Late blight resistance gene, biological material, and use

Abstract

The present invention relates to the technical field of gene isolation and plant improvement, and provides a late blight resistance gene, a biological material, and a use. An Rpi-HMA13 nucleic acid molecule that is provided comprises: a nucleotide sequence as shown in SEQ ID NO: 1; a nucleotide sequence as shown in SEQ ID NO: 2; and a nucleotide sequence encoding the amino acid sequence as shown in SEQ ID NO: 3. The present invention provides an important gene resource for late-blight-resistant potato breeding, overcomes the problem of loss of disease resistance of potato varieties, and provides a new guarantee for lasting disease resistance of potatoes.

Description

Late blight resistance genes, biomaterials and their applications Technical Field

[0001] The present disclosure relates to the technical field of gene isolation and plant improvement, and in particular to late blight resistance genes, biomaterials and applications. Background Art

[0002] Potato (Solanum tuberosum) is the world's fourth largest food crop and plays an important role in ensuring global food security. Potato late blight, caused by Phytophthora infestans, is a major crop disease in my country. The fungus has diverse transmission pathways, a rapid infection rate, and is extremely destructive, seriously affecting the development of my country's potato industry (Nowicki et al., Plant Disease, 2012, 96(1):4-17). The prediction and forecast of potato late blight occurrence and prevalence, as well as chemical control under this guidance, are the main control measures. However, the large-scale use of chemical agents not only increases production costs and pollutes the environment, but also poses a threat to people's lives and health. In addition, the long-term and large-scale application of fungicides has caused the physiological subspecies of late blight to mutate and gradually develop drug resistance (Haverkort and Hillier, Potato Research, 2011, 54:355-369). Breeding and planting disease-resistant varieties containing disease-resistant genes is an effective alternative way to prevent and control the disease. Discovering new resistance genes and appropriately aggregating multiple resistance genes are the top priorities of current potato disease-resistant breeding work.

[0003] Wild relatives of potato are an excellent source of late blight resistance genes (Rpi) (Karki et al., Plant disease, 2021, 105(2):368-376). Potato breeders in Europe and the United States continue to clone new disease resistance genes from various wild potato resources. The most famous broad-spectrum resistance genes include Rpi-vnt1.1, Rpi-blb1, R8, Rpi-amr1, etc. (van der Vossen et al., The plant journal, 2003, 36(6):867-882; Witek et al., Nature biotechnology, 2016, 34(6):656-660; Jiang et al., Journal of experimental botany, 2018, 69(7):1545-1555; Paluchowska et al., Plant disease, 2018, 34(6):1545-1555). al., Planta, 2022, 255(6):127). However, the late blight pathogen has a strong ability to mutate toxicity, and new virulent physiological races are constantly forming. Most cloned late blight resistance genes have been overcome in the field, and the lifespan of disease-resistant genes is short. The problem of potato varieties losing disease resistance is becoming increasingly serious. In addition, wild relatives of potato are excellent sources of resistance to late blight, but my country is not the origin of potato. Late blight resistance resources are relatively scarce, and there has long been a lack of systematic and organized exploration and utilization of disease-resistant resources. In production, there is a lack of disease-resistant genes with independent intellectual property rights, and the resistance of varieties is unclear. Therefore, it is a major and urgent task for my country to explore new potato late blight resistance genes with independent intellectual property rights, break the bottleneck, and cultivate new potato varieties with long-lasting late blight resistance.

[0004] The discovery and cloning of new broad-spectrum resistance genes to potato late blight is a hot topic in late blight research. In early late blight resistance breeding research, the initial resistance genes mainly came from the Mexican hexaploid wild species Solanum demissum. The 11 late blight resistance genes (R1-R11) contained in it were all major resistance genes of the race-specific type (Black and Gallegly, American Potato Journal, 1957, 34: 273-281; ​​Malcolmson and Black, Euphytica, 1966, 15(2): 199-203; Ballvora et al., The Plant Journal, 2002, 30(3): 361-3712). However, with the continuous variation of the physiological races of Phytophthora infestans, the early resistance genes have all lost their disease resistance function (Hein et al., Potato Research, 2009, 52: 215-227). With the rapid development of modern molecular biology and high-throughput sequencing technology, potato breeders in Europe and the United States have continuously cloned new disease-resistance genes from various wild potato resources using methods such as disease-resistance gene map-based cloning combined with comparative genomics, resistance gene enrichment sequencing (Renseq), and pathogen effector omics. The most famous broad-spectrum resistance genes include Rpi-vnt1.1, Rpi-blb1, R8, Rpi-amr1, etc. However, physiological subspecies of Phytophthora infestans that can overcome these disease-resistance genes have also emerged. Therefore, it is urgent to continue to discover and clone new potato late blight resistance genes.

[0005] Summary of the Invention

[0006] In view of this, the present disclosure provides a new late blight resistance gene, biomaterial and application. The discovery of the late blight resistance gene Rpi-HMA13 provided by the present disclosure provides an important gene resource for breeding potatoes resistant to late blight.

[0007] In order to achieve the above-mentioned invention objectives, the present disclosure provides the following technical solutions:

[0008] In a first aspect, the present disclosure provides an Rpi-HMA13 nucleic acid molecule comprising at least one of the following nucleotide sequences:

[0009] (a1) the nucleotide sequence shown in SEQ ID NO: 1 (genomic sequence);

[0010] (a2) the nucleotide sequence shown in SEQ ID NO: 2 (coding region sequence);

[0011] (a3) a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 3;

[0012] (a4) a nucleotide sequence having at least 75% sequence identity with the nucleotide sequence of any one of (a1) and (a2), wherein the nucleic acid molecule is capable of conferring resistance to plant diseases caused by at least one species of Phytophthora sp. on a plant comprising the nucleic acid molecule, and optionally, wherein the nucleotide sequence is not naturally occurring;

[0013] (a5) A nucleotide sequence of an amino acid sequence having at least 75% sequence identity with the amino acid sequence shown in (a3), wherein the nucleic acid molecule is capable of conferring resistance to plant diseases caused by at least one subspecies of at least one species of the genus Phytophthora on a plant comprising the nucleic acid molecule, and optionally, wherein the nucleotide sequence is not naturally occurring.

[0014] Optionally, the nucleic acid molecule is a synthetic and / or isolated nucleic acid molecule.

[0015] Through extensive experiments, the present disclosure discovered a wild diploid potato (Solanum cajamarquense) material with strong resistance to late blight. Whole-genome sequencing and evolutionary analysis were performed on this material, leading to the discovery of the candidate gene Rpi-HMA13. Unlike many known late blight-resistance genes, the amino acid sequence encoded by this gene contains a CC domain, an NB-ARC domain, an LRR domain, and an HMA domain. It is a CNL gene incorporating an HMA domain and has been named Rpi-HMA13. When this gene is stably expressed in cultivated potato varieties through genetic transformation, it can confer resistance to Phytophthora infestans on potatoes.

[0016] In the above (a4), the nucleotide sequences having at least 75% sequence identity are exemplified by nucleotide sequences having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 9 ...1%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99 Nucleotide sequences with 9.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identity, preferably nucleotide sequences with 97.0%-98.0%, 97.5%-98.5%, 98.0%-99.0%, 98.5%-99.5%, 99.0%-100% identity.

[0017] In the above (a5), the nucleotide sequence having an amino acid sequence with at least 75% sequence identity is exemplified by a nucleotide sequence having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1% or more. %, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identity, preferably a nucleotide sequence having an amino acid sequence with 97.0%-98.0%, 97.5%-98.5%, 98.0%-99.0%, 98.5%-99.5%, 99.0%-100% identity.

[0018] In some embodiments, the natural nucleotide sequence of the nucleic acid molecules related to the present disclosure may be a variant sequence derived from different species and / or different strains of the genus Solanum, and its artificial nucleotide sequence may be a variant sequence obtained by appropriate modification of the natural nucleotide sequence, wherein the modification includes but is not limited to appropriate nucleotide substitution / addition / deletion that does not affect the biological activity of the target protein, truncation of the N-terminal amino acid, codon optimization suitable for host cell preferences, addition of tags, fusion, and the like corresponding nucleotide variant sequences.

[0019] Preferably, the Rpi-HMA13 nucleic acid molecule comprises at least one of the nucleotide sequences shown in (a1) to (a3) ​​and artificial variant sequences thereof.

[0020] The Rpi-HMA13 nucleotide sequences disclosed herein include, but are not limited to, nucleotide sequences comprising a natural promoter and a 3' adjacent region containing the coding region, cDNA sequences, and nucleotide sequences comprising only the coding region.

[0021] In a second aspect, the present disclosure provides a nucleic acid molecule composition comprising the above nucleic acid molecule and an additional resistance (R) gene.

[0022] Optionally, the additional R genes include, but are not limited to, at least one of the following genes: Rpi-amr3i (Genbank Accession No. KT373889; SEQ ID NO: 1 of WO 2016 / 182881), Rpi-blb1 (also known as "RB"; Genbank Accession Nos. FB764493.1 and AY336128.1), Rpi-sto1 (Genbank Accession No. EU884421), Rpi-pta1 (Genbank Accession No. EU884422), Rpi-blb2 (Genbank Accession No. DQ122125), Rpi-blb3 (Genbank Accession No. FJ536326), Rpi-abpt (Genbank Accession No. Accession No. FJ536324), R2-like (Genbank Accession No. FJ536323), R2 (Genbank Accession No. FJ536325), Rpi-edn1.1 (Genbank Accession No. GU563963), Rpi-edn1.2, Rpi-snk1.1, Rpi-snk1.2, Rpi-hjt1.1-Rpi-hjt1.3 (Genbank Accession No. GU563971-3), Rpi-bt1 (Genbank Accession No. FJ188415), R1 (Genbank Accession No. AF447489), R 3a (Genbank accession number AY849382), R3b (Genbank accession number JF900492), Rpi-vnt1.1 (Genbank accession number FJ423044), Rpi-vnt1.2 (Genbank accession number FJ423045), Rpi-vnt1.3 (Genbank accession number FJ423046), Rpi-mcq1 (Genbank accession number GN043561), Rpi-chc, Ph-3 (Genbank accession number KJ563933) and R8 (Genbank accession number KU530153).

