Compositions comprising selective cell in organ targeting and methods of using the same

Abstract

Disclosed herein are compositions comprising LNPs capable of selectively targeting cancer cells in organs for the efficient delivery of RNA cargos, specifically aimed at targeting poorly druggable, disease-driving transcription factors in prostate cancer and methods of use thereof.

Description

COMPOSITIONS COMPRISING SELECTIVE CELL IN ORGAN TARGETING AND METHODS OF USING THE SAME I. CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No.63 / 547,736 filed 8 November 2023, which is incorporated herein in its entirety. II. REFERENCE TO THE SEQUENCE LISTING

[0002] This application is being filed electronically via Patent Center and includes an electronically submitted Sequence Listing in .xml format. The .xml file contains a sequence listing titled “24-3021-WO-Sequence_Listing.xml” created on 8 November 2024 and is 141,125 bytes in size. The Sequence Listing contained in this .xml file is part of the specification and is hereby incorporated by reference herein in its entirety. III. BACKGROUND

[0003] Metastatic cancer, the leading cause of cancer mortality, is propelled by numerous oncoproteins. Among these, transcription factors (TFs) arguably play a more critical role than conventional signaling oncoproteins, as TFs serve as focal points in the deregulated signaling pathways and are the master regulators of many signaling proteins. Indeed, cancer cells frequently develop a marked dependency on certain TFs, a phenomenon known as ‘transcriptional addiction’ in cancer. Unfortunately, apart from nuclear hormone receptors, most TFs are considered ‘undruggable’ due to conformational variability and the lack of distinct small-molecule binding sites. Thus, there remains an urgent need to develop novel approaches that can conveniently, effectively, and specifically target ‘undruggable’ oncogenic TFs. Fortunately, the compositions and methods disclosed herein meet this urgent need. IV. BRIEF DESCRIPTION OF THE FIGURES

[0004] FIG.1A – FIG.1H shows that CasRx-mediated specific HoxB13 knockdown inhibited proliferation and invasion of both AR+ and AR- CRPC cells. FIG. 1A shows representative HoxB13 immunoreactivity in normal human prostate, ADPC and mCRPC tissues. Scale bar: 200 μm (upper panels);100 μm (lower panels). FIG. 1B shows H-score of HoxB13 nuclear staining in human tissues. The bar shows the median of each group, while each dot represents an individual sample. P values were calculated by one-way ANOVA. ****p < 0.0001. FIG. 1C shows HoxB13 mRNA level in 293FT cells after transfection with CasRx plasmid and different pre-gRNAs designed to target HoxB13. HoxB13 transcript levels are normalized by 18s-rRNA. Data are presented as mean ^ SEM with n = 6 biologically independent replicates. FIG.1D shows HoxB13 mRNA level in 293FT cells after transfection with CasRx or luciferasemRNA and pre-gControl or pre-gHoxB13. Data are presented as mean ± SEM with n = 6 biologically independent replica tes. P values were calculated by two-tailed Student’s t-test. ****p < 0.0001. FIG. 1E shows volcano plot of gene expression changes between CasRx- pre-gHoxB13 and CasRx-pre-gControl transfected 293FT cells for 24 hr. RNA sequencing was performed in biological triplicates. Significantly differentially expressed genes (Fold change > 2, q-value < 0.01) are shown in red. FIG.1F – FIG.1H shows LNCaP95 (upper) and PC-3 cells (lower) were incubated with mock, empty LNPs (eLNPs), LNPs encapsulating CasRx mRNA and pre-gControl or pre-gHoxB13, respectively, and subjected for analysis. HoxB13 transcript levels. Data are presented as mean ^ SEM with n = 5 biologically independent replicates (FIG. 1F). Cell proliferation. Data are presented as mean ^ SD with n = 5 biologically independent replicates (FIG. 1G). Cell invasion. The number of invaded cells was quantified (left), and representative images are shown on right (100x magnification). Data are presented as mean ± SEM of three representative fields from one of three biologically independent experiments (FIG. 1H). P values were calculated by one-way ANOVA. **p < 0.01, ****p < 0.0001.

[0005] FIG. 2A – FIG. 2F shows the construction of SCORT LNPs for specific of CRPC cells in vitro and in vivo. FIG. 2A shows a schematic of SCORT LNPs generation through microfluidic mixing and E3 aptamer conjugation. FIG.2B shows the composition of LNP candidates. FIG.2C shows the bioluminescence signal in LNCaP95, PC-3, and AML12 cells after 24 hr. incubation with luciferase mRNA-encapsulated LNP candidates with (+E3) or without E3 aptamer (-E3). The experiment was conducted with n = 5 biologically independent replicates. Data are presented as mean ± SEM. P values were calculated by a two- tailed Student’s t-test. ****p < 0.0001, ns, not significant. FIG.2D shows a schematic of the establishment of LNCaP95 liver metastasis model and distribution of mCherry mRNA- encapsulated LNPs in major organs. FIG. 2E shows a representative images of cell classification mapping (left panel) and mCherry-positive cells (right panel) by IMC analysis. FIG.2F shows the percentage of mCherry-positive cells in different cell types. Each red point represents the distribution in an individual mouse (n = 4, one batch of SCORT-mCherry per mouse). Data are presented as mean ± SEM. P value was calculated by one-way ANOVA. ****p < 0.0001.

[0006] FIG. 3A – FIG. 3G shows that SCORT-CasRx-pre-gHoxB13 treatment suppressed liver metastasis and improved survival in AR+ CRPC liver metastasis mouse model. FIG.3A provides a schematic illustration of the experimental design. The CRPC liver metastasis mousemodel was established by hemi-spleen injection of LNCaP95 cells stably expressing luciferase (LNCaP95-Luc). One week after cell engraftment, mice received I.V. administration of DPBS, SCORT LNPs, SCORT-CasRx-pre-gControl, and SCORT-CasRx-pre-gHoxB13, receptively, twice a week for 6.5 weeks (n = 7). FIG.3B provides representative bioluminescence imaging of the whole animal on week 3, week 5, and week 7 after cancer cell engraftment. FIG. 3C shows cumulative luciferase counts during the time course. Data are presented as mean ± SEM. P values were calculated by one-way ANOVA, **p < 0.01. FIG.3D provides Kaplan-Meier survival curves. P values were determined by the log-rank (Mantel-Cox) test. **P  <  0.01. FIG. 3E – FIG. 3G show three days after the last treatments, liver metastatic tumors were subjected for analysis. HoxB13 transcript levels. Data are presented as mean ± SEM. P values were calculated by one-way ANOVA, ****p < 0.0001. FIG. 3E shows a Western blot of HoxB13 protein. Six mice per group. Each lane represents an individual mouse. The ratio of HoxB13 over the loading control calnexin is listed under the blot (FIG. 3F). Representative images for HoxB13 protein immunostaining. Scale bar: 50 μm (FIG.3G).

[0007] FIG.4A – FIG.4F shows that SCORT-CasRx-pre-gHoxB13 treatment inhibited liver metastasis and improved survival in AR- liver metastasis mouse model. FIG. 4A shows schematic illustration of the experimental design. The PC-3 liver metastasis mouse model was established by hemi-spleen injection of PC-3 Red-FLuc cells. Three days after cancer cell engraftment, mice received I.V. administration of SCORT-CasRx-pre-gControl, or SCORT- CasRx-pre-gHoxB13, respectively, twice a week for 3 weeks (n = 7). FIG. 4B shows a representative bioluminescence imaging of the whole animal on 1, 2, 3 weeks following cancer cell injection. FIG.4C shows cumulative luciferase counts during the time course. Data are presented as mean ± SEM. P values were calculated by a two-tailed Student’s t-test, ***p < 0.001. FIG. 4D shows Kaplan-Meier survival curves. P values were determined by the log- rank (Mantel-Cox) test. **P  <  0.01. FIG.4E shows representative images of HoxB13 protein immunostaining. Three days after the final treatment, the liver with metastatic PC-3 tumors were subjected to IHC analysis. Scale bar: 50 μm. FIG.4F shows H-score for HoxB13 protein. Data are presented as mean ± SEM. P values were calculated by two-tailed Student’s t-test, **p < 0.01.

[0008] FIG. 5A – FIG. 5C shows that repeated treatment with SCORT-CasRx-pre-gHoxB13 is well tolerated in immunocompetent mice. CD-1 mice were given I.V. administrations of DPBS, SCORT LNPs, SCORT-CasRx-pre-gControl, and SCORT-CasRx-pre-gHoxB13, respectively, twice a week for 6.5 weeks (n = 8). FIG.5A shows the change in body weight. Body weight at the start of treatment was set at 100%. FIG.5B shows that hepatic and renalfunctions were not impaired by SCORT-CasRx-pre-gHoxB13 treatment. ALT, alanine transaminase; AST, aspartate aminotransferase; BUN, blood urea nitrogen; CREAT, creatinine. Data are presented as box and whisker plots, where the box represents the median (center line) with bounds of the 25th to 75th percentiles. The whiskers extend to 1.5 times the interquartile range. P values were calculated by one-way ANOVA. ns, not significant. FIG. 5C shows that no substantial histopathological changes were observed in the indicated organ tissues following SCORT-CasRx-pre-gHoxB13 treatment. Scale bar: 100 μm.

[0009] FIG. 6A – FIG. 6G show direct cellular responses and transcriptional changes following SCORT-CasRx-pre-gHoxB13 treatment in AR+ CRPC liver metastasis mouse model. FIG. 6A shows a schematic illustration of the experimental design. Five weeks after LNCaP95 cell engraftment, mice received two doses of either SCORT-CasRx-pre-gControl or SCORT-CasRx-pre-gHoxB13 with a 3-day interval. Tumors were isolated three days after the second dose and subjected for analysis (n = 6). FIG.6B shows HoxB13 transcript level. Data are presented as mean ± SEM. P values were calculated by one-way ANOVA, ***P<0.001. FIG. 6C shows western blot of HoxB13 protein. Each lane represents an individual mouse. The ratio of HoxB13 to the loading control calnexin is listed below the blot. FIG. 6D shows representative immunostaining images. Scale bar 50 μm. FIG.6E shows volcano plot of gene expression changes between SCORT-CasRx-pre-gControl and SCORT-CasRx-pre-gHoxB13 treated groups. A total of 1,660 upregulated genes and 1,879 downregulated genes were identified and are highlighted in red. FIG 6F shows the validation of HoxB13, SNAI1 (encoding Snail) and CDH1 (encoding E-cadherin) gene expression changes in metastatic tumor samples by qRT-PCR. FIG.6G shows the identified top KEGG pathways by Cistrome GO from DEGs. Pathways associated with positive score are enriched from the upregulated genes and vice versa. The size of the point represents the number of genes, whereas the color represents -log10 (FDR) value.

[0010] FIG. 7 shows that CasRx-pre-gHoxB13 effectively reduced HoxB13 protein level in both AR+ and AR- CRPC cells. CasRx-pre-gHoxB13 reduced HoxB13 protein in LNCaP95 cells (left) and PC-3 cells (right). Samples were similarly treated as those in FIG.1F – FIG. 1H. Calnexin is a loading control.

[0011] FIG.8A – FIG.8C show the characterization of LNPs and SCORT LNPs. This figure is related to FIG.2. FIG.8A The encapsulation efficiency of LNPs candidates was determined by RiboGreen assay in triplicates. FIG.8B, Representative transmission electron microscopy (TEM) images of LNPs and SCORT LNPs. Scale bar: 200 nm. FIG. 8C, Size distribution,polydispersity index (PDI), and zeta potential of LNPs and SCORT LNPs candidates. Data are presented as mean ± SD.

[0012] FIG.9A – FIG. 9B shows that SCORT LNPs exhibit enhanced delivery to both AR+ and AR- CRPC cells. This figure is related to FIG.2. FIG.9A shows luminescence imaging of LNCaP95, PC-3 and AML12 cells after 24 h incubation with luciferase mRNA-encapsulated LNPs or SCORT LNPs (3 DMG-PEG for LNCaP95; 0.75 DMG-PEG for PC-3 and AML12). FIG. 9B, Flow cytometry analyses of LNCaP95, PC-3, and AML12 cells following 24 hr. incubation with EGFP or mCherry mRNA-encapsulated LNPs or SCORT LNPs.

[0013] FIG. 10A – FIG. 10B shows that SCORT-CasRx-pre-gHoxB13 treatment reduced HoxB13 protein level in liver metastatic tumors. FIG. 10A shows that integrated density of HoxB13 as quantification for FIG. 3F. Data are presented as mean ± SEM. P values were calculated by one-way ANOVA. ****p < 0.0001. FIG. 10B shows H-score for HoxB13 protein (n = 7). Data are presented as mean ± SEM. P values were calculated by two-tailed student’s t-test. **p < 0.01.

[0014] FIG. 11A – FIG. 11B shows the organ coefficient and hematology evaluation of SCORT-CasRx-pre-gHoxB13 treatment in CD-1 mice. FIG. 11A shows organ coefficient. The treatments were same as in FIG. 5. Coefficient is the organ weight normalized by the body weight. FIG. 11B shows that hematology was not impaired by SCORT-CasRx-pre- gHoxB13 treatment. WBC, white blood cell; RBC, red blood cell; PLT, platelet; RET, reticulocyte. All data are presented as mean ± SEM (n = 8). P values were calculated by one- way ANOVA, ns, not significant.

[0015] FIG. 12 shows that the plasma level of cytokine and chemokines following SCORT- CasRx-pre-gHoxB13 treatment in CD-1 mice. The treatments were the same as in FIG.5A – FIG. 5B. Data are represented as the mean ± SEM. P values were calculated by one-way ANOVA, *p < 0.05, **p < 0.01, ns, not significant.

[0016] FIG.13A – FIG.13E show the direct cellular and transcriptional impacts of SCORT- CasRx-pre-gHoxB13 on LNCaP95 liver metastasis model. This figure is related to FIG.6A – FIG. 6G. FIG. 13A shows a percentage of LNCaP95 cells within each tumor or non-tumor tissue sections as determined by H&E staining (n = 12). FIG.13B shows the integrated density of HoxB13 over the loading control for FIG. 6C. FIG. 13C shows the quantification of immunostaining and TUNEL assay (n = 6): H-score for HoxB13, E-Cadherin, and Snail; index for Ki67 and micro vessel density indicated by CD31 and vimentin. Data are presented as mean ± SEM. P values were calculated by two tailed Student’s t-tests, **p < 0.01, ***p < 0.001, ****p < 0.0001. FIG. 13D shows the heatmap of z-scored expression values of theidentified DEGs, with upregulated genes in red and downregulated genes in blue. FIG. 13E shows the validation of identified top-ranked genes in liver metastatic tumor samples by qRT- PCR. Data are represented the mean ± SEM. P values were calculated by two tailed Student’s t-tests, *p < 0.05, **p < 0.01, ***p < 0.001.

[0017] FIG.14 shows the correlation of gene expression levels with overall survival in SU2C East Coast and West Coast CRPC patient datasets. This figure is related to FIG. 6A – FIG. 6G. Upper panels: Overall survival from the start of first line ARSI treatment was compared between the highest and lowest tertile (25 cases) of NEIL3, LIG1, and ZNF727 expression within CRPC tumors from the East Coast SU2C dataset. Lower panels: Overall survival was compared between quartiles of NEIL3 (24 cases), approximate quintiles of LIG1 (20 cases), and approximate quartiles of ZNF727 (27 cases) expression in CRPC tumors from the West Coast SU2C dataset. P-values were calculated by log-rank (Mantel-Cox) test, *p < 0.05, **p < 0.01.

[0018] FIG. 15A – FIG. 15C shows the direct cellular outcomes of SCORT-CasRx-pre- gHoxB13 treatment in PC-3 liver metastasis mouse model. This figure is related to FIG.6A – FIG. 6G. FIG. 15A shows a schematic illustration of the experimental design. Two weeks after PC-3 cell injection, mice received two doses of either SCORT-CasRx-pre-gControl or SCORT-CasRx-pre-gHoxB13 with a 3-day interval. Three days after the second dose, liver samples with metastatic tumors were subjected for analysis (n = 6). A representative photomicrograph of an H&E-stained liver section was also shown. Scale bar: 20 μm. FIG. 15B shows representative immunostaining images. Scale bar: 50 μm. FIG. 15C shows the quantification of the immunostaining and TUNEL assay: H-scores for HoxB13, Vimentin, E- Cadherin and Snail; index for Ki67 and micro vessel density indicated by CD31. Data are presented as mean ± SEM. P values were calculated by two tailed Student’s t-tests, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. FIG. 16 shows the gating strategy employed in flow cytometry experiments. Cell debris and doublets were excluded by forward scatter (FSC) and side scatter (SSC) parameters, and this gating strategy was consistently applied to all samples. V. BRIEF SUMMARY

[0020] Disclosed herein is a lipid nanoparticle (LNP), comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core.

[0021] Disclosed herein is a lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide (pre-gRNA) targetingHOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core. Disclosed herein is a lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE- PEG-maleimide.

[0022] Disclosed herein is a lipid nanoparticle (LNP), comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject.

[0023] Disclosed herein is a lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject. Disclosed herein is a lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG- PEG 2000, and DSPE-PEG-maleimide, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject.

[0024] Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core.

[0025] Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core. Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG- PEG 2000, and DSPE-PEG-maleimide.

[0026] Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shellsurrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject.

[0027] Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject. Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre- guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject.

[0028] Disclosed herein is a lipid nanoparticle (LNP), comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos.

[0029] Disclosed herein is a method of treating cancer, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed LNPs. Disclosed herein is a method of treating cancer, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed pharmaceutical formulations comprising one or more disclosed LNPs. Disclosed herein is a method of treating a subject, the method comprising administering to a subject having metastatic prostate cancer a therapeutically effective amount of one or more disclosed LNPs. Disclosed herein is a method of treating a subject, the method comprising administering to a subject having metastatic prostate cancer a therapeutically effective amount of one or more disclosed pharmaceutical formulations comprising one or more disclosed LNPs. VI. DETAILED DESCRIPTION

[0030] The present disclosure describes formulations, compounded compositions, kits, capsules, containers, and / or methods thereof. It is to be understood that the inventive aspects of which are not limited to specific synthetic methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the presentinvention, example methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. A. Definitions

[0031] Before the present compounds, compositions, articles, systems, devices, and / or methods are disclosed and described, it is to be understood that they are not limited to specific synthetic methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, example methods and materials are now described.

[0032] This disclosure describes inventive concepts with reference to specific examples. However, the intent is to cover all modifications, equivalents, and alternatives of the inventive concepts that are consistent with this disclosure.

[0033] As used in the specification and the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise.

[0034] The phrase “consisting essentially of” limits the scope of a claim to the recited components in a composition or the recited steps in a method as well as those that do not materially affect the basic and novel characteristic or characteristics of the claimed composition or claimed method. The phrase “consisting of” excludes any component, step, or element that is not recited in the claim. The phrase “comprising” is synonymous with “including”, “containing”, or “characterized by”, and is inclusive or open-ended. “Comprising” does not exclude additional, unrecited components or steps.

[0035] In an aspect, when referring to any numerical value, the term “about” means a value falling within a range that is ± 10% of the stated value. In an aspect, “about” is used to provide flexibility to a numerical range endpoint by providing that a given value may be “slightly above” or “slightly below” the endpoint without affecting the desired result.

[0036] Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, a further aspect includes from the one particular value and / or to the other particular value. Similarly, when values are expressedas approximations, by use of the antecedent “about,” it will be understood that the particular value forms a further aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.

[0037] References in the specification and concluding claims to parts by weight of a particular element or component in a composition denotes the weight relationship between the element or component and any other elements or components in the composition or article for which a part by weight is expressed. Thus, in a compound containing 2 parts by weight component X and 5 parts by weight component Y, X and Y are present at a weight ratio of 2:5, and are present in such ratio regardless of whether additional components are contained in the compound.

[0038] In an aspect, the terms “optional” or “optionally” means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where said event or circumstance occurs and instances where it does not. In an aspect, a disclosed method can optionally comprise one or more additional steps, such as, for example, repeating an administering step or altering an administering step.

[0039] In an aspect, the term “subject” refers to the target of administration, e.g., a human being. The term “subject” also includes domesticated animals (e.g., cats, dogs, etc.), livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), and laboratory animals (e.g., mouse, rabbit, rat, guinea pig, fruit fly, etc.). Thus, the subject of the herein disclosed methods can be a vertebrate, such as a mammal, a fish, a bird, a reptile, or an amphibian. Alternatively, the subject of the herein disclosed methods can be a human, non-human primate, horse, pig, rabbit, dog, sheep, goat, cow, cat, guinea pig, or rodent. The term does not denote a particular age or sex, and thus, adult and child subjects, as well as fetuses, whether male or female, are intended to be covered. In an aspect, a subject can be a human patient. In an aspect, a subject can have cancer, be suspected of having cancer, or be at risk of developing cancer.

[0040] In an aspect, the term “diagnosed” means having been subjected to an examination by a person of skill, for example, a physician, and found to have a condition that can be diagnosed or treated by one or more of a disclosed LNP, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti- cancer agent, a disclosed chemotherapeutic agent, or a combination thereof, or by one or moreof the disclosed methods. For example, “diagnosed with a disease or disorder” means having been subjected to an examination by a person of skill, for example, a physician, and found to have a condition (such as cancer including prostate / metastatic prostate cancer) that can be treated by one or more of a disclosed LNP, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof, or by one or more of the disclosed methods. For example, “suspected of having a disease or disorder” can mean having been subjected to an examination by a person of skill, for example, a physician, and found to have a condition (such as cancer including prostate / metastatic prostate cancer) that can likely be treated by one or more of a disclosed LNP, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti- cancer agent, a disclosed chemotherapeutic agent, or a combination thereof, or by one or more of the disclosed methods. In an aspect, an examination can be physical, can involve various tests (e.g., blood tests, genotyping, biopsies, etc.), scans (e.g., CT scans, PET scans, etc.), and assays (e.g., enzymatic assay), or a combination thereof.

[0041] A “patient” refers to a subject afflicted with a disease or disorder (e.g., cancer such as cancer including prostate / metastatic prostate cancer). In an aspect, a patient can refer to a subject that has been diagnosed with or is suspected of having a disease or disorder (cancer such as cancer including prostate / metastatic prostate cancer) and is seeking treatment or receiving treatment.

[0042] In an aspect, the phrase “identified to be in need of treatment for a disease or disorder,” or the like, refers to selection of a subject based upon need for treatment of the disease or disorder. For example, a subject can be identified as having a need for treatment of a disease or disorder (e.g., cancer such as cancer including prostate / metastatic prostate cancer) based upon an earlier diagnosis by a person of skill and thereafter subjected to treatment for cancer (such as cancer including prostate / metastatic prostate cancer). In an aspect, the identification can be performed by a person different from the person making the diagnosis. In an aspect, the administration can be performed by one who performed the diagnosis.

[0043] In an aspect, “inhibit,” “inhibiting”, and “inhibition” mean to diminish or decrease an activity, level, response, condition, severity, disease, or other biological parameter. This can include, but is not limited to, the complete ablation of the activity, level, response, condition, severity, disease, or other biological parameter. This can also include, for example, a 10% inhibition or reduction in the activity, level, response, condition, severity, disease, or other biological parameter as compared to the native or control level (e.g., a subject not receivingone or more of a disclosed LNP, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof). Thus, in an aspect, the inhibition or reduction can be a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of reduction in between as compared to native or control levels. In an aspect, the inhibition or reduction can be 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% as compared to a native or control level (e.g., a subject not receiving one or more of a disclosed LNP, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof). In an aspect, the inhibition or reduction can be 0-25%, 25-50%, 50-75%, or 75-100% as compared to native or control levels. In an aspect, a native or control level can be a pre-disease or pre-disorder level (such as a pre-cancer state).

[0044] The words “treat” or “treating” or “treatment” include palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder. In an aspect, the terms cover any treatment of a subject, including a mammal (e.g., a human), and includes: (i) preventing the undesired physiological change, disease, pathological condition, or disorder from occurring in a subject that can be predisposed to the disease but has not yet been diagnosed as having it; (ii) inhibiting the physiological change, disease, pathological condition, or disorder, i.e., arresting its development; or (iii) relieving the physiological change, disease, pathological condition, or disorder, i.e., causing regression of the disease. For example, in an aspect, treating a disease or disorder can reduce the severity of an established a disease or disorder in a subject by 1%- 100% as compared to a control (such as, for example, an individual not having cancer). In an aspect, treating can refer to a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the severity of a disease or disorder (such as cancer including prostate / metastatic prostate cancer). For example, treating a disease or disorder can reduce one or more symptoms of a disease or disorder in a subject by 1%-100% as compared to a control (such as, for example, an individual not having cancer). In an aspect, treating can refer to 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%,70%, 80%, 90%, 100% reduction of one or more symptoms of an established a disease or disorder. It is understood that treatment does not necessarily refer to a cure or complete ablation or eradication of a disease or disorder. However, in an aspect, treatment can refer to a cure or complete ablation or eradication of a disease or disorder (such as cancer including prostate / metastatic prostate cancer).

[0045] In an aspect, the term “prevent” or “preventing” or “prevention” refers to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit, or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed. In an aspect, preventing a disease or disorder having chromatin deregulation and / or chromatin dysregulation is intended. The words “prevent”, “preventing”, and “prevention” also refer to prophylactic or preventative measures for protecting or precluding a subject (e.g., an individual) not having a given a disease or disorder (such as cancer including prostate / metastatic prostate cancer) or related complication from progressing to that complication. In an aspect, preventing metastasis is intended.

[0046] In an aspect, the terms “administering” and “administration” refer to any method of providing one or more disclosed nucleic acid molecules, one or more disclosed plasmids, one or more nanoparticles, one or more disclosed pharmaceutical formulations, or any combination thereof to a subject. Such methods are well known to those skilled in the art and include, but are not limited to, the following: oral administration, transdermal administration, administration by inhalation, nasal administration, topical administration, in utero administration, intratumoral administration, intrahepatic administration, intravaginal administration, ophthalmic administration, intraaural administration, otic administration, intracerebral administration, rectal administration, sublingual administration, buccal administration, and parenteral administration, including injectable such as intravenous administration, intra-CSF administration, intra-arterial administration, intramuscular administration, and subcutaneous administration. Administration can also include hepatic intra-arterial administration or administration through the hepatic portal vein (HPV). Administration of a disclosed nucleic acid molecule, a disclosed plasmid, a nanoparticle, a disclosed pharmaceutical formulation, a disclosed therapeutic agent, a disclosed immune modulator, a disclosed proteasome inhibitor, a disclosed small molecule, a disclosed endonuclease, a disclosed oligonucleotide, a disclosed RNA therapeutic, or any combination thereof can comprise administration directly into the CNS or the PNS or any organ or anytissue. Administration can be continuous or intermittent. Administration can comprise a combination of one or more routes.

[0047] In an aspect, the skilled person can determine an efficacious dose, an efficacious schedule, and an efficacious route of administration for a disclosed LNP, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti- chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof to treat or prevent a disease or disorder (such as cancer including prostate / metastatic prostate cancer). In an aspect, the skilled person can also alter, change, or modify an aspect of an administering step to improve efficacy of a disclosed LNP, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti- chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof.

[0048] By “determining the amount” is meant both an absolute quantification of a particular analyte (e.g., biomarker for cancer (prostate / metastatic prostate) for example) or a determination of the relative abundance of a particular analyte (e.g., a cancer (prostate / metastatic prostate) biomarker). The phrase includes both direct or indirect measurements of abundance or both.

