lane 4) recovered after linearization by enzymatic digestion with BsaI are analyzed by agarose gel electrophoresis, in which M1: M1: DNA molecular weight standard: 1kb DNA ladder III (Novoprotein) , and M2: DNA molecular weight standard: Trans15k DNA Marker (TransGen Biotech) .

[0043] Fig. 3A and Fig. 3B each shows a capillary electrophoretogram of a capped mRNA according to some embodiments of the present application.

[0044] Fig. 4A and Fig. 4B each shows the analysis result of the expression level of RSV F protein in cells according to some embodiments of the present application. 24 hrs after transfection ofHEK-293T cells with mRNAs encoding different RSV F protein variant sequences, the expression of RSV F protein in different samples was detected by western blot, where no mRNA was transfected in the Mock group, andα-Tubulin was used as an internal reference protein.

[0045] Fig. 5 shows the analysis result of the expression level of RSV pre-F protein on the cell membrane according to some embodiments of the present application. 72 hrs after transfection of HEK-293T cells with mRNAs encoding different RSV F protein variant sequences, the expression level of pre-F protein on the cell membrane in different samples was analyzed by flow cytometry using D25 antibody, where no mRNA was transfected in the Mock group.

[0046] Fig. 6 shows the detection results of specific IgG binding antibody titers against RSV F protein in mouse serum after mice were immunized with a candidate mRNA vaccine according to some embodiments of the present application, in which PBS: PBS immunization group, NR-2: LNP-NR-2 immunization group, NR-3: LNP-NR-3 immunization group, and MOD: LNP-MOD immunization group.

[0047] Fig. 7 shows the detection results of neutralizing antibody titers against RSV A2 virus in mouse serum after mice were immunized with a candidate mRNA vaccine according to some embodiments of the present application, in which PBS: PBS immunization group, NR-2: LNP-NR-2 immunization group, and NR-3: LNP-NR-3 immunization group, and MOD: LNP-MOD  immunization group;

[0048] Fig. 8 shows the effect of 5'UTR sequence (5'UTR-3) used in the present application on the expression level of CoV-2 spike protein (CoV-2 S) . 24 hrs after HEK-293T cells were transfected with no mRNA (mock) or with S protein expressing mRNAs containing different 5’-UTR sequence (5’ UTR-BNT (BNT162b2 (Comirnaty) 5’ UTR) , 5’ UTR-1, 5’ UTR-2, 5’ UTR-3 and 5’ UTR-4) , the cells were lysed, and the expression levels of S protein and internal reference proteinα-tubulin were detected by western blot.

[0049] Fig. 9 shows the effect of 3'-UTR sequence (3'UTR-4) used in the present application on the expression level of CoV-2 spike protein (CoV-2 S) . 24 hrs after HEK-293T cells were transfected with no mRNA (mock) or with S protein expressing mRNAs containing different 3’-UTR sequence (3’ UTR-BNT (BNT162b2 (Comirnaty) 3’ UTR) , 3’ UTR-2 and 3’ UTR-4) , the cells were lysed, and the expression levels of S protein and internal reference proteinα-tubulin were detected by western blot.DETAILED DESCRIPTION

[0050] To describe the technical solutions in the embodiments of the present application more clearly, the drawings in the description of the embodiments will be described briefly below. The drawings in the following description show some embodiments of the present application. Other similar scenarios where the present application is applicable can be obtained by a person of ordinary skill in the art from these accompanying drawings without creative efforts. Unless it is obvious from the context or otherwise stated, the same reference numerals in the drawings represent the same structure or operation.

[0051] As shown in the specification and claims, unless otherwise explicitly indicated, the words "a" , "an" , and / or "the" do not necessarily refer to the singular form, but may also include plural referents. Generally, the terms "including" and "containing" only imply the inclusion of clearly identified steps and elements, but these steps and elements do not constitute an exclusive list, and a method or device may also include other steps or elements.

[0052] Flowcharts are used in this specification to explain the operations performed by the system according to the embodiment of this specification. It should be understood that the  preceding or following operations are not necessarily performed accurately in order. Instead, the steps can be performed in a reverse order or simultaneously. Moreover, other operations can be added to these processes, or one or more steps can be removed from these processes.

[0053] The present application provides an mRNA, which comprises an mRNA of an RSV pre-F protein variant. The RSV pre-F protein variant is any one selected from: (a) a protein having the following mutations compared with the wild-type RSV F protein: S46G, E92D, P102A, deletion of N104-V144 and insertion of GS, A149C, S155C, S190F, V207L, S215P, S290C, L373R, I379V, M447V, Y458C, K465Q, and deletion of C550-N574, and having the functions of RSV pre-F protein, where the wild-type RSV F protein has an amino acid sequence as shown in SEQ ID NO. 8; and (b) a protein having 80%-90%sequence homology to the wild-type RSV F protein, having 90%or higher sequence homology to the variant in (a) , and having the functions of RSV pre-F protein.

[0054] “Sequence” herein should generally be understood as including both related amino acid sequences and nucleic acid sequences or nucleotide sequences encoding the amino acid sequences, unless otherwise specifically defined herein.

[0055] “Homology” between two amino acid sequences or nucleotide sequences indicates the percentage of the same amino acid or nucleotide between sequences. Methods for evaluating the degree of homology between amino acid or nucleotide sequences are known to those skilled in the art. For example, the homology of amino acid sequences is usually determined by using sequence analysis sof tware. For example, the homology can be determined using the BLAST program of the NCBI database.

[0056] As used herein, the term “wild type” refers to the phenotype that typically occurs in nature, for example, naturally occurring genes, proteins, fungal cells, or strains.

[0057] In some embodiments, the mutations of the RSV pre-F protein variant compared with the wild-type RSV F protein further include deletion of C550-N574 and insertion of QPRFAAA.

[0058] In some embodiments, the amino acid sequence of the RSV pre-F protein variant is as shown in SEQ ID NO. 9 or SEQ ID NO. 13. In some embodiments, preferably, the amino acid sequence of the RSV pre-F protein variant is as shown in SEQ ID NO. 9. In some embodiments, the RSV pre-F protein variant has 86.1%homology to the wild type RSV F protein.

[0059] In some embodiments, the mRNA may include an RNA sequence corresponding to the nucleotide sequence as shown in SEQ ID NO. 4 or SEQ ID NO. 11. In some embodiments, preferably, the mRNA may include an RNA sequence corresponding to the nucleotide sequence as shown in SEQ ID NO. 4.

[0060] In the specification of the present application, the RNA sequences are all represented by corresponding DNA sequences, and in the RNA sequences, uridine is N1-methyl-pseudouridine (m1ψ) .

[0061] It is known to those skilled in the art that stabilized nucleic acids usually show a resistance to degradation in vivo (e.g., degradation by exonucleases or endonucleases) and / or degradation in vitro (for example, caused by the manufacturing process before administration of the vaccines, for example, during the preparation of the vaccine solution to be administered) .

[0062] In order to obtain a stabilized mRNA, in some embodiments, the mRNA further includes a 5'untranslated region. In some embodiments, the 5'untranslated region is a commonly used or known sequence. To obtain better protein expression, in a preferred embodiment, the nucleotide sequence corresponding to the 5' untranslated region shown in SEQ ID NO. 3 is used.

[0063] The term "5' untranslated region" or "5' UTR element" refers to a part located at 5' (i.e. "upstream" ) of the coding sequence that is not translated into a protein. Generally, 5'-UTR is understood as a specific part of the messenger RNA (mRNA) , which is located at the 5' end of the mRNA coding sequence. Generally, 5'-UTR starts from the transcription start site and ends one nucleotide before the start codon of the coding sequence. 5'-UTR may contain an element for controlling the gene expression, also called regulatory element. Such a regulatory element may be, for example, a ribosome binding site.

[0064] In order to obtain a stabilized mRNA, in some embodiments, the mRNA further includes a 3' untranslated region. In some embodiments, the 3' untranslated region is a commonly used or known sequence. To obtain better protein expression, in a preferred embodiment, the nucleotide sequence corresponding to the 3' untranslated region shown in SEQ ID NO. 5 is used.

[0065] The term "3' untranslated region" or "3' UTR element" refers to a part located at 3' (i.e. "downstream" ) of the coding sequence that is generally not translated into a protein. Generally, 3'-UTR is a part of mRNA, which is located between a coding sequence of mRNA and a  polyadenylic acid (poly (A) ) sequence.

[0066] In some embodiments, the mRNA may also include a polyadenylic acid sequence consisting of 50-200 adenosine residues. In some embodiments, preferably, the polyadenylic acid sequence is as shown in SEQ ID NO. 6.

