Method for producing late-bolting lactuca sativa l. plant using crispr / cas9 system and late-bolting lactuca sativa l. plant produced by same method

Abstract

The present invention relates to a composition for genome editing to delay the bolting of a Lactuca sativa L. plant and a method for producing a genome-edited Lactuca sativa L. plant with delayed bolting, using same, the composition comprising, as an active ingredient, a recombinant vector encoding an endonuclease protein and a sequence encoding a guide RNA specific to a target nucleotide sequence of a Lactuca sativa L.-derived suppressor of overexpression of constans 1 (SOC1) gene consisting of the nucleotide sequences of SEQ ID NOs: 1 to 3.

Description

Method for producing a late-season lettuce plant using the CRISPR / Cas9 system and a late-season lettuce plant produced by the method

[0001] The present invention relates to a method for producing a late-season lettuce plant by correcting the SOC1 gene (SOL1, LOC111912847; SOL2, LOC111880753; SOL3, LOC111878575) of lettuce using the CRISPR / Cas9 system.

[0002]

[0003] This invention was researched with the support of the Next Generation Agricultural Crop Breeding Technology Development Project of the Rural Development Administration (Project No. RS-2024-00322156).

[0004] Lettuce (Lactuca sativa L.) is an annual herbaceous plant in the Asteraceae family. It originated from the wild lettuce, L. serriola, native to the Mediterranean region. It has been cultivated since before the Common Era, and is now cultivated worldwide in various varieties. In Korea, it is believed to have been introduced from India and China approximately 1,400 years ago. It is widely consumed as a wrap vegetable, often paired with perilla leaves or other vegetables.

[0005] Lettuce can be harvested 30-40 days after planting. However, if environmental factors such as high temperatures or long days cause premature bolting, flower buds differentiate before sufficient leaf mass is available, shortening the harvest period, reducing yield, and degrading quality. When there is a risk of premature bolting due to high temperatures during cultivation, single-season treatment or blocking sunlight can delay bolting. While treatment with growth inhibitors like maleic hydrazide or cycocel can delay bolting, they also inhibit growth.

[0006] The SOC1 (Supperssor of overexpression of constans 1) gene is a transcription factor encoding a MADS box domain. It integrates flowering signals induced by factors such as day length, temperature, hormones, and aging, and appropriately regulates the activity of flowering-promoting and -inhibiting factors. Furthermore, it is thought to play a distinct role from other flowering-time regulators because it induces the activation of genes that lead to the maintenance of floral meristems and the formation of organelles.

[0007] Meanwhile, Korean Patent Registration No. 2113500 discloses 'a method for producing a genome-edited cabbage plant having a late-fall trait by correcting the SOC1 gene and a plant thereof', and Korean Publication Patent No. 2015-0049704 discloses 'a novel gene, CmSOC1, which is a flowering regulator of plants and a method for controlling the flowering time of plants using the same', but 'a method for producing a late-fall lettuce plant using the CRISPR / Cas9 system and a late-fall lettuce plant produced by the method' of the present invention are not described.

[0008] The present invention was derived from the above-mentioned needs, and the inventors of the present invention constructed guide RNAs specific to the target base sequences of each of the three lettuce SOC1 genes (SOL1; SOL2; SOL3) selected through blast analysis of the lettuce genome and the Arabidopsis SOC1 gene, and constructed SOC1-corrected lettuce plants using a recombinant vector containing the three guide RNA sequences and the Cas9 protein coding sequence. Thereafter, as a result of analyzing the base sequence of the SOC1 corrector, it was confirmed that the lettuce corrector in which all of SOL1 / SOL2 / SOL3 were knocked out showed a significant delay in bolting and flower bud formation compared to the wild-type lettuce, thereby completing the present invention.

[0009] In order to solve the above problem, the present invention provides a composition for genome correction for delaying the bolting of a lettuce plant, which comprises as an active ingredient a sequence encoding a guide RNA specific to the target base sequence of a lettuce-derived SOC1 (suppressor of overexpression of constans 1) gene consisting of base sequences of SEQ ID NOs: 1 to 3 and a recombinant vector encoding an endonuclease protein.

[0010] In addition, the present invention provides a method for producing a genome-corrected lettuce plant with delayed bolting, comprising: (a) a step of correcting the genome by introducing a guide RNA and an endonuclease protein specific to a target base sequence of a lettuce-derived SOC1 gene consisting of base sequences of SEQ ID NOs: 1 to 3 into a lettuce plant cell; and (b) a step of redifferentiating a lettuce plant from the genome-corrected lettuce plant cell.