[0049] In an aspect, “modifying the method” can comprise modifying or changing one or more features or aspects of one or more steps of a disclosed method. In an aspect, a method can be altered by changing the amount of a disclosed LNP, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti- cancer agent, a disclosed chemotherapeutic agent, or a combination thereof administered to a subject, or by changing the frequency of administration of a disclosed LNP, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti- chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof to a subject, by changing the duration of time that a disclosed LNP, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof is administered to a subject, or by substituting for one or more of the disclosed components and / or reagents with a similar or equivalent component and / or reagent. The same applies to all disclosed nucleic acid molecules, disclosed plasmids, disclosed LNPs, disclosed pharmaceutical formulations, disclosed therapeutic agents, disclosed immune modulators, disclosed proteasome inhibitors, disclosed small molecules, disclosedendonucleases, disclosed oligonucleotides, disclosed RNA therapeutics, or any combination thereof.

[0050] In an aspect, “concurrently” means (1) simultaneously in time, or (2) at different times during the course of a common treatment schedule.

[0051] In an aspect, the term “contacting” refers to bringing a disclosed LNP, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti- chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof together with a target area or intended target area in such a manner that a disclosed LNP, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof can exert an effect on the intended target or targeted area either directly or indirectly. A target area or intended target area can be one or more of a subject’s organs (e.g., lungs, heart, liver, kidney, brain, etc.) hosting cancerous cells or cells infected with COVID-19. In an aspect, a target area or intended target area can be any cell or any organ infected by a disease or disorder (such as cancer including prostate / metastatic prostate cancer). In an aspect, a target area or intended target area can be any organ, tissue, or cells that are affected by a disease or disorder (such as cancer including prostate / metastatic prostate cancer).

[0052] In an aspect, “determining” can refer to measuring or ascertaining the presence and severity of a disease or disorder, such as, for example, cancer (prostate / metastatic prostate). Methods and techniques used to determine the presence and / or severity of a disease or disorder are typically known to the medical arts. For example, the art is familiar with the ways to identify and / or diagnose the presence, severity, or both of a disease or disorder (such as, for example, cancer (prostate / metastatic prostate).

[0053] In an aspect, “effective amount” and “amount effective” can refer to an amount that is sufficient to achieve the desired result such as, for example, the treatment and / or prevention of a disease or disorder (e.g., a cancer (prostate / metastatic prostate) or a suspected disease or disorder. In an aspect, the terms “effective amount” and “amount effective” can refer to an amount that is sufficient to achieve the desired an effect on an undesired condition (e.g., prostate / metastatic prostate cancer). For example, a “therapeutically effective amount” refers to an amount that is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms, but is generally insufficient to cause adverse side effects.

[0054] In an aspect, “therapeutically effective amount” means an amount of the disclosed LNP, the disclosed pharmaceutical formulation, the disclosed plasmid, the disclosed targetedtherapy, the disclosed anti-chemokine, the disclosed anti-cancer agent, the disclosed chemotherapeutic agent, or the combination thereof that (i) treats the particular disease, condition, or disorder (e.g., prostate / metastatic prostate cancer), (ii) attenuates, ameliorates, or eliminates one or more symptoms of the particular disease, condition, or disorder e.g., cancer (e.g., prostate / metastatic prostate cancer), or (iii) delays the onset of one or more symptoms of the particular disease, condition, or disorder described herein (e.g., prostate / metastatic prostate cancer). The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the disclosed LNP, the disclosed pharmaceutical formulation, the disclosed plasmid, the disclosed targeted therapy, the disclosed anti-chemokine, the disclosed anti-cancer agent, the disclosed chemotherapeutic agent, or the combination thereof employed; the disclosed methods employed; the age, body weight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of excretion of the disclosed LNP, the disclosed pharmaceutical formulation, the disclosed plasmid, the disclosed targeted therapy, the disclosed anti-chemokine, the disclosed anti-cancer agent, the disclosed chemotherapeutic agent, or the combination thereof employed; the duration of the treatment; drugs used in combination or coincidental with the disclosed LNP, the disclosed pharmaceutical formulation, the disclosed plasmid, the disclosed targeted therapy, the disclosed anti-chemokine, the disclosed anti-cancer agent, the disclosed chemotherapeutic agent, or the combination thereof employed, and other like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the disclosed LNP, the disclosed pharmaceutical formulation, the disclosed plasmid, the disclosed targeted therapy, the disclosed anti-chemokine, the disclosed anti-cancer agent, the disclosed chemotherapeutic agent, or the combination thereof at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, then the effective daily dose can be divided into multiple doses for purposes of administration. Consequently, a single dose of the disclosed LNP, the disclosed pharmaceutical formulation, the disclosed plasmid, the disclosed targeted therapy, the disclosed anti-chemokine, the disclosed anti-cancer agent, the disclosed chemotherapeutic agent, or the combination thereof can contain such amounts or submultiples thereof to make up the daily dose. The dosage can be adjusted by the individual physician in the event of any contraindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products. In further various aspects, a preparation can be administered in a “prophylactically effective amount”;that is, an amount effective for prevention of a disease or condition, such as, for example, a disease or disorder due to a missing, deficient, and / or mutant protein or enzyme.

[0055] “Endogenous” with reference to a gene, protein, and / or nucleic acid refers to the natural presence of that gene, protein, and / or nucleic acid in a cell, such as an immune cell.

[0056] “Exogenous” refers to an introduced agent, such as a nucleic acid, gene, or protein, into a cell, for example from an outside source. A nucleic acid introduced into a cell is exogenous even if it encodes a protein which is naturally found in the cell. Such exogenous introduction of a nucleic acid encoding a protein can be used to increase the expression of the protein over the level that would naturally be found in the cell under similar conditions, e.g., without introduction of the exogenous nucleic acid.

[0057] The term “immunotherapy” refers to the treatment of a subject afflicted with, or at risk of contracting or suffering a recurrence of, a disease by a method comprising inducing, enhancing, suppressing or otherwise modifying an immune response. Examples of immunotherapy can include, but are not limited to, NK cells and T cell therapies. T cell therapy can include adoptive T cell therapy, tumor-infiltrating lymphocyte (TIL) immunotherapy, autologous cell therapy, engineered autologous cell therapy (eACTTM), and allogeneic T cell transplantation. However, one of skill in the art would recognize that the conditioning methods disclosed herein would enhance the effectiveness of any transplanted T cell therapy.

[0058] In an aspect, “RNA therapeutics” can refer to the use of oligonucleotides to target RNA. RNA therapeutics can offer the promise of uniquely targeting the precise nucleic acids involved in a particular disease with greater specificity, improved potency, and decreased toxicity. This could be particularly powerful for genetic diseases where it is most advantageous to aim for the RNA as opposed to the protein. In an aspect, a therapeutic RNA can comprise one or more expression sequences. As known to the art, expression sequences can comprise an RNAi, shRNA, mRNA, non-coding RNA (ncRNA), an antisense such as an antisense RNA, miRNA, morpholino oligonucleotide, peptide-nucleic acid (PNA) or ssDNA (with natural, and modified nucleotides, including but not limited to, LNA, BNA, 2’-O-Me-RNA, 2’-MEO-RNA, 2’-F- RNA), or analog or conjugate thereof. In an aspect, a disclosed therapeutic RNA can comprise one or more long non-coding RNA (lncRNA), such as, for example, a long intergenic non- coding RNA (lincRNA), pre-transcript, pre-miRNA, pre-mRNA, competing endogenous RNA (ceRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), pseudo-gene, rRNA, or tRNA. In an aspect, ncRNA can be piwi-interacting RNA (piRNA), primary miRNA (pri- miRNA), or premature miRNA (pre-miRNA). In an aspect, a disclosed therapeutic RNA or an RNA therapeutic can comprise antisense oligonucleotides (ASOs) that inhibit mRNAtranslation, oligonucleotides that function via RNA interference (RNAi) pathway, RNA molecules that behave like enzymes (ribozymes), RNA oligonucleotides that bind to proteins and other cellular molecules, and ASOs that bind to mRNA and form a structure that is recognized by RNase H resulting in cleavage of the mRNA target. In an aspect, RNA therapeutics can comprise RNAi and ASOs that inhibit mRNA translation. Generally speaking, as known to the art, RNAi operates sequence specifically and post-transcriptionally by activating ribonucleases which, along with other enzymes and complexes, coordinately degrade the RNA after the original RNA target has been cut into smaller pieces while antisense oligonucleotides bind to their target nucleic acid via Watson-Crick base pairing, and inhibit or alter gene expression via steric hindrance, splicing alterations, initiation of target degradation, or other events.

[0059] In an aspect, Type VI CRISPR enzymes are programmable RNA-guided, RNA- targeting Cas proteins with nuclease activity that allow for target gene knock-down without altering the genome. In addition to target RNA knock-down, Cas13 proteins (as described infra) can be used for viral RNA detection, site-directed RNA editing, demethylation of m6A- modified transcripts, RNA live-imaging, and modulation of splice site choice as well as cleavage and polyadenylation site usage. Cas13 proteins are guided to their target RNAs by a single CRISPR RNA (crRNA) composed of a direct repeat (DR) stem loop and a spacer sequence (target specific guide RNA (gRNA)) that mediates target recognition by RNA-RNA hybridization. To date, three Cas13 effector proteins (PguCas13b, PspCas13b, RfxCas13d) have been reported to show high RNA knock-down efficacy with minimal off-target activity.

[0060] In an aspect, the terms “cancer” and “cancerous” refer to or describe the physiological condition in mammals in which a population of cells are characterized by unregulated cell growth. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More particular examples of such cancers include squamous cell cancer, small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney cancer, liver cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma and various types of head and neck cancer. In an aspect, cancer can comprise prostate cancer or metastatic prostate cancer. In an aspect, prostate cancer is a castration resistant prostate cancer (CRPC) or a neuroendocrine prostate cancer (NEPC).

[0061] The terms “proliferative disorder” and “proliferative disease” refer to disorders associated with abnormal cell proliferation (such as cancer such as cancer including prostate / metastatic prostate cancer). In an aspect, “tumor” and “neoplasm” refer to any mass of tissue that result from excessive cell growth or proliferation, either benign (noncancerous) or malignant (cancerous) including pre-cancerous lesions. In an aspect, “metastasis” refers to the process by which a cancer spreads or transfers from the site of origin to other regions of the body with the development of a similar cancerous lesion at the new location. A “metastatic” or “metastasizing” cell is one that loses adhesive contacts with neighboring cells and migrates via the bloodstream or lymph from the primary site of disease to invade neighboring body structures.

[0062] The terms “cancer cell” or “tumor cell” and grammatical equivalents refer to the total population of cells derived from a tumor including both non-tumorigenic cells, which comprise the bulk of the tumor cell population, and tumorigenic stem cells (cancer stem cells).

[0063] In an aspect “tumorigenic” refers to the functional features of a solid tumor stem cell including the properties of self-renewal (giving rise to additional tumorigenic cancer stem cells) and proliferation to generate all other tumor cells (giving rise to differentiated and thus non-tumorigenic tumor cells) that allow solid tumor stem cells to form a tumor.

[0064] “Sequence identity” and “sequence similarity” can be determined by alignment of two peptide or two nucleotide sequences using global or local alignment algorithms. Sequences may then be referred to as “substantially identical” or “essentially similar” when they are optimally aligned. For example, sequence similarity or identity can be determined by searching against databases such as FASTA, BLAST, etc., but hits should be retrieved and aligned pairwise to compare sequence identity. Two proteins or two protein domains, or two nucleic acid sequences can have “substantial sequence identity” if the percentage sequence identity is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more, preferably 90%, 95%, 98%, 99% or more. Such sequences are also referred to as “variants” herein, e.g., other variants of a missing, deficient, and / or mutant protein or enzyme. Sequences with substantial sequence identity do not necessarily have the same length and may differ in length. For example, sequences that have the same nucleotide sequence, but of which one has additional nucleotides on the 3’- and / or 5’-side, are 100% identical.

[0065] In an aspect, “immune-modulating” refers to the ability of a disclosed isolated nucleic acid molecules, a disclosed vector, a disclosed pharmaceutical formulation, or a disclosed agent to alter (modulate) one or more aspects of the immune system. The immune system functions to protect the organism from infection and from foreign antigens by cellular and humoralmechanisms involving lymphocytes, macrophages, and other antigen-presenting cells that regulate each other by means of multiple cell-cell interactions and by elaborating soluble factors, including lymphokines and antibodies, that have autocrine, paracrine, and endocrine effects on immune cells.

[0066] In an aspect, a disclosed pharmaceutically acceptable carrier can refer to sterile aqueous or nonaqueous solutions, dispersions, suspensions, or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use. In an aspect, examples of suitable aqueous and nonaqueous carriers, diluents, solvents, or vehicles include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol and the like), carboxymethylcellulose and suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. In an aspect, a pharmaceutical carrier employed can be a solid, liquid, or gas. In an aspect, examples of solid carriers can include lactose, terra alba, sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate, and stearic acid. In an aspect, examples of liquid carriers can include sugar syrup, peanut oil, olive oil, and water. In an aspect, examples of gaseous carriers can include carbon dioxide and nitrogen. In preparing a disclosed composition for oral dosage form, any convenient pharmaceutical media can be employed. For example, water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents and the like can be used to form oral liquid preparations such as suspensions, elixirs and solutions; while carriers such as starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrating agents, and the like can be used to form oral solid preparations such as powders, capsules and tablets. Because of their ease of administration, tablets and capsules are the preferred oral dosage units whereby solid pharmaceutical carriers are employed. Optionally, tablets can be coated by standard aqueous or nonaqueous techniques. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants. These compositions can also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms can be ensured by the inclusion of various antibacterial and antifungal agents such as paraben, chlorobutanol, phenol, sorbic acid and the like. It can also be desirable to include isotonic agents such as sugars, sodium chloride and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the inclusion of agents, such as aluminum monostearate and gelatin, which delay absorption. Injectable depot forms are made by forming microencapsule matrices of the drug in biodegradable polymers such as polylactide-polyglycolide, poly(orthoesters) and poly(anhydrides). Depending uponthe ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions that are compatible with body tissues. The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable media just prior to use. Suitable inert carriers can include sugars such as lactose. Desirably, at least 95% by weight of the particles of the active ingredient have an effective particle size in the range of 0.01 to 10 micrometers.

[0067] In an aspect, the term “excipient” refers to an inert substance which is commonly used as a diluent, vehicle, preservative, binder, or stabilizing agent, and includes, but is not limited to, proteins (e.g., serum albumin, etc.), amino acids (e.g., aspartic acid, glutamic acid, lysine, arginine, glycine, histidine, etc.), fatty acids and phospholipids (e.g., alkyl sulfonates, caprylate, etc.), surfactants (e.g., SDS, polysorbate, nonionic surfactant, etc.), saccharides (e.g., sucrose, maltose, trehalose, etc.) and polyols (e.g., mannitol, sorbitol, etc.). See, also, for reference, Remington’s Pharmaceutical Sciences, (1990) Mack Publishing Co., Easton, Pa., which is hereby incorporated by reference in its entirety.

[0068] In an aspect, the term “package insert” is used to refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration, contraindications and / or warnings concerning the use of such therapeutic products.

[0069] In an aspect, the term “in combination” in the context of the administration of other therapies (e.g., other agents) includes the use of more than one therapy (e.g., drug therapy). Administration “in combination with” one or more further therapeutic agents includes simultaneous (e.g., concurrent) and consecutive administration in any order. The use of the term “in combination” does not restrict the order in which therapies are administered to a subject. By way of non-limiting example, a first therapy (e.g., the disclosed LNP, the disclosed pharmaceutical formulation, the disclosed plasmid, the disclosed targeted therapy, the disclosed anti-chemokine, the disclosed anti-cancer agent, the disclosed chemotherapeutic agent, or the combination thereof) can be administered prior to (e.g., 1 minute, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, or 12 weeks), concurrently, or after (e.g., 1 minute, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours,6 hours, 7 hours, 8 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, or 12 weeks or longer) the administration of a second therapy to a subject having or diagnosed with cancer (prostate / metastatic prostate cancer).

[0070] Disclosed are the components to be used to prepare a disclosed LNP, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti- chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof used within the methods disclosed herein. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds cannot be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular compound is disclosed and discussed and a number of modifications that can be made to a number of molecules including the compounds are discussed, specifically contemplated is each and every combination and permutation of the compound and the modifications that are possible unless specifically indicated to the contrary. Thus, if a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning combinations, A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered disclosed. Likewise, any subset or combination of these is also disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E would be considered disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the compositions of the invention. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific aspect or combination aspects of the methods of the invention. B. Compositions for Use in the Disclosed Methods 1. Nanoparticles

[0071] Disclosed herein is a lipid nanoparticle (LNP), comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA.

[0072] Disclosed herein is a lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide (pre-gRNA) targetingHOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core. Disclosed herein is a lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE- PEG-maleimide.

[0073] Disclosed herein is a lipid nanoparticle (LNP), comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject.

[0074] Disclosed herein is a lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject. Disclosed herein is a lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG- PEG 2000, and DSPE-PEG-maleimide, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject.

[0075] Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA.

[0076] Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core. Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNAoligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG- PEG 2000, and DSPE-PEG-maleimide.

[0077] Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject.

[0078] Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject. Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre- guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject.

[0079] Disclosed herein is a lipid nanoparticle (LNP), comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA.

[0080] Disclosed herein is a lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos. Disclosed herein is a lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shellsurrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE- PEG-maleimide, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos.

[0081] Disclosed herein is a lipid nanoparticle (LNP), comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos.

[0082] Disclosed herein is a lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos. Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE- PEG-maleimide, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos.

[0083] Disclosed herein is a lipid nanoparticle (LNP), comprising (i) a core comprising one or more plasmids comprising RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA.

[0084] Disclosed herein is a lipid nanoparticle (LNP), comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre- guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core. Disclosed herein is a lipid nanoparticle (LNP), comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shellsurrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE- PEG-maleimide.

[0085] Disclosed herein is a lipid nanoparticle (LNP), comprising (i) a core comprising a plasmid comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface- modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject.

[0086] Disclosed herein is a lipid nanoparticle (LNP), comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre- guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject. Disclosed herein is a lipid nanoparticle (LNP), comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG- PEG 2000, and DSPE-PEG-maleimide, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject.

[0087] Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising (i) a core comprising a plasmid comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core. In an aspect, a disclosed RNA cargo molecule can comprise a plasmid comprising at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA.

[0088] Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core. Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide(pre- gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modifiedshell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide.

[0089] Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising (i) a core comprising a plasmid comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject.

[0090] Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject. Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre- guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject.

[0091] Disclosed herein is a lipid nanoparticle (LNP), comprising (i) a plasmid comprising a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA.

[0092] Disclosed herein is a lipid nanoparticle (LNP), comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre- guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos. Disclosed herein is a lipid nanoparticle (LNP), comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide(pre-gRNA)targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE- PEG-maleimide, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos.

[0093] Disclosed herein is a lipid nanoparticle (LNP), comprising (i) a core comprising a plasmid comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface- modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos.

[0094] Disclosed herein is a lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos. Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE- PEG-maleimide, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos.

[0095] In an aspect, a disclosed pre-gRNA oligonucleotide can further comprise one or more direct repeat (DR) sequences. In an aspect, a disclosed DR sequence can comprise the sequence set forth in SEQ ID NO:11. In an aspect, a disclosed pre-gRNA oligonucleotide targeting HOXB13 mRNA can comprise the sequence set forth in any one of SEQ ID NO:01 - SEQ ID NO:04 and a disclosed DR can comprise the sequence set forth in SEQ ID NO:11. In an aspect, a disclosed pre-gRNA oligonucleotide targeting HOXB13 mRNA can comprise the sequence set forth in any one of SEQ ID NO:05 - SEQ ID NO:08 and a disclosed DR can comprise the sequence set forth in SEQ ID NO:11.

[0096] In an aspect, a disclosed DR – pre-gRNA oligonucleotide targeting HoxB13 mRNA – DR sequence can comprise the sequence set forth in SEQ ID NO:86. In an aspect, a disclosed DR – pre-gRNA oligonucleotide targeting HoxB13 mRNA – DR sequence can comprise the sequence set forth in SEQ ID NO:87. In an aspect, a disclosed DR – pre-gRNA oligonucleotidetargeting HoxB13 mRNA – DR sequence can comprise the sequence set forth in SEQ ID NO:88. In an aspect, a disclosed DR – pre-gRNA oligonucleotide targeting HoxB13 mRNA – DR sequence can comprise the sequence set forth in SEQ ID NO:89. In an aspect, a disclosed DR – pre-gRNA oligonucleotide targeting HoxB13 mRNA (reverse complementary) – DR sequence can comprise the sequence set forth in SEQ ID NO:91. In an aspect, a disclosed DR – pre-gRNA oligonucleotide targeting HoxB13 mRNA (reverse complementary) – DR sequence can comprise the sequence set forth in SEQ ID NO:92. In an aspect, a disclosed DR – pre-gRNA oligonucleotide targeting HoxB13 mRNA (reverse complementary) – DR sequence can comprise the sequence set forth in SEQ ID NO:93. In an aspect, a disclosed DR – pre-gRNA oligonucleotide targeting HoxB13 mRNA (reverse complementary) – DR sequence can comprise the sequence set forth in SEQ ID NO:94.

[0097] In an aspect of a disclosed DR – pre-gRNA oligonucleotide targeting HoxB13 mRNA (reverse complementary) – DR sequence, the DR sequence can comprise SEQ ID NO:11 and the pre-gRNA oligonucleotide targeting HOXB13 can be any pre-gRNA oligonucleotide targeting a portion of SEQ ID NO:18.

[0098] In an aspect, a disclosed pre-gRNA oligonucleotide can target any portion of HOXB13 mRNA. In an aspect, a disclosed pre-gRNA oligonucleotide can target any portion of the mRNA set forth in SEQ ID NO:18.

[0099] In an aspect, a disclosed pre-gRNA oligonucleotide targeting HOXB13 mRNA can comprise a sequence having reverse complementarity to the sequence set forth in SEQ ID NO:01. In an aspect, a disclosed pre-gRNA oligonucleotide targeting HOXB13 mRNA can comprise a sequence having reverse complementarity to the sequence set forth in SEQ ID NO:02. In an aspect, a disclosed pre-gRNA oligonucleotide targeting HOXB13 mRNA can comprise a sequence having reverse complementarity to the sequence set forth in SEQ ID NO:03. In an aspect, a disclosed pre-gRNA oligonucleotide targeting HOXB13 mRNA can comprise a sequence having reverse complementarity to the sequence set forth in SEQ ID NO:04. In an aspect, SEQ ID NO:05 can be reverse complementary to SEQ ID NO:01. In an aspect, SEQ ID NO:06 can be reverse complementary to SEQ ID NO:02. In an aspect, SEQ ID NO:07 can be reverse complementary to SEQ ID NO:03. In an aspect, SEQ ID NO:08 can be reverse complementary to SEQ ID NO:04.

[0100] In an aspect, HOXB13 is Homeobox B13. This gene encodes a transcription factor that belongs to the homeobox gene family. Genes of this family are highly conserved among vertebrates and essential for vertebrate embryonic development. This gene has been implicated to play a role in fetal skin development and cutaneous regeneration. In mice, a similar genewas shown to exhibit temporal and spatial colinearity in the main body axis of the embryo, but was not expressed in the secondary axes, which suggests functions in body patterning along the axis. This gene and other HOXB genes form a gene cluster at chromosome the 17q21-22 region. In an aspect, HOXB13 is identified as HGNC 5112, NCBI Gene 10481, Ensembl ENSG00000159184, OMIM 604607, or UniProtKB / Swiss-Prot Q92826.

[0101] In an aspect, a disclosed HOXB13 mRNA can comprise the sequence set forth in SEQ ID NO:18. In an aspect, a disclosed HOXB13 mRNA can comprise a fragment of the sequence set forth in SEQ ID NO:18.

[0102] In an aspect, a disclosed HOXB13 mRNA can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more than 95% identified to the sequence set forth in SEQ ID NO:18. In an aspect, a disclosed targeted HOXB13 mRNA can exist in a prostate cancer cell. In an aspect, a disclosed targeted HOXB13 mRNA can exist in a metastatic prostate cancer cell. In an aspect, a disclosed targeted HOXB13 mRNA can exist in a metastatic prostate cancer cell in a subject’s liver.

[0103] In an aspect, FTT5 is Functionalized N1,N3,N5-tris(2-aminoethyl)benzene-1,3,5- Tricarboxamide 5. FTT5 is also referred to as 9,9′,9′′,9′′′,9′′′′,9′′′′′-[1,3,5- benzenetriyltris(carbonylimino-3,1-propanediylnitrilo)]hexakis-nonanoic acid, 1,1′,1′′,1′′′,1′′′′,1′′′′′-hexakis(1-ethylhexyl) ester, and is identified as CAS 2803606-43-9. FTT5 is a lipid-like compound that has been used in the formation of lipid-like nanoparticles (LLNs) and is a derivative of the ionizable cationic amino lipid TT3. In an aspect, a disclosed FTT5 can be ionizable.

[0104] 18:1 (Δ9-Cis) PE (DOPE), also known as 1,2-dioleoyl-sn-glycero-3- phosphoethanolamine, is a type of neutral phospholipid that displays sensitivity to changes in acidity (pH change), and is identified as CAS No. 4004-05-1. At acidic, it is an inverted hexagonal micelle and becomes spherical micelle at alkaline pH.

[0105] DMG-PEG 2000, also known as 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000, is a lipid excipient designed for the preparation of lipid nanoparticles (LNPs) for RNA delivery, and is identified as CAS No. 160743-62-4. It is derived from dimyristoyl glycerol (DMG) and exhibits similar properties as phospholipids in the way it associates with membranes.

[0106] DSPE-PEG(2000) Maleimide, also known as 1,2-distearoyl-sn-glycero-3- phosphoethanolamine-N-[maleimide(polyethylene glycol)-2000] (ammonium salt) and is identified as CAS No. 474922-22-0.

[0107] In an aspect, a disclosed shell can comprise (i) functionalized N1,N3,N5-tris(2- aminoethyl)benzene-1,3,5-Tricarboxamide 5 (FTT5), (ii) 1,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE), (iii) cholesterol, and (iv) 1,2-dimyristoyl-rac-glycero-3- methoxypolyethylene glycol-2000 (DMG-PEG 2000).

[0108] In an aspect, a disclosed shell can further comprise 1,2-distearoyl-sn-glycero-3- phosphoethanolamine-N-[maleimide(polyethylene glycol)-2000] (ammonium salt) (DSPE- PEG-maleimide), and wherein DSPE-PEG-maleimide contributes to E3 aptamer coupling.

[0109] In an aspect, a disclosed shell can further comprise a molar ratio of about 15% to about 25% FTT5, about 20% to about 40% DOPE, about 35% to about 45% cholesterol, about 0.1% to about 5.0% DMG-PEG 2000, and about 0.1% to about 3% DSPE-PEG-maleimide. In an aspect, a disclosed shell can further comprise about a molar ratio of about 20% FTT5, about 30% DOPE, about 39% cholesterol, about 0.75% DMG-PEG 2000, and about 1% DSPE-PEG- maleimide. In an aspect, a disclosed shell can further comprise about a molar ratio of about 20% FTT5, about 30% DOPE, about 38.25% cholesterol, about 1.5% DMG-PEG 2000, and about 1% DSPE-PEG-maleimide. In an aspect, a disclosed shell can further comprise about a molar ratio of about 20% FTT5, about 30% DOPE, about 36.75% cholesterol, about 3.0% DMG-PEG 2000, and about 1% DSPE-PEG-maleimide.

[0110] In an aspect, a disclosed LNP can comprise FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide in a molar ratio of 20:30:39:0.75:1, or a molar ratio of 20:30:38.25:1.5:1, or a molar ratio of 20:30:36.75:3:1.

[0111] In an aspect, a disclosed LNP can comprise a weight ratio of lipids:RNAs of about 10:1 to about 30:1. For example, in an aspect, a disclosed LNP can comprise a weight ratio of lipids:RNAs of about 10:1, about 11:1, about 12:1, about 13:1, about 14:1, about 15:1, about 16:1, about 17:1, about 18:1, about 19:1, about 20:1, about 21:1, about 22:1, about 23:1, about 24:1, about 25:1, about 26:1, about 27:1, about 28:1, about 29:1, or about 30:1.