[0067] In some embodiments, the sequence corresponding to the mRNA may include a nucleotide sequence as shown in SEQ ID NO. 10 or SEQ ID NO. 12. In some embodiments, preferably, the sequence corresponding to the mRNA may include a nucleotide sequence as shown in SEQ ID NO. 10. In some embodiments, preferably, the mRNA may further include a 5’-cap structure. In some embodiments, more preferably, the 5’-cap structure may be m7G (5') ppp (5') (2'-OMeA) p.

[0068] The term "5'-cap structure" refers to a special structure at the 5' end of mRNA, which is also known as methyl guanosine cap, and can improve the stability of mRNA and enhance the translation efficiency. In some embodiments, the 5'-cap structure is obtained by co-transcriptional capping by adding a cap analog in the in vitro transcription of mRNA, and preferred 5'-cap analog is m7G (5') ppp (5') (2'-OMeA) pG. In some embodiments, the 5’-cap structure is obtained by post-transcriptional capping using capping enzymes after the transcription of mRNA, and the commonly used capping enzymes include vaccinia capping enzyme and 2'-O-methyltransferase.

[0069] In some embodiments, the mRNA comprises a chemically modified nucleotide, to reduce the immunogenicity of the mRNA vaccine, enhance the stability of the mRNA, and improve the expression of the encoded protein. The chemically modified nucleotide may be: N1-methyl-pseudouridine (m1ψ) , pseudouridine (ψ) , 5-methoxyuridine (5moU) or 5-methylcytidine (m5C) . In some embodiments, preferably, uridines in the mRNA are all replaced by N1-methyl-pseudouridine (m1ψ) .

[0070] The present application further provides an RSV pre-F protein variant, which is any one selected from: (a) a protein having the following mutations compared with the wild-type RSV F protein: S46G, E92D, P102A, deletion of N104-V144 and insertion of GS, A149C, S155C, S190F, V207L, S215P, S290C, L373R, I379V, M447V, Y458C, K465Q, and deletion of C550-N574, and having the functions of RSV pre-F protein, where the wild-type RSV F protein has an  amino acid sequence as shown in SEQ ID NO. 8; and (b) a protein having 80%-90%sequence homology to the wild-type RSV F protein, having 90%or higher sequence homology to the variant in (a) , and having the functions of RSV pre-F protein.

[0071] In some embodiments, compared with the wild-type RSV F protein, the mutations further include deletion of C550-N574 and insertion of QPRFAAA.

[0072] In some embodiments, the amino acid sequence of the RSV pre-F protein variant is as shown in SEQ ID NO. 9 or SEQ ID NO. 13. In some embodiments, preferably, the amino acid sequence of the RSV pre-F protein variant is as shown in SEQ ID NO. 9. In some embodiments, the RSV pre-F protein variant has 86.1%homology to the wild type RSV F protein.

[0073] The present application further provides a biological composition, which is any one selected from: (a) a polynucleotide encoding the RSV pre-F protein variant according to embodiment 6 or 7; (b) a nucleic acid construct comprising the polynucleotide in (a) ; and (c) ahost cell comprising the nucleic acid construct in (b) or having the polynucleotide in (a) integrated in the genome.

[0074] Because of their inherent properties, such as electronegativity, nucleic acid drugs are prone to degradation by a nuclease, leading to inefficient penetration through the cell membrane and rapid degradation in the body. Therefore, a good delivery system is needed to deliver the nucleic acid drugs to the target site stably, so they can act on the target site effectively.

[0075] The present application further provides a lipid nanoparticle-mRNA complex. The lipid nanoparticle-mRNA complex comprises the mRNA as described above and lipid nanoparticles, where the mRNA is loaded in the lipid nanoparticles.

[0076] In some embodiments, the lipid nanoparticles comprises an ionizable cationic lipid, aneutral lipid, a sterol, and a PEGylated lipid.

[0077] In some embodiments, the molar ratio of the ionizable cationic lipid: neutral lipid: sterol: PEGylated lipid is (20-65) : (5-25) : (30-50) : (0.5-3) . In some embodiments, preferably, the molar ratio is 47.4: 10: 40.8: 1.8.

[0078] In some embodiments, the ionizable cationic lipid is any one or more selected from: ( (4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (2-hexyldecanoate) (ALC-0315) , 1-octylnonyl 8- [ (2-hydroxyethyl) [6-O-6- (undecanyloxy) hexyl] amino] -octoate (SM-102) , (dilinoleyl) methyl 4-  (N, N-dimethylamino) butyrate (Dlin-MC3-DMA) , 1, 2-dioleyloxy-3-dimethylaminopropane (DODMA) , 1, 1'- ( (2- (4- (2- ( (2- (bis (2-hydroxydodecanyl) amino) ethyl) (2-hydroxydodecanyl) amino) ethyl) piperazin-1-yl) ethyl) azanediyl) bis (dodecan-2-ol) (C12-200) , or 1, 2-dilinoleyloxy-3-dimethylamino propane (DLinDMA) . In some embodiments, preferably, the ionizable cationic lipid is ( (4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (2-hexyldecanoate) (ALC-0315) .

[0079] In some embodiments, the neutral lipid comprises any one or more selected from: 1, 2-distearoyl-sn-glycero-3-phosphorylcholine (DSPC) , 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) , and dipalmitoylphosphatidylcholine (DPPC) . In some embodiments, preferably, the neutral lipid is 1, 2-distearoyl-sn-glycero-3-phosphorylcholine (DSPC) .

[0080] In some embodiments, the sterol is cholesterol or its naturally occurring derivative, preferably cholesterol.

[0081] In some embodiments, the PEGylated lipid comprises any one or more selected from: methoxy poly (ethylene glycol) ditetradecylacetamide (ALC-0159) ,

[0082] 1‐ (monomethoxy‐polyethylene glycol) ‐2, 3‐dimyristoyl-sn-glycerol (PEG-DMG) , poly (ethylene glycol) -distearoylphosphatidylethanolamine (PEG-DSPE) , poly (ethylene glycol) -distearoyl-sn-glycero-3-phosphocoline (PEG-DSPC) , poly (ethylene glycol) -diacylglycerol (PEG-DAG) , methoxy poly (ethylene glycol) -ditetradecylamine (PEG-DTDA) , poly (ethylene glycol) -phosphatidylethanolamine (PEG-PE) , and PEG-succinate-diacylglycerol (PEG-S-DAG) . In some embodiments, preferably, the PEGylated lipid is methoxy poly (ethylene glycol) ditetradecylacetamide (ALC-0159) .

[0083] In some embodiments, in the lipid nanoparticle-mRNA complex, the weight ratio of the mRNA to the lipid nanoparticles is 1: 5 to 1: 50, and preferably 1: 10 to 1: 35.

[0084] In some embodiments, in the lipid nanoparticle-mRNA complex, the nitrogen-phosphorus ratio in the ionizable cationic lipid compound in the lipid nanoparticle and in the mRNA is 1: 1 to 12: 1, and more preferably 3: 1 to 9: 1.

[0085] In some embodiments, the particle diameter of the lipid nanoparticle-mRNA complex is 50 nm to 300 nm, and preferably 70 nm to 120 nm.

[0086] The present application further provides use of the mRNA, the RSV pre-F protein variant, the biological composition or the lipid nanoparticle-mRNA complex in the preparation of drugs. Preferably, the drugs are vaccines, more preferably, the vaccines are used for preventing respiratory diseases, and further preferably, the respiratory diseases are caused by RSV viruses. In some embodiments, “prevention” refers to a treatment given to subjects who have no signs of disease or have only early signs, to reduce the risk of pathological changes.

[0087] The present application further provides a pharmaceutical composition, which comprises an effective amount of the mRNA, the RSV pre-F protein variant, the biological material, or the lipid nanoparticle-mRNA complex of the present application.

[0088] The term "pharmaceutical composition" refers to a preparation in a form that allows the biological activity of the active ingredient contained therein to be effective, and do not contain other ingredients that would be unacceptably toxic to subjects to whom the composition would be administered.

[0089] The term "effective" means sufficient to achieve a desired, expected or wanted result.

[0090] When used in a context of preventing / treating a patient or a subject with a compound, "effective amount" , "therapeutically effective amount" or "pharmaceutically effective amount" means an amount of the compound that is sufficient to achieve the treatment of the disease when administered to the subject or patient to prevent / treat the disease.

[0091] In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

[0092] “Pharmaceutically acceptable carrier"refers to an ingredient other than the active ingredient in a pharmaceutical composition or preparation that is not toxic to the subject. The pharmaceutically acceptable carrier, includes, but is not limited to, a buffer, an excipient, astabilizer or a preservative. The pharmaceutically acceptable carrier can be a sterile liquid, such as water, saline solution, glucose solution in water, glycerol solution in water, and oil, including petroleum, those of animal, plant or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and so on.