[0011] In addition, the present invention provides a genome-corrected lettuce plant with delayed germination produced by the method and a genome-corrected seed thereof.

[0012] Since the SOC1-corrected lettuce plants produced through the method of the present invention have significantly delayed shoot and flower bud formation compared to lettuce plants without genome correction, it is expected that the crop value will be improved and the production volume will be increased.

[0013] Figure 1 shows the genomic DNA structure of the lettuce SOC1 gene (SOL1, LOC111912847; SOL2, LOC111880753; SOL3, LOC111878575) and the location of the guide RNA target sequence (arrow).

[0014] Figure 2 shows a method for producing genome-edited lettuce plants through Agrobacterium-mediated transformation.

[0015] Figure 3 shows the results of deep-sequencing analysis of lettuce plants with the SOC1 gene corrected.

[0016] Figure 4 shows the results of phenotypic analysis of control and SOC1-corrected lettuce plants.

[0017] In order to achieve the purpose of the present invention, the present invention provides a composition for genome correction for delaying the bolting of a lettuce plant, comprising as an active ingredient a sequence encoding a guide RNA specific to the target base sequence of a lettuce-derived SOC1 (suppressor of overexpression of constans 1) gene consisting of base sequences of SEQ ID NOs: 1 to 3 and a recombinant vector encoding an endonuclease protein.

[0018] The term "genome / gene editing" as used herein refers to a technology capable of introducing targeted mutations into the genome sequence of plant and animal cells, including human cells, by knocking out or knocking in a specific gene through deletion, insertion, or substitution of one or more nucleic acid molecules by DNA cleavage, or by introducing mutations into non-coding DNA sequences that do not produce proteins. For the purposes of the present invention, the genome editing may be, in particular, introducing mutations into plants using an endonuclease, such as Cas9 (CRISPR associated protein 9) protein, and a guide RNA. In addition, 'gene editing' may be used interchangeably with 'gene editing'.

[0019] Additionally, the term "target gene" refers to a portion of DNA within the genome of a plant to be corrected through the present invention. The type of gene is not limited, and may include both coding and non-coding regions. Those skilled in the art can select the target gene based on the desired mutation for the genome-edited plant to be produced, depending on the purpose.

[0020] In a composition for genome correction according to one embodiment of the present invention, the target gene may be a lettuce-derived SOC1 gene, preferably SOL1 (LOC111912847) consisting of a base sequence of SEQ ID NO: 1, SOL2 (LOC111880753) consisting of a base sequence of SEQ ID NO: 2, and SOL3 (LOC111878575) consisting of a base sequence of SEQ ID NO: 3, but is not limited thereto.

[0021] In addition, the term "guide RNA" refers to a short single-stranded RNA, which is specific to a target DNA among the base sequences encoding a target gene, and refers to a ribonucleic acid that complementarily binds to all or part of the target DNA base sequence and guides an endonuclease protein to the target DNA base sequence. The guide RNA is a dual RNA comprising two RNAs, namely crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) as components; Or, it refers to a single-stranded guide RNA (sgRNA) form that includes a first portion that includes a sequence that is completely or partially complementary to a base sequence in a target gene and a second portion that includes a sequence that interacts with an endonuclease (particularly, an RNA-guided nuclease). However, if the endonuclease is in a form that can be active in the target base sequence, it can be included in the scope of the present invention without limitation, and can be manufactured and used according to a technique known in the art, taking into account the type of endonuclease used together or the microorganism from which the endonuclease is derived.

[0022] Additionally, the guide RNA may be, but is not limited to, a guide RNA transcribed from a plasmid template, transcribed in vitro (e.g., an oligonucleotide double strand), or synthesized.

[0023] In the composition for genome correction according to the present invention, the guide RNA is specifically designed for the target base sequence of the lettuce-derived SOC1 gene, and the target base sequence may preferably be composed of the base sequences of SEQ ID NOs: 4 to 6, but is not limited thereto. The base sequence of SEQ ID NO: 4 is specific for SOL1 (LOC111912847), the base sequence of SEQ ID NO: 5 is specific for SOL2 (LOC111880753), and the base sequence of SEQ ID NO: 6 is specific for SOL3 (LOC111878575).

[0024] In addition, in the composition for genome correction according to the present invention, the endonuclease protein may be at least one selected from the group consisting of Cas9, Cpf1 (also known as Cas12a), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease) or a functional analog thereof, preferably Cas9 or Cpf1, and more preferably Cas9 protein, but is not limited thereto.