[0112] In an aspect, a therapeutically effective amount can comprise about a 1:1 ratio of Cas13d mRNA:pre-gRNA oligonucleotide (wt / wt) and about a 20:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:1.5 ratio of Cas13d mRNA:pre-gRNA oligonucleotide (wt / wt) and about a 20:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:2 ratio of Cas13d mRNA:pre-gRNA oligonucleotide (wt / wt) and about a 20:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:1 ratio of Cas13d mRNA:pre-gRNA oligonucleotide (wt / wt) and about a 19:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:1.5 ratio ofCas13d mRNA:pre-gRNA oligonucleotide (wt / wt) and about a 19:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:2 ratio of Cas13d mRNA:pre-gRNA oligonucleotide (wt / wt) and about a 19:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:1 ratio of Cas13d mRNA:pre-gRNA oligonucleotide (wt / wt) and about a 21:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:1.5 ratio of Cas13d mRNA:pre-gRNA oligonucleotide (wt / wt) and about a 21:1 ratio lipid:total RNA (wt / wt). In an aspect, a therapeutically effective amount can comprise about a 1:2 ratio of Cas13d mRNA:pre-gRNA oligonucleotide (wt / wt) and about a 21:1 ratio lipid:total RNA (wt / wt).

[0113] In an aspect, a disclosed LNP can comprise a size of at least 100 nm to at least 200 nm, or wherein the LNP comprises a size of about 100 nm to about 200 nm. In an aspect, a disclosed LNP can comprise a size of at least 120 nm to at least 190 nm, or wherein the LNP comprises a size of about 120 nm to about 190 nm. In an aspect, a disclosed LNP can comprise a size of at least 100 nm, at least 110 nm, at least 120 nm, at least 130 nm, at least 140 nm, at least 150 nm, at least 160 nm, at least 170 nm, at least 180 nm, at least 190 nm, or at least 200 nm. In an aspect, a disclosed LNP can have a size of about 10 nm to 1000 nm. In an aspect, a disclosed NP can have a size of about 10 nm to about 50 nm, about 50 to about 100 nm, about 100 nm to about 200 nm, about 200 nm to about 300 nm, about 300 nm to about 400 nm, about 400 nm to about 500 nm, about 500 nm to about 600 nm, about 600 nm to about 700 nm, about 700 nm to about 800 nm, about 800 nm to about 900 nm, or about 900 nm to about 1000 nm. In an aspect a disclosed population of NPs can have an average size of about 100 nm, about 125 nm, about 150 nm, about 175 nm, about 200 nm, about 225 nm, about 250 nm, about 275 nm, about 300 nm, about 325 nm, about 350 nm, about 375 nm, about 400 nm, about 425 nm, about 450 nm, about 475 nm, about 500 nm, about 525 nm, about 550 nm, about 575 nm, about 600 nm, about 625 nm, about 650 nm, about 675 nm, about 700 nm, about 725 nm, about 750 nm, about 775 nm, about 800 nm, about 825 nm, about 850 nm, about 875 nm, about 900 nm, about 925 nm, about 950 nm, about 975 nm, or about 1000 nm.

[0114] In an aspect, a disclosed LNP can have a zeta potential of about 2.0 mV, about 2.25 mV, about 2.5 mV, about 2.75 mV, or about 3.0 mV. In an aspect, a disclosed LNP can comprise a spherical shape.

[0115] In an aspect, a disclosed E3 aptamer can be specific for prostate cancer cells or metastatic prostate cancer cells. In an aspect, a disclosed E3 aptamer can bind to a transferrin receptor (TfR1) on the surface of prostate cancer cells. In an aspect, a disclosed E3 aptamercan comprise the sequence set forth in SEQ ID NO:12. In an aspect, a disclosed E3 aptamer can comprise a fragment of the sequence set forth in SEQ ID NO:12. In an aspect, a disclosed E3 aptamer can recognize or can be used to target both AR-positive and -negative CRPC cells or metastatic CRPC cells. In an aspect, a disclosed E3 aptamer can recognize or can be used to target both AR-positive and -negative CRPC cells or metastatic CRPC cells in a subject’s liver. In an aspect, a disclosed LNP can target metastatic castration-resistant prostate cancer (CRPC) cells in the liver of a subject. In an aspect, a disclosed E3 aptamer can recognize or can be used to target both AR-positive and -negative CRPC cells that have metastasized to a subject’s liver.

[0116] In an aspect of a disclosed LNP, a disclosed Cas13d mRNA can be that of Ruminococcus flavefaciens (CasRx). In an aspect, a disclosed CasRx mRNA can comprise the sequence set forth in SEQ ID NO:15 or SEQ ID NO:16. In an aspect, a disclosed CasRx mRNA can comprise a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more than 95% identity to the sequence set forth in SEQ ID NO:15 or SEQ ID NO:16.

[0117] In an aspect, a disclosed reduction of HOXB13 expression in metastatic CRPC cells can reduce expression of FACMR and / or CERS3. In an aspect, a disclosed LNP can inhibit the non-canonical, epithelial,-mesenchymal transition (EMT)-independent oncogenic function of SNAIL.

[0118] In an aspect, a disclosed LNP can comprise an encapsulation rate of at least 50% to at least 100%. In an aspect, a disclosed encapsulation rate can comprise at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, or at least 100%.

[0119] In an aspect, a disclosed LNP can comprise a polydispersity index (PDI) of less than 1, less than 0.9, less than 0.8, less than 0.7, less than 0.6, less than 0.5, less than 0.4, less than 0.3, less than 0.2, less than 0.1, or less than 0.05. In an aspect, a disclosed LNP can comprise a PDI of about 0.2. In an aspect, a disclosed polydispersity index (PDI) can be used as a measure of broadness of molecular weight distribution. In an aspect, the larger the PDI, the broader the molecular weight. In an aspect, PDI of a polymer is calculated as the ratio of weight average by number average molecular weight. In an aspect, PDI = Mw / Mn. Mw is weight average molecular weight and Mn is the number average molecule weight.

[0120] In an aspect, a disclosed targeted HOXB13 mRNA can be in metastatic castration- resistant prostate cancer (CRPC) cells. In an aspect, a disclosed targeted HOXB13 mRNA in metastatic castration-resistant prostate cancer (CRPC) cells can be in the liver of a subject.

[0121] In an aspect, a disclosed LNP does not simulate the expression of one or more inflammatory cytokines and / or chemokines. In an aspect, a disclosed inflammatory cytokines and / or chemokines can comprise IFN-γ, IL-1α, IL-1β, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12 (p40), IL12 (p70), IP-10, KC, MCP-1, MIP-2, MIP, MIG, VEGF-A, TNFα, or any combination thereof.

[0122] In an aspect, a disclosed LNP can reduce HOXB13 expression in metastatic CRPC cells and / or inhibited further metastasis of CRPC cells, inhibits cell proliferation, inhibits angiogenesis, slows cell metabolism, induces apoptosis, or any combination thereof.

[0123] In an aspect, a disclosed LNP does not elicit systemic toxicity as measured by liver function and / or kidney function assessment.

[0124] In an aspect, a disclosed LNP does not elicit an exaggerated immune response.

[0125] In an aspect, a disclosed LNP can reduce expression of the SNAI1 gene and the expression of one or more of SKP2, MCM3, and CCNB1.

[0126] In an aspect, SNAI1 is Snail Family Transcriptional Repressor 1. SNAI1 is involved in induction of the epithelial to mesenchymal transition (EMT), formation and maintenance of embryonic mesoderm, growth arrest, survival and cell migration. In an aspect, SNAI1 is identified as HGNC 11128, NCBI Gene 6615, Ensembl ENSG00000124216, OMIM 604238, or UniProtKB / Swiss-Prot O95863.

[0127] In an aspect, SKP2 is S-Phase Kinase Associated Protein 2. This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation- dependent ubiquitination. In an aspect, SKP2 is identified as HGNC 10901, NCBI Gene 6502, Ensembl ENSG00000145604, OMIM 601436, or UniProtKB / Swiss-Prot Q13309.

[0128] In an aspect, MCM3 is Minichromosome Maintenance Complex Component 3. The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. In an aspect, MCM3 is identified as HGNC 6945, NCBI Gene 4172, Ensembl ENSG00000112118, OMIM 602693, or UniProtKB / Swiss-Prot P25205.

[0129] In an aspect, CCNB1 is Cyclin B1. The protein encoded by this gene is a regulatory protein involved in mitosis. The gene product complexes with p34(cdc2) to form thematuration-promoting factor (MPF). The encoded protein is necessary for proper control of the G2 / M transition phase of the cell cycle. In an aspect, CCNB1 is identified as HGNC 1579, NCBI Gene 891, Ensembl ENSG00000134057, OMIM 123836, or UniProtKB / Swiss-Prot P14635.

[0130] In an aspect of a disclosed LNP, the DR sequences can flank the pre-gRNA oligonucleotide. In an aspect, a disclosed pre-gRNA oligonucleotide can be flanked by a DR sequence (e.g., such as that in SEQ ID NO:11).

[0131] In an aspect, a disclosed pre-gRNA oligonucleotide can comprise the sequence of SEQ ID NO:01 and can comprise a DR having the sequence of SEQ ID NO:11. In an aspect, a disclosed pre-gRNA oligonucleotide can comprise the sequence of SEQ ID NO:01 and can comprise two DRs each having the sequence of SEQ ID NO:11. In an aspect, a disclosed pre- gRNA oligonucleotide can comprise the sequence of SEQ ID NO:01 and can comprise a DR having a fragment of the sequence of SEQ ID NO:11. In an aspect, a disclosed pre-gRNA oligonucleotide can comprise the sequence of SEQ ID NO:01 and can comprise two DRs each having a fragment of the sequence of SEQ ID NO:11.

[0132] In an aspect, a disclosed pre-gRNA oligonucleotide can comprise the sequence of SEQ ID NO:02 and can comprise a DR having the sequence of SEQ ID NO:11. In an aspect, a disclosed pre-gRNA oligonucleotide can comprise the sequence of SEQ ID NO:02 and can comprise two DRs each having the sequence of SEQ ID NO:11. In an aspect, a disclosed pre- gRNA oligonucleotide can comprise the sequence of SEQ ID NO:02 and can comprise a DR having a fragment of the sequence of SEQ ID NO:11. In an aspect, a disclosed pre-gRNA oligonucleotide can comprise the sequence of SEQ ID NO:03 and can comprise two DRs each having a fragment of the sequence of SEQ ID NO:11.

[0133] In an aspect, a disclosed pre-gRNA oligonucleotide can comprise the sequence of SEQ ID NO:03 and can comprise a DR having the sequence of SEQ ID NO:11. In an aspect, a disclosed pre-gRNA oligonucleotide can comprise the sequence of SEQ ID NO:03 and can comprise two DRs each having the sequence of SEQ ID NO:11. In an aspect, a disclosed pre- gRNA oligonucleotide can comprise the sequence of SEQ ID NO:03 and can comprise a DR having a fragment of the sequence of SEQ ID NO:11. In an aspect, a disclosed pre-gRNA oligonucleotide can comprise the sequence of SEQ ID NO:03 and can comprise two DRs each having a fragment of the sequence of SEQ ID NO:11.

[0134] In an aspect, a disclosed pre-gRNA oligonucleotide can comprise the sequence of SEQ ID NO:04 and can comprise a DR having the sequence of SEQ ID NO:11. In an aspect, a disclosed pre-gRNA oligonucleotide can comprise the sequence of SEQ ID NO:04 and cancomprise two DRs each having the sequence of SEQ ID NO:11. In an aspect, a disclosed pre- gRNA oligonucleotide can comprise the sequence of SEQ ID NO:04 and can comprise a DR having a fragment of the sequence of SEQ ID NO:11. In an aspect, a disclosed pre-gRNA oligonucleotide can comprise the sequence of SEQ ID NO:04 and can comprise two DRs each having a fragment of the sequence of SEQ ID NO:11.

[0135] In an aspect, a disclosed pre-gRNA oligonucleotide can comprise the sequence of any one of SEQ ID NO:05 – SEQ ID NO:08 and can comprise a DR having the sequence of SEQ ID NO:11. In an aspect, a disclosed pre-gRNA oligonucleotide can comprise the sequence of any one of SEQ ID NO:05 – SEQ ID NO:08 and can comprise two DRs each having the sequence of SEQ ID NO:11. In an aspect, a disclosed pre-gRNA oligonucleotide can comprise the sequence of any one of SEQ ID NO:05 – SEQ ID NO:08 and can comprise a DR having a fragment of the sequence of SEQ ID NO:11. In an aspect, a disclosed pre-gRNA oligonucleotide can comprise the sequence of any one of SEQ ID NO:05 – SEQ ID NO:08 and can comprise two DRs each having a fragment of the sequence of SEQ ID NO:11.

[0136] In an aspect, a disclosed LNP can further comprise a cationic cell penetrating peptide (cpp). In an aspect, a cpp can be used to stably condense one or more disclosed plasmids or one or more disclosed nucleic acid molecules (e.g., to subsequently deliver to a nucleus). In an aspect, a disclosed cpp can be transactivation of transcription peptide (TAT) or can be a nuclear localization sequence (NLS). In an aspect, a disclosed TAT can comprise the sequence set forth in SEQ ID NO:78 or a portion thereof. In an aspect, a disclosed NLS can comprise the sequence set forth in SEQ ID NO:81 or a portion thereof.

[0137] As used herein, “a nanoparticle carrier” is any composition comprising one or more materials that can be formulated into LNPs that are capable of encapsulating or otherwise retaining (e.g., by adsorption or otherwise) a disclosed pre-gRNA oligonucleotide and / or a disclosed Cas13d mRNAs.

[0138] In an aspect, a disclosed LNP can comprise a cationic cell penetrating peptide (cpp), examples of which include the transactivator of transcription peptide (TAT) and nuclear localization sequences (NLS). In vivo delivery of plasmid DNA, for example, can be hindered by systemic instability due to excessive size and negative charge. Accordingly, these cpps are used to stably condense plasmids or nucleic acids and deliver them into the nucleus.

[0139] In an aspect, a disclosed LNP can further comprise an additional nucleic acid aptamer (Apt) immobilized on the surface of the LNP. In an aspect, a disclosed LNP can further comprise an additional nucleic acid aptamer (Apt) immobilized on the shell of the LNP. In an aspect, a disclosed LNP can be surface-functionalized with one or more additional aptamers.In an aspect, a disclosed LNP can be surface-functionalized with one or more nucleic acid ligand aptamers. In an aspect, a disclosed LNP can further comprise an immobilized Apt and a cpp. In an aspect, a disclosed additional Apt can target castration-resistant prostate cancer (CRPC) cells. In an aspect, a disclosed additional Apt can be a prostate-specific membrane antigen (PSMA) aptamer. In an aspect, a disclosed additional Apt can target neuroendocrine prostate cancer (NEPC) cells. In an aspect, a disclosed additional Apt can be a neural cell adhesion molecule 1 (NCAM1) aptamer, a chromogranin A (CHGA) aptamer, a synaptophysin (SYP) aptamer, a synaptosome associated protein 25 (SNAP25) aptamer, or a carcinoembryonic antigen-related cell adhesion molecule 5 (CEACAM5) aptamer. In an aspect, a disclosed additional aptamer can achieve cell-specific targeting by recognized / binding to a membrane marker on the cell surface. In an aspect, a disclosed additional aptamer can be used to target a nanoparticle to a specific cell. In an aspect, a disclosed PSMA aptamer can recognize or can be used to target PSMA positive CRPC cells. In an aspect, a disclosed NCAM1 aptamer, a disclosed CHGA aptamer, a disclosed SYP aptamer, a disclosed SNAP25 aptamer, or a disclosed CEACAM5 aptamer can recognize or can be used to target NEPC cells.

[0140] In an aspect of a disclosed LNP, the ratio of a disclosed Cas13d mRNA to a disclosed pre-gRNA oligonucleotide can be between 1:0.5 and 1:3. In an aspect of a disclosed LNP, the ratio of a disclosed Cas13d mRNA to a disclosed pre-gRNA oligonucleotide can be between 1:1 and 1:2. In an aspect of a disclosed LNP, the ratio of a disclosed Cas13d mRNA to a disclosed pre-gRNA oligonucleotide can be about 1:1.5

[0141] In an aspect, a disclosed LNP can comprise a cpp to RNA weight ratio of about 0.1 to about 20. In an aspect, a disclosed LNP can comprise a cpp to RNA weight ratio of about 1:20, about 1:19, about 1:18, about 1:17, about 1:16, about 1:15, about 1:14, about 1:13, about 1:12, about 1:11, about 1:10, about 1:9, about 1:8, about 1:7, about 1:6, about 1:5, about 1:4, about 1:3, about 1:2, about 1:1, about 1:0.5, or about 0.5:1. In an aspect, a disclosed LNP can comprise a cpp to RNA weight ratio of about 1:18, about 3:16, or about 5:15.6.

[0142] In an aspect, a disclosed LNP can be prepared or generated by any process known to the skilled person in the art. For example, in an aspect, a disclosed LNP can be prepared or generated using self-assembled nano-precipitation. In an aspect of preparing or generating a disclosed LNP, a disclosed apt can be immobilized on the NP surface using carbodiimide coupling chemistry (e.g., between the –COOH group of carboxy modified PEG and the amino group at the end of the PSMA Apt). In an aspect, nano-precipitation time and weight ratio of cpp to plasmid / nucleic acid can be optimized to minimize any batch-to-batch variability.

[0143] In an aspect, a disclosed LNP can be formulated according to any technique and / or guidance provided in the EXAMPLES set forth below.

[0144] In an aspect, a disclosed LNP can decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcription factor (e.g., HOXB13). In an aspect, a disclosed LNP can decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcription factor (e.g., HOXB13) and can mitigate and / or non-specific gene targeting or off-targeting effects. In an aspect, a disclosed LNP can decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor (e.g., HOXB13). In an aspect, a disclosed LNP can decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor (e.g., HOXB13) and can mitigate and / or non-specific gene targeting or off- targeting effects. In an aspect, a disclosed LNP can reduce and / or decrease the risk of metastases.

[0145] In an aspect, a disclosed LNP can be used in RNA-based editing system. In an aspect, a disclosed LNP can be used in RNA-based editing system comprising a tri-targeting strategy. In an aspect, a tri-targeting strategy can comprise (i) incorporating ionizable lipid FTT5 into a disclosed LNP, (ii) using a low molar ratio of PEG to enhance delivery to metastatic CRPC cells in a subject’s liver, and (iii) modifying the surface of a disclosed LNP with the prostate cancer cell-specific E3 aptamer, thereby enhancing targeted delivery to metastatic CRPC cells.

[0146] In an aspect, a disclosed LNP can be used in a method of treating cancer can comprise protecting the subject from metastasis. In an aspect, a disclosed LNP can be used in a method of treating cancer can comprise reducing the risk of developing metastasis. In an aspect, a disclosed LNP can be used in a method of treating cancer can comprise preventing or inhibiting metastasis.

[0147] In an aspect, a disclosed LNP can be used to (i) prevent and / or decrease the risk of developing metastases; (ii) prolong the survival of the subject; (iii) enhance and / or improve the subject’s quality of life; (iv) reduce and / or minimize the likelihood of surgical intervention; (v) prevent and / or delay recurrence of the cancer; (vi) reduce and / or decrease the size of one or more tumors in the subject; (vii) eliminate one or more tumors in the subject can be eliminated; (viii) extend and / or prolong disease-free or tumor-free survival time; (ix) increase and / or lengthening overall survival time; (x) reduce and / or minimize the frequency of treatment; (xi) relieve and / or ameliorate one or more symptoms of the cancer; (xii) reduce and / or decrease tumor burden, (ix) prevent and / or facilitate surgical intervention; (xiii) improve and / or restore normal metabolism of one or more organ systems in the subject; (xiv) restore and / or improveone or more aspects of cellular homeostasis and / or cellular functionality, and / or metabolic dysregulation; or (xv) any combination thereof.

[0148] In an aspect, a disclosed LNP and / or a disclosed SCORT LNP can reduce and / or decrease angiogenesis. In an aspect, a disclosed LNP and / or a disclosed SCORT LNP can reduce and / or decrease cancer cell proliferation. In an aspect, a disclosed LNP and / or a disclosed SCORT LNP can increase apoptosis and / or cell death of the cancer cells.

[0149] In an aspect, a disclosed LNP and / or a disclosed SCORT LNP can selectively target metastatic prostate cancer cells in a subject’s liver. In an aspect, a disclosed LNP and / or a disclosed SCORT LNP can selectively target metastatic prostate cancer cells in a subject’s liver without affecting and / or damaging and / or disturbing non-cancer cells in the liver.

[0150] In an aspect, a disclosed LNP and / or a disclosed SCORT LNP can be used in one or more disclosed methods. In an aspect, a disclosed LNP and / or a disclosed SCORT LNP can be used in one or more disclosed methods of treating a subject. 2. Nucleic Acid Sequence

[0151] Disclosed herein is a nucleic acid sequence comprising one or more RNA cargo molecules.

[0152] In an aspect, a disclosed nucleic acid sequence can comprise the sequence for one or more disclosed pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed nucleic acid sequence for a disclosed pre-gRNA oligonucleotide targeting HOXB13 mRNA can comprise the sequence set forth in any one of SEQ ID NO:01 - SEQ ID NO:04. In an aspect, a disclosed nucleic acid sequence for a disclosed pre-gRNA oligonucleotide targeting HOXB13 mRNA can comprise the sequence set forth in any one of SEQ ID NO:05 - SEQ ID NO:08.

[0153] In an aspect, a disclosed nucleic acid sequence can comprise the sequence for a disclosed targeted HOXB13 mRNA. In an aspect, a disclosed nucleic acid sequence for a disclosed targeted HOXB13 mRNA can comprise the sequence set forth in SEQ ID NO:18. In an aspect, a disclosed nucleic acid sequence for a disclosed targeted HOXB13 mRNA can comprise can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more than 95% identity to the sequence set forth in SEQ ID NO:18.

[0154] In an aspect, a disclosed nucleic acid sequence can be for a pre-gRNA oligonucleotide targeting any portion of HOXB13 mRNA. In an aspect, a disclosed nucleic acid sequence canbe for a pre-gRNA oligonucleotide targeting any portion of the mRNA set forth in SEQ ID NO:18.

[0155] In an aspect, a disclosed nucleic acid sequence can comprise the sequence for one or more disclosed E3 aptamers. In an aspect, a disclosed nucleic acid sequence for a disclosed E3 aptamer can comprise the sequence set forth in SEQ ID NO:12.

[0156] In an aspect, a disclosed nucleic acid sequence can comprise the sequence for one or more disclosed DRs. In an aspect, a disclosed nucleic acid sequence for a disclosed DR can comprise the sequence set forth in SEQ ID NO:11.

[0157] In an aspect, a disclosed nucleic acid sequence can comprise the sequence for one or more disclosed Cas13d mRNAs. In an aspect, a disclosed nucleic acid sequence for a disclosed Cas13d mRNA can comprise the sequence set forth in SEQ ID NO:15 or SEQ ID NO:16. In an aspect, a disclosed nucleic acid sequence for a disclosed Cas13d mRNA can comprise a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more than 95% identity to the sequence set forth in SEQ ID NO:15 or SEQ ID NO:16.

[0158] Disclosed herein is a nucleic acid sequence for each one of the primers of SEQ ID NO:17 – SEQ ID NO:77.

[0159] In an aspect, a disclosed nucleic acid sequence can be used in any disclosed method. In an aspect, a disclosed nucleic acid sequence can be used to generate and / or validate and / or characterize any disclosed LNP.

[0160] In an aspect, a disclosed nucleic acid sequence can be encapsulated in one or more disclosed LNPs. In an aspect, a disclosed nucleic acid sequence can be incorporated into one or more disclosed plasmids.

[0161] In an aspect, a disclosed nucleic acid sequence can be used in a method of treating cancer can comprise protecting the subject from metastasis. In an aspect, a disclosed nucleic acid sequence can be used in a method of treating cancer can comprise reducing the risk of developing metastasis. In an aspect, a disclosed nucleic acid sequence can be used in a method of treating cancer can comprise preventing or inhibiting metastasis.

[0162] In an aspect, a disclosed nucleic acid sequence can be used to (i) prevent and / or decrease the risk of developing metastases; (ii) prolong the survival of the subject; (iii) enhance and / or improve the subject’s quality of life; (iv) reduce and / or minimize the likelihood of surgical intervention; (v) prevent and / or delay recurrence of the cancer; (vi) reduce and / or decrease the size of one or more tumors in the subject; (vii) eliminate one or more tumors in the subject can be eliminated; (viii) extend and / or prolong disease-free or tumor-free survival time; (ix) increase and / or lengthening overall survival time; (x) reduce and / or minimize the frequency oftreatment; (xi) relieve and / or ameliorate one or more symptoms of the cancer; (xii) reduce and / or decrease tumor burden, (ix) prevent and / or facilitate surgical intervention; (xiii) improve and / or restore normal metabolism of one or more organ systems in the subject; (xiv) restore and / or improve one or more aspects of cellular homeostasis and / or cellular functionality, and / or metabolic dysregulation; or (xv) any combination thereof.

[0163] In an aspect, a disclosed nucleic acid sequence can reduce and / or decrease angiogenesis. In an aspect, a disclosed nucleic acid sequence can reduce and / or decrease cancer cell proliferation. In an aspect, a disclosed nucleic acid sequence can increase apoptosis and / or cell death of the cancer cells. In an aspect, a disclosed nucleic acid sequence can selectively target metastatic prostate cancer cells in a subject’s liver. In an aspect, a disclosed nucleic acid sequence can selectively target metastatic prostate cancer cells in a subject’s liver without affecting and / or damaging and / or disturbing non-cancer cells in the liver.

[0164] In an aspect, a disclosed nucleic acid sequence can be used in one or more disclosed methods. In an aspect, a disclosed nucleic acid sequence can be used in one or more disclosed methods of treating a subject. 3. Plasmids

[0165] Disclosed herein is a plasmid comprising a disclosed nucleic acid sequence. Disclosed herein is a plasmid comprising a nucleic acid sequence comprising one or more RNA cargo molecules.

[0166] In an aspect of a disclosed plasmid, a disclosed nucleic acid sequence can comprise the sequence for one or more disclosed pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect of a disclosed plasmid, a disclosed nucleic acid sequence for a disclosed pre-gRNA oligonucleotide targeting HOXB13 mRNA can comprise the sequence set forth in any one of SEQ ID NO:01 - SEQ ID NO:04. In an aspect of a disclosed plasmid, a disclosed nucleic acid sequence for a disclosed pre-gRNA oligonucleotide targeting HOXB13 mRNA can comprise the sequence set forth in any one of SEQ ID NO:05 - SEQ ID NO:08.

[0167] In an aspect of a disclosed plasmid, a disclosed nucleic acid sequence can comprise the sequence for a disclosed targeted HOXB13 mRNA. In an aspect of a disclosed plasmid, a disclosed nucleic acid sequence for a disclosed targeted HOXB13 mRNA can comprise the sequence set forth in SEQ ID NO:18. In an aspect of a disclosed plasmid, a disclosed nucleic acid sequence for a disclosed targeted HOXB13 mRNA can comprise can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more than 95% identity to the sequence set forth in SEQ ID NO:18.

[0168] In an aspect of a disclosed plasmid, a disclosed pre-gRNA oligonucleotide can target any portion of HOXB13 mRNA. In an aspect of a disclosed plasmid, a disclosed pre-gRNA oligonucleotide can target any portion of the mRNA set forth in SEQ ID NO:18.