[0093] In some embodiments, the pharmaceutical composition is a vaccine.

[0094] "Vaccine" refers to a pharmaceutical composition that generates a preventive or  therapeutic immune response in a subject. In some cases, the immune response is a protective immune response. Generally, the vaccine induces an antigen-specific immune response against an antigen of a pathogen (such as a viral pathogen) or a cellular component related to a pathological condition. The vaccine can comprise a polynucleotide (e.g., a nucleic acid encoding the disclosed RSV pre-F protein variant) , a peptides or polypeptide (e.g., the disclosed RSV pre-F protein variant) , a virus, a cell, or one or more cellular components.

[0095] The present application further provides a method for preventing / treating a respiratory disease. The method includes administering a preventively / therapeutically effective amount of the above-mentioned mRNA, RSV pre-F protein variant, lipid nanoparticle-mRNA complex, or pharmaceutical composition to an individual having the respiratory disease. In some embodiments, the respiratory diseases are caused by RSV viruses.

[0096] The term "effective amount" refers to an amount or dosage of the above-mentioned mRNA, RSV pre-F protein variant, lipid nanoparticle-mRNA complex or pharmaceutical composition of the present application, which, after being administered to an individual in single or multiple doses, produces an expected effect in the treated individual.

[0097] "Preventively / therapeutically effective amount" refers to an amount that effectively achieves a required preventive / therapeutic result at a required dosage and for a required time period. In the present application, the preventively / therapeutically effective amount of the mRNA, RSV pre-F protein variant, lipid nanoparticle-mRNA complex or pharmaceutical composition can vary according to various factors such as disease state, and the age, sex and weight of an individual. The preventively / therapeutically effective amount is also such an amount that any toxic or harmful effect of the above-mentioned mRNA, RSV pre-F protein variant, lipid nanoparticle-mRNA complex or pharmaceutical composition is less than the beneficial effect for prevention / treatment.

[0098] Unless otherwise stated, the experimental methods given in examples below are based on known methods used in the field. Unless otherwise stated, the reagents used in examples below are commercially available. For the quantitative experiments in the following examples, the results were averaged from three repeated experiments.

[0099] EXAMPLES

[0100] Example 1-Preparation of mRNA

[0101] mRNA was prepared by in vitro transcription (where N1-methyl-pseudouridine (m1ψ) was used to replace uridine in the transcription process) . The preparation process is shown in Fig. 1B.In the template plasmid used, pUC57-kan was used as a vector, and all the sequences needed for transcription of the mRNA sequence were inserted, including the following:

[0102] A suitable promoter, such as T7 or SP6 promoter, was used for in vitro transcription. A T7 promoter (SEQ ID NO. 2: TAATACGACTCACTATA) was used in the present example.

[0103] A 5’-cap structure was inserted. A cap structure could be added by an enzymatic reaction, or a cap analog (preferably m7G (5') ppp (5') (2'-OMeA) pG) could be added by co-transcription, and an enzymatic reaction was adopted in the present example.

[0104] A 5’ UTR element (SEQ ID NO. 3:

[0105] GGGTCCGGATTAACCCTGAGCTAAAGTAGCTTACCGCGCAAACCTGCGAGGACGGTT TACGGTGCTACGACCGCCCGCCACC) . The 5'UTR element used in this example has been optimized; it could increase the protein expression, which can be used in the preparation of proteins and mRNA vaccines. Particularly, in a protein expression level test, it was confirmed that after the use of the 5’ UTR, the expression of firefly luciferase and green fluorescent protein (Fluc-GFP) in eukaryotic HEK-293T cells was superior to that in the situation where the 5'UTR sequence (5'UTR-AG+G) of alpha globin reported in the existing literature (reference: Adv Mater. 2020 October; 32 (40) : e2004452. doi: 10.1002 / adma. 202004452) was used; and after the use of the 5’ UTR, the expression level of SARS-CoV-2 spike protein in eukaryotic HEK-293T cells was better than that in the situation where other randomly synthesized 5'UTR and BNT162b2 5'UTR were used (as shown in Fig. 8) . The purpose of using this 5'UTR in this example was also to improve the expression level of a downstream target protein.

[0106] Kozak sequence: translation initiation signal (GCCACCATG) .

[0107] Coding region: The coding region encodes the RSV F protein variant (NR-2 or NR-3) , which is a variant of RSV A2 F protein (Sequence Accession Number: P03420) ;

[0108] SEQ ID NO. 11 (sequence encoding RSV F protein variant NR-2) :

[0109] SEQ ID NO. 4 (sequence encoding RSV F protein variant NR-3) :

[0110] 3’ UTR element (SEQ ID NO. 5:

[0111] ATGTCTTAAGAACCTAATTAAATAGCTGACTACATTTTGTGTCTCTTTTTTTAATTTTTG GTTTT) . The 3'UTR element used in this example has been optimized; it can significantly increase the protein expression after being constructed downstream of firefly luciferase (Fluc) reporter gene, green fluorescent protein (GFP) gene or SARS-CoV-2 spike protein coding sequence, and it can be used in the molecular design of new mRNA drugs. Particularly, in a fluorescent expression test, it was confirmed that after the use of the 3’ UTR, the luciferase activity in eukaryotic HEK-293T was the highest, which was 1.5 times (3.29x106 / 2.20x106) that in HEK-293T cells transfected with positive control 3'UTR BNT. After the use of the 3’ UTR, the expression level ofCoV-2 spike protein in eukaryotic HEK-293T cells was higher than that in the situation where otherrandomly synthesized 3'UTR and BNT162b2 3'UTR were used (as shown in Fig. 9) . The purpose of using this 3'UTR in this example was also to improve the expression level of an upstream target protein.

[0112] Polyadenylic acid (poly (A) ) sequence (SEQ ID NO. 6: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA) .

[0113] Enzymatic cleavage site for linearization: Class II restriction sites, for example, BsaI and BspQI, were preferred. In the present example, BsaI restriction sites (GGTCTC) were used.

[0114] Plasmid pNR-RSV F containing the transcription region of RSV F protein variant: Plasmids pNR-2 (having a sequence of SEQ ID NO. 1 without positions 2060-2080) and pNR-3 (having a sequence ofSEQ ID NO. 1) were synthesizedby The mapping of plasmid pNR-RSV F was shown in Fig. 1A. The prepared circular plasmid was digested with BsaI (Novoprotein) (by incubation overnight at 37℃) , and then the digested product was purified by a  SV Gel and PCR Clean-Up System kit to obtain a linearized plasmid. The linearized plasmid was analyzed by 1%agarose gel electrophoresis. As shown in Fig. 2, the pNR -2 plasmid before digestion (Lane 1) and pNR-3 plasmid before digestion (Lane 3) are mainly in the configuration of supercoiled plasmids. After BsaI digestion, pNR-2-BsaI (Lane 2) and pNR-3 -BsaI (Lane 4) can be seen as single bands having consistent theoretical size of plasmids (4415  bp), indicating that almost all plasmids are linearized successfully.

[0115] SEQ ID NO. 1:

[0116] Using the linearized plasmid pNR-2-BsaI or pNR-3-BsaI as a template, the in-vitro transcription reaction was carried out according to the instruction of T7 High Yield RNA Transcription kit (Novoprotein, E131) , in which N1-methyl-pseudouridine (m1ψ) was used to replace uridine. The reaction was continued at 37℃for 3 hrs. After the reaction, DNase I (Novoprotein) was added for treatment at 37℃for 15 min to remove the residual DNA template. The transcript was purified by precipitation with lithium chloride to obtain an uncapped mRNA product: mRNA-NR-2 (SEQ ID NO. 12) or mRNA-NR-3 (SEQ ID NO. 10) . The specific steps  were as follows. Alithium chloride solution (7.5 M, Thermo Fisher AM9480) of 1.5 times the volume of the reaction product was added to the transcript, uniformly mixed, allowed to stand at-20℃for at least 30 min, and centrifuged at 12,000 rpm and 4℃for 15 min. The supernatant was removed, and the precipitate was collected. The precipitate was washed twice with pre-cooled 70%ethanol, and then dissolved in enzyme-free water.