[0025] In addition, the Cas9 protein may be at least one selected from the group consisting of a Cas9 protein derived from Streptococcus pyogenes, a Cas9 protein derived from Campylobacter jejuni, a Cas9 protein derived from S. thermophilus or S. aureus, a Cas9 protein derived from Neisseria meningitidis, a Cas9 protein derived from Pasteurella multocida, a Cas9 protein derived from Francisella novicida, and the like, but is not limited thereto. The Cas9 protein or its genetic information can be obtained from a known database such as GenBank of the National Center for Biotechnology Information (NCBI). The above Cas9 gene information may use a known sequence as is, or may use a sequence optimized for the codon of the target (organism) to be transduced, but is not limited thereto.

[0026] The Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double-stranded DNA breaks. For the Cas9 protein to precisely bind to its target sequence and cleave the DNA strand, a short three-base sequence known as a Protospacer Adjacent Motif (PAM) must be present next to the target sequence. The Cas9 protein cleaves between the third and fourth base pairs from the PAM sequence (NGG).

[0027] The CRISPR / Cas9 system used in the present invention is a gene correction method using the NHEJ (non-homologous end joining) mechanism that introduces a double-strand break at a specific location of a specific gene to be corrected, thereby inducing an insertion-deletion (InDel) mutation due to incomplete repair induced during the DNA repair process.

[0028] In the composition for genome correction according to the present invention, the guide RNA and endonuclease protein can form a ribonucleoprotein complex and also function in the form of RNA-Guided Engineered Nuclease (RGEN).

[0029] The present invention also provides:

[0030] (a) a step of correcting the genome by introducing a guide RNA and an endonuclease protein specific to the target base sequence of the lettuce-derived SOC1 (suppressor of overexpression of constans 1) gene consisting of base sequences of sequence numbers 1 to 3 into a lettuce plant cell; and

[0031] (b) a step of re-differentiating a lettuce plant from a lettuce plant cell in which the genome has been corrected; a method for producing a genome-corrected lettuce plant with delayed seedling development is provided.

[0032] In a manufacturing method according to one embodiment of the present invention, the target base sequence and endonuclease protein of the lettuce-derived SOC1 gene are as described above.

[0033] In addition, in the manufacturing method according to the present invention, the introduction of the guide RNA and endonuclease protein of step (a) into the lettuce plant cell may be done by using a recombinant vector including a sequence encoding a guide RNA specific to the target base sequence of the lettuce-derived SOC1 gene and a nucleic acid sequence encoding an endonuclease protein, but is not limited thereto.

[0034] In the manufacturing method according to the present invention, the method for transducing the complex of the guide RNA and the endonuclease protein into plant cells includes the calcium / polyethylene glycol method for protoplasts (Krens et al., 1982, Nature 296:72-74; Negrutiu et al., 1987, Plant Mol. Biol. 8:363-373), electroporation of protoplasts (Shillito et al., 1985, Bio / Technol. 3:1099-1102), microinjection into plant elements (Crossway et al., 1986, Mol. Gen. Genet. 202:179-185), particle bombardment of various plant elements (DNA or RNA-coated) (Klein et al., 1987, Nature 327:70), Agrobacterium tumefaciens tumefaciens) mediated gene transfer, and can be appropriately selected from (incomplete) bacterial infections, etc.

[0035] Furthermore, introducing a recombinant vector comprising a DNA encoding a guide RNA specific for the target sequence and a nucleic acid sequence encoding an endonuclease protein into a plant cell represents a transformation method. Transformation of plant species is now commonplace, including both dicotyledonous and monocotyledonous plants. In principle, any transformation method can be used to introduce the recombinant vector according to the present invention into a suitable progenitor cell.

[0036] In the manufacturing method according to the present invention, the "plant cell" into which the guide RNA and endonuclease protein specific for the target base sequence are introduced may be any plant cell. The plant cell is a cultured cell, cultured tissue, cultured organ, or whole plant. The "plant tissue" includes differentiated or undifferentiated plant tissue, such as, but not limited to, roots, stems, leaves, pollen, microspores, egg cells, seeds, and various types of cells used for culture, such as single cells, protoplasts, shoots, and callus tissues. The plant tissue may be in planta or in an organ culture, tissue culture, or cell culture state. A preferred plant cell according to the present invention is a protoplast.

[0037] In the manufacturing method of the present invention, any method known in the art can be used to regenerate genome-edited plants from genome-edited plant cells. Genome-edited plant cells must be regenerated into whole plants. Techniques for regenerating mature plants from callus or protoplast cultures are well known in the art for numerous and diverse species.