[0023] Nucleotide sequences corresponding to the accession numbers of the genes listed above, or any gene or protein disclosed elsewhere herein, can be obtained from publicly available online nucleotide and amino acid sequence databases, such as GenBank and EMBL databases.

[0024] In a third aspect, the present disclosure provides a biomaterial, wherein the biomaterial is any one of the following (b1) to (b3):

[0025] (b1) an expression cassette or an expression cassette composition comprising the above-mentioned nucleic acid molecule or nucleic acid molecule composition;

[0026] (b2) a vector or vector composition comprising the aforementioned nucleic acid molecule or nucleic acid molecule composition, or a vector or vector composition comprising the expression cassette or expression cassette composition described in (b1);

[0027] (b3) A host cell containing the aforementioned nucleic acid molecule or nucleic acid molecule composition, or a host cell containing the expression cassette or expression cassette composition described in (b1), or a host cell containing the vector or vector composition described in (b2).

[0028] Optionally, the host cell comprises a bacterial or fungal cell.

[0029] In one embodiment of the present disclosure, the biological material is an expression cassette or an expression cassette composition.

[0030] In the embodiments of the present disclosure, when the nucleic acid molecule or nucleic acid molecule composition comprises at least two nucleic acid molecules, it can be prepared into one expression cassette or a composition consisting of at least two expression cassettes.

[0031] In an embodiment of the present disclosure, the expression cassette or expression cassette composition further comprises a regulatory element, and the regulatory element comprises at least one of a promoter, an enhancer, a leader sequence, a transposon, a terminator, and a marker gene.

[0032] In an embodiment of the present disclosure, the expression cassette or expression cassette composition further comprises an operably linked promoter.

[0033] Optionally, the promoter includes an operably linked endogenous promoter and / or an operably linked heterologous promoter.

[0034] Optionally, the operably linked endogenous promoter is the native promoter of the Rpi-HMA13 gene, such as the endogenous promoter PHMA13.

[0035] In an embodiment of the present disclosure, the endogenous promoter PHMA13 comprises the nucleotide sequence set forth in SEQ ID NO: 4, and / or a nucleotide sequence having at least 75% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 4. Exemplary nucleotide sequences having at least 75% sequence identity are nucleotide sequences having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0036] In the embodiments of the present disclosure, the selection of an operably linked heterologous promoter may depend on many factors, such as the desired timing, localization, and expression pattern, as well as responsiveness to specific biotic or abiotic stimuli. Optionally, the operably linked heterologous promoter includes at least one of a pathogen-inducible promoter, a constitutive promoter, a tissue-preferred promoter, a wound-inducible promoter, and a chemically regulated promoter. For example, the pblb3 promoter (Lokossou AA et al. (2009) Molecular plant-microbe interactions, 22(6):630-641.); the core CaMV 35S promoter (Odell et al. (1985) Nature 313:810-812); rice actin (McElroy et al. (1990) Plant Cell 2:163-171); ubiquitin (Christensen et al. (1989) Plant Mol. Biol. 12:619-632 and Christensen et al. (1992) Plant Mol. Biol. 18:675-689); pEMU (Last et al. (1991) Theor. Appl. Genet. 81:581-588); MAS (Velten et al. (1984) EMBO J.3:2723-2730); ALS promoter (U.S. Patent No. 5,659,026), etc. Preferably, the promoter is suitable for stably expressing similar disease resistance genes in Solanum crops.

[0037] The exact nature of the regulatory sequences required for gene expression may vary between species or cell types, but generally should include 5' non-transcribed and 5' non-translated sequences for transcription and translation initiation, such as TATA boxes, capping sequences, CAAT sequences, and the like, as needed. In particular, such 5' non-transcribed regulatory sequences will include a promoter region, which includes a promoter sequence that controls transcriptional control of the operably linked gene. Regulatory sequences may also include enhancer sequences or upstream activator sequences as needed. The disclosed expression cassettes may optionally include a 5' leader or signal sequence.

[0038] In embodiments of the present disclosure, expression of a nucleic acid molecule can be regulated by manipulating the copy number of a gene or operon in a cell.

[0039] In some embodiments, the expression of nucleic acid molecules can be regulated by manipulating the order of nucleic acid molecules within a module.

[0040] In some embodiments, expression of a nucleic acid molecule is regulated by integrating one or more nucleic acid molecules or operons into a chromosome.

[0041] In another embodiment of the present disclosure, the biomaterial is a carrier or a carrier composition.

[0042] In some embodiments, one or more nucleic acid molecules related to the present disclosure are expressed in an expression vector. As used herein, a "vector" can be any of a large number of nucleic acids into which one or more desired sequences can be inserted by restriction enzyme digestion and ligation for transport in various genetic environments or expression in host cells. Vectors are typically composed of DNA but can also be composed of RNA.

[0043] In the disclosed embodiments, the vector comprises a plasmid, a chloroplast, a viral vector, a phage, a phagemid, a clay, a fosmid, a bacteriophage or an artificial chromosome, and optionally, the viral vector comprises an adenoviral vector, a retroviral vector or an adeno-associated viral vector, and optionally, the vector comprises a bacterial artificial chromosome (BAC), a plasmid, a bacteriophage P1-derived vector (PAC), a yeast artificial chromosome (YAC) or a mammalian artificial chromosome (MAC). For example, the vector comprises pFastBac1, pYES2, pYES2.1, pESC-Ura, pESC-Trp, pESC-Leu, pESC-His, pGEX2T, pTAex3, pUSA, pYMB0, pHT43, pET28b, pIJ702, pUCP19, pYMB03, pHT43, pEAQ, pBin307, pPZP, pSAT, pCAMIA-1300, etc.

[0044] Cloning vectors are capable of autonomous replication or integration into the host cell genome and are further characterized by one or more restriction endonuclease sites at which the vector can be cut in a deterministic manner and the desired DNA sequence can be ligated into the vector so that the new plasmid retains its ability to replicate in the host cell. In the case of plasmids, replication of the desired sequence can occur multiple times as the number of copies of the plasmid in the host cell (e.g., a bacterial host) increases, or only once per host before the host reproduces by mitosis. In the case of bacteriophages, replication can occur actively during the lytic phase or passively during the lysogenic phase.

[0045] The expression vector can be inserted into the desired DNA sequence by restriction enzyme digestion and ligation so that it is effectively connected to the regulatory sequence and can be expressed as an RNA transcript. The vector may also contain one or more marker sequences suitable for identifying whether the cell has been transformed or transfected by the vector. Markers include genes that encode proteins that increase or decrease their resistance or sensitivity to antibiotics or other compounds, genes that encode enzymes whose activity can be detected by standard methods known in the art (e.g., β-galactosidase, luciferase, or alkaline phosphatase), and genes that have a visible effect on the phenotype of transformed or transfected cells, hosts, colonies, or plaques (e.g., green fluorescent protein). Preferred vectors are vectors that can autonomously replicate and express the structural gene products present in the DNA fragments that are effectively connected thereto.

[0046] In the embodiments of the present disclosure, when a nucleic acid molecule or a nucleic acid molecule composition includes at least two nucleic acid molecules, it can be prepared into one vector or a composition consisting of at least two vectors.

[0047] In another embodiment of the present disclosure, the biological material is a host cell.

[0048] Optionally, the host cell comprises a bacterial or fungal cell.

[0049] In a fourth aspect, the present disclosure further provides a promoter for driving transcription of the Rpi-HMA13 gene, the promoter (PHMA13) comprising the nucleotide sequence as shown in SEQ ID NO: 4, and / or a nucleotide sequence having at least 75% sequence identity to the nucleotide sequence shown in SEQ ID NO: 4. Exemplary nucleotide sequences having at least 75% sequence identity are nucleotide sequences having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0050] In a fifth aspect, the present disclosure provides a method for producing a host cell, which comprises transforming the host cell with at least one of the above-mentioned nucleic acid molecules or nucleic acid molecule compositions, expression cassettes or expression cassette compositions, vectors or vector compositions.

[0051] In a sixth aspect, the present disclosure provides use of any one of the nucleic acid molecules, nucleic acid molecule compositions, and biological materials of the present disclosure in enhancing plant resistance to plant diseases caused by at least one subspecies of at least one Phytophthora species.

[0052] In an embodiment of the present disclosure, the plant comprises a plant of the Solanaceae family.

[0053] Optionally, the Solanaceae plant includes at least one of potato, tomato, eggplant, pepper, tobacco, petunia, tomatillo, and cape gooseberry.

[0054] Preferably, the plant of the Solanaceae family is potato and / or tomato.

[0055] In a seventh aspect, the present disclosure provides a method for enhancing a plant's resistance to a plant disease caused by at least one subspecies of at least one species of the genus Phytophthora, the method comprising modifying at least one plant cell to contain a heterologous polynucleotide comprising the above-mentioned nucleic acid molecule or nucleic acid molecule composition.

[0056] In preferred embodiments of the present disclosure, the species of Phytophthora is Phytophthora infestans. In other embodiments, the species of Phytophthora is a species of Phytophthora that is capable of causing a plant disease in at least one plant. For purposes of the present disclosure, certain species of Phytophthora include, but are not limited to, Phytophthora infestans, Phytophthora parasitica, Phytophthora ramorum, Phytophthora ipomoeae, Phytophthora mirabilis, Phytophthora capsici, Phytophthora porri, Phytophthora sojae, Phytophthora palmivora, and Phytophthora phaseoli.

[0057] In an embodiment of the disclosure, a plant comprising the heterologous polynucleotide has enhanced resistance to a plant disease caused by at least one race of at least one Phytophthora species relative to a control plant (a control plant not comprising the heterologous polynucleotide).

[0058] In an embodiment of the present disclosure, modifying at least one plant cell to contain a heterologous polynucleotide specifically comprises: transforming at least one of the nucleic acid molecules, nucleic acid molecule compositions, or expression cassettes or expression cassette compositions, vectors or vector compositions in biological materials disclosed herein into plant cells, so that the plant cells express the protein.

[0059] In the above methods, methods for transforming nucleic acid molecules, nucleic acid molecule compositions, expression cassettes, and vectors into plant cells include but are not limited to Agrobacterium-mediated transformation, gene gun transformation, electroporation, polyethylene glycol (PEG) transformation, lipid transfection, heat shock, calcium phosphate precipitation, virus-mediated, microinjection, and genetic engineering editing technology.