[0169] In an aspect of a disclosed plasmid, a disclosed nucleic acid sequence can comprise the sequence for one or more disclosed E3 aptamers. In an aspect of a disclosed plasmid, a disclosed nucleic acid sequence for a disclosed E3 aptamer can comprise the sequence set forth in SEQ ID NO:12.

[0170] In an aspect of a disclosed plasmid, a disclosed nucleic acid sequence can comprise the sequence for one or more disclosed DRs. In an aspect of a disclosed plasmid, a disclosed nucleic acid sequence for a disclosed DR can comprise the sequence set forth in SEQ ID NO:11.

[0171] In an aspect of a disclosed plasmid, a disclosed nucleic acid sequence can comprise the sequence for one or more disclosed Cas13d mRNAs. In an aspect of a disclosed plasmid, a disclosed nucleic acid sequence for a disclosed Cas13d mRNA can comprise the sequence set forth in SEQ ID NO:15 or SEQ ID NO:16. In an aspect of a disclosed plasmid, a disclosed nucleic acid sequence for a disclosed Cas13d mRNA can comprise a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more than 95% identity to the sequence set forth in SEQ ID NO:15 or SEQ ID NO:16.

[0172] In an aspect of a disclosed plasmid, a disclosed nucleic acid sequence can be used in any disclosed method.

[0173] In an aspect of a disclosed plasmid, a disclosed nucleic acid sequence can be used to generate and / or validated any disclosed LNP.

[0174] Disclosed herein is a plasmid comprising the nucleic acid sequence for the primer of anyone of SEQ ID NO:17 – SEQ ID NO:77.

[0175] In an aspect, a disclosed plasmid can comprise the sequence for one or more regulatory elements. For example, in an aspect, disclosed regulatory elements can comprise promoters, enhancers, internal ribosomal entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences, Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulator Element (WPRE), triplex from MALAT1, the PRE of Hepatitis B virus (HPRE), and an iron response element). Regulatory elements can include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences-lung cells, liver cells, spleen cells, etc.).

[0176] In an aspect of a disclosed plasmid, a disclosed promoter can be tissue-specific or ubiquitous and can be constitutive or inducible, depending on the pattern of the expression desired. A promoter can be native or foreign and can be a natural or a synthetic sequence. By foreign, it is intended that the transcriptional initiation region is not found in the wild-type host into which the transcriptional initiation region is introduced. In an aspect, a disclosed promoter can be a promoter / enhancer. In an aspect, a disclosed promoter for the disclosed nucleic acid molecule can be an endogenous promoter. In an aspect, a disclosed endogenous promoter can be an endogenous promoter / enhancer. In an aspect, a disclosed endogenous promoter or a disclosed endogenous promoter / enhancer can generally be obtained from a non-coding region upstream of a transcription initiation site of a gene of interest. In an aspect, a disclosed endogenous promoter or a disclosed endogenous promoter / enhancer can be used for constitutive expression of a disclosed gene.

[0177] Tissue-specific promoters are known to the art and include, but are not limited to, neuron-specific promoters, muscle-specific promoters, liver-specific promoters, skeletal muscle-specific promoters, lung-specific promoters, spleen-specific promoters, and heart- specific promoters. Ubiquitous / constitutive promoters are known to the art and include, but are not limited to, a CMV major immediate-early enhancer / chicken beta-actin promoter, a cytomegalovirus (CMV) major immediate-early promoter, an Elongation Factor 1-α (EF1-α) promoter, a simian vacuolating virus 40 (SV40) promoter, an AmpR promoter, a PγK promoter, a human ubiquitin C gene (Ubc) promoter, a MFG promoter, a human beta actin promoter, a CAG promoter, a EGR1 promoter, a FerH promoter, a FerL promoter, a GRP78 promoter, a GRP94 promoter, a HSP70 promoter, a β-kin promoter, a murine phosphoglycerate kinase (mPGK) or human PGK (hPGK) promoter, a ROSA promoter, human Ubiquitin B promoter, a Rous sarcoma virus promoter, or any other natural or synthetic ubiquitous / constitutive promoters.

[0178] In an aspect, a disclosed regulatory element can be operably linked to a sequence to be expressed (e.g., a nucleic acid sequence encoding a Cas13d, a CasRx, one or more pre-guide RNA oligonucleotides (pre-gRNA) sequences and one or more direct repeat (DR) sequences, and one or more pre-guide RNA oligonucleotides (pre-gRNA) targeting a prostate cancer (PC) associated transcription factor (TF) (e.g., HOXB13). In an aspect, a disclosed sequence to be express can be any disclosed nucleic acid sequence encoding one or more pre-gRNA oligonucleotides. In an aspect, a disclosed sequence to be express can be any disclosed nucleic acid sequence encoding a Cas13d or a CasRx.

[0179] In an aspect, “operably linked” refers to a juxtaposition where the components described are in a relationship permitting them to function in their intended manner. For example, a control element or regulatory element “operably linked” to a functional element is associated in such a way that expression and / or activity of the functional element is achieved under conditions compatible with the control element. In an aspect, a promotor can be operably linked to a disclosed nucleic acid.

[0180] In an aspect, a disclosed plasmid can be encapsulated in a disclosed LNP and / or a disclosed SCORT LNP. In an aspect, one or more disclosed plasmids can be encapsulated in a disclosed LNP and / or a disclosed SCORT LNP.

[0181] In an aspect, a disclosed plasmid can decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcription factor (e.g., HOXB13). In an aspect, a disclosed plasmid can decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcription factor (e.g., HOXB13) and can mitigate and / or non-specific gene targeting or off-targeting effects. In an aspect, a disclosed plasmid can decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor (e.g., HOXB13). In an aspect, a disclosed plasmid can decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor (e.g., HOXB13) and can mitigate and / or non-specific gene targeting or off- targeting effects. In an aspect, a disclosed plasmid can reduce and / or decrease the risk of metastases.

[0182] In an aspect, a disclosed plasmid can be used in RNA-based editing system. In an aspect, a disclosed plasmid can be used in RNA-based editing system comprising a tri-targeting strategy. In an aspect, a tri-targeting strategy can comprise (i) incorporating ionizable lipid FTT5 into a disclosed LNP, (ii) using a low molar ratio of PEG to enhance delivery to metastatic CRPC cells in a subject’s liver, and (iii) modifying the surface of a disclosed LNP with the prostate cancer cell-specific E3 aptamer, thereby enhancing targeted delivery to metastatic CRPC cells.

[0183] In an aspect, a disclosed plasmid can be used in a method of treating cancer can comprise protecting the subject from metastasis. In an aspect, a disclosed plasmid can be used in a method of treating cancer can comprise reducing the risk of developing metastasis. In an aspect, a disclosed plasmid can be used in a method of treating cancer can comprise preventing or inhibiting metastasis.

[0184] In an aspect, a disclosed plasmid can be used to (i) prevent and / or decrease the risk of developing metastases; (ii) prolong the survival of the subject; (iii) enhance and / or improve thesubject’s quality of life; (iv) reduce and / or minimize the likelihood of surgical intervention; (v) prevent and / or delay recurrence of the cancer; (vi) reduce and / or decrease the size of one or more tumors in the subject; (vii) eliminate one or more tumors in the subject can be eliminated; (viii) extend and / or prolong disease-free or tumor-free survival time; (ix) increase and / or lengthening overall survival time; (x) reduce and / or minimize the frequency of treatment; (xi) relieve and / or ameliorate one or more symptoms of the cancer; (xii) reduce and / or decrease tumor burden, (ix) prevent and / or facilitate surgical intervention; (xiii) improve and / or restore normal metabolism of one or more organ systems in the subject; (xiv) restore and / or improve one or more aspects of cellular homeostasis and / or cellular functionality, and / or metabolic dysregulation; or (xv) any combination thereof.

[0185] In an aspect, a disclosed plasmid can reduce and / or decrease angiogenesis. In an aspect, a disclosed plasmid can reduce and / or decrease cancer cell proliferation. In an aspect, a disclosed plasmid can increase apoptosis and / or cell death of the cancer cells.

[0186] In an aspect, a disclosed plasmid and / or a disclosed SCORT LNP can selectively target metastatic prostate cancer cells in a subject’s liver. In an aspect, a disclosed LNP and / or a disclosed SCORT LNP can selectively target metastatic prostate cancer cells in a subject’s liver without affecting and / or damaging and / or disturbing non-cancer cells in the liver.

[0187] In an aspect, a disclosed plasmid can be used in one or more disclosed methods. In an aspect, a disclosed plasmid can be used in one or more disclosed methods of treating a subject. 4. Pharmaceutical Formulations

[0188] Disclosed herein is a pharmaceutical formulation comprising one or more disclosed nucleic acid molecules, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients Disclosed herein is a pharmaceutical formulation comprising one or more disclosed plasmids, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. Plasmids are discussed supra. Disclosed herein is a pharmaceutical formulation comprising one or more disclosed LNPs, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients.

[0189] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA.

[0190] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients.

[0191] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject.

[0192] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE- PEG-maleimide, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients.

[0193] Disclosed herein is a pharmaceutical formulation comprising one or more SCORT LNPs comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3aptamer surface-modified shell surrounding the core, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA.

[0194] Disclosed herein is a pharmaceutical formulation comprising one or more SCORT LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre- guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. Disclosed herein is a pharmaceutical formulation comprising one or more SCORT LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG- maleimide, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients.

[0195] Disclosed herein is a pharmaceutical formulation comprising one or more SCORT LNPs comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre- gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject.

[0196] Disclosed herein is a pharmaceutical formulation comprising one or more SCORT LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre- guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. Disclosed herein is a pharmaceutical formulation comprising one or more SCORT LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients.

[0197] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA.

[0198] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients.

[0199] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients.

[0200] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guideRNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients.

[0201] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising (i) a core comprising one or more plasmids comprising RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA.

[0202] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients.

[0203] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising (i) a core comprising a plasmid comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject.

[0204] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE- PEG-maleimide, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients.

[0205] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising (i) a core comprising a plasmid comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. In an aspect, a disclosed RNA cargo molecule can comprise a plasmid comprising at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA.

[0206] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. Disclosed herein is a SCORT lipid nanoparticle (LNP), comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre- guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE,cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients.

[0207] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising (i) a core comprising a plasmid comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients.

[0208] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE- PEG-maleimide, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients.

[0209] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising (i) a plasmid comprising a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA.

[0210] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients.

[0211] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising (i) a core comprising a plasmid comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients.

[0212] Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients. Disclosed herein is a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients.

[0213] In an aspect, a disclosed pharmaceutical formulation can further comprise (i) one or more active agents, (ii) biologically active agents, (iii) one or more pharmaceutically active agents, (iv) one or more immune-based therapeutic agents, (v) one or more clinically approved agents, or (vi) a combination thereof.

[0214] In an aspect of a disclosed pharmaceutical formulation, a disclosed pre-gRNA oligonucleotide can target any portion of HOXB13 mRNA. In an aspect of a disclosed pharmaceutical formulation, a disclosed pre-gRNA oligonucleotide can target any portion of the mRNA set forth in SEQ ID NO:18.

[0215] In an aspect, a disclosed pharmaceutical formulation can further comprise one or more anti-inflammatory agents. Anti-inflammatory agents or drugs include, but are not limited to, steroids and glucocorticoids (including betamethasone, budesonide, dexamethasone, hydrocortisone acetate, hydrocortisone, hydrocortisone, methylprednisolone, prednisolone, prednisone, triamcinolone), nonsteroidal anti-inflammatory drugs (NSAIDS) including aspirin, ibuprofen, naproxen, methotrexate, sulfasalazine, leflunomide, anti-TNF medications, cyclophosphamide and mycophenolate.

[0216] In an aspect, NSAIDs can comprise ibuprofen, naproxen, naproxen sodium, Cox-2 inhibitors such as rofecoxib and celecoxib, sialylates, or any combination thereof. In an aspect, analgesics can comprise acetaminophen, oxycodone, tramadol, proporxyphene hydrochloride, or any combination thereof. In an aspect, glucocorticoids can comprise cortisone, dexamethasone, hydrocortisone, methylprednisolone, prednisolone, prednisone, or any combination thereof. Exemplary biological response modifiers include molecules directed against cell surface markers (e.g., CD4, CD5, etc.), cytokine inhibitors, such as the TNF antagonists (e.g., etanercept, adalimumab, and infliximab, chemokine inhibitors and adhesion molecule inhibitors. In an aspect, biological response modifiers can comprise monoclonal antibodies as well as recombinant forms of molecules. In an aspect, exemplary disease- modifying anti-rheumatic drugs (DMARDs) can comprise include azathioprine, cyclophosphamide, cyclosporine, methotrexate, penicillamine, leflunomide, sulfasalazine, hydroxychloroquine, Gold (oral (auranofin) and intramuscular), minocycline, or any combination thereof.

[0217] In an aspect, a disclosed chemotherapeutic agent in a disclosed pharmaceutical formulation can comprise an anthracycline, a vinca alkaloid, an alkylating agent, an immune cell antibody, an antimetabolite, a TNFR glucocorticoid induced TNFR related protein (GITR) agonist, a proteasome inhibitor, an immunomodulator, or any combination thereof. In an aspect, a disclosed chemotherapeutic agent can comprise 5-fluorouracil (Adrucil, Efudex), 6-mercaptopurine (Purinethol), 6-thioguanine, aclarubicin or aclacinomycin A, alemtuzamab (Lemtrada), anastrozole (Arimidex), bicalutamide (Casodex), bleomycin sulfate (Blenoxane), bortezomib (Velcade), busulfan (Myleran), busulfan injection (Busulfex), capecitabine (Xeloda), carboplatin (Paraplatin), carmustine (BiCNU), chlorambucil (Leukeran), cisplatin (Platinol), cladribine (Leustatin), Cosmegan, cyclophosphamide (Cytoxan or Neosar), cyclophosphamide, cytarabine liposome injection (DepoCyt), cytarabine, cytosine arabinoside (Cytosar-U), dacarbazine (DTIC-Dome), dactinomycin (Cosmegen), daunorubicin citrate liposome injection (DaunoXome), daunorubicin hydrochloride (Cerubidine), dexamethasone, docetaxel (Taxotere), doxorubicin hydrochloride (Adriamycin, Rubex), etoposide (Vepesid), fludarabine phosphate (Fludara), flutamide (Eulexin), folic acid antagonists, gemcitabine (difluorodeoxycitidine), gemtuzumab, gliotoxin, hydroxyurea (Hydrea), Idarubicin (Idamycin), ifosfamide (IFEX), ifosfamide, irinotecan (Camptosar), L-asparaginase (ELSPAR), lenalidomide), leucovorin calcium, melphalan (Alkeran), melphalan, methotrexate (Folex), mitoxantrone (Novantrone), mylotarg, N4-pentoxycarbonyl-5 deoxy-5-fluorocytidine, nab-paclitaxel (Abraxane), paclitaxel (Taxol), pentostatin, phoenix (Yttrium90 / MX-DTPA), polifeprosan 20 with carmustine implant (Gliadel), purine analogs and adenosine deaminase inhibitors (fludarabine), pyrimidine analogs, rituximab, tamoxifen citrate (Nolvadex), temozolomide), teniposide (Vumon), tezacitibine, thalidomide or a thalidomide derivative, thiotepa, tirapazamine (Tirazone), topotecan hydrochloride for injection (Hycamptin), tositumomab), vinblastine (Velban), vinblastine, vincristine (Oncovin), vindesine, vinorelbine (Navelbine), or any combination thereof.

[0218] In an aspect, a disclosed pharmaceutical formulation can comprise an anti-chemokine therapy that enhances the resident memory T cell formations in tumor-free tissues. In an aspect, a disclosed anti-chemokine therapy can comprise one or more antibodies against CCL1, CCL2, CCL4, CCL17, CCL19, CCL21, CCL22, CCL25, CXCL9, CXCL10, CXCL11, CXCL12, CXCL13, CCR2, CCR5, CCR7, CCR8, CCR9, CXCR3, CXCR4, CXCR5, CX3CL1, CX3CR1, or any combination thereof.

[0219] In an aspect, a disclosed pharmaceutical formulation can further comprise abagovomab, adecatumumab, afutuzumab, alemtuzumab, altumomab, amatuximab, anatumomab, arcitumomabm bavituximab, bectumomab, bevacizumab, bivatuzumab, blinatumomab, brentuximab, cantuzumab, catumaxomab, cetuximab, citatuzumab, cixutumumab, clivatuzumab, conatumumab, daratumumab, drozitumab, duligotumab, dusigitumab, detumomab, dacetuzumab, dalotuzumab, ecromeximab, elotuzumab, ensituximab, ertumaxomab, etaracizumab, farietuzumab, ficlatuzumab, figitumumab, flanvotumab,futuximab, ganitumab, gemtuzumab, girentuximab, glembatumumab, ibritumomab, igovomab, imgatuzumab, indatuximab, inotuzumab, intetumumab, ipilimumab, iratumumab, labetuzumab, lexatumumab, lintuzumab, lorvotuzumab, lucatumumab, mapatumumab, matuzumab, milatuzumab, minretumomab, mitumomab, moxetumomab, namatumab, naptumomab, necitumumab, nimotuzumab, nofetumomab, ocaratuzumab, ofatumumab, olaratumab, onartuzumab, oportuzumab, oregovomab, panitumumab, parsatuzumab, patritumab, pemtumomab, pertuzumab, pintumomab, pritumumab, racotumomab, radretumab, rilotumumab, rituximab, robatumumab, satumomab, sibrotuzumab, siltuximab, simtuzumab, solitomab, tacatuzumab, taplitumomab, tenatumomab, teprotumumab, tigatuzumab, tositumomab, trastuzumab, tucotuzumab, ublituximab, veltuzumab, vorsetuzumab, votumumab, zalutumumab, CC49, 3F8, or any combination thereof.

[0220] In an aspect, a disclosed pharmaceutical formulation can be prepared for systemic or direct administration. In an aspect, a disclosed pharmaceutical formulation can be prepared for oral administration, intravenous administration, intratumoral administration, intraperitoneal administration, or any combination thereof. In an aspect, a disclosed pharmaceutical formulation can be prepared for any method of administration disclosed herein. In an aspect, a disclosed pharmaceutical formulation can be prepared for administration via multiple routes either concurrently or sequentially. For example, in an aspect, a disclosed pharmaceutical formulation can be first administered intratumorally and then be administered intravenously. In an aspect, a disclosed pharmaceutical formulation can be first administered intratumorally and then be administered orally. A skilled clinical can determine the best route of administration for a subject at a given time.

[0221] In an aspect, a disclosed pharmaceutical formulation can comprise one or more immune modulators. In an aspect, a disclosed pharmaceutical formulation can comprise one or more proteasome inhibitors. In an aspect, a disclosed pharmaceutical formulation can comprise one or more immunosuppressives or immunosuppressive agents. In an aspect, an immunosuppressive agent can be anti-thymocyte globulin (ATG), cyclosporine (CSP), mycophenolate mofetil (MMF), or a combination thereof. In an aspect, a disclosed pharmaceutical formulation can comprise an anaplerotic agent (such as, for example, C7 compounds like triheptanoin or MCT).

[0222] In an aspect, a disclosed pharmaceutically acceptable carrier can comprise any disclosed carrier and / or any disclosed excipient.

[0223] In an aspect, a disclosed pharmaceutical formulation can decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcriptionfactor (e.g., HOXB13). In an aspect, a disclosed pharmaceutical formulation can decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcription factor (e.g., HOXB13) and can mitigate and / or non-specific gene targeting or off-targeting effects. In an aspect, a disclosed pharmaceutical formulation can decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor (e.g., HOXB13). In an aspect, a disclosed pharmaceutical formulation can decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor (e.g., HOXB13) and can mitigate and / or non-specific gene targeting or off- targeting effects. In an aspect, a disclosed pharmaceutical formulation can reduce and / or decrease the risk of metastases.

[0224] In an aspect, a disclosed pharmaceutical formulation can be used in RNA-based editing system. In an aspect, a disclosed pharmaceutical formulation can be used in RNA-based editing system comprising a tri-targeting strategy. In an aspect, a tri-targeting strategy can comprise (i) incorporating ionizable lipid FTT5 into a disclosed LNP, (ii) using a low molar ratio of PEG to enhance delivery to metastatic CRPC cells in a subject’s liver, and (iii) modifying the surface of a disclosed LNP with the prostate cancer cell-specific E3 aptamer, thereby enhancing targeted delivery to metastatic CRPC cells.

[0225] In an aspect, a disclosed pharmaceutical formulation can be used in a method of treating cancer can comprise protecting the subject from metastasis. In an aspect, a disclosed pharmaceutical formulation can be used in a method of treating cancer can comprise reducing the risk of developing metastasis. In an aspect, a disclosed pharmaceutical formulation can be used in a method of treating cancer can comprise preventing or inhibiting metastasis.

[0226] In an aspect, a disclosed pharmaceutical formulation can be used to (i) prevent and / or decrease the risk of developing metastases; (ii) prolong the survival of the subject; (iii) enhance and / or improve the subject’s quality of life; (iv) reduce and / or minimize the likelihood of surgical intervention; (v) prevent and / or delay recurrence of the cancer; (vi) reduce and / or decrease the size of one or more tumors in the subject; (vii) eliminate one or more tumors in the subject can be eliminated; (viii) extend and / or prolong disease-free or tumor-free survival time; (ix) increase and / or lengthening overall survival time; (x) reduce and / or minimize the frequency of treatment; (xi) relieve and / or ameliorate one or more symptoms of the cancer; (xii) reduce and / or decrease tumor burden, (ix) prevent and / or facilitate surgical intervention; (xiii) improve and / or restore normal metabolism of one or more organ systems in the subject; (xiv) restore and / or improve one or more aspects of cellular homeostasis and / or cellular functionality, and / or metabolic dysregulation; or (xv) any combination thereof.

[0227] In an aspect, a disclosed pharmaceutical formulation can reduce and / or decrease angiogenesis. In an aspect, a disclosed pharmaceutical formulation can reduce and / or decrease cancer cell proliferation. In an aspect, a disclosed pharmaceutical formulation can increase apoptosis and / or cell death of the cancer cells.

[0228] In an aspect, a disclosed pharmaceutical formulation can selectively target metastatic prostate cancer cells in a subject’s liver. In an aspect, a disclosed pharmaceutical formulation can selectively target metastatic prostate cancer cells in a subject’s liver without affecting and / or damaging and / or disturbing non-cancer cells in the liver.

[0229] In an aspect, a disclosed pharmaceutical formulation can be used in one or more disclosed methods. In an aspect, a disclosed pharmaceutical formulation can be used in one or more disclosed methods of treating a subject. C. Methods of Treating Cancer

[0230] Disclosed herein is a method of treating cancer, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed LNPs. Disclosed herein is a method of treating cancer, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of one or more disclosed pharmaceutical formulations comprising one or more disclosed LNPs. Disclosed herein is a method of treating a subject, the method comprising administering to a subject having metastatic prostate cancer a therapeutically effective amount of one or more disclosed LNPs. Disclosed herein is a method of treating a subject, the method comprising administering to a subject having metastatic prostate cancer a therapeutically effective amount of one or more disclosed pharmaceutical formulations comprising one or more disclosed LNPs.

[0231] Disclosed herein is a method of delivering targeted treatment to metastatic cancer cells, the method comprising administering to a subject having metastatic prostate cancer in the liver a therapeutically effective amount of one or more disclosed LNPs. Disclosed herein is a method of delivering targeted treatment to metastatic cancer cells, the method comprising administering to a subject having metastatic prostate cancer in the liver a therapeutically effective amount of one or more disclosed pharmaceutical formulations comprising one or more disclosed LNPs.

[0232] In an aspect, a therapeutically effective amount can comprise about 0.1 mg / kg to about 100 mg / kg of total RNA. In an aspect, a therapeutically effective amount can comprise about 0.1 mg / kg to about 1 mg / kg of total RNA. In an aspect, a therapeutically effective amount can comprise about 1 mg / kg to about 10 mg / kg of total RNA, about 10 mg / kg to about 20 mg / kgof total RNA, about 20 mg / kg to about 30 mg / kg of total RNA, about 30 mg / kg to about 40 mg / kg of total RNA, about 40 mg / kg to about 50 mg / kg of total RNA, about 50 mg / kg to about 60 mg / kg of total RNA, about 60 mg / kg to about 70 mg / kg of total RNA, about 70 mg / kg to about 80 mg / kg of total RNA, about 80 mg / kg to about 90 mg / kg of total RNA, or about 100 mg / kg of total RNA. In an aspect, a therapeutically effective amount can comprise about 1 mg / kg of total RNA.

[0233] In an aspect, a subject has cancer or metastatic cancer. In an aspect, a subject has prostate cancer or metastatic prostate cancer. In an aspect, prostate cancer can be neuroendocrine prostate cancer (NEPC). NEPC is an aggressive variant of prostate cancer that may arise de novo or in patients previously treated with hormonal therapies for prostate adenocarcinoma as a mechanism of resistance. The clinical features of NEPC are poorly defined. In an aspect, a subject has castration-resistant prostate cancer (CRPC) or metastatic CRPC.

[0234] In an aspect of a disclosed method, the administering step can comprise daily, weekly, monthly, and / or yearly administration. In an aspect of a disclosed method, the administering step can be performed 1, 2, 3, 4, or 5 times per day. In an aspect of a disclosed method, the administering step can be performed 1, 2, 3, 4, or 5 times per week. In an aspect of a disclosed method, the administering step can be performed 1, 2, 3, 4, or 5 times per month. In an aspect of a disclosed method, the administering step can be performed 1, 2, 3, 4, 5, or more times per year. In an aspect of a disclosed method, the administering step can be performed at multiple points in the subject’s treatment and / or in the subject’s life.

[0235] In an aspect, a disclosed method of treating cancer can further comprise collecting one or more blood and / or biological samples from a subject at the same time or at different times. For example, in an aspect, a blood sample and / or a biological sample can be collected from a subject at a pre-determined interval. In an aspect, a pre-determined interval can be once a week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, or at a longer interval. In an aspect, a pre-determined interval can be once a month, once every 2 months, once every 3 months, once every 5 months, once every 5 months, once every 6 months, or at a longer interval. In an aspect, a blood sample and / or a biological sample can be collected from a subject prior to treatment, during treatment, after treatment, or any combination thereof. In an aspect, a blood and / or a biological sample can be collected from a subject at any time deemed medically and / or clinically appropriate by the skilled clinician.

[0236] In an aspect, a therapeutically effective amount of a disclosed LNP. In an aspect, a therapeutically effective amount of a disclosed pharmaceutical formulation. In an aspect of a disclosed method, a therapeutically effective amount can be titrated during a treatment regimen.

[0237] In an aspect, a therapeutically effective amount or effective dose or effective amount or therapeutically effective dosage of a disclosed LNP or a disclosed pharmaceutical formulation can protect a subject against the onset of a disease and / or promotes disease regression evidenced by a decrease in severity of disease symptoms, an increase in frequency and duration of disease symptom-free periods, or a prevention of impairment or disability due to the disease affliction. The ability of a therapeutic agent to promote disease regression can be evaluated using a variety of methods known to the skilled practitioner, such as in human subjects during clinical trials, in animal model systems predictive of efficacy in humans, or by assaying the activity of the agent in in vitro assays.

[0238] In an aspect, administering a disclosed LNP or a disclosed pharmaceutical formulation can comprise systemic or direct administration. In an aspect, administering can comprise oral administration, intravenous administration, intratumoral administration, intraperitoneal administration, or any combination thereof. In an aspect, a disclosed LNP or a disclosed pharmaceutical formulation can be administered by any method of administration disclosed herein. In an aspect, a disclosed LNP or a disclosed pharmaceutical formulation can be administered via multiple routes either concurrently or sequentially.