[0117] SEQ ID NO. 12: (mRNA-NR-2)

[0118] SEQ ID NO. 10: (mRNA-NR-3)

[0119] A cap structure was added at 5’ of the above-mentioned mRNA product, mRNA-NR-2 (SEQ ID NO. 12) or mRNA-NR-3 (SEQ ID NO. 10) , before translation into the target protein. There are two main methods to add a cap structure to mRNA. One is to add cap analogs to the in vitro transcription reaction mix and a 5'cap structure is added during transcription. The other method is to cap the uncapped mRNA product by capping enzymes after the in vitro transcription reaction. The second capping method was used in this example. The specific steps were as follows. After the uncapped mRNA was purified by precipitation with lithium chloride, the capping reaction was carried out according to the instructions of the capping kit Cap 1 Capping System (Novoprotein) . The reaction was continued at 37℃for 1 hr. After the reaction, the capped product was purified by precipitation with lithium chloride or oligo dT affinity chromatography. The specific steps of purification by Oligo dT affinity chromatography were as follows:  Oligo dT18 (C12 Linker) 1 mL Monolithic Column (2μm) was washed with 0.1 M NaOH aqueous solution, then washed with ultrapure water and equilibrated with an equilibration buffer (50 mM PB, 250 mM NaCl, pH8.0) . Then the sample to be purified (capped product) was loaded onto the column, equilibrated with an equilibration buffer, and then washed  with a washing buffer (50 mM PB, pH 8.0) . The bound component was finally eluted with ultrapure water and collected (that is, the purified capped mRNA) .

[0120] To analyze the quality of the capped mRNA product, the integrity of RNA was analyzed by capillary electrophoresis technology, that is, the percentage of target RNA product in the total transcription product was analyzed by Qsep1 automatic nucleic acid / protein analysis system The specific method was as follows: The RNAproduct was diluted to 50-60 ng / μLwith 1 x Dilution Buffer heated at 70℃for 2 min, quickly transferred to ice and left thereon for 5 min, and then detected with R1 Cartridge The molecular weight of each peak in the test results was calibrated with RNA6000 molecular weight standard  Finally, the integrity data of the target RNAwas obtainedby analyzing the proportion of peaks that are consistent with the expected RNA molecular weight. The capped mRNA products, mRNA-NR-2 and mRNA-NR-3, were analyzed by capillary electrophoresis. The results show that the peak areas of the main peaks accounted for 93.1%and 92.2%, respectively, indicating that the mRNA had high integrity (Fig. 3A and 3B) .

[0121] Example 2. In vitro activity test of mRNA

[0122] To verify the ability of the mRNA expressing the RSV F protein variant in Example 1 to express the RSV pre-F protein, in this example we analyzed the expression level of RSV F protein in HEK-293T cells transfected with the mRNAs encoding the RSV F protein variants. In this example, 3 candidate RSV F protein variant sequences (NR-1, NR-2, and NR-3) , were compared, and the mRNA sequence (MOD) in PCT publication No. WO 2021 / 155243 A1 was used as the control. The mutation sites of different RSV F protein variant sequences compared with wild-type RSV F protein are shown in Table 1.

[0123] Table 1. Mutation sites of different RSV F protein variant sequences compared with wild-type RSV F protein

[0124] The mRNA sequences encoding NR-1, NR-2, and NR-3 protein sequences had the same 5’ UTR (SEQ ID NO. 3) , 3’ UTR (SEQ ID NO. 5) , and poly (A) sequences (SEQ ID NO. 6) ,utilizing the same codon optimization method. The mRNA sequence encoding the MOD sequence used was the same sequence as that in SEQ ID NO. 15 of PCT publication No. WO 2021 / 155243 A1 (also see SEQ ID NO. 15 of the Chinese Patent Application No. CN115103682A) . In this example, the sequence of NR-2 protein (SEQ ID NO. 13) or NR-3 protein (SEQ ID NO. 9) has 86.1%homology to the sequence of wild-type RSV F protein (A2, Sequence Accession Number: P03420) (SEQ ID NO. 8) . The mRNA sequence mRNA-NR-2 (SEQ ID NO. 12) encoding NR-2 has 77.4%homology to the mRNA sequence of the MOD sequence. The mRNA sequence mRNA-NR-3 (SEQ ID NO. 10) encoding NR-3 has 77.5%homology to the mRNA sequence of MOD.

[0125] SEQ ID NO. 8 (wild-type RSV A2 F protein sequence) :

[0126] SEQ ID NO. 13 (NR-2 RSV F protein variant sequence) :

[0127] SEQ ID NO. 9 (NR-3 RSV F protein variant sequence) :

[0128] In this example, the expression level of RSV F protein was detected by western blot. The specific method was as follows: HEK-293T cells adhered to the wall and grown into a dense monolayer were digested with trypsin to obtain a cell suspension, and inoculated into a 6-well plate at the density of 6 x 105cells per well. The cell culture medium is a high-glucose DMEM liquid medium containing 10%fetal bovine serum (Capricorn Scientific) , 1%penicillin-streptomycin 1%nonessential amino acids and 1%sodium pyruvate The percentages with respect to the culture medium are all percentages by volume. The next day, 300 ng of mRNA with different sequences was transfected into HEK-293T cells by MessengerMAXTM (Thermo Fisher ) . 24 hrs after cell transfection, the cells in the 6-well plate were rinsed with PBS, then 1 mL of PBS was added to each well, and the cells were collected into a 1.5 mL EP tube by a cell scraper. After centrifugation at 4000 rpm and 4℃for 5 min, the precipitate was collected. 100μL of a lysing buffer (1x protease inhibitor and 1%nuclease added to RIPA) was added to the precipitate, and it was lysed on ice for 15 min. After centrifugation at 13200 rpm and 4℃for 5 min, the supernatant was collected. 25μl of 5x SDS protein loading buffer (NCM Biotech) was added to 100μL of cell lysate in each tube, and then the system was heated in a metal bath at 100℃for 5 min. By using 4-12%SurePAGETM gel electrophoresis was performed at a constant voltage of 160V for40 min, and then constant-current transfer to a membrane was performed at 400 mA for 30 min. The membrane with transferred protein was blocked in a blocking buffer (5%milk) 1 hr at room temperature. The blocking buffer was discarded, and the protein was incubated with a primary antibody for 2 hrs at room temperature. The antibodies were RSV-F rabbit antibody (SinoBiological., 1: 200 diluted with the blocking solution) ; andα-Tubulin mouse antibody ( 1: 10000 diluted with the blocking solution) . The primary antibody was discarded, and the membrane was washed 3 times with TBST, for 5 min each time. Then, the protein was incubated with HRP-conjugated AffinipureTM Goat Anti-Rabbit IgG (H+L) or HRP-conjugated AffinipureTM Goat Anti-Mouse IgG (H+L) ( 1: 5000 diluted with the blocking buffer) at normal temperature for 1 hr. The secondary antibody was discarded, and  the membrane was washed 5 times with TBST, for 5 min each time. The high-sensitivity ECL chemiluminescence substrate (NCM Biotech) was 1: 1 mixed, dropped on the membrane and allowed for reaction for 1 min. The membrane was placed in a 4600SF chemiluminescence image analysis system (Tanon) for imaging.

[0129] The result is shown in Fig. 4A and 4B. The expression of RSV F protein was not detected in the negative control Mock group (HEK-293T cells without mRNA transfection) . The expression of F protein consistent with the predicted size was detected in all cells transfected with the mRNA encoding RSV F protein variant. NR-1 group had the lowest protein expression, while NR-2 and NR-3 groups had the high protein expression.

[0130] To further analyze the expression level of RSV pre-F protein on the cell membrane after transfection with different mRNAs, D25 antibody (an antibody that recognizes the specific epitope of pre F, that is, an antibody specific to RSV pre-F protein) was used to analyze the expression level of pre-F protein on the cell membrane by flow cytometry after transfection with mRNAs of different RSV F protein variants. The specific method was as follows: HEK-293T cells adhered to the wall and grown into a dense monolayer were digested with trypsin to obtain a cell suspension, and inoculated into a 24-well plate at the density of 1.5 x 105cells per well. The next day, 300 ng of mRNA with different sequences was transfected into HEK-293T cells by MessengerMAXTM (Thermo Fisher ) . 72 hrs after transfection, the HEK-293T cells were rinsed with PBS, then digested with 200μL of Trypsin and incubated at 37℃ for 2 min. The dissociated cells were neutralized with 200μL of complete medium to remove Trypsin, and centrifuged at 1000 rpm for 5 min. The supernatant was discarded. The cells were re-suspended in 500μL of complete medium. 60μL was transferred into a new 1.5 mL EP tube. 1.33μL ofD25 antibody was added, and incubated at 4℃for 30 min. After centrifugation at 1500 rpm for 5min, the supernatant was discarded, and then the cells were washed twice with 500μL of PBS. 100μL of secondary antibody PE (1: 200, Jackson) was added, and incubated at 4℃in the dark for 30 min. After centrifugation at 1500 rpm for 5min, the supernatant was discarded, and then the cells were washed once with PBS. 200μL of PBS was added, and the cells were harvested on 2000R flow cytometer under conditions including: PE channel, the number of cells  collected: 10000 cells, volume: 50μL, and sample flow rate: medium.