[0060] In a specific embodiment of the present disclosure, the method for expressing a protein is, for example: (1) constructing a vector comprising a nucleic acid molecule or a nucleic acid molecule composition of the present disclosure; (2) transforming the resulting vector into a plant cell; and (3) culturing the resulting plant cell to express the gene to produce a protein.

[0061] In an embodiment of the present disclosure, the method of enhancing plant resistance further comprises regenerating the plant cell into a plant comprising the heterologous polynucleotide in its genome.

[0062] Preferably, the regenerated plants comprise enhanced resistance to a plant disease caused by at least one race of at least one species of Phytophthora relative to the resistance of control plants to said plant disease.

[0063] Preferably, plants comprising the heterologous polynucleotide have enhanced resistance to plant diseases caused by at least two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen or more races of a species of the genus Phytophthora relative to control plants.

[0064] In an embodiment of the disclosure, a plant comprising the heterologous polynucleotide in its genome has an enhanced or increased resistance to a plant disease caused by at least one race of at least one species of Phytophthora by at least 25%, such as by at least 25%, at least 50%, at least 75%, at least 100%, at least 150%, at least 200%, at least 250%, at least 300%, at least 350%, at least 400%, at least 450%, at least 500%, or more, compared to a control plant.

[0065] In some embodiments, the plant disease caused by at least one race of at least one Phytophthora species is late blight.

[0066] Depending on the desired outcome, the heterologous polynucleotides of the present disclosure can be stably integrated into the genome of the plant cell or stably integrated into the genome of the plant cell.

[0067] For example, if the desired result is to produce a stably transformed plant with enhanced resistance to a plant disease caused by at least one species of the genus Phytophthora, the heterologous polynucleotide can be fused, for example, to a plant transformation vector suitable for stably integrating the heterologous polynucleotide into the genome of the plant cell. In some embodiments, the nucleic acid molecule or nucleic acid molecule composition (heterologous polynucleotide) of the present disclosure can be stably integrated into the genome of the host cell. Such stably transformed plants are capable of transmitting the heterologous polynucleotide to subsequent generations of offspring plants through sexual and / or asexual reproduction.

[0068] In an embodiment of the present disclosure, said modifying at least one plant cell to contain a heterologous polynucleotide comprises genome editing technology.

[0069] In other embodiments of the present disclosure where stable integration of the heterologous polynucleotide into the plant genome is undesirable, transient transformation methods can be used to introduce the heterologous polynucleotide into one or more plant cells of the plant. In other embodiments, the heterologous polynucleotide is not stably integrated into the genome of the host cell by microinjection, microprojectile bombardment, viral vector infection, or by applying a modified virus and / or modified viral nucleic acid to the plant or part thereof by spraying, irrigation, dusting, etc., so that the host or host cell transiently expresses the gene of interest.

[0070] In the embodiments of the present disclosure, the plant includes any plant species, such as monocots, dicots, and conifers.

[0071] In specific embodiments, plants of the present disclosure include crop plants such as corn, soybean, wheat, rice, cotton, alfalfa, sunflower, Brassica (certain species of the genus Brassica, particularly Brassica napus, Brassica rapa, Brassica juncea), rapeseed (Brassica napus), sorghum, millet, barley, triticale, safflower, peanut, sugarcane, tobacco, potato, tomato, eggplant, and pepper.

[0072] Preferably, the plant comprises a plant of the Solanaceae family.

[0073] Preferably, the Solanaceae plant includes but is not limited to at least one of potato, tomato, eggplant, pepper, tobacco, petunia, tomatillo, and cape gooseberry.

[0074] In a more preferred embodiment, the Solanaceae plant is potato and / or tomato.

[0075] In an eighth aspect, the present disclosure provides a method for controlling plant diseases caused by at least one race of at least one Phytophthora species in crop production, the method comprising:

[0076] modifying at least one plant cell to contain a heterologous polynucleotide comprising the nucleic acid molecule or nucleic acid molecule combination described above;

[0077] regenerating the plant cell into a plant comprising the heterologous polynucleotide in its genome;

[0078] The seedlings, tubers or seeds of the plants are planted and cultivated under conditions conducive to the growth and development of the plants.

[0079] In an embodiment of the present disclosure, the method further comprises harvesting at least one of fruits, tubers, leaves, and seeds from the plant.

[0080] In a ninth aspect, the present disclosure provides a method for detecting plant disease resistance, the method comprising detecting the presence of the aforementioned nucleic acid molecule or nucleic acid molecule composition in a plant, a plant part thereof, or a plant cell.

[0081] In embodiments of the present disclosure, the plant disease resistance comprises resistance to a plant disease caused by at least one race of at least one Phytophthora species.

[0082] In some embodiments, the plant disease caused by at least one race of at least one Phytophthora species is late blight.

[0083] In some embodiments, the method for detecting plant disease resistance can be used to breed Solanaceae plants that are resistant to plant diseases caused by certain species of Phytophthora (e.g., late blight). Such resistant plants can be used for agricultural production of fruits, tubers, leaves and / or seeds for human or animal consumption or other uses.

[0084] In an embodiment of the present disclosure, the method for detecting the presence of the nucleic acid molecule or nucleic acid molecule composition includes: detecting the presence of the nucleic acid molecule or nucleic acid molecule composition by detecting the complete nucleic acid molecule or nucleic acid molecule composition, or detecting at least one molecular marker in the nucleic acid molecule or nucleic acid molecule composition.

[0085] In an embodiment of the present disclosure, methods for detecting the presence of the above-mentioned nucleic acid molecules or nucleic acid molecule compositions include PCR amplification, nucleic acid sequencing, nucleic acid hybridization, or immunological assays for detecting proteins or polypeptides encoded by the nucleic acid molecules or nucleic acid molecule compositions.

[0086] In some embodiments, in a method for detecting a Solanaceae plant that exhibits newly conferred or enhanced resistance to a plant disease caused by at least one subspecies of a species of the genus Phytophthora, detecting the presence of an Rpi-HMA13 nucleotide sequence in the Solanaceae plant may involve one or more of the following molecular biology techniques known in the art, including but not limited to isolating genomic DNA and / or RNA from the plant, amplifying a nucleic acid molecule comprising an Rpi-HMA13 nucleotide sequence and / or a marker herein by PCR amplification, sequencing a nucleic acid molecule comprising an Rpi-HMA13 nucleotide sequence and / or a marker, identifying an Rpi-HMA13 nucleotide sequence, a marker, or a transcript of an Rpi-HMA13 nucleotide sequence by nucleic acid hybridization, and performing an immunological assay for detecting an R protein encoded by an Rpi-HMA13 nucleotide sequence. Specifically, oligonucleotide probes and PCR primers can be designed to identify the Rpi-HMA13 nucleotide sequences of the present disclosure, and such probes and PCR primers can be used in methods disclosed elsewhere herein or known in the art to rapidly identify one or more plants in a plant population that contain the presence of the Rpi-HMA13 nucleotide sequences of the present disclosure.

[0087] In other embodiments of the present disclosure, detecting the presence of the Rpi-HMA13 nucleotide sequence comprises detecting the presence of the R protein encoded by the Rpi-HMA13 nucleotide sequence using, for example, an immunological detection method involving antibodies specific for the R protein.

[0088] In a tenth aspect, the present disclosure provides a method for selecting plants, the method comprising: detecting the presence of the above-mentioned nucleic acid molecules or nucleic acid molecule compositions in plants, plant parts thereof, or plant cells thereof; and selecting plants containing at least one copy of the nucleic acid molecules or nucleic acid molecule compositions in their genomes.

[0089] In an embodiment of the present disclosure, the method for detecting the presence of the nucleic acid molecule or nucleic acid molecule composition includes: detecting the presence of the nucleic acid molecule or nucleic acid molecule composition by detecting the complete nucleic acid molecule or nucleic acid molecule composition, or detecting at least one molecular marker in the nucleic acid molecule or nucleic acid molecule composition.

[0090] In an embodiment of the present disclosure, methods for detecting the presence of the above-mentioned nucleic acid molecules or nucleic acid molecule compositions include PCR amplification, nucleic acid sequencing, nucleic acid hybridization, or immunological assays for detecting proteins or polypeptides encoded by the nucleic acid molecules or nucleic acid molecule compositions.

[0091] In some embodiments, detecting the presence of an Rpi-HMA13 nucleotide sequence in a Solanaceae plant may involve one or more of the following molecular biology techniques known in the art, including but not limited to isolating genomic DNA and / or RNA from the plant, amplifying a nucleic acid molecule comprising the Rpi-HMA13 nucleotide sequence and / or marker herein by PCR amplification, sequencing a nucleic acid molecule comprising the Rpi-HMA13 nucleotide sequence and / or marker, identifying a transcript of the Rpi-HMA13 nucleotide sequence, marker, or Rpi-HMA13 nucleotide sequence by nucleic acid hybridization, and performing an immunological assay for detecting an R protein encoded by the Rpi-HMA13 nucleotide sequence. Specifically, oligonucleotide probes and PCR primers can be designed to detect the Rpi-HMA13 nucleotide sequence of the present disclosure, and such probes and PCR primers can be used in methods disclosed elsewhere herein or known in the art to rapidly detect one or more plants comprising the Rpi-HMA13 nucleotide sequence of the present disclosure in a plant population.

[0092] In the disclosed embodiments, detecting the presence of the nucleic acid molecule or nucleic acid molecule composition can be achieved by using the primers shown in SEQ ID NO: 5 and SEQ ID NO: 6.

[0093] In other embodiments of the present disclosure, detecting the presence of the Rpi-HMA13 nucleotide sequence comprises detecting the presence of the R protein encoded by the Rpi-HMA13 nucleotide sequence using, for example, an immunological detection method involving antibodies specific for the R protein.