[0038] The present invention also provides a genome-edited lettuce plant with delayed germination produced by the method and a genome-edited seed thereof.

[0039] The genome-edited lettuce plant with delayed bolting according to the present invention is a genome-edited lettuce plant in which lettuce-derived SOC1 genes (SOL1, LOC111912847; SOL2, LOC111880753; SOL3, LOC111878575) are corrected using the CRISPR / Cas9 system, and three SOC1 genes are knocked out, resulting in delayed bolting and flower bud formation compared to a lettuce plant without genome editing.

[0040]

[0041] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

[0042]

[0043] Materials and Methods

[0044] 1. Guide RNA design

[0045] Three SOC1 genes (SOL1, LOC111912847; SOL2, LOC111880753; SOL3, LOC111878575) showing similar homology were selected through blast analysis of the lettuce genome and the Arabidopsis SOC1 gene (AT2G45660) (Fig. 1). Guide RNAs for generating mutants using the CRISPR-Cas9 system were then selected using the CRISPR RGEN Tool (https: / www.rgenome.net / cas-analyzer). Guide RNAs were selected based on their GC content of 30-70% in the target sequence region and their high out-of-frame scores.

[0046] Guide RNA target sequence for lettuce SOC1 gene correction gRNA target sequence (5' to 3') Sequence number SOL1 GAGGGAAGACTCAAATGCGGAGG4 SOL2 GAGGGAAGACTCAGATGAAGAGG5 SOL3 GGATAGAAAACGCTACAAGTAGG6 Underline: PAM

[0047]

[0048] 2. Production of vectors for transporting gene scissors

[0049] To target the SOC1 gene, for which three similar genes (SOL1; SOL2; SOL3) were identified, oligos containing restriction enzyme sequences were synthesized for the three selected guide RNAs, and then ligated to the pECO301 vector (Oh et al. Plant Methods (2020) 16:37) treated with AarI restriction enzyme. The recombinant vector was transformed into Aagrobacterium tumefaciens LBA4404 strain to secure cell stock, which was then used for lettuce transformation.

[0050]

[0051] 3. Agrobacterium-mediated transformation

[0052] To produce a genetically modified organism, Agrobacterium transformation and tissue culture were performed. Manhongpochap (Jeonong S&T) seeds were washed three times with sterilized water for 1 minute in 70% ethanol, surface sterilized and disinfected in 10% sodium hypochlorite for 15 minutes, and then washed three times with sterilized water. The sterilized seeds were soaked at 4°C for one day, then plated on MS medium [1 / 2 MS medium + 2% sucrose + 0.6% agarose], and cultured for 3 days (16 h light / 8 h dark). The Agrobacterium suspension cultured in an incubator at 28°C for one day (OD 600nm=0.8~1) were immersed in explants (lettuce cotyledons) for 10 minutes (Fig. 2). After immersing in the Agrobacterium suspension, they were co-cultured in MCO medium [MS media + 3% sucrose + 0.2 mg / ℓ benzyladenine (BA) + 0.05 mg / ℓ 1-naphthaleneacetic acid (NAA) + 0.6% agarose] in the dark for 4 days. After 3 days of co-culture, the explants were transferred to MSE medium [MS media + 3% sucrose + 0.2 mg / ℓ BA + 0.05 mg / ℓ NAA + 250 mg / ℓ carbenicillin + 100 mg / ℓ kanamycin + 0.8% agarose] and cultured for 3 weeks. Shoots induced in MSE medium were transferred to MRO medium (1 / 2 MS media + 2% sucrose + 0.05 mg / ℓ NAA + 250 mg / ℓ carbenicillin + 100 mg / ℓ kanamycin + 0.6% agarose) and elongation and rooting were induced for 3 to 4 weeks (Fig. 2).