[0131] The results are shown in Table 2 and Fig. 5. The expression of RSV F protein was hardly detected on the cell membrane surface ofHEK-293T cells (Mock group) which were not transfected with mRNA, while the expression of RSV pre-F protein was detected on cells transfected with mRNA encoding RSV F protein variant. The expression of pre-F in NR-1 group was the lowest and the most unstable. The expression of pre-F in NR-2 and NR-3 groups was high and stable.

[0132] Table 2. Analysis result of the expression level of RSV pre-F protein on the cell membrane after transfection with different mRNAs

[0133] Therefore, the mRNAs of NR-2 and NR-3 sequences have strong ability to express RSV pre-F protein, and are expected to be candidate sequences for RSV vaccines.

[0134] Example 3. Preparation of lipid nanoparticle and trait characterization

[0135] To prevent the degradation of mRNA and deliver it to animals effectively, lipid nanoparticles (LNPs) are often used as a carrier. The specific steps of preparing LNPs in the present example were as follows:

[0136] Preparation of aqueous phase: The capped mRNA product was diluted in 25 mM citric acid buffer to give a final concentration of 100 ng / μL.

[0137] Preparation of organic phase: Various lipid components (ionizable cationic lipid, DSPC, cholesterol, PEGylated lipid) were dissolved in ethanol according to the molar ratio shown in Table 3.

[0138] The aqueous solution and organic solution were respectively filled in a BD syringe, and the two syringes were connected to a chip of a nano-drug preparation system. An appropriate volume of injection of the sample, flow rate of sample injection (6 mL / min) , flow rate ratio of the aqueous phase to the organic phase (3: 1) , and the liquids were injected into the chip. The product color at the chip outlet was observed, an appropriate amount of milky white droplets at the front and rear ends were removed, and the sample in the middle section was collected into an EP tube. The collected product was transferred to a dialysis bag (molecular weight cut-off: 10 KDa) and dialyzed in Tris buffer for 24 hrs. The lipid nanoparticles were centrifugally concentrated in an ultrafiltration centrifugal tube. Then a sucrose solution was added for aseptic filtration to prepare a finished product. See Table 3 for the specific composition of mRNA-LNP.

[0139] Table 3. Composition of mRNA-LNP

[0140] The particle size and polydispersity index (PDI) were detected by a standard detection method on the instrument from Malvern The encapsulation rate and content of the finished product were tested and calculated according to the instructions of the kit. The mRNA in lipid nanoparticles was extracted with isopropanol, and the mRNA integrity was analyzed by a standard detection method on the Qsep1 instrument

[0141] The detection results of particle size, PDI, encapsulation rate, and mRNA integrity of mRNA-loaded lipid nanoparticles (LNP) prepared in this example are shown in Table 4.

[0142] Table 4. Characterization results of mRNA-LNP

[0143] Example 4. Study on immunogenicity in mice

[0144] Lipid nanoparticles LNP-NR-2 or LNP-NR-3 containing candidate mRNA prepared in Example 3 or the control LNP-MOD were intramuscularly (IM) injected to immunize BALB / C mice (18-24 g, female) . In each group, n=8. Each mouse was immunized with 50μL of lipid nanoparticles (containing 1μg mRNA) , and the mice in the negative control group were immunized with PBS. The mice were immunized twice (on days 0 and 21) . The mouse serum was collected 14 days after the second immunization (that is, on the 35th day after the first administration) .

[0145] The antibody titers for antibodies specifically binding to RSV F protein in mouse serum were determined by enzyme-linked immunosorbent assay (ELISA) . The specific steps were as follows. 100μL of RSV F protein (Sino Biotech, article number: 11049-V08B) with a concentration of 1μg / mL was added to a 96-well plate, and coated overnight at 4℃. After coating, the protein was washed three times with PBS (PBST) containing 0.05%Tween-20.250 μL of PBST containing 5%skimmed milk was added to each well, and blocked at 37℃for 1 hr. After washing, 100μL of serially diluted mouse serum was added to each well, and incubated at 37℃for 1 hr, where duplicate wells were set for each dilution gradient. After washing, 100μl of goat anti-mouse secondary antibody (Southern Biotechnology, article number: 1036-05) , labeled with HRP was added to each well, and incubated at 37℃for 1 hr. After washing, 100μl of TMB developing solution ( article number: 00-2023) was addedto each well, and the development was performed at room temperature for 15 min. 50μL of terminating solution (NCM Biotech, E40500) was added to each well to terminate the development, and the absorbance at OD450nm was read on a microplate reader.

[0146] Calculation method: If the OD450 of the well to be tested is>0.1 and is over 2.1 times that of the negative control well (P / N>2.1, where P is the OD value of the serum to be tested at a certain dilution fold, and N is the OD value of the negative serum at the corresponding  dilution fold) , a positive result is determined. The highest dilution fold of the serum determined as positive is the antibody titer in serum.

[0147] As shown in FIG. 6, after immunization of the mice, the candidate mRNA vaccine (NR-2 or NR-3) can induce a higher titer of RSV F protein-specific IgG binding antibody, which is slightly better than the control mRNA vaccine (MOD) immunization group.

[0148] RSV-specific neutralizing antibody in mouse serum was determined by a micro neutralizing antibody detection method. The specific steps were as follows. Before the start of the experiment, the serum sample to be tested was inactivated at 56℃ for 30 min. Then, the sample was serially diluted with the culture medium. The serum in the PBS group was 3-fold diluted from 1: 10 dilution, and the highest dilution was 2430. The NR-2 group, NR-3 group, and MOD group was each 3-fold diluted from 1: 100 dilution, and the highest dilution was 24300. The diluted sample was mixed with 400 TCID50 / mL virus (RSV A2) and incubated at 37℃ and 5%CO2 for 1 hr. Then Hep-2 cells were inoculated into the test well at a certain density (2.5 x 104 cells / well) . A cell control group (cells without virus infection) and a virus control group (cells infected with virus, without other treatment) were also set. The cells were cultured at 37℃and 5%CO2 for 5 days. The cell culture supernatant was discarded. The cells were immobilized. Then the plate was blocked with 5%BSA at room temperature for 1 hr, and then washed 3 times with TBST solution. After washing the plate, a primary antibody solution (RSV-F antibody (SinoBiological., 1: 5000 diluted with TBST) ) was added and incubated at 37℃ for 1 hr. The plate was washed 3 times with TBST solution. A secondary antibody solution (HRP-labeled IgG antibody, 1: 2000 diluted with TBST) ) was added, and incubated at 37℃ for 1 hr. The plate was washed 3 times with TBST solution. ATMB substrate was added and left at room temperature for 10 min. After the incubation, the absorbance was read at 450 nm on a microplate reader. The raw data was used to calculate the neutralization activity of the samples at various concentrations. The maximum dilution fold at which the antibody showed an antiviral activity of >50%was taken as the neutralization titer.

[0149] Y=100- (a-c)  /  (b-c) *100, in which: Y=%antibody activity; a=absorbance at OD450 of the sample; b=absorbance at OD450 of virus control group; and c=absorbance at OD450 of cell control group.

[0150] As shown in FIG. 7, after immunization of the mice, the candidate mRNA vaccine (NR-2 or NR-3) induced a higher titer of RSV neutralizing antibody that was better than the control mRNA vaccine (MOD) immunization group.

[0151] The basic concepts have been described above. For those skilled in the art, the above detailed disclosure is merely illustrative, and does not constitute a limitation of this specification. Although it is not explicitly stated here, various modifications, improvements and changes can be made to this specification by those skilled in the art. Such modifications, improvements and changes are suggested in this specification, so they still fall within the spirit and scope of the exemplary embodiments of this specification.

[0152] Moreover, specific words are used in this specification to describe the embodiments of this specification. For example, "one embodiment" , "an embodiment" and / or "some embodiments" mean a certain feature, structure or characteristic related to at least one embodiment of this specification. Therefore, two or more references to "an embodiment" , "one embodiment" or "an alternative embodiment" in different places in this specification do not necessarily refer to the same embodiment. Furthermore, some features, structures or characteristics in one or more embodiments of this specification can be combined appropriately.