[0239] For example, in an aspect, a disclosed LNP or a disclosed pharmaceutical formulation can be first administered intratumorally and then be administered intravenously. In an aspect, a disclosed LNP or a disclosed pharmaceutical formulation can be first administered intravenously and then be administered intratumorally. In an aspect, a disclosed LNP or a disclosed pharmaceutical formulation can be administered intrahepatically. A skilled clinician can determine the best route of administration for a subject at a given time.

[0240] In an aspect, local administration of a disclosed LNP or a disclosed pharmaceutical formulation can comprise delivery to one or more of the subject’s body systems having cancerous cells or tumorous growth. In an aspect, the subject’s one or more body systems having cancerous cells or tumorous growth can comprise the subject’s cardiovascular system, the subject’s digestive system, the subject’s endocrine system, the subject lymphatic system, the subject’s muscular system, the subject’s nervous system, the subject’s reproductive system, the subject’s respiratory system, the subject’s skeletal system, the subject’s urinary system, the subject’s integumentary system, or any combination thereof.

[0241] In an aspect, a disclosed method of treating cancer can further comprise repeating one or more times the administering of a disclosed LNP or a disclosed pharmaceutical formulation. In an aspect, a disclosed method of treating cancer can further comprise repeating one or more times the administering of any disclosed targeted therapy or anti-cancer therapy.

[0242] In an aspect, a disclosed method of treating cancer can comprise protecting the subject from metastasis. In an aspect, a disclosed method of treating cancer can comprise reducing the risk of developing metastasis. In an aspect, a disclosed method of treating cancer can comprise preventing or inhibiting metastasis.

[0243] In an aspect, a disclosed method can comprise diagnosing the subject as being in need of a disclosed LNP or disclosed pharmaceutical formulation. In an aspect, a disclosed method can comprise diagnosing the subject as having prostate cancer and / or metastatic prostate cancer. In an aspect, a disclosed method can comprise diagnosing the subject as having prostate cancer and / or metastatic prostate cancer that affects the liver.

[0244] In an aspect, a disclosed method can comprise monitoring the subject for adverse effects. In an aspect, in the absence of adverse effects, a disclosed method can comprise continuing to treat the subject. In an aspect, continuing to treat the subject can comprise continuing to administer a disclosed LNP or a disclosed pharmaceutical formulation. In an aspect, in the presence of adverse effects, a disclosed method can comprise modifying one or more steps of the method. In an aspect, modifying one or more steps of a disclosed method can comprise modifying the administering step. In an aspect, modifying the administering step can comprise changing the amount of a disclosed LNP or a disclosed pharmaceutical formulation administered to the subject, changing the frequency of administration of a disclosed LNP or a disclosed pharmaceutical formulation, changing the duration of administration of a disclosed LNP or a disclosed pharmaceutical formulation, changing the route of administration of a disclosed LNP or a disclosed pharmaceutical formulation, or any combination thereof.

[0245] In an aspect, a disclosed method of treating cancer can comprise administering to the subject one or more additional anti-cancer therapies. Anti-cancer therapies are known to the art. In an aspect, a disclosed anti-cancer therapy can comprise endocrine therapy, radiotherapy, hormone therapy, gene therapy, thermal therapy, ultrasound therapy, or any combination thereof. In an aspect, a disclosed anti-cancer therapy can comprise one or more chemotherapeutic agents. In an aspect, a disclosed chemotherapeutic agent can comprise an anthracycline, a vinca alkaloid, an alkylating agent, an immune cell antibody, an antimetabolite, a TNFR glucocorticoid induced TNFR related protein (GITR) agonist, aproteasome inhibitor, an immunomodulator, or any combination thereof. In an aspect, a disclosed chemotherapeutic agent can comprise 5-fluorouracil (Adrucil, Efudex), 6- mercaptopurine (Purinethol), 6-thioguanine, aclarubicin or aclacinomycin A, alemtuzamab (Lemtrada), anastrozole (Arimidex), axitinib (Inlyta), bevacizumab (Avastin), bicalutamide (Casodex), bleomycin sulfate (Blenoxane), bortezomib (Velcade), busulfan (Myleran), busulfan injection (Busulfex), capecitabine (Xeloda), carboplatin (Paraplatin), carmustine (BiCNU), chlorambucil (Leukeran), cisplatin (Platinol), cladribine (Leustatin), Cosmegan, cyclophosphamide (Cytoxan or Neosar), cyclophosphamide, cytarabine liposome injection (DepoCyt), cytarabine, cytosine arabinoside (Cytosar-U), dacarbazine (DTIC-Dome), dactinomycin (Cosmegen), daunorubicin citrate liposome injection (DaunoXome), daunorubicin hydrochloride (Cerubidine), dexamethasone, docetaxel (Taxotere), doxorubicin hydrochloride (Adriamycin, Rubex), etoposide (Vepesid), fludarabine phosphate (Fludara), flutamide (Eulexin), folic acid antagonists, gemcitabine (difluorodeoxycitidine), gemtuzumab, gliotoxin, hydroxyurea (Hydrea), Idarubicin (Idamycin), ifosfamide (IFEX), ifosfamide, irinotecan (Camptosar), L-asparaginase (ELSPAR), lenalidomide), leucovorin calcium, melphalan (Alkeran), melphalan, methotrexate (Folex), mitoxantrone (Novantrone), mylotarg, N4-pentoxycarbonyl-5 deoxy-5-fluorocytidine, nab-paclitaxel (Abraxane), paclitaxel (Taxol), pentostatin, phoenix (Yttrium90 / MX-DTPA), polifeprosan 20 with carmustine implant (Gliadel), purine analogs and adenosine deaminase inhibitors (fludarabine), pyrimidine analogs, rituximab, tamoxifen citrate (Nolvadex), temozolomide), teniposide (Vumon), tezacitibine, thalidomide or a thalidomide derivative, thiotepa, tirapazamine (Tirazone), topotecan hydrochloride for injection (Hycamptin), tositumomab), vinblastine (Velban), vinblastine, vincristine (Oncovin), vindesine, vinorelbine (Navelbine), or any combination thereof.

[0246] In an aspect, a disclosed method of treating cancer can comprise administering to the subject an anti-chemokine therapy. In an aspect, a disclosed anti-chemokine therapy can comprise one or more antibodies against CCL1, CCL2, CCL4, CCL17, CCL19, CCL21, CCL22, CCL25, CXCL9, CXCL10, CXCL11, CXCL12, CXCL13, CCR2, CCR5, CCR7, CCR8, CCR9, CXCR3, CXCR4, CXCR5, CX3CL1, CX3CR1, or any combination thereof.

[0247] In an aspect, a disclosed method of treating cancer can comprise administering to the subject one or more immune modulators. In an aspect, a disclosed immune modulator can comprise aspirin, azathioprine, belimumab, betamethasone dipropionate, betamethasone valerate, bortezomib, bredinin, cyazathioprine, cyclophosphamide, cyclosporine, deoxyspergualin, didemnin B, fluocinolone acetonide, folinic acid, ibuprofen, IL6 inhibitors(such as sarilumab) indomethacin, inebilizumab, intravenous gamma globulin (IVIG), methotrexate, methylprednisolone, mycophenolate mofetil, naproxen, prednisolone, prednisone, prednisolone indomethacin, rapamycin, rituximab, sirolimus, sulindac, synthetic vaccine particles containing rapamycin (SVP-Rapamycin or ImmTOR), thalidomide, tocilizumab, tolmetin, triamcinolone acetonide, anti-CD3 antibodies, anti-CD4 antibodies, anti-CD19 antibodies, anti-CD20 antibodies, anti-CD22 antibodies, anti-CD40 antibodies, anti-FcRN antibodies, anti-IL6 antibodies, anti-IGF1R antibodies, an IL2 mutein, a BTK inhibitor, or a combination thereof. In an aspect, a disclosed immune modulator can comprise one or more Treg (regulatory T cells) infusions (e.g., antigen specific Treg cells to AAV). In an aspect, a disclosed immune modulator can be bortezomib or SVP-Rapamycin. In an aspect, an immune modulator can be administered by any suitable route of administration.

[0248] In an aspect, a disclosed method of treating cancer can comprise administering an oligonucleotide therapeutic agent. A disclosed oligonucleotide therapeutic agent can comprise a single-stranded or double-stranded DNA, iRNA, shRNA, siRNA, mRNA, non-coding RNA (ncRNA), an antisense molecule, miRNA, a morpholino, a peptide-nucleic acid (PNA), or an analog or conjugate thereof. In an aspect, a disclosed oligonucleotide therapeutic agent can be an ASO or an RNAi. In an aspect, a disclosed oligonucleotide therapeutic agent can comprise one or more modifications at any position applicable. In an aspect, a disclosed oligonucleotide therapeutic agent can comprise a CRISPR-based endonuclease. In an aspect, a disclosed endonuclease can be Cas9. CRISPR / Cas9 systems and methods are known to the art.

[0249] In an aspect, a disclosed method of treating cancer can further comprise preventing or inhibiting metastasis of cancer cells. In an aspect, a disclosed method can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of decrease or reduction in the risk of and / or actual metastasis of cancer cells when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., a disclosed LNP or a disclosed pharmaceutical formulation). In an aspect, preventing or inhibiting metastasis of cancer cells can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of decrease or reduction in the risk of and / or actual metastasis of cancer cells when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., a disclosed LNP or a disclosed pharmaceutical formulation) or a pharmaceutical formulation thereof).

[0250] In an aspect, a disclosed method of treating cancer can comprise surgically resecting the tumor and / or cancer cells from the subject. In an aspect, following resecting the tumor and / or cancer cells from the subject, a disclosed method of treating cancer can comprisecontinuing to administer to the subject a therapeutically effective amount of a disclosed anti- cancer agent, a disclosed anti-chemokine therapy, a disclosed chemotherapeutic agent, any disclosed therapeutic agent, or any combination thereof.

[0251] In an aspect, a disclosed method of treating cancer can further comprise subjecting the subject to one or more invasive or non-invasive diagnostic assessments. Diagnostic assessments are known to the art. In an aspect, a disclosed non-invasive diagnostic assessment can comprise x-rays, computerized tomography (CT) scans, magnetic resonance imaging (MRI) scans, ultrasounds, positron emission tomography (PET) scans, or any combination thereof. In an aspect, a disclosed invasive diagnostic assessment can comprise a tissue biopsy or exploratory surgery. In an aspect, a subject can be diagnosed with prostate cancer or metastatic cancer. In an aspect, a subject can be diagnosed with CRPC or NEPC.

[0252] In an aspect, a disclosed method of treating cancer can restore one or more aspects of cellular homeostasis and / or cellular functionality and / or metabolic dysregulation in a subject, such as, for example, a subject having cancer or cancerous cells. In an aspect, a disclosed interfering molecule can restore one or more aspects of cellular homeostasis and / or cellular functionality and / or metabolic dysregulation in a subject having cancer. In an aspect, metabolic dysregulation can be associated with cancer or cancerous cells. In an aspect, restoring one or more aspects of cellular homeostasis and / or cellular functionality can comprise one or more of the following: (i) correcting cell starvation in one or more cell types; (ii) normalizing aspects of the autophagy pathway (such as, for example, correcting, preventing, reducing, and / or ameliorating autophagy); (iii) improving, enhancing, restoring, and / or preserving mitochondrial functionality and / or structural integrity; (iv) improving, enhancing, restoring, and / or preserving organelle functionality and / or structural integrity; (v) correcting enzyme dysregulation; (vi) reversing, inhibiting, preventing, stabilizing, and / or slowing the rate of progression of the multi-systemic manifestations of a cancer; (vii) reversing, inhibiting, preventing, stabilizing, and / or slowing the rate of progression of a cancer, or (viii) any combination thereof. In an aspect, restoring one or more aspects of cellular homeostasis can comprise improving, enhancing, restoring, and / or preserving one or more aspects of cellular structural and / or functional integrity. In an aspect, restoration can be a partial or incomplete restoration. In an aspect, restoration can be complete or near complete restoration such that the level of expression, activity, and / or functionality is similar to that of a wild-type or control level. In an aspect, restoring one or more aspects of cellular homeostasis and / or cellular functionality can comprise preventing or inhibiting metastasis of cancer cells in the subject.

[0253] In an aspect, following the administering step, (i) the risk of developing metastases can be prevented and / or decreased; (ii) the survival of the subject can be prolonged; (iii) the subject’s quality of life can be enhanced and / or improved; (iv) the likelihood of surgical intervention can be reduced and / or minimized; (v) preventing and / or delaying recurrence of the cancer; (vi) the size of one or more tumors in the subject can be reduced and / or decreased; (vii) one or more tumors in the subject can be eliminated; (viii) extending and / or prolonging disease-free or tumor-free survival time; (ix) increasing and / or lengthening overall survival time; (x) reducing and / or minimizing the frequency of treatment; (xi) relieving and / or ameliorating one or more symptoms of the cancer; (xii) reducing and / or decreasing tumor burden, (ix) preventing and / or facilitating surgical intervention; (xiii) normal metabolism of one or more organ systems in the subject can be improved and / or restored, (xiv) one or more aspects of cellular homeostasis and / or cellular functionality, and / or metabolic dysregulation can be restored and / or improved, or (xv) any combination thereof.

[0254] In an aspect of a disclosed method of treating cancer, techniques to monitor, measure, and / or assess the restoring one or more aspects of cellular homeostasis and / or cellular functionality can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person.

[0255] In an aspect, a disclosed method of treating cancer can comprise titrating the dose of a disclosed LNP and / or SCORT LNP, a disclosed targeted therapy, a disclosed composition, a disclosed pharmaceutical formulation, a disclosed therapeutic agent, a disclosed immune modulator, a disclosed proteasome inhibitor, a disclosed small molecule, a disclosed endonuclease, a disclosed oligonucleotide, a disclosed RNA therapeutic, or any combination thereof to identify an effective dose and / or to identify an effective dose eliciting only mild adverse and / or side effects.

[0256] In an aspect, a disclosed method of treating cancer can comprise titrating the dose of a disclosed treatment regimen in a specific or disclosed subject. In an aspect, a disclosed method of treating and / or preventing cancer can comprise titrating the dose of a disclosed LNP and / or SCORT LNP, a disclosed composition, a disclosed pharmaceutical formulation, a disclosed therapeutic agent, a disclosed immune modulator, a disclosed proteasome inhibitor, a disclosed small molecule, a disclosed endonuclease, a disclosed oligonucleotide, a disclosed RNA therapeutic, or any combination thereof to identify an effective dose and / or to identify an effective dose eliciting only mild adverse and / or side effects for a specific or disclosed subject.

[0257] In an aspect, administering to a subject a disclosed LNP or a disclosed pharmaceutical formulation can be done prior to, concurrent with, or after the administering of any othertherapeutic agent and / or targeted therapy can change during a treatment regimen. In an aspect, the order of administering a disclosed LNP or a disclosed pharmaceutical formulation and the administering of any other therapeutic agent and / or targeted therapy can change during a treatment regimen.

[0258] In an aspect, a disclosed method of treating can further comprise obtaining a biological sample from the subject prior to administering a disclosed treatment regimen. In an aspect, a disclosed method of treating and / or preventing cancer can further comprise obtaining a biological sample from the subject after administering a disclosed treatment regimen. In an aspect, a disclosed method of treating and / or preventing cancer can further comprise subjecting the biological sample to a cell-free DNA (cfDNA) analysis. cfDNA analyses are known to the skilled person in the art. In an aspect, a disclosed cfDNA analysis can be repeated one or more times. In an aspect, a disclosed obtaining step can be repeated one or more times.

[0259] In an aspect of a disclosed method of treating and / or preventing cancer, a disclosed cfDNA analysis can comprise next generation sequencing. In an aspect, next generation sequencing (NGS) can comprise using one or more commercially available platforms. Commercially available NGS sequencing platforms can comprise, for example, Guardant360 CDx (Guardant Health, Inc.), FoundationOne CDx (F1CDx) (Foundation Medicine, Inc.), or Tempus xT (Tempus).

[0260] In an aspect of a disclosed method of treating cancer, next generation sequencing can comprise sequencing one or more cancer related genes. In an aspect of a disclosed method of treating and / or preventing cancer, sequencing one or more cancer related genes can comprise identifying one or more genomic aberrations. In an aspect, one or more genomic aberrations can comprise somatic genomic aberrations. In an aspect, the disclosed one or more somatic genomic aberrations can comprise mutations, insertions, deletions, chromosomal rearrangements, copy number aberrations, or any combination thereof.

[0261] In an aspect of a disclosed method, one or more genomic aberrations in the biological sample can be detected. In an aspect, a disclosed method can further comprise detecting one or more genomic aberrations in the biological sample. In an aspect, a disclosed method can further comprise identifying one or more genomic aberrations in a panel of genes. In an aspect, disclosed genomic aberrations can be identified in a panel of genes. In an aspect, a disclosed panel of genes can comprise at least one gene, at least two genes, 3 or more genes, 5 or more genes, 7 or more genes, or 10 or more genes. In an aspect, a disclosed panel of genes can comprise 2 or more genes, 3 or more genes, 4 or more genes, 5 or more genes, 6 or more genes, 7 or more genes, 8 or more genes, 9 or more genes, or 10 or more genes. In an aspect, adisclosed panel of genes can comprise any combination of disclosed genes or disclosed cancer- related genes.

[0262] In an aspect, a disclosed method can comprise detecting the expression of one or more disclosed genes and / or one or more disclosed gene aberrations. In an aspect, a disclosed method can comprise generating a control sample and / or a pooled control sample. In an aspect, a disclosed method can comprise generating a reference sample and / or a pooled reference sample. In an aspect, a disclosed method can comprise generating a range of a control samples and / or a pooled control sample. In an aspect, a disclosed method can comprise generating a range of reference samples and / or a pooled reference sample.

[0263] In an aspect, if the expression and / or amount and / or presence of the disclosed one or more genomic aberrations in the post-treatment biological sample is lower than the expression and / or amount and / or presence of the same one or more genomic aberrations in a pre-treatment sample, then a disclosed method of treating cancer can comprise continuing to administer to the subject a disclosed LNP or a disclosed pharmaceutical formulation. In an aspect, if the expression and / or amount and / or presence of the disclosed one or more genomic aberrations in the post-treatment biological sample is lower than the expression and / or amount and / or presence of the same one or more genomic aberrations in a prior post-treatment sample, then a disclosed method of treating and / or preventing cancer of treating and / or preventing cancer can comprise continuing to administer to the subject a disclosed LNP or a disclosed pharmaceutical formulation.

[0264] In an aspect, if the expression and / or amount and / or presence of the disclosed one or more prostate cancer (PC) associated transcription factors (TF) (such as, for example, HOXB13) in the post-treatment biological sample is lower than the expression and / or amount and / or presence of the same one or more prostate cancer (PC) associated transcription factors (TF) in a pre-treatment sample, then a disclosed method of treating cancer can comprise continuing to administer to the subject a disclosed LNP or a disclosed pharmaceutical formulation. In an aspect, if the expression and / or amount and / or presence of the disclosed one or more prostate cancer (PC) associated transcription factors (TF) (such as, for example, HOXB13) in the post-treatment biological sample is lower than the expression and / or amount and / or presence of the same one or more prostate cancer (PC) associated transcription factors (TF) in a prior post-treatment sample, then a disclosed method of treating and / or preventing cancer of treating and / or preventing cancer can comprise continuing to administer to the subject a disclosed LNP or a disclosed pharmaceutical formulation.

[0265] In an aspect, a disclosed method of treating cancer can further comprise measuring the subject’s tumor response to the administering of a disclosed LNP or a disclosed pharmaceutical formulation. In an aspect, a subject’s tumor response can comprise a partial response or a complete response. In an aspect, a disclosed partial response can comprise a decrease in the size of a tumor or a decrease in one or more tumors by 25% or more when compared to the size of the same tumor or the same one or more tumors prior to the treatment with a disclosed LNP or a disclosed pharmaceutical formulation. In an aspect, a disclosed partial response can comprise a decrease in the size of a tumor or a decrease in one or more tumors by 50% or more when compared to the size of the same tumor or the same one or more tumors prior to treatment with a disclosed LNP or a disclosed pharmaceutical formulation. In an aspect, a disclosed partial response can comprise a decrease in the size of a tumor or a decrease in one more tumors by about 100% or more when compared to the size of the same tumor or the same one or more tumors prior to treatment.

[0266] In an aspect, a complete response can be defined as complete disappearance of all tumors with no recurrence of tumors for at least four weeks. In an aspect, a partial response can be defined as a 50% reduction in total tumor size with such reduction lasting at least four weeks. In an aspect, stable disease can be defined as less than 50% reduction in size but no more than 25% increase in size of the tumor mass lasting for at least twelve weeks.

[0267] In an aspect, a disclosed method of treating cancer can further comprise measuring the subject’s molecular response to a disclosed treatment regimen. In an aspect, a disclosed molecular response can comprise a decrease in the number of somatic genomic aberrations in a disclosed biological sample obtained from the subject. In an aspect, disclosed somatic genomic aberrations can comprise mutations, insertions, deletions, chromosomal rearrangements, copy number aberrations, fusions, or any combination thereof.

[0268] In an aspect, a subject can be a human patient. In an aspect a subject can be any age (e.g., geriatric, adult, young adult, teenager, tween, adolescent, child, toddler, baby, or infant), can be male or female, can be any nationality, can be of any ethnicity, and / or can be of any race. In an aspect, a subject can have a terminal cancer. In an aspect, a subject can have metastatic cancer. In an aspect, a subject can have recurrent cancer.

[0269] In an aspect, a disclosed targeted therapy can comprise one or more monoclonal antibodies. In an aspect, a disclosed monoclonal antibody can comprise an angiogenesis inhibitor (e.g., bevacizumab), a HER-2 targeted agent (e.g., trastuzumab, pertuzumab, etc.), an anti-CD20 monoclonal antibody (e.g., rituximab, obinutuzumab, etc.), or any combination thereof. In an aspect, a disclosed targeted therapy can comprise one or more small moleculeinhibitors. In an aspect, a disclosed small molecule inhibitor can comprise a tyrosine kinase inhibitor (e.g., erlotinib, sunitinib, imatinib, dasatinib, etc.), a mTOR inhibitor (e.g., everolimus), a PARP inhibitor (e.g., olaparib), a CDK inhibitor (e.g., palbociclib, ribociclib, abermaciclib, etc.), a CD4 and / or CD6 inhibitor, or any combination thereof.

[0270] In an aspect, a disclosed targeted therapy can comprise abagovomab, abciximab, abituzumab, abrilumab, actoxumab, adalimumab, adecatumumab, aducanumab, afelimomab, afutuzumab, alacizumab pegol, alemtuzumab, alirocumab, altumomab pentetate, amatuximab, anatumomab mafenatox, anetumab ravtansine, anifrolumab, anrukinzumab, apolizumab, arcitumomab, ascrinvacumab, aselizumab, atezolizumab, atinumab, atlizumab (tocilizumab), atorolimumab, bapineuzumab, basiliximab, bavituximab, bectumomab, begelomab, belimumab, benralizumab, bertilimumab, besilesomab, bevacizumab, bezlotoxumab, biciromab, bimagrumab, bimekizumab, bivatuzumab mertansine, blinatumomab, blosozumab, bococizumab, brentuxim abvedotin, briakinumab, brodalumab, brolucizumab, brontictuzumab, canakinumab, cantuzumab mertansine, cantuzumab ravtansine, caplacizumab, capromab pendetide, carlumab, catumaxomab, cbr96-doxorubicin immunoconjugate, cedelizumab, certolizumab pegol, cetuximab, citatuzumab bogatox, cixutumumab, clazakizumab, clenoliximab, clivatuzumab tetraxetan, codrituzumab, coltuximab ravtansine, conatumumab, concizumab, crenezumab, dacetuzumab, daclizumab, dalotuzumab, dapirolizumab pegol, daratumumab, dectrekumab, demcizumab, denintuzumab mafodotin, denosumab, derlotuximab biotin, detumomab, dinutuximab, diridavumab, dorlimomab aritox, drozitumab, duligotumab, dupilumab, durvalumab, dusigitumab, ecromeximab, eculizumab, edobacomab, edrecolomab, efalizumab, efungumab, eldelumab, elgemtumab, elotuzumab, elsilimomab, emactuzumab, emibetuzumab, enavatuzumab, enfortumab vedotin, enlimomab pegol, enoblituzumab, enokizumab, enoticumab, ensituximab, epitumomab cituxetan, epratuzumab, erlizumab, ertumaxomab, etanercept, etaracizumab, etrolizumab, evinacumab, evolocumab, exbivirumab, fanolesomab, faralimomab, farletuzumab, fasinumab, felvizumab, fezakinumab, ficlatuzumab, figitumumab, firivumab, flanvotumab, fletikumab, fontolizumab, foralumab, foravirumab, fresolimumab, fulranumab, futuximab, galiximab, ganitumab, gantenerumab, gavilimomab, gemtuzumab ozogamicin, gevokizumab, girentuximab, glembatumumab vedotin, golimumab, gomiliximab, guselkumab, ibalizumab, ibritumomab tiuxetan, icrucumab, idarucizumab, igovomab, imalumab, imciromab, imgatuzumab, inclacumab, indatuximab ravtansine, indusatumab vedotin, infliximab, inolimomab, inotuzumab ozogamicin, intetumumab, ipilimumab, iratumumab, isatuximab, itolizumab, ixekizumab, keliximab, labetuzumab, lambrolizumab, lampalizumab,lebrikizumab, lemalesomab, lenzilumab, lerdelimumab, lexatumumab, libivirumab, lifastuzumab vedotin, ligelizumab, lilotomab satetraxetan, lintuzumab, lirilumab, lodelcizumab, lokivetmab, lorvotuzumab mertansine, lucatumumab, lulizumab pegol, lumiliximab, lumretuzumab, mapatumumab, margetuximab, maslimomab, matuzumab, mavrilimumab, mepolizumab, metelimumab, milatuzumab, minretumomab, mirvetuximab soravtansine, mitumomab, mogamulizumab, morolimumab, motavizumab, moxetumomab pasudotox, muromonab-cd3, nacolomab tafenatox, namilumab, naptumomab estafenatox, narnatumab, natalizumab, nebacumab, necitumumab, nemolizumab, nerelimomab, nesvacumab, nimotuzumab, nivolumab, nofetumomab merpentan, obiltoxaximab, obinutuzumab, ocaratuzumab, ocrelizumab, odulimomab, ofatumumab, olaratumab, olokizumab, omalizumab, onartuzumab, ontuxizumab, opicinumab, oportuzumab monatox, oregovomab, orticumab, otelixizumab, otlertuzumab, oxelumab, ozanezumab, ozoralizumab, pagibaximab, palivizumab, panitumumab, pankomab, panobacumab, parsatuzumab, pascolizumab, pasotuxizumab, pateclizumab, patritumab, pembrolizumab, pemtumomab, perakizumab, pertuzumab, pexelizumab, pidilizumab, pinatuzumab vedotin, pintumomab, placulumab, polatuzumab vedotin, ponezumab, priliximab, pritoxaximab, pritumumab, quilizumab, racotumomab, radretumab, rafivirumab, ralpancizumab, ramucirumab, ranibizumab, raxibacumab, refanezumab, regavirumab, reslizumab, rilotumumab, rinucumab, rituximab, robatumumab, roledumab, romosozumab, rontalizumab, rovelizumab, ruplizumab, sacituzumab govitecan, samalizumab, sarilumab, satumomab pendetide, secukinumab, seribantumab, setoxaximab, sevirumab, sibrotuzumab, sifalimumab, siltuximab, simtuzumab, siplizumab, sirukumab, sofituzumab vedotin, solanezumab, solitomab, sonepcizumab, sontuzumab, stamulumab, sulesomab, suvizumab, tabalumab, tacatuzumab tetraxetan, tadocizumab, talizumab, tanezumab, taplitumomab paptox, tarextumab, tefibazumab, telimomab aritox, tenatumomab, teneliximab, teplizumab, teprotumumab, tesidolumab, tetulomab, ticilimumab, tigatuzumab, tildrakizumab, tocilizumab, toralizumab, tosatoxumab, tositumomab, tovetumab, tralokinumab, trastuzumab, tregalizumab, tremelimumab, trevogrumab, tucotuzumab celmoleukin, tuvirumab, ublituximab, ulocuplumab, urelumab, urtoxazumab, ustekinumab, vandortuzumab vedotin, vantictumab, vanucizumab, vapaliximab, varlilumab, vatelizumab, vedolizumab, veltuzumab, vepalimomab, vesencumab, visilizumab, volociximab, vorsetuzumab mafodotin, votumumab, zalutumumab, zanolimumab, zatuximab, ziralimumab, zolimomab aritox, or any combination thereof.