[0094] In an eleventh aspect, the present disclosure provides a method for introducing the aforementioned nucleic acid molecule or nucleic acid molecule composition into a plant, the method comprising:

[0095] (c1) hybridizing the first plant with the second plant to produce offspring plants;

[0096] The first plant is a plant comprising at least one copy of the above-mentioned nucleic acid molecule or nucleic acid molecule composition in its genome;

[0097] The second plant is a plant lacking the nucleic acid molecule or nucleic acid molecule combination in its genome;

[0098] (c2) selecting an offspring plant comprising in its genome at least one copy of the nucleic acid molecule or the combination of nucleic acid molecules.

[0099] In the disclosed embodiment, (c2) is specifically:

[0100] detecting the presence of the nucleic acid molecule or nucleic acid molecule combination described above in progeny plants, plant parts thereof, or plant cells thereof;

[0101] Progeny plants are selected that comprise in their genome at least one copy of the nucleic acid molecule or combination of nucleic acid molecules.

[0102] In the disclosed embodiments, the first plant and the second plant can be of the same species or can be of different species. This hybridization of a first plant species with a second plant species is known as interspecific hybridization and can be used to introgress one or more target genes from one species into a related species that lacks the one or more target genes, and typically involves multiple generations of backcrossing of offspring with the related species and selecting offspring that contain the one or more target genes in each generation. Such interspecific hybridization, introgression, and backcrossing methods are well known in the art and can be used in the methods of the present disclosure.

[0103] In the methods of the present disclosure for introducing at least one Rpi-HMA13 gene of the present disclosure into a plant that lacks the at least one Rpi-HMA13 gene in its genome, the first plant or the second plant can be a pollen donor plant. For example, if the first plant is a pollen donor plant, the second plant is a pollen recipient plant. Similarly, if the second plant is a pollen donor plant, the first plant is a pollen recipient plant. After hybridization, the pollen recipient plant is grown under conditions that are conducive to plant growth and development and grown for a sufficient time to allow the seeds to mature or achieve other desired growth stages for subsequent in vitro germination processes (e.g., embryo rescue). The seeds can then be harvested and those seeds containing the Rpi-HMA13 gene identified by any method known in the art, including, for example, methods described elsewhere herein for identifying Solanaceae plants that exhibit newly conferred or enhanced resistance to plant diseases caused by at least one species of the genus Phytophthora. In certain embodiments, the first plant is a potato plant comprising one or more Rpi-HMA13 genes and the second plant is a potato plant lacking the one or more Rpi-HMA13 genes.

[0104] In a twelfth aspect, the present disclosure provides a plant or a plant part thereof, wherein the plant is one of the following plants:

[0105] (d1) a plant comprising at least one of the above-mentioned nucleic acid molecules, nucleic acid molecule compositions or biological materials (such as expression cassettes, expression cassette compositions, vectors, vector compositions or host cells);

[0106] (d2) plants grown from plant cells modified to contain the aforementioned nucleic acid molecules or nucleic acid molecule compositions;

[0107] (d3) producing a plant obtained by the method for increasing the resistance of a plant to a plant disease caused by at least one species of at least one species of the genus Phytophthora;

[0108] (d4) progeny formed by self-pollination of any one of the plants in (d1) to (d3), and plants grown from the progeny;

[0109] (d5) Offspring formed by hybridizing any plant among (d1)-(d3) with other varieties, and plants grown from the offspring; preferably, the hybridization adopts one of the above-mentioned methods for introducing the above-mentioned nucleic acid molecules or nucleic acid molecule compositions into plants.

[0110] The plant parts mentioned above are roots, stems, tubers, leaves, flowers, fruits, pollen or seeds.

[0111] The present disclosure provides plants comprising nucleic acid molecules or nucleic acid molecule compositions (heterologous polynucleotides), wherein the heterologous polynucleotide comprises an R gene nucleotide sequence of the present disclosure. Preferably, such an R gene nucleotide sequence encodes a full-length R protein of the present disclosure, or at least one or more functional portions or one or more domains thereof.

[0112] The plants disclosed herein can be used in methods of controlling plant diseases caused by at least one race of at least one species of Phytophthora in agricultural crop production, particularly in areas where such plant diseases are prevalent and known to negatively impact, or at least potentially negatively impact, agricultural yields.

[0113] In specific embodiments, plants of the present disclosure include crop plants such as corn, soybean, wheat, rice, cotton, alfalfa, sunflower, Brassica (certain species of the genus Brassica, particularly Brassica napus, Brassica rapa, Brassica juncea), rapeseed (Brassica napus), sorghum, millet, barley, triticale, safflower, peanut, sugarcane, tobacco, potato, tomato, eggplant, and pepper.

[0114] Preferably, the plant comprises a plant of the Solanaceae family.

[0115] Preferably, the Solanaceae plant includes but is not limited to at least one of potato, tomato, eggplant, pepper, tobacco, petunia, tomatillo, and cape gooseberry.

[0116] In a more preferred embodiment, the Solanaceae plant is potato and / or tomato.

[0117] In a thirteenth aspect, the present disclosure provides a plant or a plant part thereof, wherein the plant includes a transgenic plant containing the above-mentioned nucleic acid molecule or nucleic acid molecule composition.

[0118] In a fourteenth aspect, the present disclosure provides a method for producing a plant, the method comprising transforming the plant with at least one of the above-mentioned nucleic acid molecules or nucleic acid molecule compositions, expression cassettes or expression cassette compositions, vectors or vector compositions.

[0119] The present disclosure also provides plants prepared using the above method for producing plants.

[0120] In a fifteenth aspect, the present disclosure provides an agricultural product for human or animal consumption, wherein the agricultural product for human or animal consumption comprises the above-mentioned plant or its plant part, or the agricultural product for human or animal consumption is a product made from the above-mentioned plant or its plant part.

[0121] In embodiments of the present disclosure, agricultural products for human or animal consumption include food and other agricultural products.Other agricultural products include, for example, tobacco products (such as cigarettes, cigars, pipes and chewing tobacco) produced from tobacco leaves and food and industrial starch products produced from potato tubers.Such food can be consumed or used by humans and other animals, including but not limited to pets (such as dogs and cats), livestock (such as pigs, cattle, chickens, turkeys and ducks) and animals (such as fish, shrimp, prawns, crayfish and lobsters) produced in freshwater and seawater aquaculture systems.

[0122] In a sixteenth aspect, the present disclosure provides an Rpi-HMA13 protein comprising at least one of the following amino acid sequences:

[0123] (e1) the amino acid sequence shown in SEQ ID NO: 3;

[0124] (e2) the amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO: 1;

[0125] (e3) the amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO: 2;

[0126] (e4) an amino acid sequence having at least 75% sequence identity with the amino acid sequence shown in SEQ ID NO: 3, wherein a protein comprising the amino acid sequence is capable of conferring resistance to plant diseases caused by at least one subspecies of at least one species of the genus Phytophthora on a plant comprising the protein.

[0127] In the above (e4), the amino acid sequences having at least 75% sequence identity are exemplified by amino acid sequences having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 9 ...1%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99 amino acid sequences with 9.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identity, preferably amino acid sequences with 97.0%-98.0%, 97.5%-98.5%, 98.0%-99.0%, 98.5%-99.5%, 99.0%-100% identity.

[0128] In some embodiments, the natural amino acid sequence of the aforementioned protein may be a variant sequence derived from different species and / or strains of the genus Solanum. The artificial variant amino acid sequence of the aforementioned protein may be a variant sequence obtained by appropriate modification of the natural amino acid sequence, including but not limited to appropriate amino acid substitutions / additions / deletions that do not affect the biological activity of the target protein, truncation of the N-terminal amino acid, codon optimization suitable for host cell preference, addition of tags, fusion, etc.

[0129] Preferably, the amino acid sequence of Rpi-HMA13 is at least one of the amino acid sequences shown in (e1) to (e3) and artificial variant sequences thereof.

[0130] Compared with the prior art, the present invention has the following beneficial effects:

[0131] The present disclosure discloses that transient expression of the Rpi-HMA13 gene in Nicotiana benthamiana leaves can confer resistance to late blight on Nicotiana benthamiana leaves.

[0132] The present invention discloses genetic transformation of the Rpi-HMA13 gene in potato, and conducts a late blight inoculation test on the obtained positive transformed plants, demonstrating that the gene can mediate broad-spectrum resistance of potato to late blight.

[0133] The present disclosure provides important genetic resources for potato late blight resistance breeding, overcomes the problem of loss of disease resistance in potato varieties, and provides new guarantees for long-term disease resistance in potatoes. BRIEF DESCRIPTION OF THE DRAWINGS

[0134] Figure 1 shows the results of inoculation of Nicotiana benthamiana leaves transiently expressing Rpi-HMA13; ns indicates no significant difference; *** indicates P value less than 0.001;

[0135] Figure 2 shows the results of inoculation of Nicotiana benthamiana leaves transiently expressing Rpi-HMA13 homologous genes; ns indicates no significant difference; *** indicates a P value less than 0.001;

[0136] Figure 3 shows the PCR verification results of Rpi-HMA13 transgenic potatoes; M represents DNA maker; #13, #14, and #23 represent the strain numbers of Rpi-HMA13 that were successfully transferred into the potato genome;

[0137] Figure 4 shows the results of inoculation of Rpi-HMA13 transgenic potatoes;

[0138] Figure 5 shows the results of inoculation of Rpi-HMA13 transgenic potatoes;

[0139] The English annotations in the figure are as follows: WT: wild type; Infection area: infection area; Desiree RB: potato variety Desiree with Rpi-blb1 gene. DETAILED DESCRIPTION

[0140] The present disclosure will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanations of the present disclosure and should not be construed as limiting the scope of protection of the present disclosure. All technologies implemented based on the above content of the present disclosure are included within the scope of protection intended by the present disclosure.

[0141] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the reagents, materials, etc. used in the following examples are all commercially available unless otherwise specified.

[0142] In the description of the present disclosure, it should be noted that the terms "first", "second", etc. are only used for descriptive purposes and do not indicate or imply relative importance.

[0143] This disclosure discloses a novel late blight resistance gene, biomaterial, and application. Those skilled in the art can draw upon the content herein and appropriately modify process parameters to achieve these goals. It is particularly important to note that all similar substitutions and modifications readily apparent to those skilled in the art are considered encompassed by this disclosure. The methods and applications of this disclosure have been described through preferred embodiments, and it is apparent that those skilled in the art can modify, alter, and combine the methods and applications described herein to implement and apply the disclosed technology without departing from the content, spirit, and scope of this disclosure.