[0153] In some embodiments, numbers describing the amount of ingredients and attributes are used. It should be understood that such numbers used in the description of embodiments are modified by the modifiers "about" , "approximately" or "substantially" in some examples. Unless otherwise specified, "about" , "approximately" or "substantially" means that the number allows a variation of up to plus or minus 20%. Correspondingly, in some embodiments, the numerical parameters used in the specification and claims are approximations, which can be changed according to the required characteristics of individual embodiments. In some embodiments, for the numerical parameters, the specified significant digits need to be considered and the method of general digit reservation is used. Although the numerical ranges and parameters used to confirm the range and width in some embodiments of this specification are approximations, in a specific embodiment, such numerical values are set as accurately as possible within a feasible range.

[0154] Finally, it should be understood that the embodiments described in this  specification are only used to illustrate the principles of the embodiments in this specification. Other variations may also fall within the scope of this specification. Therefore, by way of examples without limitation, alternative configurations of embodiments of this specification can be regarded to be consistent with the teachings of this specification. Correspondingly, the embodiments in this specification are not limited to those explicitly introduced and described in this specification.

[0155] NUMBERED EMBODIMENTS

[0156] 1. An mRNA, comprising an mRNA encoding a respiratory syncytial virus F protein variant in pre-fusion conformation (RSV pre-F) , wherein the RSV pre-F protein variant is any one selected from:

[0157] a. a protein having the following mutations compared with the wild-type RSV F protein: S46G, E92D, P102A, deletion of N104-V144 and insertion of GS, A149C, S155C, S190F, V207L, S215P, S290C, L373R, I379V, M447V, Y458C, K465Q, and deletion of C550-N574, and having the functions of RSV pre-F protein, where the wild-type RSV F protein has an amino acid sequence as shown in SEQ ID NO. 8;

[0158] b. a protein having 80%-90%sequence homology to the wild-type RSV F protein, having 90%or higher sequence homology to the variant in a, and having the functions of RSV pre-F protein.

[0159] 2. The mRNA according to embodiment 1, wherein the mutations of the RSV pre-F protein variant compared with the wild-type RSV F protein further comprise deletion of C550-N574 and insertion of QPRFAAA;

[0160] and / or, the amino acid sequence of the RSV pre-F protein variant is as shown in SEQ ID NO. 9 or SEQ ID NO. 13;

[0161] and / or, the RSV pre-F protein variant has 86.1%homology to wild type RSV F protein.

[0162] 3. The mRNA according to embodiment 1, wherein the mRNA comprises an RNA sequence corresponding to the nucleotide sequence as shown in SEQ ID NO. 4 or SEQ ID NO. 11.

[0163] 4. The mRNA according to embodiment 1, the mRNA further comprising a 5' untranslated region, wherein preferably, the nucleotide sequence corresponding to the 5’ untranslated region is as shown in SEQ ID NO. 3;

[0164] and / or, the mRNA further comprising a 3' untranslated region, wherein preferably, the nucleotide sequence corresponding to the 3’ untranslated region is as shown in SEQ ID NO. 5;

[0165] and / or, the mRNA further comprising a polyadenylic acid sequence, wherein preferably, the polyadenylic acid sequence is as shown in SEQ ID NO. 6;

[0166] and / or, the mRNA further comprising a 5’-cap structure, wherein preferably, the 5’-cap structure is added by capping enzymes or the 5’-cap structure is m7G (5') ppp (5') (2'-OMeA) p, and more preferably, the capping enzymes are vaccinia capping enzyme and 2'-O-methyltransferase.

[0167] 5. The mRNA according to embodiment 1, wherein the sequence corresponding to the mRNA comprises a nucleotide sequence as shown in SEQ ID NO. 10 or SEQ ID NO. 12, preferably, the mRNA further comprising a 5’-cap structure, wherein more preferably, the 5’-cap structure is added by capping enzymes or the 5’-cap structure is m7G (5') ppp (5') (2'-OMeA) p, and further preferably, the capping enzymes are vaccinia capping enzyme and 2'-O-methyltransferase;

[0168] and / or, the mRNA further comprising a chemical modification, wherein preferably, uridines in the mRNA are all replaced by N1-methyl-pseudouridine (m1ψ) .

[0169] 6. A respiratory syncytial virus F protein variant in pre-fusion conformation (RSV pre-F) , which is any one selected from:

[0170] a. a protein having the following mutations compared with the wild-type RSV F protein: S46G, E92D, P102A, deletion of N104-V144 and insertion of GS, A149C, S155C, S190F, V207L, S215P, S290C, L373R, I379V, M447V, Y458C, K465Q, and deletion of C550-N574, and having the functions of RSV pre-F protein, where the wild-type RSV F protein has an amino acid sequence as shown in SEQ ID NO. 8;

[0171] b. a protein having 80%-90%sequence homology to the wild-type RSV F protein, having 90%or higher sequence homology to the variant in a, and having the functions of RSV pre-F protein.

[0172] 7. The RSV pre-F protein variant according to embodiment 6, wherein compared with the wild-type RSV F protein, the mutations further comprise deletion of C550-N574 and insertion of QPRFAAA;

[0173] and / or, the amino acid sequence of the RSV pre-F protein variant is as shown in SEQ ID  NO. 9 or SEQ ID NO. 13;

[0174] and / or, the RSV pre-F protein variant has 86.1%homology to wild type RSV F protein.

[0175] 8. A biological composition, comprising any one selected from:

[0176] a. a polynucleotide encoding the RSV pre-F protein variant according to embodiment 6 or 7;

[0177] b. a nucleic acid construct comprising the polynucleotide in a; and

[0178] c. a host cell comprising the nucleic acid construct in b or having the polynucleotide in a integrated in the genome.

[0179] 9. A lipid nanoparticle-mRNA complex, comprising the mRNA according to any one of embodiments 1 to 5 and lipid nanoparticles, wherein the mRNA is loaded in the lipid nanoparticles.

[0180] 10. The lipid nanoparticle-mRNA complex according to embodiment 9, wherein the raw material of the lipid nanoparticles comprises an ionizable cationic lipid, a neutral lipid, a sterol, and a PEGylated lipid.

[0181] 11. The lipid nanoparticle-mRNA complex according to embodiment 10, wherein

[0182] in the lipid nanoparticle-mRNA complex, the weight ratio of the mRNA to the lipid nanoparticles is 1: 5 to 1: 50, and preferably 1: 10 to 1: 35;

[0183] and / or, the molar ratio of the ionizable cationic lipid: neutral lipid: sterol: PEGylated lipid is (20-65) : (5-25) : (30-50) : (0.5-3) , and preferably, the molar ratio of the ionizable cationic lipid: neutral lipid: sterol: PEGylated lipid is 47.4: 10: 40.8: 1.8;

[0184] and / or, the ionizable cationic lipid is any one or more selected from: ( (4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (2-hexyldecanoate) , 1-octylnonyl 8- [ (2-hydroxyethyl) [6-O-6- (undecanyloxy) hexyl] amino] -octoate, (dilinoleyl) methyl 4- (N, N-dimethylamino) butyrate, 1, 2-dioleyloxy-3-dimethylaminopropane, 1, 1'- ( (2- (4- (2- ( (2- (bis (2-hydroxydodecanyl) amino) ethyl) (2-hydroxydodecanyl) amino) ethyl) piperazin-1-yl) ethyl) azanediyl) bis (dodecan-2-ol) , or 1, 2-dilinoleyloxy-3-dimethylamino propane, and preferably, the ionizable cationic lipid is ( (4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (2-hexyldecanoate) ;

[0185] and / or, the neutral lipid is any one or more selected from: 1, 2-distearoyl-sn-glycero-3-phosphorylcholine, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine, and  dipalmitoylphosphatidylcholine, and preferably, the neutral lipid is 1, 2-distearoyl-sn-glycero-3-phosphorylcholine;

[0186] and / or, the sterol is cholesterol or its naturally occurring derivative, and preferably cholesterol;

[0187] and / or, the PEGylated lipid is any one or more selected from: methoxy poly (ethylene glycol) ditetradecylacetamide, 1‐ (monomethoxy‐polyethylene glycol) ‐2 , 3‐dimyristoyl-sn-glycerol, poly (ethylene glycol) -distearoylphosphatidylethanolamine, poly (ethylene glycol) -distearoyl-sn-glycero-3-phosphocoline, poly (ethylene glycol) -diacylglycerol, methoxy poly (ethylene glycol) -ditetradecylamine, poly (ethylene glycol) -phosphatidylethanolamine or PEG-succinate-diacylglycerol, and preferably, the PEGylated lipid is methoxy poly (ethylene glycol) ditetradecylacetamide.

[0188] 12. Use of the mRNA according to any one of embodiments 1 to 5, the RSV pre-F protein variant according to embodiment 6 or 7, the biological composition according to embodiment 8 or the lipid nanoparticle-mRNA complex according to any one of embodiments 9 to 11 in the preparation of drugs, wherein preferably, the drugs are vaccines, more preferably, the vaccines are used for preventing respiratory diseases, and further preferably, the respiratory diseases are caused by RSV viruses.