[0271] In an aspect, a disclosed targeted therapy can comprise abemaciclib, ado-trastuzumab emtansine, afatinib, alectinib, alemtuzumab, alpelisib, atezolizumab, avelumab, axitinib,bevacizumab, binimetinib, blinatumomab, bosutinib, brentuximab, brigatinib, cabozantinib, carfilzomib, cemiplimab, ceritinib, cetuximab, gilteritinib, cobimetinib, copanlisib, crizotinib, dabrafenib, dacomitinib, daratumumab, dasatinib, denosumab, dinutuximab, durvalumab, duvelisib, elotuzumab, encorafenib, entrectinib, erdafitinib, erlotinib, fam-trastuzumab deruxtecan-nxki, gefitinib, gemtuzumab, ibritumomab tiuxetan, ibrutinib, imatinib, inotuzumab, ipilumumab, ivosidenib, lapatinib, larotrectinib, Lenvatinib, lorlatinib, margetuximab-cmkb, necitumumab, neratinib, nilotinib, niraparib, nivolumab, obinutuzumab, ofatumumab, olaparib, olaratumab, osimertinib, palbociclib, panitumumab, pazopanib, pembrolizumab, pertuzumab, ponatinib, ramucirumab, regorafenib, ribociclib, rituximab, rucaparib, sorafenib, sunitinib, talazoparib, tivozanib, tositumomab, trametinib, trastuzumab, tucatinib, vandetanib, vemurafenib, vismodegib, or any combination thereof.

[0272] In an aspect, a disclosed targeted therapy for oral administration can comprise abemaciclib, afatinib, alectinib, alpelisib, axitinib, binimetinib, bosutinib, brigatinib, cabozantinib, cobimetinib, crizotinib, dabrafenib, dacomitinib, dasatinib, duvelisib, encorafenib, entrectinib, erdafitinib, erlotinib, gefitinib, gilteritinib, ibrutinib, imatinib mesylate, ivosidenib, lapatinib, larotrectinib, lorlatinib, lenvatinb, neratinib, nilotinib, niraparib, olaparib, osimertinib palbociclib, pazopanib, ponatinib, regorafenib, ribociclib, rucaparib, sorafenib, sunitinib malate, talazoparib, tivozanib, trametinib, vandetanib, vemurafenib, vismodegib, or any combination thereof.

[0273] In an aspect, a disclosed targeted therapy for intravenous administration can comprise ado-trastuzumab emtansine, alemtuzumab, atezolizumab, avelumab, bevacizumab, blinatumomab, brentuximab vedotin, carfilzomib, cetuximab, cemiplimab-rwlc, certinib, copanlisib, daratumumab, dinutuximab, durvalumab, elotuzumab, fam-trastuzumab deruxtecan-nxki, gemtuzumab ozogamicin, ibritumomab tiuxetan, inotuzumab ozogamicin, ipilimumab, margetuximab-cmkb, necitumumab, nivolumab, obinutuzumab, olaratumab, panitumumab, pembrolizumab, pertuzumab, ramucirumab, rituximab, tositumomab and iodine I131 tositumomab, trastuzumab, ublituximab-xiiy, or any combination thereof.

[0274] In an aspect, a disclosed targeted therapy for subcutaneous administration can comprise denosumab, ofatumumab, or any combination thereof.

[0275] In an aspect, a disclosed method of treating cancer can comprise administering to the subject a therapeutically effective amount of a targeted immunotherapy agent (e.g., fam- trastuzumab-deruxtecan-nxki; trastuzumab; Herceptin Hylecta (injectable Herceptin); Herceptin biosimilars (e.g., Herzuma, Kanjinti, Ogivri, Ontruzant, and Trazimera); ado-trastuzumab emtansine; margetuximab-cmkb; pertuzumab, trastuzumab, and hyaluronidase- zzxf; pertuzumab; sacituzumab govitecan-hziy; or any combination thereof).

[0276] In an aspect, a disclosed method can be modified. In an aspect, one or more steps of a disclosed method can be modified. In an aspect, a disclosed method of treating cancer and / or metastatic cancer can comprise modifying or changing one or more features or aspects of one or more steps. In an aspect, a method can be altered by changing the amount of a disclosed LNP, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti-cancer agent, a disclosed chemotherapeutic agent, or a combination thereof administered to a subject, or by changing the frequency of administration of a disclosed LNP, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti- cancer agent, a disclosed chemotherapeutic agents, or a combination thereof to a subject, by changing the duration of time that a disclosed LNP, a disclosed pharmaceutical formulation, a disclosed plasmid, a disclosed targeted therapy, a disclosed anti-chemokine, a disclosed anti- cancer agent, a disclosed chemotherapeutic agent, or a combination thereof is administered to a subject, or by substituting for one or more of the disclosed components and / or reagents with a similar or equivalent component and / or reagent. The same applies to all disclosed treatment regimens, disclosed LNP, disclosed pharmaceutical formulations, disclosed targeted therapies, disclosed pharmaceutical formulations, disclosed anti-chemokines, disclosed anti-cancer agents, disclosed chemotherapeutic agents, or combinations thereof. D. Uses

[0277] Disclosed herein is a use of a disclosed pharmaceutical formulation to treat a subject having prostate cancer and / or metastatic prostate cancer. Disclosed herein is a use of a pharmaceutical formulation comprising one or more disclosed nucleic acid molecules to treat a subject having prostate cancer and / or metastatic prostate cancer. Disclosed herein is a use of a pharmaceutical formulation comprising one or more disclosed plasmids to treat a subject having prostate cancer and / or metastatic prostate cancer. Disclosed herein is a use of a pharmaceutical formulation comprising one or more disclosed LNPs to treat a subject having prostate cancer and / or metastatic prostate cancer.

[0278] Disclosed herein is the use of a pharmaceutical formulation comprising one or more disclosed nucleic acid molecules, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. Disclosed herein is the use of a pharmaceutical formulation comprising one or more disclosed plasmids, and one or more pharmaceutically acceptable carriers, diluents, and / orexcipients to treat a subject having prostate cancer and / or metastatic prostate cancer. Plasmids are discussed supra. Disclosed herein is the use of a pharmaceutical formulation comprising one or more disclosed LNPs, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer.

[0279] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA.

[0280] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre- guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer.

[0281] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject.

[0282] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre- guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE- PEG-maleimide, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer.

[0283] Disclosed herein is the use of a pharmaceutical formulation comprising one or more SCORT LNPs comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA.

[0284] Disclosed herein is the use of a pharmaceutical formulation comprising one or more SCORT LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. Disclosed herein is the use of a pharmaceutical formulation comprising one or more SCORT LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG- PEG 2000, and DSPE-PEG-maleimide, and one or more pharmaceutically acceptable carriers,diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer.

[0285] Disclosed herein is the use of a pharmaceutical formulation comprising one or more SCORT LNPs comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject.

[0286] Disclosed herein is the use of a pharmaceutical formulation comprising one or more SCORT LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. Disclosed herein is the use of a pharmaceutical formulation comprising one or more SCORT LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG- PEG 2000, and DSPE-PEG-maleimide, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer.

[0287] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA.

[0288] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre- guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer.

[0289] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising (i) a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre- guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer.

[0290] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre- guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. Disclosed herein is the use of a pharmaceutical formulationcomprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer.

[0291] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising (i) a core comprising one or more plasmids comprising RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA.

[0292] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer.

[0293] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising (i) a core comprising a plasmid comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. In an aspect, adisclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre- gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject.

[0294] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG- maleimide, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer.

[0295] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising (i) a core comprising a plasmid comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. In an aspect, a disclosed RNA cargo molecule can comprise a plasmid comprising at least one pre-guide RNA oligonucleotide (pre- gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA.

[0296] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. Disclosed herein is theuse of a SCORT lipid nanoparticle (LNP), comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer.

[0297] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising (i) a core comprising a plasmid comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer.

[0298] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG- maleimide, wherein the LNP provides precise delivery of RNA cargos to metastatic prostate cancer cells in the liver of a subject, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer.

[0299] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising (i) a plasmid comprising a core comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA.

[0300] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) a plasmid comprising at least one Cas13d mRNA; and (ii) a plasmid comprising at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer.

[0301] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising (i) a core comprising a plasmid comprising one or more RNA cargo molecules; and (ii) an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos. In an aspect, a disclosed RNA cargo molecule can comprise at least one pre-guide RNA oligonucleotide (pre- gRNA) targeting HOXB13 mRNA or a portion thereof. In an aspect, a disclosed RNA cargo molecules can comprise at least one Cas13d mRNA, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer.

[0302] Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre- guide RNA oligonucleotide (pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. Disclosed herein is the use of a pharmaceutical formulation comprising one or more LNPs comprising a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA oligonucleotide(pre-gRNA) targeting HOXB13 mRNA or a portion thereof; and an E3 aptamer surface-modified shell surrounding the core and comprising FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide, wherein the LNP provided selective cell in organ targeted of one or more mRNA cargos, and one or more pharmaceutically acceptable carriers, diluents, and / or excipients to treat a subject having prostate cancer and / or metastatic prostate cancer. E. Kits

[0303] Disclosed herein is a kit comprising one or more disclosed nucleic acid molecules, one or more disclosed plasmids, one or more nanoparticles, one or more disclosed pharmaceutical formulations, or any combination thereof. Disclosed herein is a kit comprising one or more disclosed LNPs. Disclosed herein is a kit comprising one or more SCORT LNPs. Disclosed herein is a kit comprising one or more disclosed pharmaceutical formulations comprising one or more disclosed LNPs and / or disclosed SCORT LNPs.

[0304] In an aspect, a disclosed kit can comprise one or more additional active agents and / or therapeutic agents (such as, for example, a disclosed anti-cancer agent). In an aspect, the one or more agents can treat, prevent, inhibit, and / or ameliorate one or more comorbidities in a subject. In an aspect, one or more active agents can treat, inhibit, prevent, and / or ameliorate cellular and / or metabolic complications related to cancer or cancer cells or cancerous cells.

[0305] In an aspect, a disclosed kit can comprise one or more additional active agents and / or therapeutic agents (such as, for example, a disclosed anti-viral agent). In an aspect, the one or more agents can treat, prevent, inhibit, and / or ameliorate one or more comorbidities in a subject.

[0306] In an aspect, a disclosed kit can comprise at least two components constituting the kit. Together, the components constitute a functional unit for a given purpose (such as, for example, treating a subject diagnosed with or suspected of having a disease or disorder such as cancer). Individual member components may be physically packaged together or separately. Forexample, a kit comprising an instruction for using the kit may or may not physically include the instruction with other individual member components. Instead, the instruction can be supplied as a separate member component, either in a paper form or an electronic form which may be supplied on a computer readable memory device or downloaded from an internet website, or as recorded presentation. In an aspect, a kit for use in a disclosed method can comprise one or more containers holding one or more disclosed nucleic acid molecules, one or more disclosed plasmids, one or more nanoparticles, one or more disclosed pharmaceutical formulations, or any combination thereof, and a label or package insert with instructions for use. In an aspect, suitable containers include, for example, bottles, vials, syringes, blister pack, etc. The containers can be formed from a variety of materials such as glass or plastic. The container can hold one or more disclosed nucleic acid molecules, one or more disclosed plasmids, one or more nanoparticles, one or more disclosed pharmaceutical formulations, or any combination thereof, and can have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). The label or package insert can indicate that one or more disclosed nucleic acid molecules, one or more disclosed plasmids, one or more nanoparticles, one or more disclosed pharmaceutical formulations, or any combination thereof can be used for treating, preventing, inhibiting, and / or ameliorating a disease or disorder or complications and / or symptoms associated with a disease or disorder such as cancer including prostate / metastatic prostate cancer. A kit can comprise additional components necessary for administration such as, for example, other buffers, diluents, filters, needles, and syringes.

[0307] In an aspect, a disclosed kit can be used to decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcription factor (such as, for example, HOXB13). In an aspect, a disclosed kit can be used to decrease and / or knockdown the expression and / or activity of a transcription factor and / or an undruggable transcription factor (such as, for example, HOXB13) and can mitigate and / or non-specific gene targeting or off-targeting effects. In an aspect, a disclosed kit can be used to decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor (such as, for example, HOXB13). In an aspect, a disclosed kit can be used to decrease and / or knockdown the mRNA levels of a transcription factor and / or an undruggable transcription factor (such as, for example, HOXB13) and can mitigate and / or non-specific gene targeting or off-targeting effects. In an aspect, a disclosed kit can be used to reduce and / or decrease the risk of metastases. In an aspect, a disclosed kit can be used in RNA-based editing system. In an aspect, a disclosed kit can be used in RNA-based editing system comprising a bi-targetingstrategy. In an aspect, a bi-targeting strategy comprises targeting through PSMA and targeting transcription factors through using CRISPR / Cas13d system. In an aspect, a disclosed kit can be used in one or more disclosed methods. In an aspect, a disclosed kit can be used in one or more disclosed methods of treating a subject having prostate cancer and / or metastatic prostate cancer. Table 1 - Listing of Sequences SEQ ID NO Description of Sequence 1 H B1 RNA 1SEQ ID NO Description of Sequence 25 SNAI1-R Primer (5’ to 3’)SEQ ID NO Description of Sequence 55 UGT2B11-R Primer (5’ to 3’) )SEQ ID NO Description of Sequence 85 Plasmid comprising NLS-CasRx-NLS-HA-T2A-EGFP (Addgene #10049)

[0308] Prostate cancer is the most common cause of cancer in men in the United States and Europe and the second leading cause of cancer death. Most patients present with prostate adenocarcinoma, a tumor type that displays morphologic characteristics reminiscent of luminal prostate cells, is driven by androgen and is typically associated with elevated serum prostate- specific antigen (PSA).

[0309] Metastatic cancer, the primary cause of cancer mortality, often relies on transcription factors (TFs) untargetable by small-molecule drugs. Therefore, described herein is Selective Cell in Organ Targeting (SCORT) nanoparticles were developed for precise CRISPR / Cas13d mRNA and gRNA delivery to metastatic cancer cells in vivo, aiming to knock down these undruggable oncogenic TFs. In prostate cancer liver metastasis models driven by the undruggable TF HoxB13, repeated systemic SCORT-Cas13d-gHoxB13 treatment significantly decreased HoxB13 expression in metastatic tumors, reduced metastasis, and extended mouse survival. Importantly, prolonged treatment showed no significant impact on the functions and histology of major organs or on immune markers, underscoring its safety. Mechanistic studies revealed that SCORT-Cas13d-gHoxB13 treatment inhibits metastatic tumor proliferation and angiogenesis while promoting apoptosis by regulating multiple gene pathways. Unexpectedly, it inhibited the non-canonical, EMT-independent oncogenic function of Snail. These findings suggest that SCORT-Cas13d-gTF can effectively and safely target undruggable TFs in metastatic cancers, positioning CRISPR as a potential treatment.

[0310] Metastatic cancer, the leading cause of cancer mortality, is propelled by numerous oncoproteins. (Ganesh K. (2021) Nat Med. 27:34-44). Among these, transcription factors(TFs) arguably play a more critical role than conventional signaling oncoproteins, as TFs serve as focal points in the deregulated signaling pathways and are the master regulators of many signaling proteins - a concept suggested by James E. Darnell over 20 years ago. (Darnell JE, Jr. (2002) Nat Rev Cancer. 2:740-749). Indeed, cancer cells frequently develop a marked dependency on certain TFs, a phenomenon known as ‘transcriptional addiction’ in cancer. (Bradner JE, et al. (2017) Cell. 168:629-643). Unfortunately, apart from nuclear hormone receptors, most TFs are considered ‘undruggable’ due to conformational variability and the lack of distinct small-molecule binding sites. (Henley MJ, et al. (2021) Nat Rev Drug Discov. 20:669-688).

[0311] Several innovative protein-targeting strategies have emerged to target these traditionally ‘undruggable’ TFs. However, many of these strategies are indirect, employing kinase inhibitors to modulate TF function, epigenetic inhibitors to alter TF-bound chromatin, and agents that disrupt TF-cofactor interactions. Proteolysis targeting chimeras (PROTACs) are heterobifunctional small molecules designed to bind to TFs and recruit endogenous E3 ubiquitin ligases for the targeted degradation of TFs. Yet, the efficacy of these molecules hinges on the presence of accessible binding sites, which are often lacking in classically ‘undruggable’ TFs. As a result, current PROTACs largely depend on pre-existing ligands for proteins already classified as druggable, such as the androgen receptor (AR) and estrogen receptor (ER). Furthermore, not all ubiquitin E3 ligases are effective in the degradation of certain proteins. (Henley MJ, et al. (2021) Nat Rev Drug Discov. 20:669-688); (Bushweller JH. (2019) Nat Rev Cancer. 19:611-624); (Xie X, et al. (2023) Signal Transduct Target Ther. 8:335). Nucleic acid-based therapies have emerged as crucial alternative strategies with the potential to directly target traditionally undruggable genes, including oncogenic TFs. However, antisense oligonucleotides (ASOs) have primarily been utilized in the treatment of neurological disorders, and none of the approved ASOs target undruggable proteins directly. (Xie X, et al. (2023) Signal Transduct Target Ther. 8:335). Although RNA interference (RNAi) is promising, clinical trials have revealed that some siRNA drugs targeting TFs, such as DCR-Myc, lack silencing efficacy. (Xie X, et al. (2023) Signal Transduct Target Ther. 8:335). Moreover, RNAi-based approaches may silence target genes but can also produce significant off-target effects due to their vital roles in endogenous processes. (Birmingham A, et al. (2006) Nat Methods. 3:199-204); (Sigoillot FD, et al. (2012) Nat Methods. 9:363-366). CRISPR / Cas9-based therapy, currently mainly used ex vivo for non-cancer diseases, exhibits higher efficiency than other nucleic-acid-based approaches; however, it also carries potential risks for irreversible off-target effects and immunogenicity issues due to preexisting immunityto Cas9 in humans. (Xie X, et al. (2023) Signal Transduct Target Ther.8:335); (Khoshandam M, et al. (2024) Genes Dis.11:268-282).

[0312] Here, the RNA-targeting CRISPR / Cas13d system was used for the knockdown of TF mRNAs in metastatic cancer. The Cas13d enzyme (Konermann S, et al. (2018) Cell.173:665- 676 e614) is a compact and efficient mediator for RNA-targeting gene therapy, capable of degrading mRNA without the irreversible off-target genomic alterations associated with CRISPR / Cas9 (Nature Editors. (2018) Nat Med. 24:1081), and with a substantially lower frequency of off-target transcriptomic alterations compared to RNAi. (Birmingham A, et al. (2006) Nat Methods. 3:199-204); (Sigoillot FD, et al. (2012) Nat Methods. 9:363-366). By simply changing guide RNAs (gRNAs), this system can target the mRNA of various TFs. Importantly, the Cas13d-NLS (nuclear localization signals) protein from the Ruminococcus flavefaciens strain XPD3002 (CasRx) can be utilized for programmable RNA knockdown in vitro and in vivo with high efficiency and minimal off-target effects. (Konermann S, et al. (2018) Cell. 173:665-676 e614; Xu C, et al. (2021) Nat Methods. 18:499-506; Cui Z, et al. (2022) Nat Chem Biol.18:1056-1064; He B, et al. (2020) Protein Cell.11:518-524; Kushawah G, et al. (2020) Dev Cell.54:805-817 e807).

[0313] Although CasRx facilitates potent and specific gene knockdown, the efficient and targeted delivery of CasRx - preferably in its mRNA format, due to rapid gene-editing kinetics and reduced off-target effects compared to plasmid DNA (Cui Z, et al. (2022) Nat Chem Biol. 18:1056-1064); (Eoh J, et al. (2019) Biomater Sci. 7:1240-1261); (Tong S, et al. (2019) Nat Rev Mater. 4:726-737) - alongside gRNA to metastatic cancer cells in vivo remains a considerable challenge. Lipid nanoparticles (LNPs), comprised of ionizable lipid, cholesterol, phospholipid, and polyethylene glycol (PEG)-lipid, have been extensively investigated for mRNA delivery in various biomedical applications. (Zhang H, et al. (2021) Proc Natl Acad Sci USA. 118(52):e2116269118; Zhang X, et al. (2020) Sci Adv. 6:eaay6953). Notably, LNPs administered intravenously tend to accumulate primarily in the liver, a property that could be beneficial for treating liver metastases (Tsilimigras DI, et al. (2021) Nat Rev Dis Primers.7:27) - a deadly progression of several cancers, including colorectal and prostate cancer. Nevertheless, these nanoparticles are predominantly taken up by hepatocytes rather than metastatic cancer cells in the liver. (Zhang X, et al. (2020) Sci Adv. 6:eaay6953; Love KT, et al. (2010) Proc Natl Acad Sci U S A.107:1864-1869). Therefore, precise engineering of LNPs is essential for the systemic delivery of LNP-mRNA therapeutics specifically to metastatic cancer cells in the liver to achieve anti-tumor effects.

[0314] In this study, a strategy termed Selective Cell in Organ Targeting (SCORT) was developed to enable systematic engineering of nanoparticles for precise delivery of RNA cargoes, including reporter mRNA, CasRx mRNA, and gRNA oligonucleotides, to metastatic cancer cells in the liver. Metastatic castration-resistant prostate cancer (CRPC) liver metastasis was used as the experimental model since it is present in approximately 25% of patients with advanced disease, according to autopsy studies. (Bubendorf L, et al. (2000) Hum Pathol. 31:578-583); (Shah RB, et al. (2004) Cancer Res. 64:9209-9216). It is associated with the worst prognosis and poor response to hormonal therapy, taxane chemotherapy, and PSMA- directed radioligand therapy; thus, overcoming CRPC liver metastases represents a major unmet medical need. Metastatic CRPC highly expresses the undruggable oncogenic TF, a member of the 39 human members of the Hox subgroup within the homeobox family of TFs. The experiments described herein demonstrate that SCORT LNPs, which carried CasRx mRNA and unprocessed gRNA (pre-gRNAs) targeting HoxB13 (designated as SCORT- CasRx-pre-gHoxB13) decreased HoxB13 expression in the metastatic tumors, inhibited metastasis, and prolonged survival of mice bearing AR-positive (AR+) or negative (AR-) CRPC tumors by inhibiting cell proliferation, angiogenesis, and metabolism, and inducing apoptosis. Using SCORT-CasRx-pre-gHoxB13 as a tool, we also unexpectedly found that HoxB13 knockdown inhibited the non-canonical, epithelial-mesenchymal transition (EMT)- independent oncogenic function of Snail. Notably, prolonged administration of SCORT- CasRx-pre-gHoxB13 did not significantly alter body weight, hepatic and renal function, or levels of chemokines and cytokines, effectively highlighting its safety. This research represents a pioneering effort to precisely, effectively, and safely target undruggable oncogenic TFs via nanoparticle-delivered CasRx RNA-targeting gene therapy, and to use CRISPR as a treatment for metastatic cancers. The SCORT-Cas13d-gHOXB13 system, a highly flexible technology, that can alter the treatment landscape for metastatic prostate cancer.

[0315] The Examples that follow are illustrative of specific aspects of the invention and set forth for explanatory purposes only and are not to be taken as limiting the invention. METHODS AND MATERIALS Cell Lines and Reagents

[0316] 293FT cells were obtained from Invitrogen (no. R70007), and PC-3 cells were obtained from the American Type Culture Collection (ATCC, no. CRL-1435). Both cell lines were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Gibco, no. A4766801). LNCaP95 cells, provided by Dr. Jun Luo (Johns Hopkins University), were grown in phenol red-free RPMI 1640 medium with 10% charcoal-strippedFBS. LNCaP95 cells stably expressing luciferase (LNCaP95-Luc) was generated by incubating LNCaP95 cells with IVISbrite Red F-luc-Puromycin Lentiviral Particles (no. CLS96002), followed by selection with puromycin (Gibco, no. A1113803,1 µg / mL). PC3 Red-Fluc was obtained from PerkinElmer (no. BW128444) and was grown in Eagle’s Minimum Essential Medium (EMEM) supplemented with 10% FBS. AML12 cells were obtained from Duke University Cell Culture Facility, sourced from ATCC, and grown in DMEM / F12 medium with 10% FBS, 1x Insulin-Transferrin-Selenium (ITS) and 40 ng / mL Dexamethasone. All cell lines were maintained at 37 °C with 5% CO2. The cell lines were routinely tested for mycoplasma contamination using the VenorTMGeM Mycoplasma Detection Kit (Sigma-Aldrich, no. MP0025) following the manufacturer’s protocol. Mice

[0317] For all animal studies, the study protocols were approved by the Institutional Animal Care and Use Committee of Duke University. CD-1 mice (strain no. 022, males, aged 5-8 weeks) were purchased from Charles River (Wilmington, MA). NSG (NOD.Cg-PrkdcscidIl2rgtm1Wjl / SzJ, strain no. 005557, male, 4-6 weeks old) were acquired from The Jackson Laboratory (Bar Harbor, ME) or Rodent Gnotobiotic and Breeding Core at Duke University Medical Center. The mice were maintained under pathogen-free conditions (22.5 °C, 51% humidity and a 12 hr. light / dark cycle) and were acclimatized for 1 week before the start of the studies. vNSG Mice were surgically castrated as previous described74. After 1-2 weeks of recovery, a liver metastatic CRPC model was established by hemispleen injection of LNCaP95- Luc Cells (1 x 106per mouse) or PC-3 Red-Fluc cells (3 x 105per mouse), following previously described methods. (Simons BW, et al. (2020) Prostate.80:1263-1269) Human Pathology

[0318] Paraffin-embedded tissue microarray sections with multiple cores of prostate tumors (Normal, ADPC, mCRPC) were constructed by Dr. Jiaoti Huang (Duke). The level of HoxB13 expression was assessed via immunohistochemical staining, wherein HoxB13 immunoreactivity was examined and scored. The expression score was derived by combining both the intensity and the percentage of immunoreactive cells. SCORT LNP Candidates

[0319] Preparation and Conjugation. The preparation procedure for LNP candidates was followed as previously described. (Cui Z, et al. (2022) Nat Chem Biol.18:1056-1064) Briefly, a lipid-like compound functionalized TT derivative 5 (FTT5, synthesized by Dr. Yizhou Dong’s laboratory at Icahn School of Medicine at Mount Sinai) (Zhang X, et al. (2020) Sci Adv. 6:eaay6953), DOPE (Avanti Polar Lipids, no. 850725), cholesterol (Sigma, no. C3045),DMG-PEG2000 (NOF America Corporation), and DSPE-PEG-maleimide (Avanti Polar Lipids, no.880126) were dissolved in ethanol in molar ratios of 20:30:39:0.75:1, 20:30:38.25:1.5:1, 20:30:36.75:3:1, respectively. RNAs were diluted in citrate buffer (10 mM, pH 4.0). The prepared solutions were mixed via a microfluidic mixing device (The NanoAssemblr SparkTM, Precision Nanosystems) at a volume ratio of 1:2 (organic: aqueous) to achieve a final weight ratio of lipids: RNAs of 20:1. Luciferase mRNA (no. L-7202), mCherry mRNA (no. L-7203), EGFP mRNA (no. L-7601) were purchased from TriLink. CasRx mRNA with pseudouridine modification (pseudouridine-5’-triphosphate, TriLink) was synthesized using in vitro transcription (AmpliScribe T7-Flash Transcription Kit, Lucigen) and was then installed with 5’ cap (Vaccinia Capping System, NEB; Cap 2’-O-methyltransferase, NEB) and 3’ poly(A) tail structures by Dr. Yizhou Dong’s laboratory (Li B, et al. (2016) Bioconjug Chem. 27:849-853; Li B, et al. (2018) Nat Protoc. 13:899-914). Pre-gControl and pre-gHoxB13 oligos with 2’OMe and phosphorothioate modification were synthesized by TriLink, and their sequences are listed in Table 2. The buffer was exchanged to DPBS containing 5 mM EDTA by 7K Zeba Spin Desalting Columns (ThermoFisher Scientific, no. 89882), incubated with a fivefold molar excess of E3 aptamer compared to DSPE-PEG- maleimide for 2 hours at room temperature followed by overnight at 4 ℃ with gentle shaking for the thiol-maleimide cross-linking reaction. The E3 aptamer, with 2’ Fluoro and 5’ C6 thiol linker modification, was synthesized by TriLink; the sequence is included in Table 2. Free aptamer was separated and washed by Amicon Ultra spin columns (10k, no. UFC901024) the following day. The RNA dose for the animal studies (CasRx mRNA: pre-gRNA, 1:2, wt: wt) is 1.5 mg / kg. Table 2 - Sequences Used for Pre-gRNA Screening and Oligos with Modification Name Sequence (5’ to 3’)Name Sequence (5’ to 3’) C*A*A*GUAA*A*C*CCCUACCAACUGGUCGGGGUUUGAAACCAA A A

[0320] The Zetasizer Nano ZS (Malvern Panalytical) was used to measure the particle size, polydispersity index (PDI), and zeta potential. Transmission Electron Microscopy (TEM) examination was performed by Chapel Hill Analytical and Nanofabrication Laboratory at the University of North Carolina-Chapel Hill, using a Talos F200X (Thermo Fisher) at an accelerating voltage of 200 kv. mRNA encapsulation efficiency was determined by the RiboGreen Assay (Thermo Fisher, no. R11490) and Spectra Max M3 microplate reader (Molecular Devices). In Vitro Studies Cell Delivery Evaluation.