[0144] Explanation of terms:

[0145] In the present disclosure, the term "nucleic acid molecule" (or "nucleic acid" or "polynucleotide") may refer to a polymeric form of nucleotides, which may include sense and antisense strands of RNA, cDNA, genomic DNA, as well as synthetic forms and mixed polymers of the above. Nucleotides may refer to ribonucleotides, deoxyribonucleotides or modified forms of either type of nucleotide. As used herein, "nucleic acid molecule" is synonymous with "nucleic acid" and "polynucleotide". A nucleic acid molecule is typically at least 10 bases in length, unless otherwise indicated. The term may refer to an RNA or DNA molecule of indefinite length. This term includes single-stranded and double-stranded forms of DNA. A nucleic acid molecule may include one or both of naturally occurring and modified nucleotides linked together by naturally occurring and / or non-naturally occurring nucleotides. The present disclosure provides nucleic acid molecules comprising the nucleotide sequence of the Rpi-HMA13 gene (particularly alleles, homologs, orthologs and other naturally occurring variants of Rpi-HMA13, as well as synthetic or artificial (i.e., non-naturally occurring) variants thereof). Therefore, the genes and polynucleotides disclosed herein include naturally occurring sequences as well as mutants and other variant forms.

[0146] The term "variant" is intended to mean a substantially similar sequence. For polynucleotides, variants are included in polynucleotides having deletions (i.e., truncations) at the 5' and / or 3' ends; and / or deletions and / or additions of one or more nucleotides at one or more internal sites in a natural polynucleotide; and / or substitutions of one or more nucleotides at one or more sites in a natural polynucleotide. As used herein, "natural" polynucleotides or polypeptides comprise naturally occurring nucleotide sequences or amino acid sequences, respectively. For polynucleotides, conservative variants include those sequences that encode the amino acid sequence of one of the R proteins of the present disclosure due to the degeneracy of the genetic code. Naturally occurring allelic variants can be identified using well-known molecular biology techniques (e.g., polymerase chain reaction (PCR) and hybridization techniques). Variant polynucleotides also include synthetically derived polynucleotides, such as those produced by using site-directed mutagenesis but still encoding the R protein of the present disclosure. Typically, variants of a particular polynucleotide of the present disclosure will have at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with the particular polynucleotide as determined by sequence alignment programs and parameters. In certain embodiments of the present disclosure, variants of a particular polynucleotide of the present disclosure will have at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with the nucleotide sequence set forth in SEQ ID NO: 1, and optionally comprise a non-naturally occurring nucleotide sequence that differs from the nucleotide sequence set forth in SEQ ID NO: 1 by at least one nucleotide modification selected from the group consisting of a substitution of at least one nucleotide, an addition of at least one nucleotide, and a deletion of at least one nucleotide. It should be understood that the addition of at least one nucleotide may be the addition of one or more nucleotides within the nucleotide sequence of the present disclosure, the addition of one or more nucleotides to the 5' end of the nucleotide sequence of the present disclosure, and / or the addition of one or more nucleotides to the 3' end of the nucleotide sequence of the present disclosure.

[0147] As will be readily appreciated by those skilled in the art, nucleic acid molecules may be chemically or biochemically modified, or may comprise non-natural or derivatized nucleotide bases. Such modifications include, for example, labeling, methylation, substitution of one or more naturally occurring nucleotides with analogs, internucleotide modifications (e.g., uncharged bonds: such as methyl phosphonates, phosphotriesters, phosphoramidites, carbamates, etc.; charged bonds: such as phosphorothioates, phosphorodithioates, etc.; pendant moieties: such as peptides; intercalators: such as acridine, psoralen, etc.; chelating agents; alkylating agents; and modified bonds: such as α-anomeric nucleic acids, etc.). The term "nucleic acid molecule" also includes any topological conformation, including single-stranded, double-stranded, partially double-stranded, triple-stranded, hairpin, circular, and padlock conformations.

[0148] As those skilled in the art will readily appreciate, naturally occurring allelic variants can be identified through hybridization techniques under stringent conditions. "Stringent conditions" can be any of low, moderate, or high stringency conditions. "Low stringency conditions" include, for example, 5xSSC, 5xDenhardt's solution, 0.5% SDS, 50% formamide, and 32°C. "Moderate stringency conditions" include, for example, 5xSSC, 5xDenhardt's solution, 0.5% SDS, 50% formamide, and 42°C. "High stringency conditions" include, for example, 5xSSC, 5xDenhardt's solution, 0.5% SDS, 50% formamide, and 50°C. Among these conditions, increasing the temperature increases the likelihood of obtaining DNA with high homology. Hybridization stringency can be influenced by various factors, including temperature, probe concentration, probe length, ionic strength, time, and salt concentration. By appropriately selecting these factors, those skilled in the art can achieve similar stringency conditions.

[0149] In this disclosure, the term "identity" refers to sequence similarity to an exemplary nucleic acid sequence or amino acid sequence. Identity can be assessed visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to assess the identity between related sequences.

[0150] The sequence identity values ​​provided herein refer to the full-length sequence identity evaluation of the sequence using the Dispatcher tools framework. Other software can also be used to obtain sequence identity values, such as the values ​​obtained by using Jalview version 2.11.2.7 (Waterhouse, AM, Procter, JB, Martin, DMA, Clamp, M. and Barton, GJ (2009) "Jalview Version 2-a multiple sequence alignment editor and analysis workbench" Bioinformatics 25 (9) 1189-1191 doi: 10.1093 / bioinformatics / btp033) using the default parameters in the multiple alignment software package MUSCLE v3.8.31 ("MUSCLE: multiple sequence alignment with high accuracy and high throughput" Nucleic Acids Res. 32 (5): 1792 (2004)); or any equivalent program thereof.

[0151] Other mathematical algorithms are known in the art and can be used to align two sequences. See, for example, the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264, as modified in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. This algorithm was incorporated into the BLAST program of Altschul et al. (1990) J. Mol. Biol. 215:403. BLAST nucleotide searches can be performed using the BLASTN program (nucleotide query for nucleotide sequence searches) to obtain nucleotide sequences homologous to the nucleic acid molecules of the present disclosure, or using the BLASTX program (translated nucleotide query for protein sequence searches) to obtain protein sequences homologous to the nucleic acid molecules of the present disclosure. BLAST protein searches can be performed using the BLASTP program (protein query for protein sequence searches) to obtain amino acid sequences homologous to the protein molecules of the present disclosure, or using the TBLASTN program (protein query for translated nucleotide sequence searches) to obtain nucleotide sequences homologous to the protein molecules of the present disclosure. In order to obtain gap alignments for comparison purposes, Gapped BLAST (in BLAST2.0) can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389. Alternatively, PSI-Blast can be used to perform an iterative search that detects distant relationships between molecules. See Altschul et al. (1997) supra. When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the corresponding programs (e.g., BLASTX and BLASTN) can be used. Alignment can also be performed manually by inspection.

[0152] In this disclosure, the term "homology" is sometimes used to refer to the level of similarity between two or more nucleic acid or amino acid sequences (i.e., sequence similarity or identity) expressed as a percentage of positional identity. Homology also refers to the concept of evolutionary relatedness, often demonstrated by similar functional properties between different nucleic acids or proteins that share similar sequences.

[0153] In some embodiments, homologous sequences related to the present disclosure can be obtained by comparing exemplary sequences with genomic or transcriptomic data from samples of evolutionarily closely related species. For example, between different species of the same genus or between different strains of the same species, by comparing an exemplary sequence with genomic or transcriptomic data from a sample, a person skilled in the art can expect that the sequence has the same or similar function.

[0154] In this disclosure, the term "CDS" refers to a coding sequence. DNA is transcribed into mRNA, which is then translated into protein through splicing and other processing. A CDS is a DNA sequence that corresponds one-to-one with the protein sequence, without any other sequences not corresponding to the protein. Regardless of sequence changes during mRNA processing, it completely corresponds to the codons of the protein.

[0155] In some embodiments, nucleic acid molecules of interest can be cloned from DNA containing a given nucleic acid molecule from any source, e.g., by PCR amplification and / or restriction enzyme digestion. In some embodiments, nucleic acid molecules of interest are synthesized. Any method for obtaining nucleic acid molecules of interest is compatible with the present disclosure.

[0156] In this disclosure, the term "synthetic" refers to polynucleotide (i.e., DNA or RNA) molecules produced by chemical synthesis as an in vitro process. For example, TM Synthetic DNA is produced during the reaction process in the tube so that the synthetic DNA is enzymatically produced from natural DNA or RNA chains. Other laboratory methods can be used to synthesize polynucleotide sequences. Oligonucleotides can be chemically synthesized on an oligonucleotide synthesizer using solid phase synthesis using phosphoramidites. The synthesized oligonucleotides can be annealed to each other as complexes to produce "synthetic" polynucleotides. Other methods for chemically synthesizing polynucleotides are known in the art and can be easily implemented for use in the present disclosure.

[0157] In this disclosure, the term "gene" refers to a nucleic acid fragment that expresses a specific protein. A "gene" includes the DNA region that encodes the gene product, as well as all DNA regions that regulate the production of the gene product, regardless of whether such regulatory sequences are adjacent to the coding and / or transcribed sequences. Thus, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites, introns, and locus control regions.

[0158] In this disclosure, the term "gene product" refers to any product produced by a gene. For example, a gene product can be the direct transcription product of a gene (such as mRNA, tRNA, rRNA, antisense RNA, interfering RNA, ribozyme, structural RNA, or any other type of RNA), or it can be a protein produced by translation of an mRNA.

[0159] In this disclosure, the term "protein" (or "protein" or "peptide" or "polypeptide" or "peptide composition") includes both naturally occurring proteins and variants and modified forms thereof. As used herein, the terms "protein" and "polypeptide" are used interchangeably, so the term polypeptide can be used to refer to a full-length polypeptide or a fragment of a full-length polypeptide. The term "fragment" refers to a portion of a polypeptide sequence. "Fragments" or "biologically active portions" include polypeptides that contain a sufficient number of contiguous amino acid residues to retain biological activity, such as polypeptides in which the N-terminal amino acid is truncated.