[0189] 13. A pharmaceutical composition, comprising a therapeutically effective amount of the mRNA according to any one of embodiments 1 to 5, the RSV pre-F protein variant according to embodiment 6 or 7, the biological composition according to embodiment 8 or the lipid nanoparticle-mRNA complex according to any one of embodiments 9 to 11.

[0190] 14. The pharmaceutical composition according to embodiment 13, which is a vaccine.

[0191] 15. A messenger ribonucleic acid (mRNA) comprising a nucleic acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, or 100%identity to the sequence set forth in SEQ ID NO: 15, 16, 17, or 18.

[0192] 16. The mRNA of embodiment 15, wherein the nucleic acid sequence has 100%identity to the sequence set forth in SEQ ID NO: 15 or 16.

[0193] 17. The mRNA of embodiment 15 or 16, wherein the nucleic acid sequence comprises a 5’  untranslated region (UTR) having 100%identity to the sequence set forth in SEQ ID NO: 17.

[0194] 18. The mRNA of embodiment 17, wherein the 5’ UTR has a length of less than 1,000, 500, 300, 200, 150, 100, or 90 nucleotides.

[0195] 19. The mRNA of embodiment 15, wherein the nucleic acid sequence comprises a 3’ untranslated region (UTR) and the 3’ UTR has 100%identity to the sequence set forth in SEQ ID NO: 18.

[0196] 20. The mRNA of embodiment 19, wherein the 3’ UTR has a length of less than 1,000, 500, 300, 200, 150, 100, or 90 nucleotides.

[0197] 21. The mRNA of any one of embodiments 15-20, wherein the mRNA comprises a codon optimized sequence that encodes a pre-fusion form of a respiratory syncytial virus (RSV) F protein variant.

[0198] 22. The mRNA of embodiment 21, wherein the F protein variant comprises or consists of a polypeptide sequence selected from the group consisting of:

[0199] i)a sequence having at least 80%, at least 85%, or at least 90%identity to SEQ ID NO: 8;

[0200] ii) a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or 100%identity to SEQ ID NO: 9;

[0201] iii) a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or 100%identity to SEQ ID NO: 13;

[0202] iv) SEQ ID NO: 8 comprising the following modifications: S46G, E92D, P102A, replacing N104-V144 with GS, A149C, S155C, S190F, V207L, S215P, S290C, L373R, I379V, M447V, Y458C, K465Q, and deletion of C550-N574; and

[0203] v)a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98%identity to the sequence in iv) .

[0204] 23. The mRNA of embodiment 21 or 22, wherein the F protein variant comprises a modification that replaces C550-N574 with QPRFAAA (SEQ ID NO. 21) .

[0205] 24. The mRNA of any one of embodiments 21-23, wherein the F protein variant comprises or consists of a polypeptide sequence having about 86%identity to SEQ ID NO: 8.

[0206] 25. The mRNA of any one of embodiments 15-24, wherein the mRNA comprises a polyadenylic acid (poly (A) ) sequence, optionally wherein the poly (A) sequence comprises the sequence set forth in SEQ ID NO: 6.

[0207] 26. The mRNA of any one of embodiments 15-25, wherein the mRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 19 or SEQ ID NO: 20.

[0208] 27. The mRNA of any one of embodiments 15-26, wherein the mRNA comprises a 5’-cap structure, optionally wherein the 5’-cap structure is m7G (5') ppp (5') (2'-OMeA) p.

[0209] 28. The mRNA of embodiment 27, wherein the 5’-cap structure is added by capping enzymes, optionally wherein the capping enzymes comprise vaccinia capping enzyme and 2'-O-methyltransferase.

[0210] 29. The mRNA of any one of embodiments 15-28, wherein the mRNA comprises a chemical modification, optionally wherein at least one uridine in the mRNA is replaced by N1-methyl-pseudouridine (m1ψ) .

[0211] 30. The mRNA of embodiment 29, wherein all uridines are replaced by N1-methyl-pseudouridines (m1ψ) .

[0212] 31. A respiratory syncytial virus (RSV) F protein variant comprising an amino acid sequence having 100%identity to the sequence set forth in SEQ ID NO: 13 or SEQ ID NO: 21.

[0213] 32. The RSV F protein variant of embodiment 31, further comprising an amino acid sequence having 100%identity to the sequence set forth in SEQ ID NO: 9.

[0214] 33. A pharmaceutical composition comprising a therapeutically effective amount of the mRNA of any one of embodiments 15-30 and a pharmaceutically acceptable excipient.

[0215] 34. The pharmaceutical composition of embodiment 33, wherein the pharmaceutical composition is a vaccine.

[0216] 35. The pharmaceutical composition of embodiment 33 or 34, wherein the pharmaceutically acceptable excipient comprises a lipid nanoparticle, wherein the mRNA is formulated in the lipid nanoparticle.

[0217] 36. The pharmaceutical composition of embodiment 35, wherein the lipid nanoparticle comprises an ionizable cationic lipid, a neutral lipid, a sterol, and a PEGylated lipid.

[0218] 37. The pharmaceutical composition of embodiment 35 or 36, wherein the weight ratio of the mRNA to the lipid nanoparticle is 1: 5 to 1: 50.

[0219] 38. The pharmaceutical composition of any one of embodiments 35-37, wherein the molar ratio of the ionizable cationic lipid: neutral lipid: sterol: PEGylated lipid is (20-65) : (5-25) : (30-50) : (0.5-3) .

[0220] 39. The pharmaceutical composition of any one of embodiments 35-38, comprising one or more of the following:

[0221] i) wherein the ionizable cationic lipid is any one or more selected from the group consisting of:( (4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (2-hexyldecanoate) , 1-octylnonyl 8- [ (2-hydroxyethyl) [6-O-6- (undecanyloxy) hexyl] amino] -octoate, (dilinoleyl) methyl 4- (N, N-dimethylamino) butyrate, 1, 2-dioleyloxy-3-dimethylaminopropane, 1, 1'- ( (2- (4- (2- ( (2- (bis (2-hydroxydodecanyl) amino) ethyl) (2-hydroxydodecanyl) amino) ethyl) piperazin-1-yl) ethyl) azanediyl) bis (dodecan-2-ol) , and 1, 2-dilinoleyloxy-3-dimethylamino propane;

[0222] ii) wherein the neutral lipid is any one or more selected from the group consisting of: 1, 2-distearoyl-sn-glycero-3-phosphorylcholine, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine, and dipalmitoylphosphatidylcholine;

[0223] iii) wherein the sterol is cholesterol or its naturally occurring derivative; and / or

[0224] iv) wherein the PEGylated lipid is any one or more selected from the group consisting of: methoxy poly (ethylene glycol) ditetradecylacetamide, 1‐ (monomethoxy‐polyethylene glycol) ‐2, 3‐dimyristoyl-sn-glycerol, poly (ethylene glycol) -distearoylphosphatidylethanolamine, poly (ethylene glycol) -distearoyl-sn-glycero-3-phosphocoline, poly (ethylene glycol) - diacylglycerol, methoxy poly (ethylene glycol) -ditetradecylamine, poly (ethylene glycol) -phosphatidylethanolamine, and PEG-succinate-diacylglycerol.

[0225] 40. The pharmaceutical composition of any one of embodiments 35-39, wherein the ionizable cationic lipid is ( (4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (2-hexyldecanoate) , the neutral lipid is 1, 2-distearoyl-sn-glycero-3-phosphorylcholine, the sterol is cholesterol; and the PEGylated lipid is methoxy poly (ethylene glycol) ditetradecylacetamide.

[0226] 41. A method, comprising administering to a subject the pharmaceutical composition of any one of embodiments 33-40 in an amount effective to induce an immune response against RSV infection in the subject.

[0227] 42. The method of embodiment 41, wherein the subject is human.

[0228] 43. The method of embodiment 41 or 42, wherein the immune response elicits neutralizing antibodies in the subject.

[0229] 44. The method of any one of embodiments 41-43, wherein the pharmaceutical produces an RSV F protein in pre-fusion conformation in the subject.

[0230] 45. An mRNA comprising a nucleic acid sequence encoding a respiratory syncytial virus (RSV) F protein variant, wherein the RSV F protein variant comprises an amino acid sequence having 100%identity to the sequence set forth in SEQ ID NO: 13.

[0231] 46. An mRNA comprising a nucleic acid sequence encoding a respiratory syncytial virus (RSV) F protein variant, wherein the RSV F protein variant comprises an amino acid sequence having 100%identity to the sequence set forth in SEQ ID NO: 21.