[0321] LNCaP95 cells (3 x 105), PC-3 cells (2 x 105), or AML12 cells (2 x 105) were seeded into 6-well plates and allowed to reach 70-80% confluence overnight, followed by incubation with SCORT LNP candidates encapsulating 1 μg luciferase mRNA for 24 hrs. For subsequent analysis, LNCaP-95 cells (1 x 104), PC-3 cells (6 x 104), or AML12 cells (3 x 104) were reseeded into 96-well plates with black walls and clear bottoms (Corning, no.3603). They were then incubated with 150 ng / μL IVIS brite D-Luciferin Potassium Salt Bioluminescent Substrate (Perkin Elmer, no.122799) for 5 minutes. The luminescence signal was then measured using the Spectra Max M3 microplate reader and imaged using the IVIS lumina XR system (Caliper Life Science). For the flow cytometry assay, the three cell lines were prepared in 6-well plates overnight until 70-80% confluence. The plates were then separately incubated with SCORT LNP candidates encapsulating 1 μg of EGFP mRNA (TriLink, no. L-7601) or mCherry mRNA (TriLink, no. L-7203) for 24 hrs. Subsequently, fluorescence analysis was conducted using the Fortessa x20 Analyzer (BD).Cell Proliferation and Invasion Assays

[0322] LNCaP95 cells (3 x 105) or PC-3 cells (2 x 105) were seeded into 6-well plates and allowed overnight to reach 70-80% confluence. The cells were then transfected with 1 μg / mL CasRx mRNA along with 2 μg / mL of either pre-gControl oligo or pre-gHoxB13 oligo using Lipofectamine MessengerMAX (Invitrogen, no. LMRNA015). Opti-MEM (Mock) and Lipofectamine MessengerMAX reagent alone (eLNPs) served as controls. Cell proliferation was assessed using the WST-1 assay. The following day, LNCaP95 cells (5 x 103) and PC-3 cells (3 x 103) were reseeded into 96-well plates. On day 1, day 3, and day 5 post-transfection, cell proliferation reagent WST-1 (10 μL / well, Roche, no. 11644807001) was added, and absorbance at 450 nm was measured using the Spectra Max M3 microplate reader after a 1- hour incubation. Cell invasion was evaluated using a transwell assay. After 48 hrs. of treatments, LNCaP95 cells (3 x 105) and PC-3 cells (2 x 105) were suspended in FBS-free medium and seeded into 8-μm Transwell inserts (Corning, no. 3422) coated with Matrigel (Corning, no.356237). After 24 hrs., the invasive cells were fixed with methanol and stained with crystal violet (Sigma, no.1159400025) for 20 minutes. Cells on the upper surface of the membranes were removed with a cotton swab, while those that had penetrated were photographed and counted. Mouse Experiments Metastasis Suppression Assay In the LNCaP95 mouse model, treatments including DPBS, SCORT LNP, SCORT-CasRx-pre- gControl, and SCORT-CasRx-pre-gHoxB13 were respectively administered to mice (n = 7 per group) starting one week after cell injection, with a frequency of twice per week for 6.5 weeks. Bioluminescent signal measurements were performed at 3-weeks, 5-weeks, and 7-weeks post- cell injection to monitor metastasis. For the PC-3 mouse model, treatments of SCORT-CasRx- pre-gControl and SCORT-CasRx-pre-gHoxB13 commenced 3 days after cell injection, administered twice per week for 3 weeks. Bioluminescent signal measurements were taken at 1-week, 2-weeks, and 3-weeks post-cell engraftment. For both models, animals were monitored daily until death or humane euthanasia. Tumor tissues or liver tissues with metastatic tumors were collected 72 hrs. after the last treatment for histological and / or biochemical analysis. Mechanistic Investigation Assay

[0323] In the LNCaP95 mouse model (5 weeks after cell injection), mice received treatments of SCORT-CasRx-pre-gControl and SCORT-CasRx-pre-gHoxB13 twice within one week, with a 3-day interval between doses. Tumor tissues were collected 72 hrs. after the finaltreatment for subsequent analysis, including molecular analysis, biochemical assessments, and histological examinations. Similarly, in the PC-3 mouse model (2 weeks after cell injection), mice underwent the same treatment regimen as the LNCaP95 mouse model. Liver tissues with metastatic tumors were collected 72 hrs. after the final treatment for histological analysis. Toxicity Profiling Male CD-1 mice (n = 8 per group) were administered DPBS, SCORT LNP, SCORT-CasRx- pre-gControl, and SCORT -CasRx-pre-gHoxB13, respectively, twice per week for 6.5 weeks. Body weight was measured every 3-4 days. Blood samples were collected 72 hours after the last treatments. Complete blood cell counts (CBC) were assessed using IDEXX Procyte DX (IDEXX Laboratories). Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), and creatinine (CREAT) were measured by the Animal Histopathology and Laboratory Medicine Core at the University of North Carolina-Chapel Hill. Additionally, plasma levels of 18 cytokines / chemokines were analyzed by Alfawasserman Vet Axcel (Alfawasserman Diagnostic Technologies) using the MAGNETIC Kit (Millipore Sigma, no. MCYTOMAG-70K). Major organ tissues, including the lungs, liver, spleen, heart, and kidneys, were collected for organ coefficient evaluation and histopathological examination. IVIS Imaging

[0324] For monitoring the luciferase signal, LNCaP95 or PC-3 mouse models were intraperitoneally injected with substrate D-Luciferin (150 mg / kg, Pekin Elmer, no.770505) for bioluminescence detection in whole body or specific organs. For mCherry signal visualization, organs in the LNCaP95 mouse model were imaged for fluorescence 2 hrs. after SCORT- mCherry injection. All signal measurements were conducted using the IVIS Lumina XR system (Caliper Life Science). Imaging Mass Cytometry (IMC)

[0325] The LNCaP95 tumor tissues were processed and stained per protocol as previously described (Xu Y, et al. (2022) Cancer Res Commun.2:884-893). Briefly, tumor sections were baked at 60 °C overnight, then dewaxed in xylene and rehydrated in a graded series of alcohol. Heat-induced epitope retrieval was performed in an EZ-Retriever System (BioGenex) at 95 °C in Citrate buffer at pH6 for 20 minutes. After immediate cooling for 20 minutes, the sections were blocked with 3% BSA in TBS for 1 hr., and then incubated overnight at 4 °C with an antibody master mix. The Samples were subsequently washed four times with TBS / 0.1% Tween20 before staining with Cell-ID Intercalator (Standard BioTools) for 5 minutes for nuclear staining. Slides were washed twice with TBS / 0.1% Tween20 and air dried to store at4 °C for ablation. The sections were ablated with Hyperion™ Imaging System (Standard BioTools) for data acquisition. The raw data were preprocessed and checked for tissue integrity, staining quality, and signal range prior to downstream analysis. For every Region of interest (ROI), the single cells were segmented using ilastik (Berg, S. et al. (2019) Nat Methods 16:1226-1232) and CellProfiler (Stirling DR, et al. (2021) BMC Bioinformatics. 22:433), based on DNA staining (Ir191) and cell surface markers (i.e., HNF4a, PSMA, and F4 / 80). Each ROI contained an average of 2,093 cells within the areas of 0.25 mm2.

[0326] Following cell segmentation, data were processed and visualized using the Histology Topography Cytometry Analysis Toolbox (HistoCAT) (Schapiro D, et al. (2017) Nat Methods. 14:873-876). Mean intensities of each marker for all single cells were extracted and consolidated in R scripts for downstream analysis. The positive cells for each marker were determined by thresholding method based on histogram and cross-validated by unsupervised clustering from normalized intensity values. Cell densities or percentages of each cell type were calculated by normalizing cell counts by ROI areas or total cell counts of that ROI. RNA Isolation and Quantitative RT-PCR (qRT-PCR)

[0327] Total RNA of treated cells or tumor tissues was isolated using the RNeasy Mini Kit (Qiagen, no.74106) and was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Life Technologies, no. 4368814). qRT-PCR was performed with PowerUp SYBR Green PCR Master Mix reagents (Applied Biosystems, no. A25742) on a qTOWER3G system (Analytik Jena). The primers used were synthesized by IDT, and their sequences are listed in Table 3. The transcript level was normalized by the internal control (18s-rRNA). Table 3 - Primers Used in this Study SEQ ID NO Name Sequence (5’ to 3’)SEQ ID NO Name Sequence (5’ to 3’) 29 MSMP-R TGGAGGAGTAGAGACATCACCA TSEQ ID NO Name Sequence (5’ to 3’) 59 AMOTL2-R CATGAGCTAGTACAACATGAGGG

[0328] RNA-seq analysis was conducted following previously established procedures. (Chen Z, et al. (2018) Proc Natl Acad Sci USA.115:6810-6815) Briefly, 293FT cells were transfected with either a pre-gControl or a pre-HoxB13 vector in combination with a CasRx expression plasmid for 24 hrs. LNCaP95 liver metastasis samples were collected for mechanistic investigation assays. RNA extraction was performed using the RNeasy Mini Kit (Qiagen, no. 74106). To generate libraries, mRNA enrichment was carried out using the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB, no. E7490L). After two rounds of processing, the enriched mRNA was subject to library construction with NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, no. E7765S) according to the manufacturer’s instructions. Complementary DNA molecules were amplified for eight cycles by PCR. The resulting non- size-selected libraries were sequenced on either an Illumina NovaSeq 6000 or NovaSeq X Plusplatform at the Duke Sequencing and Genomic Technologies Shared Resource. For the RNA- seq data analysis of HoxB13 knockdown in 293FT cells, alignment of reads to the human hg19 reference genome was executed using HISAT2 v.2.1.0, and expression counts were calculated using htseq-count v.0.11.2. Differentially expressed genes (DEGs) were identified using DESeq2 v.1.26.0 (Love MI, et al. (2014) Genome Biol.15:550) with a cutoff of absolute fold change > 2 and a q value < 0.01. For the RNA-seq analysis of isolated tumors from LNCaP95 CRPC liver metastases, the fastq files were first performed quality control by Trim Galore v.0.6.10 and were then mapped to hg38 by Hisat2 v.2.2.1 (Kim D, et al. (2019) Nat Biotechnol. 37:907-915) with its default parameters. The read counts for each gene were calculated by featureCounts v.2.0.6 (Liao Y, et al. (2013) Nucleic Acids Res.41:e108) with parameters -s 2 and -M. DEGs were identified by DESeq2 v.1.40.1 (Love MI, et al. (2014) Genome Biol. 15:550) with the cutoffs of absolute fold change ≥ 1.4 and p-value ≤ 0.05. Cistrome-GO Analysis

[0329] All HoxB13 peaks associated with prostate cancer were incurated, including those from cell lines and tissues (CistromID: 56663, 56664, 84204, 84205, 84342, 84343, 84346, 84347, 88278, 88495, 88496, 88497, 88686, 89854, 89856, 89857, 90052, 90057, 90058, 93209), using Cistrome Data Browser v2.0. (Zheng R, et al. (2019) Nucleic Acids Res.47:D729-D735) The separated peak files were further merged into a single file using bedtools (Quinlan AR, et al. (2010) Bioinformatics. 26:841-842) merge with default parameters. Subsequently, Cistrome GO analysis was performed on the Cistrome GO webserver (Li S, et al. (2019) Nucleic Acids Res.47:W206-W211) by inputting both HoxB13 peaks and DEGs from RNA- seq with the following advance setting: Peak number to use 100000; customized half-decay distance: 50; cutoffs of (logFoldChange, FDR) for DEGs: 0.4 / 0.05; FDR cutoff of GO / KEGG terms to return: 0.2; Minimum and maximum gene number in GO and KEGG gene sets: 10 / 2000. For visualization convenience, the enrichment scores calculated in Cistrome GO were further scaled by log10. Western Blotting (WB)

[0330] The treated Cells or homogenized tumor tissues were collected and lysed in RIPA buffer (Boston BioProducts, no. BP115) with 1X cOmplete protease inhibitor cocktail (Roche, no.11697498001) for 30 min on ice. The proteins concentration was determined by a BCA protein assay (Thermo, no.23225). Samples were resolved on 4%-15% Mini-PROTEAN®TGX Stain-Free™ Protein Gels (Bio-Rad, no. 4568084) or 4%-15% CriterionTMTGXTMPrecast Midi Protein Gel (Bio-Rad, no.5671085), then transferred onto PVDF membranes (Bio-Rad, no.1704157, no. 88520). After being blocked with 5% milk powder solution (Bio-Rad, no.170-6404) for 1 hr., the membranes were probed with HoxB13 antibody (Santa Cruz, no. SC66923, 1:200; or GeneTex, no. GEX129245, 1:500) or calnexin antibody (Enzo Life Sciences, no. ADI-SPA-860-F, 1:1000) overnight at 4 °C. Following incubation with corresponding secondary antibodies (LI-COR, no. 926-80011, 1:5000), immunoblots were developed using Supersignal West Pico PLUS chemiluminescent substrate and visualized using the C-DiGit Chemiluminescent Western Blot Scanner (Li-COR). Protein expression was quantified by densitometry (Image J 1.52a / Java 1.8.0_112) and normalized to calnexin. Immunohistochemistry (IHC) and Scoring

[0331] LNCaP95 tumor tissues or PC-3 metastatic liver were fixed in 4% paraformaldehyde, routinely processed in paraffin, and sectioned at 4 μm for immunostaining. Briefly, sections were deparaffinized, and antigen retrieval was performed using citrate buffer (Abcam, no. AB93678), followed by blocking with 1.2% H2O2. The sections were then incubated overnight at 4 °C with the following primary antibodies: anti-HoxB13 (Santa Cruz, no. SC66923, 1:200), anti-CD31 (Abcam, no. ab182981, 1:1000), anti-Ki67 (Abcam, no. ab16667, 1:200), anti-E- Cadherin (Abcam, no. ab40772, 1:400), anti-SNAIL+SLUG (Abcam, no. ab85936, 1 μg / mL), and anti-vimentin (Abcam, no. ab92547, 1:200). This was followed by a 30-minute incubation with goat anti-rabbit secondary antibody (Vector Laboratories, no. BA-1000, 1:400). The stained slides were either captured using a bright-field microscope (Nikon, USA) or scanned with the Aperio ScanScope (Leica, Nussloch, Germany). The H-score for HoxB13, snail, vimentin (in the PC-3 mouse model), and E-cadherin ranged from 0 to 300. This score was calculated as the product of the Intensity Score, assigned on a scale from 0 to 3 (0 for negative, 1 for weak positive, 2 for moderate positive, 3 for strong positive), multiplied by the percentage of cells in each tumor sample exhibiting maximum intensity (0%-100%). In assessing CD31 and vimentin (in the LNCaP95 mouse model) immunostaining, Microvessel Density (MVD) was appraised in areas of the invasive tumor featuring the highest concentration of capillaries and small venules (Weidner N, et al. (1991) N Engl J Med. 324:1-8; Weidner N, et al. (1993) Am J Pathol. 143:401-409; Miyata Y, et al. (2015) Int J Urol. 22:806-815). Regions rich in vascularity were identified at a low power (100x), and micro-vessels were quantified within a high-power field (400x). MVD was evaluated across three non-overlapping fields, and the final MVD was determined as the mean. Ki67 was scored by the proliferation index. Terminal Deoxynucleotidyl Transferase dUTP Nick-End Labeling (TUNEL) Assay

[0332] A one-step TUNEL In Situ Apoptosis kit (Elabscience, no. E-CK-A321) was used to assess apoptosis in tissue sections, following the manufacturer’s protocol.Statistical Analysis

[0333] A one-way ANOVA was employed for multiple group comparisons, and the Student’s t-test (two-tailed) was used for comparisons between two groups. A log-rank (Mantel-Cox) test was conducted for survival analysis. All statistical analyses were performed using GraphPad Prism software version 9.0. Statistical significance was defined as *p  <  0.05, **p  <  0.01, ***p  <  0.001, and ****P  <  0.0001. Data and Code Availability

[0334] The RNA-seq data generated in this study was deposited in the Gene Expression Omnibus database under accession number GSE264062. Analysis details was provided in the STAR Methods section. EXAMPLE 1 Specific and Effective Targeting of HoxB13 by CasRx Inhibited CRPC cell Proliferation and Invasion

[0335] Silencing HoxB13 with RNAi significantly decreased CRPC cell growth in vitro and in xenograft models. (Chen Z, et al. (2018) Proc Natl Acad Sci USA.115:6810-6815) To examine the clinical relevance of HoxB13, immunohistochemical (IHC) analysis was performed on normal human prostate tissues, earlier androgen-dependent prostate cancer (ADPC) patient tissues, and metastatic CRPC patient tissues. CRPC samples exhibited significantly higher HoxB13 staining than ADPC or normal prostate samples (FIG.1A – FIG.1B), indicating that HoxB13 expression increases during prostate cancer progression to the lethal phase. To knock down HoxB13 using CasRx, a series of pre-gRNAs were screened to identify one (pre- gHoxB13-4) that mediated the most potent knockdown of HoxB13 (~99%) mRNA in human 293FT cells (FIG. 1C). Furthermore, transfection with pre-gHoxB13-4 gRNA alone or luciferase mRNA, in the absence of CasRx mRNA, did not lead to a reduction in HoxB13 mRNA levels (FIG. 1D). These data are consistent with the notion that Cas13 guide RNAs have no RNA interference effects. (Cox DBT, et al. (2017) Science.358:1019-1027). Next, using RNA-seq analysis, the off-target effects of CasRx-mediated HoxB13 gene knockdown was examined. In cells transiently transfected with the CasRx-pre-gHoxB13 vector, significant changes were observed only in the targeted gene, i.e., HoxB13, and two other genes, FACMR and CERS3 (FIG. 1E), which genes were previously reported to be direct target genes of HoxB13 in other systems. (Kron KJ, et al. (2017) Nat Genet. 49:1336-1345; Pomerantz MM, et al. (2015) Nat Genet. 47:1346-1351). The findings of no significant off-target effects resulting from CasRx-gHoxB13 targeting are consistent with previous reports of the high specificity of CasRx-mediated RNA knockdown in mammalian cells. (Konermann S, et al.(2018) Cell. 173:665-676 e614; Xu C, et al. (2021) Nat Methods. 18:499-506; Cui Z, et al. (2022) Nat Chem Biol. 18:1056-1064). Finally, the effects of CasRx-mediated HoxB13 knockdown on the CRPC cellular phenotypes were interrogated. Two CRPC models (LNCaP95 and PC-3) were chosen to cover the spectrum of CRPC patients. LNCaP95 represents the majority who are AR- positive, while PC-3 accounts for the significant AR- negative minority (approximately 30%). (Tang F, et al. (2022) Science. 376:eabe1505). Significantly, transfection with CasRx mRNA and pre-gHoxB13 oligos decreased HoxB13 mRNA and protein expression in LNCaP95 and PC-3 cells (FIG.1F and FIG.7), concurrently leading to the inhibition of LNCaP95 and PC-3 cell growth (FIG.1G) and invasion (FIG.1H). Collectively, these data demonstrate that CasRx-mediated specific HoxB13 knockdown effectively inhibits CRPC cell growth and invasion in vitro. EXAMPLE 2 Development of the SCORT LNP System for Effective and Precise mRNA Delivery to Target Liver Metastatic Cancer Cells

[0336] Next, an LNP system was developed to effectively and precisely deliver CasRx mRNA / pre-gRNA to target HoxB13 within metastatic CRPC cells in the liver. Here, the SCORT LNP-mRNA delivery approach was developed, which synergistically combines the unique characteristics of nanomaterials with the biological traits of CRPC cells and the specific environment of their metastatic site, the liver. This strategy included: (1) utilizing the recently identified ionizable lipid FTT5 (Zhang X, et al. (2020) Sci Adv.6:eaay6953) as the main lipid for efficient in vivo delivery of long mRNA, specifically the CasRx mRNA (2.9 kb); (2) incorporating active targeting through the addition of the E3 aptamer into LNP, an RNA aptamer initially used for aptamer-drug conjugates, selected through a process targeting cells rather than proteins. (Powell Gray B, et al. (2018) Proc Natl Acad Sci U S A.115:4761-4766). This aptamer has initially demonstrated internalization into ADPC and CRPC cells but not normal prostate cells, and subsequently exhibited broad, specific targeting capabilities across multiple cancer types (Powell Gray B, et al. (2018) Proc Natl Acad Sci U S A.115:4761-4766); (Powell Gray B, et al. (2020) Cancers (Basel). 12:3217); (3) fine-tuning the molar ratios of PEG-lipids to enhance the preferential delivery of LNP to CRPC cells over hepatocytes. These ratios affect nanoparticle diameters, which are crucial for the delivery of LNP to various cell types. (Kim M, et al. (2021) Sci Adv. 7(48):eabk2984) It is noteworthy that smaller LNP particles navigate through the fenestrations, which are approximately 100-140 nm in diameter (Kim M, et al. (2021) Sci Adv. 7(48):eabk2984); (Braet F, et al. (2002) Comp Hepatol. 1:1), between liver sinusoidal endothelial cells (LSECs) to reach hepatocytes. Additionally, thevasculature of tumors often features an incomplete endothelial lining, presenting relatively larger pores compared to those in most normal microvessels. (Chauhan VP, et al. (2013) Nat Mater.12:958-962); (Carmeliet P, et al. (2011) Nat Rev Drug Discov.10:417-427).

[0337] In adherence to these guiding principles, we first developed three modified FTT5 LNPs (mFTT5 LNPs), each comprising five components (FIG.2A): four basic elements, which are FTT5, DOPE (helper lipid), cholesterol, and DMG-PEG 2000 (at molar ratios of 0.75, 1.5, or 3), along with a fifth molecule, DSPE-PEG-maleimide, for E3 aptamer coupling (FIG. 2B). These mFTT5 LNPs were then loaded with the cargo mRNA using the NanoAssembler microfluidic mixing device to attain a high mRNA encapsulation rate while reducing batch-to- batch variability. Following this, E3-modified mFTT5 LNPs (SCORT LNPs) were obtained through a thiol-maleimide cross-linking reaction (FIG. 2A – FIG. 2B). Physicochemical characterization of these LNPs found that the mFTT5 with a 0.75 ratio of DMG-PEG2000 had the highest encapsulation rate, reaching almost 90% (FIG. 8A). Transmission electron microscopy (TEM) revealed that both mFTT5 LNPs and SCORT LNPs displayed spherical structures (FIG. 8B). Interestingly, decreasing the molar ratio of DMG-PEG2000 led to an increase in mean particle size, expanding from 118.0 to 161.5 nm for mFTT5 LNPs and from 129.5 to 179.3 nm for SCORT LNPs (FIG.8C). The polydispersity index (PDI) of these LNPs was lower than 0.2, indicating highly monodisperse characteristics (FIG.8C).

[0338] The delivery efficiencies of three mFTT5 LNPs and three SCORT LNPs, each carrying luciferase mRNA, in LNCaP95 and PC-3 CRPC cells in vitro. The mouse hepatocyte cell line AML12 served as a control. Incubation of these cells with the mFTT5 formulations carrying luciferase mRNA revealed the highest delivery efficiency in LNCaP95 cells, surpassing both PC-3 and AML12 cells (FIG.2C). Notably, in LNCaP95 cells, the mFTT5 formulation with the lowest DMG-PEG2000 molar ratio exhibited the highest luciferase expression (FIG.2C). Although luciferase expression levels were low, a similar trend was observed in PC-3 cells (FIG.2C). Significantly, the SCORT LNPs (+E3) achieved a substantial increase in luciferase expression compared to the mFTT5 LNPs (-E3), with enhancements of up to 3.63-fold in LNCaP95 cells and 9.34-fold in PC-3 cells (FIG. 2C). No increase was observed in AML12 cells, indicating the tumor selectivity of SCORT LNPs (FIG.2C). Bioluminescence imaging further illustrated the pronounced differences between mFTT5 LNPs and SCORT LNPs in LNCaP95 and PC-3 cells but not AML12 cells (FIG. 9A). Similar outcomes were also observed in flow cytometry assays with two other reporter genes, EGFP and mCherry (FIG. 9B, gating strategy shown in FIG.16). Based on these findings, SCORT LNPs with the lowestPEG lipid molar ratio (0.75 DMG-PEG 2000) were selected for subsequent in vivo assays, due to superior delivery efficacy in vitro and their large particle sizes.