[0160] "Variant" protein refers to a protein derived from a native protein by the deletion of one or more amino acids at the N-terminus and / or C-terminus of the native protein (so-called truncation), the deletion and / or addition of one or more amino acids at one or more internal sites in the native protein, or the substitution of one or more amino acids at one or more sites in the native protein. Such variants can be produced, for example, by genetic polymorphism or artificial manipulation. As determined by sequence alignment programs and parameters, biologically active variants of R proteins will have at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity with the amino acid sequence of the present invention (e.g., the amino acid sequence shown in SEQ ID NO: 3). The biologically active variants of a protein of the present invention may differ from the protein in as few as 1-15 amino acid residues, as few as 1-10, such as 6-10, as few as 5, as few as 4, 3, 2 or even 1 amino acid residue. More preferably, such variants confer enhanced resistance to plant diseases caused by at least one species of at least one Phytophthora species on the plant or part thereof comprising the variant. In some embodiments, the mutations to be created in the DNA encoding the variant will not place the sequence out of reading frame. Optimally, the mutations will not create complementary regions that could produce secondary mRNA structure.

[0161] The protein of the present disclosure can be changed in various ways, including amino acid substitutions, deletions, truncations and insertions. Methods for such operations are generally known in the art. Methods for mutagenesis and polynucleotide alterations are well known in the art. Guidance for appropriate amino acid substitutions that do not affect the biological activity of the target protein can be found in the models of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC), which are incorporated herein by reference. Conservative substitutions such as replacing one amino acid with another amino acid having similar properties can be optimal.

[0162] It is expected that deletions, insertions, and substitutions of the protein sequences encompassed herein will not produce fundamental changes in the characteristics of the protein. However, where it is difficult to predict the exact effect of a substitution, deletion, or insertion, one skilled in the art will appreciate that the effect will be assessed by conventional screening assays. That is, activity can be assessed by the assays disclosed below.

[0163] Variant polynucleotides and proteins also include sequences and proteins derived from mutagenesis and recombination processes such as DNA shuffling. Strategies for such DNA shuffling are known in the art.

[0164] In the present disclosure, the term "amino acid" refers to any amino acid (both standard and non-standard amino acids), including but not limited to α-amino acids, β-amino acids, γ-amino acids and δ-amino acids. Examples of suitable amino acids include but are not limited to alanine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, proline, serine, tyrosine, arginine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan and valine.

[0165] In this disclosure, the term "isolated" means removed from its natural environment or from other compounds present when the compound is first formed. The term "isolated" includes materials separated from natural sources as well as materials (such as nucleic acids and proteins) recovered after production by recombinant expression in host cells, or chemically synthesized compounds such as nucleic acid molecules, proteins, and peptides. Any method of obtaining the proteins of interest is compatible with this disclosure.

[0166] In the present disclosure, the term "expression cassette" refers to a DNA fragment that can be inserted into a nucleic acid or polynucleotide at a specific restriction site or by homologous recombination. As used herein, the DNA fragment comprises a polynucleotide encoding a polypeptide of interest, and the expression cassette and restriction sites are designed to ensure that the expression cassette is inserted into an appropriate reading frame for transcription and translation. In one embodiment, the expression cassette can include a polynucleotide encoding a polypeptide of interest and, in addition to the polynucleotide, also has elements that promote specific host cell transformation. In one embodiment, the expression cassette can also include elements that allow the expression of the polynucleotide encoding the polypeptide of interest to be enhanced in the host cell. These elements can include, but are not limited to, promoters, minimal promoters, enhancers, response elements, terminator sequences, polyadenylation sequences, etc.

[0167] The expression cassette can also include a selective marker gene for selecting transformed cells. The selective marker gene is used to select the cells or tissues of transformation. The marker gene includes a gene encoding antibiotic resistance, such as the gene encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), and a gene that confers resistance to herbicidal compounds (such as glufosinate, bromoxynil, imidazolinone and 2,4-dichlorophenoxyacetic acid ester (2,4-d)). Other selective markers include phenotypic markers such as beta-galactosidase and fluorescent proteins, such as green fluorescent protein (GFP), cyan fluorescent protein (CYP) and yellow fluorescent protein.

[0168] In this disclosure, the terms "vector" and "construct", "cloning vector" and "expression vector" are used interchangeably and mean a vector that can introduce a DNA or RNA sequence (e.g., an exogenous gene) into a host cell to transform the host and promote the expression (e.g., transcription and translation) of the introduced sequence. "Non-viral vector" refers to any vector that does not contain a virus or retrovirus. In some embodiments, a "vector" is a DNA sequence that comprises at least one DNA replication origin and at least one selectable marker gene. Examples include, but are not limited to, plasmids, cosmids, bacteriophages, bacterial artificial chromosomes (BACs), or viruses that carry exogenous DNA into cells. Vectors can also include one or more genes, antisense molecules, and / or selectable marker genes and other genetic elements known in the art. Vectors can transduce, transform, or infect cells, thereby causing the cells to express nucleic acid molecules and / or proteins encoded by the vector. The term "plasmid" refers to a circular chain of nucleic acid that can replicate autosomal in a prokaryotic or eukaryotic host cell. The term includes nucleic acids, which can be DNA or RNA, and can be single-stranded or double-stranded. The plasmid defined in this definition can also include sequences corresponding to bacterial replication origins.

[0169] In some embodiments, a "cloning vector" can replicate or integrate autonomously in the host cell genome and is further characterized by one or more restriction endonuclease sites at which the vector can be cut in a defined manner and a desired DNA sequence can be ligated into the vector so that the new recombinant plasmid retains its ability to replicate in the host cell. In the case of a plasmid, replication of the desired sequence can occur multiple times as the number of copies of the plasmid in the host cell (e.g., a bacterial host) increases, or only once per host before the host reproduces by mitosis. In the case of a bacteriophage, replication can occur actively during the lytic phase or passively during the lysogenic phase.

[0170] In some embodiments, an "expression vector" can be inserted into a desired DNA sequence by restriction enzyme digestion and ligation so that it is effectively linked to a regulatory sequence and can be expressed as an RNA transcript. The vector may also contain one or more marker sequences suitable for identifying whether a cell has been transformed or transfected by the vector. Markers include genes that encode proteins that increase or decrease their resistance or sensitivity to antibiotics or other compounds, genes that encode enzymes whose activity can be detected by standard methods known in the art (e.g., β-galactosidase, luciferase, or alkaline phosphatase), and genes that have a visible effect on the phenotype of transformed or transfected cells, hosts, colonies, or plaques (e.g., green fluorescent protein). Preferred vectors are those that are capable of autonomous replication and expression of the products of the structural genes present in the DNA fragments to which they are effectively linked.

[0171] In this disclosure, the term "expression" refers to the biosynthesis of a gene product, including the transcription and / or translation of the gene product. "Expression" or "production" of a protein or polypeptide from a DNA molecule refers to the transcription and translation of the coding sequence to produce the protein or polypeptide, and "expression" or "production" of a protein or polypeptide from an RNA molecule refers to the translation of the RNA coding sequence to produce the protein or polypeptide.

[0172] Gene expression can be influenced by external signals, such as exposure of a cell, tissue, or organism to a substance that increases or decreases gene expression. Gene expression can also be regulated anywhere along the pathway from DNA to RNA to protein. Regulation of gene expression can be achieved through control of transcription, translation, RNA transport and processing, degradation of intermediate molecules (such as mRNA), or through activation, inactivation, compartmentalization, or degradation of specific protein molecules after their production, or a combination thereof. The exact nature of the regulatory sequences required for gene expression may vary between species or cell types, but generally should include, as needed, 5′ non-transcribed and 5′ non-translated sequences involved in the initiation of transcription and translation, respectively, such as TATA boxes, capping sequences, CAAT sequences, and the like. In particular, such 5′ non-transcribed regulatory sequences will include a promoter region, which includes a promoter sequence that controls transcriptional control of an operably linked gene. Regulatory sequences may also include enhancer sequences or upstream activator sequences as needed. The disclosed vectors may optionally include a 5′ leader or signal sequence. The selection and design of suitable vectors is within the ability and judgment of one of ordinary skill in the art.

[0173] In some embodiments, when the nucleic acid molecules encoding any enzyme of the present disclosure are expressed in cells, a variety of transcription control sequences (e.g., promoter / enhancer sequences) can be used to direct their expression. The promoter can be a natural promoter, i.e., the promoter of a gene in its endogenous environment, which provides normal regulation of gene expression. In some embodiments, the promoter can be constitutive, i.e., the promoter continuously transcribes its associated gene without regulation. A variety of conditional promoters can also be used, such as promoters controlled by the presence or absence of a molecule. Chemically regulated promoters can be used to regulate gene expression in a host by applying exogenous chemical regulators. Depending on the purpose, the promoter can be a chemically inducible promoter, wherein the application of the chemical induces gene expression, or a chemically repressible promoter, wherein the application of the chemical represses gene expression. Chemically inducible promoters are known in the art, and include but are not limited to the corn In2-2 promoter (which is activated by benzenesulfonamide herbicide safeners), the corn GST promoter (which is activated by hydrophobic electrophilic compounds used as pre-germination herbicides), and the tobacco PR-1a promoter (which is activated by salicylic acid). Other chemically regulated promoters of interest include glucocorticoid-inducible promoters among the steroid-responsive promoters, as well as tetracycline-inducible and tetracycline-repressible promoters.

[0174] Expression vectors containing all necessary expression elements are commercially available and are well known to those skilled in the art. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, 1989. Cells are genetically engineered by introducing exogenous DNA (RNA) into the cells. The exogenous DNA (RNA) is placed under the effective control of transcriptional elements to allow expression of the exogenous DNA in the host cell.

[0175] In this disclosure, the term "transformation" includes all techniques by which a nucleic acid molecule can be introduced into such a cell. Examples include, but are not limited to: transfection with viral vectors; transformation with plasmid vectors; electroporation; adipose infection; microinjection; Agrobacterium-mediated transfer; direct DNA uptake; WHISKERS TM mediated transformation; and microprojectile bombardment. These techniques can be used for both stable and transient transformation of host cells. "Stable transformation" refers to the introduction of a nucleic acid fragment into the genome of a host organism, resulting in genetic stability. Once stably transformed, the nucleic acid fragment is stably integrated into the genome of the host organism and any subsequent generations. Host organisms containing the transformed nucleic acid fragment are referred to as "transgenic" organisms. "Transient transformation" refers to the introduction of a nucleic acid fragment into the nucleus or DNA-containing organelles of a host organism, resulting in gene expression without genetically stable inheritance.