[0232] 47. The mRNA of embodiment 45 or 46, comprising a nucleic acid sequence encoding an RSV F protein variant, wherein the RSV F protein variant comprises an amino acid sequence having 100%identity to the sequence set forth in SEQ ID NO: 9.

[0233] 48. The mRNA of any one of embodiments 45-47, comprising a nucleic acid sequence encoding an RSV F protein variant, wherein the RSV F protein variant comprises the amino acid sequence set forth in SEQ ID NO: 21, wherein the RSV F protein variant induces a higher titer of RSV  neutralizing antibody than a comparable RSV F protein variant without the amino acid sequence set forth in SEQ ID NO: 21.

[0234] 49. The mRNA of any one of embodiments 45-48, comprising a 5’ untranslated region (UTR) having 100%identity to the sequence set forth in SEQ ID NO: 17.

[0235] 50. The mRNA of embodiment 49, wherein the 5’ UTR has a length of less than 1,000, 500, 300, 200, 150, 100, or 90 nucleotides.

[0236] 51. The mRNA of any one of embodiments 45-50, comprising a 3’ untranslated region (UTR) and the 3’ UTR has 100%identity to the sequence set forth in SEQ ID NO: 18.

[0237] 52. The mRNA of embodiment 51, wherein the 3’ UTR has a length of less than 1,000, 500, 300, 200, 150, 100, or 90 nucleotides.

[0238] 53. The mRNA of any one of embodiments 45-52, comprising a codon optimized sequence that encodes a pre-fusion form of an RSV F protein variant.

Claims

1.A messenger ribonucleic acid (mRNA) comprising a nucleic acid sequence having at least 85%, at least 90%, at least 95%, at least 98%, or 100%identity to the sequence set forth in SEQ ID NO: 15, 16, 17, or 18.2.The mRNA of claim 1, wherein the nucleic acid sequence has 100%identity to the sequence set forth in SEQ ID NO: 15 or 16.3.The mRNA of claim 1, wherein the nucleic acid sequence comprises a 5’ untranslated region (UTR) having 100%identity to the sequence set forth in SEQ ID NO: 17.4.The mRNA of claim 3, wherein the 5’ UTR has a length of less than 1,000, 500, 300, 200, 150, 100, or 90 nucleotides.5.The mRNA of claim 1, wherein the nucleic acid sequence comprises a 3’ untranslated region (UTR) and the 3’ UTR has 100%identity to the sequence set forth in SEQ ID NO: 18.6.The mRNA of claim 5, wherein the 3’ UTR has a length of less than 1,000, 500, 300, 200, 150, 100, or 90 nucleotides.7.The mRNA of claim 1, wherein the mRNA comprises a codon optimized sequence that encodes a pre-fusion form of a respiratory syncytial virus (RSV) F protein variant.8.The mRNA of claim 7, wherein the F protein variant comprises or consists of a polypeptide sequence selected from the group consisting of:i)a sequence having at least 80%, at least 85%, or at least 90%identity to SEQ ID NO: 8;ii) a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or 100%identity to SEQ ID NO: 9;iii) a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or 100%identity to SEQ ID NO: 13;iv) SEQ ID NO: 8 comprising the following modifications: S46G, E92D, P102A, replacing N104-V144 with GS, A149C, S155C, S190F, V207L, S215P, S290C, L373R, I379V, M447V, Y458C, K465Q, and deletion of C550-N574; andv)a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98%identity to the sequence in iv) .9.The mRNA of claim 7, wherein the F protein variant comprises a modification that replaces C550-N574 with QPRFAAA (SEQ ID NO. 21) .10.The mRNA of claim 7, wherein the F protein variant comprises or consists of a polypeptide sequence having about 86%identity to SEQ ID NO: 8.11.The mRNA of claim 1, wherein the mRNA comprises a polyadenylic acid (poly (A) ) sequence, optionally wherein the poly (A) sequence comprises the sequence set forth in SEQ ID NO:6.12.The mRNA of claim 1, wherein the mRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 19 or SEQ ID NO: 20.13.The mRNA of claim 1, wherein the mRNA comprises a 5’-cap structure, optionally wherein the 5’-cap structure is m7G (5') ppp (5') (2'-OMeA) p.14.The mRNA of claim 13, wherein the 5’-cap structure is added by capping enzymes, optionally wherein the capping enzymes comprise vaccinia capping enzyme and 2'-O-methyltransferase.15.The mRNA of claim 1, wherein the mRNA comprises a chemical modification, optionally wherein at least one uridine in the mRNA is replaced by N1-methyl-pseudouridine (m1ψ) .16.[Rectified under Rule 91, 27.12.2024]The mRNA of claim 15, wherein all uridines are replaced by N1-methyl-pseudouridines (m1ψ) .17.[Rectified under Rule 91, 27.12.2024]A respiratory syncytial virus (RSV) F protein variant comprising an amino acid sequence having 100%identity to the sequence set forth in SEQ ID NO: 13 or SEQ ID NO: 21.18.The RSV F protein variant of claim 17, further comprising an amino acid sequence having 100%identity to the sequence set forth in SEQ ID NO: 9.19.The RSV F protein variant of claim 17, comprising the amino acid sequence set forth in SEQ ID NO: 21, wherein the RSV F protein variant induces a higher titer of RSV neutralizing antibody than a comparable RSV F protein variant without the amino acid sequence set forth in SEQ ID NO: 21.20.A pharmaceutical composition comprising a therapeutically effective amount of the mRNA of claim 1 and a pharmaceutically acceptable excipient.21.The pharmaceutical composition of claim 20, wherein the pharmaceutical composition is a vaccine.22.The pharmaceutical composition of claim 20, wherein the pharmaceutically acceptable excipient comprises a lipid nanoparticle, wherein the mRNA is formulated in the lipid nanoparticle.23.The pharmaceutical composition of claim 22, wherein the lipid nanoparticle comprises an ionizable cationic lipid, a neutral lipid, a sterol, and a PEGylated lipid.24.The pharmaceutical composition of claim 22, wherein the weight ratio of the mRNA to the lipid nanoparticle is 1: 5 to 1: 50.25.The pharmaceutical composition of claim 23, wherein the molar ratio of the ionizable cationic lipid: neutral lipid: sterol: PEGylated lipid is (20-65) : (5-25) : (30-50) : (0.5-3) .26.The pharmaceutical composition of claim 23, comprising one or more of the following:i)wherein the ionizable cationic lipid is any one or more selected from the group consisting of: ( (4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (2-hexyldecanoate) , 1-octylnonyl 8- [ (2-hydroxyethyl) [6-O-6- (undecanyloxy) hexyl] amino] -octoate, (dilinoleyl) methyl 4- (N, N-dimethylamino) butyrate, 1, 2-dioleyloxy-3-dimethylaminopropane, 1, 1'- ( (2- (4- (2- ( (2- (bis (2-hydroxydodecanyl) amino) ethyl) (2-hydroxydodecanyl) amino) ethyl) piperazin-1-yl) ethyl) azanediyl) bis (dodecan-2-ol) , and 1, 2-dilinoleyloxy-3-dimethylamino propane;ii) wherein the neutral lipid is any one or more selected from the group consisting of: 1, 2-distearoyl-sn-glycero-3-phosphorylcholine, 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine, and dipalmitoylphosphatidylcholine;iii) wherein the sterol is cholesterol or its naturally occurring derivative; and / oriv) wherein the PEGylated lipid is any one or more selected from the group consisting of: methoxy poly (ethylene glycol) ditetradecylacetamide, 1‐ (monomethoxy‐polyethylene glycol) ‐2, 3‐dimyristoyl-sn-glycerol, poly (ethylene glycol) -distearoylphosphatidylethanolamine, poly (ethylene glycol) -distearoyl-sn-glycero-3-phosphocoline, poly (ethylene glycol) -diacylglycerol, methoxy poly (ethylene glycol) -ditetradecylamine, poly (ethylene glycol) -phosphatidylethanolamine, and PEG-succinate-diacylglycerol.27.The pharmaceutical composition of claim 26, wherein the ionizable cationic lipid is ( (4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (2-hexyldecanoate) , the neutral lipid is 1, 2-distearoyl-sn-glycero-3-phosphorylcholine, the sterol is cholesterol; and the PEGylated lipid is methoxy poly (ethylene glycol) ditetradecylacetamide.28.A method, comprising administering to a subject the pharmaceutical composition of claim 20 in an amount effective to induce an immune response against RSV infection in the subject.29.The method of claim 28, wherein the immune response elicits neutralizing antibodies in the subject.30.The method of claim 28, wherein the pharmaceutical produces an RSV F protein in pre-fusion conformation in the subject.

Images