[0053]

[0054] 4. DNA base sequence analysis of the SOC1 corrector

[0055] To confirm the introduction of the recombinant vector and the occurrence of mutations in the shoots selected on the MSE medium, DNA of the plants was extracted. The extracted DNA was subjected to PCR analysis (98℃ 5 min, 98℃ 1 min, 58℃ 30 sec, 72℃ 500 bp / 30 sec, 72℃ 5 min, 30 cycles) using primer sets specific for the Kan (710 bp, forward primer - TGCGCTGCGAATCGGGAGCG, SEQ ID NO: 7; reverse primer - GAGGCTATTCGGCTATGACT, SEQ ID NO: 8) and Cas9 (590 bp, forward primer - CACCAAGGCTCCACTCTCAG, SEQ ID NO: 9; reverse primer - GGAGCACCTTCTCGTTTGGA, SEQ ID NO: 10) genes, respectively, to select only plants with the inserted recombinant vector. Afterwards, a primer set specific for the SOC1 gene (Table 2) was used to confirm the operation of the target gene region and the occurrence of mutations. Since three similar genes were targeted simultaneously, the PCR products amplified through PCR were each purified and then sent to an external company (KAIST Biocore Center, MiniSeq TM The analysis was requested from System, Korea.

[0056] Lettuce SOC1 gene specific primer set Primer name Base sequence (5' to 3') Product size Sequence number SOL1_forwardGATATGGGTATTTGAGGTTGGTG1,308bp 11 SOL1_reverseGCTGTGACATTCTTCGTATTCGT 12 SOL2_forwardGTTTCTAGGGTTTCTGGTCACG 1,007bp 13 SOL2_reverseGCGTTCAATAGTCTCCTTCATGC 14 SOL3_forwardCCAATCAATCAGCTCCAACTTACC 980bp 15 SOL3_reverseGCAGTGAAGGAAAGATAGAGAGAG 16

[0057] As a result, the SOL1 / SOL2 / SOL3 KO (S-49-4, S-48-26) line was identified, in which mutations in three SOC1 genes were confirmed compared to the control plant (wild type, wt).

[0058]

[0059] 5. Analysis of the characteristics of the SOC1 correction body

[0060] SOC1 correctors whose mutations were confirmed through DNA analysis were seeded through self-fertilization. The seeds were then sown in pots and grown in a growth chamber at 25℃ (16 hours light incubation) / 20℃ (8 hours dark incubation) for 24 days. After 24 days of cultivation, the lettuce was subjected to high-temperature treatment at 35℃ (16 hours light incubation) / 25℃ (8 hours dark incubation) for 14 days, and then grown again under the original conditions.

[0061]

[0062] Example 1. Sequence analysis of SOC1 corrector

[0063] We performed deep-sequencing analysis of plants in which the SOC1 gene was corrected using the CRISPR / Cas9 system to determine the presence or absence of mutations in the target gene sequence. As a result, deletions of -1 to -6 bp and insertions of +1 bp were confirmed in SOL1 / SOL2 / SOL3 KO (Fig. 3).

[0064]

[0065] Example 2. Analysis of late-season traits

[0066] Comparison of the late-falling traits of lettuce plants corrected for the SOC1 gene revealed that the control (wt) plants showed the formation of bolting and flower buds, but in the case of SOL1 / SOL2 / SOL3 KO, bolting was not formed under the same conditions (Fig. 4). This confirmed that the lettuce plants corrected for the three SOC1-like genes had characteristics in which bolting and flower bud formation were significantly delayed compared to the control.

Claims

1. A composition for genome correction for delaying the bolting of a lettuce plant, comprising as an active ingredient a sequence encoding a guide RNA specific to the target base sequence of the lettuce-derived SOC1 (suppressor of overexpression of constans 1) gene consisting of base sequences of sequence numbers 1 to 3 and a recombinant vector encoding an endonuclease protein.

2. A composition according to claim 1, characterized in that the target base sequence of the SOC1 gene consists of base sequences of SEQ ID NOs: 4 to 6. 3.(a) A step of correcting the genome by introducing a guide RNA and an endonuclease protein specific to the target base sequence of the lettuce-derived SOC1 (suppressor of overexpression of constans 1) gene consisting of base sequences of sequence numbers 1 to 3 into a lettuce plant cell; and (b) A method for producing a genome-corrected lettuce plant with delayed seedling growth, comprising the step of re-differentiating a lettuce plant from a genome-corrected lettuce plant cell.

4. A manufacturing method characterized in that, in the third paragraph, the introduction of the guide RNA and endonuclease protein of step (a) into a lettuce plant cell uses a recombinant vector including a sequence encoding a guide RNA specific to the target base sequence of the lettuce-derived SOC1 gene and a nucleic acid sequence encoding an endonuclease protein.

5. A manufacturing method according to claim 3, characterized in that the target base sequence of the SOC1 gene consists of base sequences of sequence numbers 4 to 6.

6. A genetically corrected lettuce plant with delayed rooting produced by the method of any one of claims 3 to 5.

7. Seeds of lettuce plants whose genomes have been corrected according to Article 6.

Images