[0176] In some embodiments, to transform hosts and host cells, the nucleotide sequences of the present disclosure can be inserted into any vector known in the art that is suitable for expressing nucleotide sequences in hosts or host cells using standard techniques. The choice of vector depends on the preferred transformation technique and the target host species to be transformed. The transformation method depends on the host cell to be transformed, the stability of the vector used, the expression level of the gene product, and other parameters.

[0177] In the present disclosure, the term "plant" includes seeds, plant cells, plant protoplasts, plant cell tissue cultures, plant calli, plant pieces from which plants can be regenerated, and intact plant cells in plants or plant parts such as embryos, pollen, ovules, seeds, tubers, propagules, leaves, flowers, branches, fruits, roots, root tips, anthers, etc. Progeny, variants, and mutants of regenerated plants are also included within the scope of the present disclosure, provided that these parts contain the introduced polynucleotides. As used herein, unless otherwise expressly stated or apparent from the context of use, "offspring" and "offspring plants" include any subsequent generation of plants, whether produced by sexual reproduction and / or asexual reproduction.

[0178] The terms "transgenic plant" and "transformed plant" refer to equivalent terms for "plant" as described above, wherein the plant comprises a heterologous nucleic acid molecule, heterologous polynucleotide, or heterologous polynucleotide construct introduced into the plant by, for example, any stable and transient transformation method disclosed elsewhere herein or otherwise known in the art. Such transgenic plants and transformed plants also refer, for example, to the plant into which the heterologous nucleic acid molecule, heterologous polynucleotide, or heterologous polynucleotide construct was first introduced, as well as any progeny plants thereof that comprise the heterologous nucleic acid molecule, heterologous polynucleotide, or heterologous polynucleotide construct.

[0179] In other embodiments, a plant comprising a heterologous polynucleotide comprising an R gene nucleotide sequence disclosed herein is produced using the methods of the present disclosure, the methods involving genome editing to modify the nucleotide sequence of a native or non-native gene in the genome of the plant. Here, the native or non-native gene comprises a nucleotide sequence different from the R gene nucleotide sequence disclosed herein, and the modified native or non-native gene comprises the R gene nucleotide sequence disclosed herein. Generally, such methods comprise using a plant comprising a native or non-native gene in its genome, wherein the native or non-native gene comprises a nucleotide sequence homologous to the R gene nucleotide sequence disclosed herein, and further comprising introducing into the plant a nucleic acid molecule comprising at least a portion of the R gene nucleotide sequence disclosed herein. Preferably, the nucleotide sequence of the native or non-native gene has about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more nucleotide sequence identity with at least one R gene nucleotide sequence disclosed herein. Such a native or non-native gene may be, for example, a non-functional homologue of an R gene, in particular the Rpi-HMA13 gene, which is not capable of conferring or is not known to confer resistance to plant diseases on plants.

[0180] The term "Solanaceae" is intended to include Solanaceae plants at any stage of maturity or development, and, unless the context clearly indicates otherwise, any cell, tissue, or organ (plant part) obtained or derived from any such plant. Solanaceae plant parts include, but are not limited to, fruits, stems, tubers, roots, flowers, ovules, stamens, leaves, embryos, meristematic regions, callus, anther cultures, gametophytes, sporophytes, pollen, microspores, protoplasts, and the like. As used herein, the term "tuber" is intended to mean a whole tuber or any part thereof, such as a slice or portion of a potato tuber containing one or more buds (i.e., "eyes") suitable for planting in the field to produce potato plants. The present disclosure also includes seeds produced by Solanaceae plants of the present disclosure.

[0181] In certain embodiments of the present disclosure, plants of the present disclosure, particularly Solanaceae plants, may comprise one, two, three, four, five, six or more nucleotide sequences encoding R proteins. Typically, but not necessarily, the two or more R proteins are different from one another. For the present disclosure, when two R proteins have different amino acid sequences, the R protein is different from the other R protein. In certain embodiments of the present disclosure, each of the different R proteins used to resist plant diseases caused by a species of Phytophthora has one or more differences in resistance characteristics, such as resistance to different species and / or groups of species of the same Phytophthora species or even different species of Phytophthora. By combining two, three, four, five, six or more nucleotide sequences with each nucleotide sequence encoding a different R protein for resistance to different species of a species of Phytophthora or certain species (spp.) of Phytophthora, a Solanaceae plant comprising a broad spectrum of resistance to multiple species of a single species of Phytophthora or even multiple species of Phytophthora can be produced. Such Solanaceae plants, particularly potato or tomato plants, may be used in agriculture in areas where multiple races of a species of Phytophthora, such as multiple races of Phytophthora infestans, are prevalent.

[0182] Plants of the present disclosure comprising multiple R genes can be produced, for example, by transforming a plant already comprising one or more other R gene nucleotide sequences with a heterologous polynucleotide comprising at least one Rpi-HMA13 nucleotide sequence of the present disclosure. Such plants already comprising one or more other R gene nucleotide sequences can comprise R genes native to the genome or plant, R genes introduced into the plant through sexual reproduction, or R genes introduced by transforming the plant or its ancestors with R gene nucleotide sequences. Alternatively, the one or more other R gene nucleotide sequences can be introduced into a plant of the present disclosure, such as by transformation or sexual reproduction, that already comprises a heterologous polynucleotide of the present disclosure.

[0183] In other embodiments, two or more different R gene sequences can be introduced into a plant by stably transforming the plant with a heterologous polynucleotide or vector comprising two or more R gene nucleotide sequences. Alternatively, a heterologous polynucleotide of the present disclosure can be integrated into the genome of a plant adjacent to another R gene nucleotide sequence using homologous recombination-based genome modification methods described elsewhere herein or known in the art.

[0184] In the present disclosure, the use of the term "DNA" or "RNA" is not intended to limit the present disclosure to polynucleotide molecules comprising DNA or RNA. It will be appreciated by those skilled in the art that the methods and compositions of the present disclosure include polynucleotide molecules consisting of deoxyribonucleotides (i.e., DNA), ribonucleotides (i.e., RNA), or a combination of ribonucleotides and deoxyribonucleotides. Such deoxyribonucleotides and ribonucleotides include naturally occurring molecules and synthetic analogs, including but not limited to nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, having binding properties similar to reference nucleic acids, and metabolized in a manner similar to reference nucleotides. Examples of such analogs include but are not limited to phosphorothioates, phosphoramidates, methylphosphonates, chiral-methylphosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNA). The polynucleotide molecules of the present disclosure also include all forms of polynucleotide molecules, including but not limited to single-stranded forms, double-stranded forms, hairpins, stem-loop structures, etc. In addition, it will be understood by those skilled in the art that the nucleotide sequences disclosed herein also include the complementary sequences of the exemplary nucleotide sequences.

[0185] Table 1 Species information of the disclosed genes

[0186] Unless otherwise specified, the reagents, instruments, strains, or biological materials used in this disclosure can be obtained through commercial channels. The Phytophthora infestans strains JH19 and 88069 used in the following examples were obtained from the Crop Disease Genomics Laboratory, Department of Plant Pathology, College of Plant Protection, Nanjing Agricultural University.

[0187] The present disclosure is further described below with reference to the following embodiments:

[0188] Example 1 Acquisition of Rpi-HMA13 gene and vector preparation

[0189] Specific primers Rpi-HMA13-F and Rpi-HMA13-R were designed based on the genome sequence information of Solanum cajamarquense.

[0190] The Rpi-HMA13 gene was cloned from the Solanum cajamarquense genome using high-fidelity enzyme. The reaction conditions were: 95℃5min; 95℃30sec, 58℃50sec, 72℃3min 30sec, Go to 35cycles; 72℃10min.

[0191] The fragment was constructed into the pBin308 expression vector by homologous recombination, and the ligation product was transformed into Escherichia coli DH5α competent cells by heat shock method. The cells were cultured in an inverted manner at 37°C on LB solid medium containing 100 mg / L kanamycin for 12 to 16 hours. Single colonies were selected for testing, and the positive transformant pBin308-Rpi-HMA13 with correct sequencing was obtained.

[0192] Table 2 Rpi-HMA13 primer sequences

[0193] Example 2 Transient Expression of Rpi-HMA13 in Nicotiana benthamiana Leaves and Inoculation with Phytophthora infestans

[0194] The recombinant plasmid pBin308-Rpi-HMA13 was transformed into Agrobacterium GV3101 by heat shock method. The Agrobacterium strain containing pBin308-Rpi-HMA13 was cultured overnight, collected by centrifugation at 5000 r for 5 min, and resuspended in MES buffer to adjust the OD 600 = 0.2, injected into one side of 4-week-old wild-type Nicotiana benthamiana leaves. Transiently expressing pBin308-GFP served as a negative control, and transiently expressing the late blight resistance gene R3a served as a positive control. One day after injection, 10 μL droplets of 100,000 zoospores of Phytophthora infestans per mL were inoculated onto both sides of the leaves. Results were counted 5 days after inoculation. Three separate leaves were used for each inoculation experiment, and each experiment was replicated at least three times.

[0195] At the same time, the above method was used to verify the resistance of Rpi-HMA13's orthologous genes Rpi-HMA13-C509 (its CDS sequence is shown in SEQ ID NO: 7), Rpi-HMA13-C454 (its CDS sequence is shown in SEQ ID NO: 8), and Rpi-HMA13-C555 (its CDS sequence is shown in SEQ ID NO: 9) to the infesting fungus JH19.

[0196] The results showed that transient expression of Rpi-HMA13 induced significant resistance of Nicotiana benthamiana to Phytophthora infestans JH19 compared with the negative control, and there was no significant difference between the resistance conferred by Rpi-HMA13 and the resistance conferred by the positive control (Figure 1).