[0339] To evaluate the in vivo mRNA delivery selectivity and efficacy of SCORT LNPs, which contains a 0.75 mol ratio of DMG-PEG2000 for carrying mCherry mRNA (hereafter, SCORT- mCherry), to metastatic CRPC cells following systemic administration, a CRPC liver metastasis model using LNCaP95 cells that stably express luciferase (LNCaP95-Luc) was established via hemi-spleen injection. (Simons BW, et al. (2020) Prostate. 80:1263-1269). Conspicuous metastatic lesions developed 5-7 weeks post-cell injection, at which point SCORT-mCherry was administered via intravenous injection. Two hours later, mCherry expression was precisely observed at the sites of LNCaP95 metastatic tumors that express luciferase, demonstrating the substantial CRPC-targeting ability of the SCORT LNP system (FIG.2D). To quantify the expression levels of mCherry protein in LNCaP95 tumor cells and compare these with liver cell types, especially hepatocytes, histology analysis was performed using an Imaging Mass Cytometry (IMC) assay. After labeling the corresponding cells with specific antibodies (PSMA for LNCaP95, HNF4α for hepatocytes, and F4 / 80 for macrophages), a remarkable accumulation of mCherry protein predominantly in LNCaP95 tumor cells was observed. This accumulation was 3.23-fold, 5.73-fold, and 19.45-fold higher than in hepatocytes, macrophages, and other cells, respectively, indicating that approximately 66% of metastatic CRPC cells expressed mCherry (FIG. 2E – FIG. 2F). These data demonstrate the effectiveness and precision of this established SCORT LNP system for mRNA delivery to metastatic cancer cells in the liver. EXAMPLE 3 Systemic SCORT-CasRx-pre-gHoxB13 Treatment Suppressed CRPC Liver Metastasis and Extended Mice Survival

[0340] Having established the SCORT LNP-mRNA delivery system, SCORT LNPs carrying CasRx mRNA and pre-gHoxB13-4 oligos (hereafter, SCORT-CasRx-pre-gHoxB13) were constructed. To evaluate the therapeutic efficacy of SCORT-CasRx-pre-gHoxB13 in vivo, the LNCaP95-Luc CRPC liver metastasis model was utilized. Treatments were initiated one week after LNCaP95-Luc cell injection, with SCORT-CasRx-pre-gHoxB13 administered alongside control groups receiving SCORT LNPs loaded with CasRx-pre-gControl (SCORT-CasRx-pre- gControl), SCORT LNPs alone, and DPBS. Treatments were administered twice weekly until mice in the control group started to succumb, approximately at 6.5 weeks (FIG.3A, FIG.3D). The administration of SCORT-CasRx-pre-gHoxB13 significantly suppressed metastasis, as evidenced by bioluminescence evaluations at 3 weeks, 5 weeks, and 7 weeks (FIG.3B – FIG.3C). Survival analysis consistently underscored the superiority of the treatment, with all mice in the control groups succumbing by approximately 9 weeks, while 71% of mice in the SCORT-CasRx-pre-gHoxB13 group remained alive (FIG. 3D). As expected, a significant decrease in mRNA (FIG.3E) and protein expression (FIG.3F and FIG.10A) of HoxB13 was noted within the SCORT-CasRx-pre-gHoxB13 group compared to the control groups. Additionally, immunostaining for HoxB13 provided further validation, illustrating notable attenuation in HoxB13 expression within the SCORT-CasRx-pre-gHoxB13 group (FIG. 3G and FIG.10B).

[0341] Next, an AR- CRPC mouse model was established via hemi-spleen injection of PC-3 cells stably expressing luciferase (PC-3-Red-F-Luc). Given the lack of variation among the control groups in the AR+ CRPC mouse model, treatments involving SCORT-CasRx-pre- gControl and SCORT-CasRx-pre-gHoxB13 were exclusively administered starting three days after cell injection and continued twice per week for three weeks, aligning with the time mice in the control group began to succumb (FIG.4A, FIG.4D). Similar therapeutic efficacy was observed in this model, as evidenced by bioluminescence measurements at 1 week, 2 weeks, and 3 weeks. (FIG. 4B – FIG. 4C). Moreover, a significant increase in survival rate was observed following treatment with SCORT-CasRx-pre-gHoxB13 (FIG. 4D). Due to the inability to isolate the tumor in this model (i.e., the tumor is diffused in the liver tissue), the analysis was restricted to immunostaining for HoxB13 in the liver sections with metastatic PC- 3 cells. As expected, there was a significant downregulation in HoxB13 expression (FIG.4E – FIG.4F). Collectively, these findings indicate that SCORT-CasRx-pre-gHoxB13 treatment significantly inhibited both AR+ and AR- CRPC liver metastases and extends the mice survival via downregulation of HoxB13 expression. EXAMPLE 4 Long-Term SCORT-CasRx-pre-gHoxB13 Treatment was Well-Tolerated In Vivo.

[0342] Normal immunocompetent mice CD-1 were used to evaluate the safety of long-term SCORT-CasRx-pre-gHoxB13 treatment. This study included control groups (DPBS, SCORT LNPs alone, or SCORT-CasRx-pre-gControl) and SCORT-CasRx-pre-gHoxB13, which were administered twice weekly for a period of 6.5 weeks, the maximal duration of treatment used in these studies (FIG.3A – FIG. 3G). SCORT-CasRx-pre-gHoxB13 treatment did not result in an evident systemic toxicity (FIG.5). This conclusion is supported by thorough evaluations, including body weight measurements (FIG.5A), liver and kidney function assessments (FIG. 5B), histological examinations (FIG.5C), and organ coefficient analyses across major organs such as the heart, liver, spleen, lung, and kidney (FIG. 11A). Furthermore, no notablehematological alterations were observed in the levels of white and red blood cells, platelets, or reticulocytes in mice receiving SCORT-CasRx-pre-gHoxB13, compared to those in the control groups (FIG.11B).

[0343] Recent studies have indicated that mice and humans can mount innate and adaptive immune responses to Cas9, potentially decreasing therapeutic efficacy and posing significant safety concerns. (Wagner DL, et al. (2019) Nat Med. 25:242-248; Charlesworth CT, et al. (2019) Nat Med. 25:249-254; Mehta A, et al. (2020) J Pharm Sci. 109:62-67). However, it remains unclear whether such immune responses extend to CasRx and other Cas13 enzymes. (Palaz F, et al. (2021) ACS Synth Biol.10:1245-1267). Importantly, no elevation in the levels of any of the 18 chemokines / cytokines examined in response to long-term SCORT-CasRx-pre- gHoxB13 treatment was observed. (FIG. 12). Conversely, SCORT-CasRx-pre-gHoxB13 treatment led to a reduction in the levels of three factors: KC (keratinocyte-derived chemokine, also known as IL-8 / CXCL1), macrophage inflammatory protein 2 (MIP-2, also known as CXCL2), and IL-12(p70), the heterodimeric form of IL-12. These data suggest an absence of an exaggerated immune response or inflammatory reaction in response to SCORT-CasRx-pre- gHoxB13 treatment (FIG. 12). Altogether, these data demonstrated a robust tolerability of prolonged SCORT-CasRx-pre-gHoxB13 treatment in immune-competent CD-1 mice. EXAMPLE 5 Direct Cellular and Transcriptional Outcomes of HoxB13 Knockdown in CRPC Liver Metastases by SCORT-CasRx-pre-gHoxB13 Treatment

[0344] The mechanisms underlying the organismal phenotypes (i.e., suppression of metastasis and extension of survival time) altered by SCORT-CasRx-pre-gHoxB13 treatment of prostate cancer liver metastases were investigated. Recognizing the potential adaptation of cancer cells to long-term treatment, the direct cellular and molecular mechanisms responsible for the therapeutic efficacy of SCORT-CasRx-pre-gHoxB13 was studied. Instead of administering treatment for several weeks, CRPC liver metastasis mouse models were treated with two doses of SCORT-CasRx-pre-gHoxB13 within one week. The mice were sacrificed, and tumors were collected three days following the second dose of treatment (FIG.6A). In isolated tumors from LNCaP95 CRPC liver metastases (6 weeks after hemi-spleen injection of LNCaP95 cells, FIG. 6A), tumors predominantly comprised over 85% LNCaP95 cells and exhibited minimal infiltration of liver tissues, as determined by pathological evaluation (FIG.6A and FIG.13A). Two-dose treatments with SCORT-CasRx-pre-gHoxB13 significantly decreased HoxB13 mRNA and protein expression in metastatic LNCaP95 tumors (FIG. 6B, FIG. 6C, FIG. 6D and FIG.13B – FIG.13C). Subsequently, we performed IHC staining of metastatic LNCaP95tumors using antibodies against various markers associated with proliferation (Ki67), angiogenesis (CD31), and EMT (vimentin, E-Cadherin, and Snail). Additionally, a TUNEL assay was carried out in conjunction with fluorescence detection to measure apoptosis. The staining for Ki67 decreased, while an increase in green fluorescence was observed in the TUNEL assay in the SCORT-CasRx-pre-gHoxB13 group compared with the SCORT-CasRx- pre-gControl group, indicating that SCORT-CasRx-pre-gHoxB13 inhibited cell proliferation and induces apoptosis (FIG. 6D and FIG. 13C). Interestingly, vimentin, a canonical marker of EMT, was predominantly expressed in mesenchymal tissues rather than in the metastatic tumor cells themselves, which are primarily surrounded by capillaries within the nests of metastatic cells. Furthermore, the pattern of vimentin expression correlated with the micro- vessel density (MVD) observed in the corresponding tissues stained for CD31. Notably, SCORT-CasRx-pre-gHoxB13 treatment significantly reduced the expression of extracellular vimentin and CD31, suggesting its inhibition of the angiogenesis associated with metastatic tumors. Intriguingly, while EMT marker Snail expression was significantly decreased following SCORT-CasRx-pre-gHoxB13 treatment, no changes were observed in E-cadherin expression (FIG.6D and FIG.13C). This finding, combined with the extracellular expression pattern of vimentin, suggests that SCORT-CasRx-pre-gHoxB13 may suppress the EMT- independent oncogenic function of Snail rather than EMT. (Paul MC, et al. (2023) Nat Commun.14:1201).

[0345] Next, RNA-seq analysis was performed on metastatic LNCaP95 tumors, revealing 1,660 upregulated genes and 1,879 downregulated genes following SCORT-CasRx-pre- gHoxB13 treatment (FIG.6E and FIG.13D). Consistent with the finding that SCORT-CasRx- pre-gHoxB13 treatment decreased Snail protein expression (FIG.6D) and the reported role of EMT-independent oncogenic function of Snail in accelerating cell cycle progression (Paul MC, et al. (2023) Nat Commun. 14:1201), SCORT-CasRx-pre-gHoxB13 treatment reduced the expression of the SNAI1 gene (encoding Snail protein) and Snail target cell cycle genes (SKP2, MCM3, and CCNB1. (Paul MC, et al. (2023) Nat Commun. 14:1201); (Yan J, et al. (2013) Cell. 154:801-813). However, it had no effect on the CDH1 gene (which encodes the E- Cadherin protein) (FIG.6F and FIG.13E). Prostate cancer-related HoxB13 ChIP-seq binding peaks from the Cistrome Data Browser (Zheng R, et al. (2019) Nucleic Acids Res. 47:D729- D735) were next curated and integrated these with differentially regulated genes (DEGs) from RNA-seq to analyze the functions of HoxB13 directly regulated DEGs using Cistrome-GO- KEGG pathway analysis. (Li S, et al. (2019) Nucleic Acids Res. 47:W206-W211). This analysis revealed downregulation in cell cycle, base excision repair, and DNA replicationpathways, and upregulation in apoptosis, Hippo signaling pathway, and FoxO signaling pathway (FIG.6G), which contributed to the observed decrease in cell growth and an increase in apoptosis. (Harvey KF, et al. (2013) Nat Rev Cancer.13:246-257); (Calnan DR, et al. (2008) Oncogene. 27:2276-2288). Additionally, downregulation in metabolic processes including steroid hormone biosynthesis, pentose and glucuronate interconversions, and ascorbate and aldarate metabolism (FIG. 6G) can alter the energy metabolism, expression and synthesis of factors involved in angiogenesis and extracellular matrix modeling, thereby decreasing angiogenesis. (Telang S, et al. (2007) Neoplasia.9:47-56); (Wang Z, et al. (2019) Front Oncol. 9:1491). Interestingly, among the top five most statistically significantly downregulated genes upon SCORT-CasRx-pre-gHoxB13 treatment, the UGT2B17 gene is highly expressed in CRPC patients (Zhang A, et al. (2016) Horm Cancer. 7:104-113) and promotes CRPC growth and invasion through activation of the c-Src kinase. (Li H, et al. (2016) Cancer Res.76:6701-6711). Meanwhile, the microseminoprotein, prostate-associated (MSMP) gene, directly and robustly stimulates angiogenesis via CCR2. (Mitamura T, et al. (2018) Oncogene. 37:722-731). RT- PCR analysis of representative genes from different pathways, using metastatic LNCaP95 tumors, validated the RNA-seq results (FIG. 13E). Of note, the high expression of DNA replication / repair genes, NEL3 and LIG1, which were upregulated by HoxB13, was associated with shorter overall survival of CRPC patients (FIG.14). Conversely, high expression of the HoxB13-downregulated gene ZNF227, involved in the herpes simplex virus 1 infection pathway, correlated with longer overall survival of CRPC patients (FIG. 14). These associations were consistently observed in analyses of two large CRPC patient cohorts (FIG. 14), highlighting the clinical relevance of genes directly regulated by HoxB13 as identified from metastatic LNCaP95 tumors.

[0346] Finally, the mechanisms contributing to the decreased metastasis and increased survival following SCORT-CasRx-pre-gHoxB13 treatment was investigated in the AR- CRPC PC-3 liver metastasis model. Treatments were administered twice within one week, beginning two weeks after cell injection, and liver tissues containing metastatic tumors were collected three days after the final treatment (FIG. 15A). Similar to the findings from the AR+ CRPC LNCaP95 liver metastasis model, proliferation and angiogenesis were suppressed, while apoptosis was induced following treatment with SCORT-CasRx-pre-gHoxB13 (FIG. 15B - FIG.15C). Different from LNCaP95 metastatic tumor cells, vimentin was primarily expressed in the cytosol of metastatic PC-3 tumor cells, and its expression decreased following treatment with SCORT-CasRx-pre-gHoxB13, suggesting a decrease in tumor growth and metastasis. Remarkably, Snail was strongly expressed in control tumors, and its expression dramaticallydecreased following treatment, whereas E-Cadherin was very weakly expressed, and its expression decreased rather than increased following treatment (FIG. 15B – FIG. 15C), indicating that SCORT-CasRx-pre-gHoxB13 treatment also inhibits the non-canonical oncogenic function of Snail (Paul MC, et al. (2023) Nat Commun.14:1201) in PC-3 tumors.

[0347] Collectively, these findings demonstrate that SCORT-CasRx-pre-gHoxB13 treatment decreases metastatic tumor growth and angiogenesis while promoting apoptosis of both AR+ and AR- CRPC. SUMMARY OF EXAMPLES

[0348] Effective therapeutics for metastatic cancer require approaches that can simultaneously target diverse cancer hallmarks, such as uncontrolled cell growth, resistance to cell death, induced angiogenesis, activated metastasis, and deregulated cellular metabolism. (Hanahan D. (2022) Cancer Discov. 12:31-46). TFs are ideal therapeutic targets for metastatic cancers because they are master regulators, controlling hundreds to thousands of downstream target genes involved in multiple signaling pathways contributing to cancer hallmarks. HoxB13, a prostate-specific lineage TF, is highly expressed in CRPC and promotes CRPC growth, invasion, and metastasis. (FIG. 1A – FIG. 1H). Unfortunately, like the majority of TFs, HoxB13 is considered untargetable by traditional small molecule-based drug design. To overcome this challenge, the RNA-targeting CRISPR / CasRx system was used here. Consistently, CasRx, guided by a pre-gRNA targeting HoxB13 mRNA, mediated a potent and specific knockdown of HoxB13 in vitro (FIG. 1A – FIG. 1H). To effectively target undruggable TFs like HoxB13 in metastatic cancer cells in vivo, precise delivery of CasRx and pre-gRNAs to metastatic cells in organs is key. Although the small size (2.9 kb) of the Cas13d enzyme facilitates its packaging into low-capacity adeno-associated virus (AAV) vectors, the clinical application of AAV vectors is limited by several factors, including immunogenicity induced by repeated injections, a small percentage of tumor cells successfully targeted, production difficulties, and tumorigenic potential. To overcome these challenges, the SCORT LNP system was developed herein to preferentially deliver CasRx mRNA / pre-gRNA to metastatic CRPC cells in the liver, rather than to surrounding liver cells (FIG.2A – FIG.2F). This effective and preferential targeting by the SCORT LNP is achieved by incorporating the ionizable lipid FTT5 for potent in vivo RNA delivery, using a low molar ratio of PEG to enhance delivery to CRPC cells in culture and within the liver environment and modifying the LNP surface with the prostate cancer cell-specific E3 aptamer to enhance targeted delivery to CRPC cells (FIG.2A – FIG.2F). Notably, the E3 specifically recognized prostate cancer by binding to transferrin receptor 1 (TfR1).

[0349] Importantly, systemic treatment with SCORT-CasRx-pre-gHoxB13 effectively suppressed CRPC metastases and extended the survival in both AR+ and AR- CRPC mouse models with liver metastasis. This outcome resulted from decreased tumor growth and angiogenesis, and increased apoptosis (FIG. 4A – FIG. 4F, FIG. 5A – FIG. 5C, FIG. 6A – FIG. 6G), underscoring the therapeutic importance of targeting master TFs contributing to various cancer hallmarks. Consistent with its role in inhibiting multiple tumor cellular phenotypes, SCORT-CasRx-pre-gHoxB13 treatment downregulated several oncogenic pathways and upregulates multiple tumor suppressive gene pathways in AR+ CRPC tumors (FIG.6A – FIG.6G). Due to significant infiltration of liver tissues into the AR- CRPC tumors (FIG. 15A), isolating AR- tumors with a high percentage of tumor cells, as in AR+ CRPC tumors, for bulk RNA-seq was challenging. And, although Snail and E-cadherin are well- known EMT markers - with Snail known to transcriptionally repress E-cadherin expression - SCORT-CasRx-pre-gHoxB13 treatment significantly decreased Snail expression without enhancing E-cadherin expression (FIG.6A – FIG.6G and FIG.15A – FIG.15C). Moreover, this treatment reduces the expression of the SNAI1 gene itself and directly targeted cell cycle genes such as SKP2, MCM3 and CCNB1 (FIG. 6A – FIG. 6G and FIG. 7A – FIG. 7E). Together, these results indicate that SCORT-CasRx-pre-gHoxB13 treatment inhibited the EMT-independent, non-canonical oncogenic function of Snail. Since there are no HoxB13 binding sites close to the SNAI1 gene, HoxB13 appeared to indirectly regulate the SNAI1 gene by directly regulating other factors.

[0350] Repeated dosing is typical in cancer treatment and for RNA-based therapies, emphasizing the paramount importance of safety considerations. Surprising, repeated SCORT- CasRx-pre-gHoxB13 treatment (administered twice per week for 6.5 weeks) was well-tolerated in normal CD-1 mice, as evidenced by no significant changes in body weight, liver and kidney functions, or histology of major organs including the heart, liver, spleen, lung, and kidney. Additionally, there was no elevation in the levels of any of the 18 chemokines / cytokines examined in response to prolonged SCORT-CasRx-pre-gHoxB13 treatment. The lack of toxicity from prolonged SCORT-CasRx-pre-gHoxB13 treatment can be attributed to the following reasons: (1) the nanomaterials for constructing SCORT LNP were safe, as repeated injections of empty SCORT LNP exhibited no toxicity (FIG.5A – FIG.5C, FIG.11A – FIG. 11B, FIG. 12); (2) the high specificity of CasRx in mammalian cells (FIG. 1E) minimized potential toxicity associated with promiscuous RNA cleavage by some other Cas13 enzymes (e.g., Cas13a) in cancer; (3) unlike Cas9 protein from the bacterial pathogens Staphylococcus aureus and Streptococcus pyogenes, which may cause preexisting immunity, CasRx is derivedfrom Ruminococcus flavefaciens, a primary degrader of plant structural carbohydrates in the rumen of mammals and an apparently non-pathogenic bacterium. Indeed, repeated SCORT- CasRx-pre-gHoxB13 treatment did not stimulate the expression of inflammatory cytokines / chemokines (FIG.12); (4) HoxB13 is only strongly expressed in prostate tissues.

[0351] In summary, the challenge of directly targeting undruggable TFs in metastatic cancer has been overcome by developing the SCORT-Cas13d-gTF system disclosed herein.

Claims

VIII. CLAIMS What is claimed is:

1. A lipid nanoparticle (LNP), comprising: a core comprising (i) at least one Cas13d mRNA; and (ii) at least one pre-guide RNA (pre-gRNA) oligonucleotide targeting HOXB13 mRNA; and an E3 aptamer surface-modified shell surrounding the core.

2. The LNP of Claim 1, wherein the at least one pre-gRNA oligonucleotide further comprises one or more direct repeat (DR) sequences.

3. The LNP of any one of Claims 1-2, wherein the DR sequence comprises the sequence set forth in SEQ ID NO:

11.

4. The LNP of Claim 1, wherein the pre-gRNA targeting HOXB13 mRNA comprise the sequence set forth in any one of SEQ ID NO:01-SEQ ID NO:

04.

5. The LNP of Claim 1, wherein the pre-gRNA targeting HOXB13 mRNA comprise the sequence set forth in any one of SEQ ID NO:05-SEQ ID NO:

08.

6. The LNP of any one of Claims 1-5, wherein the shell comprises (i) functionalized N1,N3,N5-tris(2-aminoethyl)benzene-1,3,5-Tricarboxamide 5 (FTT5), (ii) 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), (iii) cholesterol, and (iv) 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG 2000).

7. The LNP of Claim 6, wherein the FTT5 is ionizable.

8. The LNP of Claim 6, wherein the shell further comprises 1,2-distearoyl-sn-glycero-3- phosphoethanolamine-N-[maleimide(polyethylene glycol)-2000] (ammonium salt) (DSPE-PEG-maleimide), and wherein DSPE-PEG-maleimide contributes to E3 aptamer coupling.

9. The LNP of any of Claim 8, wherein the shell comprises a molar ratio of about 15% to about 25% FTT5, about 20% to about 40% DOPE, about 35% to about 45% cholesterol, about 0.1% to about 5.0% DMG-PEG 2000, and about 0.1% to about 3% DSPE-PEG- maleimide.

10. The LNP of Claim 9, wherein the shell comprises about a molar ratio of about 20% FTT5, about 30% DOPE, about 39% cholesterol, about 0.75% DMG-PEG 2000, and about 1% DSPE-PEG-maleimide.

11. The LNP of Claim 9, wherein the LNP carrier comprises about a molar ratio of about 20% FTT5, about 30% DOPE, about 38.25% cholesterol, about 1.5% DMG-PEG 2000, and about 1% DSPE-PEG-maleimide.

12. The LNP of Claim 9, wherein the LNP carrier comprises about a molar ratio of about 20% FTT5, about 30% DOPE, about 36.75% cholesterol, about 3.0% DMG-PEG 2000, and about 1% DSPE-PEG-maleimide.

13. The LNP of Claim 9, wherein the LNP comprises FTT5, DOPE, cholesterol, DMG-PEG 2000, and DSPE-PEG-maleimide in a molar ratio of 20:30:39:0.75:1, or a molar ratio of 20:30:38.25:1.5:1, or a molar ratio of 20:30:36.75:3:

1.

14. The LNP of any preceding claim, wherein the LNP comprises a size of at least 100 nm to at least 200 nm, or wherein the LNP comprises a size of about 100 nm to about 200 nm.

15. The LNP of any preceding claim, wherein the LNP comprises a size of at least 120 nm to at least 190 nm, or wherein the LNP comprises a size of about 120 nm to about 190 nm.

16. The LNP of any preceding claim comprising a size of at least 100 nm, at least 110 nm, at least 120 nm, at least 130 nm, at least 140 nm, at least 150 nm, at least 160 nm, at least 170 nm, at least 180 nm, at least 190 nm, or at least 200 nm.

17. The LNP of any preceding claim comprising a spherical shape.

18. The LNP of any preceding claim, wherein the E3 aptamer is specific for prostate cancer cells.

19. The LNP of any preceding claim, wherein the E3 aptamer binds to a transferrin receptor (TfR1) on the surface of prostate cancer cells.

20. The LNP of any preceding claim, wherein the E3 aptamer comprises the sequence set forth in SEQ ID NO:

12.

21. The LNP of any preceding claim, wherein the Cas13d is CasRx.

22. The LNP of Claim 21, wherein CasRx comprises a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more than 95% identity to the sequence set forth in SEQ ID NO:15 or SEQ ID NO:

16.

23. The LNP of Claim 21, wherein CasRx comprises the sequence set forth in SEQ ID NO:15 or SEQ ID NO:

16.

24. The LNP of any preceding claim, wherein the LNP targets metastatic castration-resistant prostate cancer (CRPC) cells in the liver of a subject.

25. The LNP of any preceding claim, wherein the targeted HOXB13 mRNA in metastatic castration-resistant prostate cancer (CRPC) cells.

26. The LNP of any preceding claim, wherein the targeted HOXB13 mRNA in metastatic castration-resistant prostate cancer (CRPC) cells in the liver of a subject.

27. The LNP of any preceding claim, wherein the LNP does not simulate the expression of one or more inflammatory cytokines and / or chemokines.

28. The LNP of Claim 27, wherein inflammatory cytokines and / or chemokines comprise IFN- γ, IL-1α, IL-1β, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12 (p40), IL12 (p70), IP-10, KC, MCP-1, MIP-2, MIP, MIG, VEGF-A, TNFα, or any combination thereof.

29. The LNP of any preceding claim, wherein the LNP reduces HOXB13 expression in metastatic CRPC cells and / or inhibited further metastasis of CRPC cells, inhibits cell proliferation, inhibits angiogenesis, slows cell metabolism, induces apoptosis, or any combination thereof.

30. The LNP of Claim 29, wherein the reduction of HOXB13 expression in metastatic CRPC cells reduces expression of FACMR and / or CERS3.

31. The LNP of any preceding claim, wherein the LNP inhibits the non-canonical, epithelial,- mesenchymal transition (EMT)-independent oncogenic function of SNAIL.

32. The LNP of any preceding claim comprising an encapsulation rate of at least 50% to at least 100%.

33. The LNP of any preceding claim comprising an encapsulation rate of at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, or at least 100%.

34. The LNP of any preceding claim comprising a polydispersity index (PDI) of less than 1, less than 0.9, less than 0.8, less than 0.7, less than 0.6, less than 0.5, less than 0.4, less than 0.3, less than 0.2, less than 0.1, or less than 0.

05.

35. The LNP of any preceding claim, wherein the LNP does not elicit systemic toxicity as measured by liver function and / or kidney function assessment.

36. The LNP of any preceding claim, wherein the LNP does not elicit an exaggerated immune response.

37. The LNP of any preceding claim, wherein the LNP reduces expression of the SNAI1 gene and the expression of one or more of SKP2, MCM3, and CCNB1.

38. A pharmaceutical formulation, comprising: a plurality of the LNP of any one of claims 1- 37 and a pharmaceutically acceptable carrier or excipient.

39. A method of treating a subject, the method comprising:administering to a subject having metastatic prostate cancer a therapeutically effective amount of the pharmaceutical formulation of Claim 38.

40. A method of delivering targeted treatment to metastatic cancer cells, the method comprising: administering to a subject having metastatic prostate cancer in the liver a therapeutically effective amount of the pharmaceutical formulation of Claim 38.

41. The method of Claim 39 or Claim 40, further comprising administering to the subject one or more additional anti-cancer therapies.

42. The method of Claim 41, wherein the one or more anti-cancer therapies comprise endocrine therapy, radiotherapy, hormone therapy, gene therapy, thermal therapy, ultrasound therapy, or any combination thereof.

43. The method of any one of Claims 39-42, further comprising repeating the administering of the pharmaceutical formulation.

44. The method of any one of Claims 39-43, wherein, following the administering of the pharmaceutical formulation, apoptosis is induced in cancer cells.

45. The method of any one of Claims 39-43, wherein, following the administering of the pharmaceutical formulation, (i) the risk of developing metastases is prevented and / or decreased; (ii) the survival of the subject is prolonged; (iii) the subject’s quality of life is be enhanced and / or improved; (iv) the likelihood of surgical intervention is reduced and / or minimized; (v) the recurrence of the cancer is prevented and / or delayed; (vi) the size of one or more tumors in the subject is reduced and / or decreased; (vii) one or more tumors in the subject are eliminated; (viii) the disease-free or tumor-free survival time is increased and / or prolonged; (ix) the subject’s overall survival time is increased and / or prolonged; (x) the frequency of treatment is minimized and / or reduced; (xi) one or more symptoms of the cancer are reduced and / or eliminated; (xii) the tumor burden is reduced and / or decreased; or (xiii) any combination thereof.

Images