[0197] However, the orthologous genes of Rpi-HMA13, Rpi-HMA13-C509, Rpi-HMA13-C454, and Rpi-HMA13-C555, could not confer resistance to Phytophthora infestans JH19 in Nicotiana benthamiana ( Figure 2 ).

[0198] Example 3 Stable expression of Rpi-HMA13 in potato and inoculation with Phytophthora infestans

[0199] In the following examples, the disease resistance gene Rpi-HMA13 was expressed using the CamV 35S promoter and constructed into the plant expression vector pBin308. Agrobacterium-mediated stable transformation of the stems of the susceptible potato variety Desiree was used to obtain transgenic plants. Kanamycin resistance screening and phenotypic verification revealed transgenic material resistant to late blight and resistant to the herbicide kanamycin. The specific transgenic method is as follows.

[0200] (1) Stem segment pre-culture

[0201] Two sterilized filter papers were spread on Z1N2 culture medium, 2 mL of PACM (plant MS liquid culture medium containing 1 μg / mL 2,4-dichlorophenoxyacetic acid and 0.5 μg / mL kinetin) was added, a certain number of stem segments were cut, arranged neatly, and cultured under light (48 h).

[0202] (2) Bacteria activation

[0203] Take 100 μL of the bacterial solution to be transformed from -80℃, put it in a 1.5mL centrifuge tube, add 1mL LB (kana + Rif) liquid medium, and culture it on a shaker at 28℃, 220r for 12h. Then take 100 μL of it in a 50mL centrifuge tube, add 10mL LB (kana + Rif) liquid medium, and culture it on a shaker at 28℃, 220r overnight. Detect the OD value, which is OD 600 About 0.5.

[0204] (3) Infection

[0205] The Agrobacterium culture liquid was centrifuged (4°C, 4000r, 10min), the bacterial precipitate was collected, and the OD value was resuspended in MS20 liquid (1% acetosyringone AS was added, and 10μL AS was added to each 10mL liquid MS20 medium). 600 To 0.5. Place the pre-cultured stem segments in the resuspended bacterial solution and shake for 10 minutes. Take the stem segments and place them on Z1N2 AS medium (covered with filter paper) and culture in the dark at 24°C for 48 hours.

[0206] (4) Differentiation

[0207] Stem segments were cultured in differentiation medium Z2N0.01. The medium was changed every two weeks. When calli differentiated and sprouted, they were transferred to rooting medium (MS30 + 2 mL 300 mg / mL Timentin TMT + 1 mL 50 mg / mL kanamycin per liter) and subcultured every 3 to 4 weeks.

[0208] (5) Screening of transgenic positive plants

[0209] The potato seedlings on the rooting medium can be screened after they have taken root and grown to a certain size. Leaves of the plants are taken and DNA is extracted for PCR verification.

[0210] Based on the sequence of the pBin308-Rpi-HMA13 recombinant plasmid, specific primers pBin308-F (5'→3': TGATAACAGCGGGTTAATTAACG, SEQ ID NO: 10) and pBin308-R (5'→3': CTCTAGATCAGGTGGATCCC, SEQ ID NO: 11) were designed. PCR amplification was performed using genomic DNA from transgenic potato leaves as a template. Reaction conditions were: 95°C for 5 minutes; 95°C for 30 seconds, 60°C for 30 seconds, 72°C for 20 seconds, Go to 25 cycles; 72°C for 10 minutes. The PCR product was 441 bp in size. The attached results demonstrate that the target gene Rpi-HMA13 has integrated into the potato genome (Figure 3).

[0211] Example 4 Inoculation of transgenic potato leaves with Phytophthora infestans

[0212] In this example, transgenic potatoes were tested for resistance to late blight using zoospores of the infesting fungus strain 88069 collected from petri dishes. A 10-μl droplet of 50,000 spores per ml was inoculated onto detached leaves of 4- to 6-week-old potato plants. Results were recorded five days after inoculation. Each inoculation experiment used one to two individual leaves, and each experiment was replicated at least three times.

[0213] The results showed that transgenic potato plants stably expressing Rpi-HMA13 were significantly resistant to the infesting P. infestans strain 88069 compared to untransformed potato Desiree ( Figures 4 and 5 ).

[0214] The above is only a preferred embodiment of the present disclosure. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present disclosure. These improvements and modifications should also be regarded as within the scope of protection of the present disclosure.

Claims

1. A nucleic acid molecule, characterized in that It contains at least one of the following nucleotide sequences: (a1) the nucleotide sequence shown in SEQ ID NO: 1; (a2) the nucleotide sequence shown in SEQ ID NO: 2; (a3) a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 3; (a4) an artificial variant nucleotide sequence having at least 90% sequence identity with the nucleotide sequence shown in any one of (a1) and (a2); (a5) An artificial variant nucleotide sequence of an amino acid sequence having at least 90% sequence identity with the amino acid sequence shown in (a3).

2. A nucleic acid molecule composition, characterized in that: It comprises the nucleic acid molecule according to claim 1 and another R gene; Optionally, the additional R genes include at least one of the following genes: Rpi-amr3i, Rpi-blb1, Rpi-sto1, Rpi-pta1, Rpi-blb2, Rpi-blb3, Rpi-abpt, R2-like, R2, Rpi-edn1.1, Rpi-edn1.2, Rpi-snk1.1, Rpi-snk1.2, Rpi-hjt1.1-Rpi-hjt1.3, Rpi-bt1, R1, R3a, R3b, Rpi-vnt1.1, Rpi-vnt1.2, Rpi-vnt1.3, Rpi-mcq1, Rpi-chc, Ph-3 or R8.

3. A biomaterial, characterized in that: The biological material is any one of the following (b1) to (b3): (b1) an expression cassette or an expression cassette composition comprising the nucleic acid molecule of claim 1 or the nucleic acid molecule composition of claim 2; (b2) a vector or vector composition comprising the nucleic acid molecule of claim 1 or the nucleic acid molecule composition of claim 2, or a vector or vector composition comprising the expression cassette or expression cassette composition of (b1); (b3) a host cell containing the nucleic acid molecule of claim 1 or the nucleic acid molecule composition of claim 2, or a host cell containing the expression cassette or expression cassette composition of (b1), or a host cell containing the vector or vector composition of (b2); optionally, the host cell comprises a bacterial or fungal cell.

4. The biomaterial according to claim 3, characterized in that The expression cassette or expression cassette composition further comprises an operably linked promoter; Optionally, the promoter comprises an operably linked endogenous promoter and / or an operably linked heterologous promoter; Preferably, the endogenous promoter comprises the nucleotide sequence shown in SEQ ID NO: 4, and / or, A nucleotide sequence having at least 75% sequence identity with the nucleotide sequence shown in SEQ ID NO:

4.

5. A promoter, characterized in that It comprises the nucleotide sequence shown in SEQ ID NO:

4.

6. A method for increasing the resistance of plants to plant diseases caused by at least one subspecies of at least one species of the genus Phytophthora, characterized in that The method comprises modifying at least one plant cell to contain a heterologous polynucleotide comprising the nucleic acid molecule of claim 1 or the nucleic acid molecule composition of claim 2.

7. The method according to claim 6, characterized in that The method further comprises regenerating the plant cell into a plant comprising the heterologous polynucleotide in its genome.

8. A method for controlling plant diseases caused by at least one subspecies of at least one species of Phytophthora in crop production, characterized in that: The method comprises: Modifying at least one plant cell to contain a heterologous polynucleotide comprising the nucleic acid molecule of claim 1 or the nucleic acid molecule composition of claim 2; regenerating the plant cell into a plant comprising the heterologous polynucleotide in its genome; The seedlings, tubers or seeds of the plant are planted and cultivated under conditions conducive to the growth and development of the plant.

9. A method for detecting plant disease resistance, characterized in that: The method comprises detecting the presence of the nucleic acid molecule of claim 1 or the nucleic acid molecule composition of claim 2 in a plant, a plant part thereof or a plant cell.

10. The method according to claim 9, characterized in that The method for detecting the presence of the nucleic acid molecule described in claim 1 or the nucleic acid molecule composition described in claim 2 comprises: detecting the presence of the nucleic acid molecule or the nucleic acid molecule composition by detecting the complete nucleic acid molecule or the nucleic acid molecule composition, or detecting at least one molecular marker in the nucleic acid molecule or the nucleic acid molecule composition.

11. The method according to claim 9 or 10, characterized in that: The method for detecting the presence of the nucleic acid molecule of claim 1 or the nucleic acid molecule composition of claim 2 comprises PCR amplification, nucleic acid sequencing, nucleic acid hybridization or an immunological assay for detecting a protein or polypeptide encoded by the nucleic acid molecule or nucleic acid molecule composition.

12. A method for selecting plants, characterized in that: The method comprises: Detecting the presence of the nucleic acid molecule of claim 1 or the nucleic acid molecule composition of claim 2 in the plant, its plant part or its plant cell; Plants are selected which comprise in their genome at least one copy of said nucleic acid molecule or combination of nucleic acid molecules.

13. The method according to claim 12, characterized in that The method comprises using the primers shown in SEQ ID NO:5 and SEQ ID NO:

6.

14. A protein, characterized in that It contains at least one of the following amino acid sequences: (e1) the amino acid sequence shown in SEQ ID NO: 3; (e2) the amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO: 1; (e3) the amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO: 2; (e4) an artificial variant amino acid sequence having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 3, wherein a protein comprising the artificial variant amino acid sequence is capable of conferring resistance to plant diseases caused by at least one subspecies of at least one species of the genus Phytophthora to the plant comprising the protein.

15. A plant or a plant part thereof, characterized in that The plant is one of the following: (d1) A plant comprising at least one of the nucleic acid molecule according to claim 1 or the nucleic acid molecule composition according to claim 2, and the biological material according to claim 3; (d2) plants grown from plant cells modified to contain the nucleic acid molecule of claim 1 or the nucleic acid molecule composition of claim 2; (d3) a plant produced by the method for enhancing plant resistance to a plant disease caused by at least one subspecies of at least one species of the genus Phytophthora according to claim 6; (d4) progeny formed by self-pollination of any plant in (d1) to (d3), and plants grown from the progeny; (d5) The offspring formed by hybridizing any plant in (d1) to (d3) with other varieties, and the plants grown from the offspring.

Images