Antisense oligonucleotides for modulation of progranulin splicing

Abstract

There is described a set of antisense oligonucleotides suitable for inducing exon skipping on a pre-mature RNA transcript (pre-mRNA) from a human Granulin gene (GRN) carrying a null mutation. There are further described a pharmaceutical composition comprising said set of antisense oligonucleotides and the therapeutic use of said oligo set and / or pharmaceutical composition, particularly for the prevention and / or therapeutic treatment of a neurodegenerative disease such as frontotemporal dementia (FTD).

Description

[0001] Antisense oligonucleotides for modulation of progranulin splicing

[0002] Technical field

[0003] The present invention pertains to the therapeutic field of neurodegenerative disorders. More specifically, the present invention relates to antisense oligonucleotide molecules for use in the therapeutic treatment of frontotemporal disorders such as Frontotemporal Dementia (FTD).

[0004] Background art

[0005] Frontotemporal Dementia (FTD), the second most common cause of early-onset dementia, is a neurodegenerative disorder encompassing a broad range of neuropathological entities and clinical manifestations (Borroni B, and Benussi A. “Recent advances in understanding frontotemporal degeneration”; FlOOORes. 2019; 8:2098). This disorder primarily affects behavioural, linguistic, and executive functions due to the progressive atrophy of the frontal and temporal lobes (Raskovsky K. et al., “Sensitivity of revised diagnostic criteria for the behavioural variant of frontotemporal dementia”. Brain. 2011; 134:2456-2477; Gorno- Tempini ML. et al., ML, “Classification of primary progressive aphasia and its variants”. Neurology. 2011; 76: 1006-1014).

[0006] All FTD clinical syndromes share an underlying frontotemporal lobar degeneration (FTLD), which can be categorized based on the primary constituent proteins of cellular inclusions, such as FLTD-Tau, FTLD-TDP, and FTLD-FET, corresponding to the deposition of tau protein, TAR DNA Binding Protein 43 (TDP-43), and FET family proteins, respectively (Mackenzie IRA et al., “Nomenclature and nosology for neurop athologic subtypes of frontotemporal lobar degeneration: an update”. ActaNeuropathol. 2010; 119: 1-4.; Neumann M, and Mackenzie IRA. Review: Neuropathology of non-tau frontotemporal lobar degeneration. Neuropathol Appl Neurobiol. 2019; 45: 19-40).

[0007] Alongside the heterogeneity in clinical presentations and pathological markers, a growing body of literature illustrates the intricate genetic determinants of FTD, with approximately 20-30% of cases having variations in Granulin GRN), microtubule-associated protein tau (MAPT), and chromosome 9 open reading frame 72 (C9orf72) genes (Borroni B, and Padovani A. Dementia: a new algorithm for molecular diagnostics in FTLD. Nat Rev Neurol 2013; 9:241-242).

[0008] FTD is an orphan disorder, as no treatment has been approved by regulatory agencies so far. The urgent need for therapies that can prevent, delay onset, slow progression, and alleviate FTD symptoms is driven by the increasing number of affected individuals and the growing public health crisis it represents. In particular, in monogenic inherited FTD potential diseasemodifying treatment approaches may be addressed to both patients and at-risk subjects carrying pathogenetic mutations.

[0009] GRN mutations represent one of the most frequent causes of autosomal dominant inherited FTD. The GRN gene encodes for progranulin, a protein highly expressed in immune cells and microglia, regulating cell growth survival and inflammation.

[0010] As schematically depicted in Figure 1, the human GRN gene consists of 13 exons that are transcribed in a pre-mature RNA transcript (pre-mRNA) and joined together during splicing to produce a mature RNA (accession number NM_002087 in the NCBI database). The mature mRNA is translated in a precursor protein of 593 amino acids (approximately 88 kDa) that is then cleaved in several secreted, glycosylated peptides called granulins, designated granulins A through G. Each granulin domain contains 7.5 repeats of a highly conserved 12-cysteine granulin / epithelin motif and is encoded by two exons in tandem contributing either the N- or C-terminal half of the domain (Figure 1).

[0011] Most mutations in the human GRN gene are changes in nucleotide bases or small deletions / insertions that introduce premature stop codons (PTCs) and induce nonsense- mediated decay (NMD) of the mRNA. In addition, a few mutations have been detected in the splicing controlling elements of various exons and such mutations induce exon skipping, which can also eventually alter the protein coding frame and lead to the introduction of PTCs. Exemplary null mutations in the GRN gene are illustrated in Figure 2. Variations in the GRN gene, which recognises FTLD-TDP as pathological hallmark and has over 110 pathogenic variants (Moore KM et al., “Age at symptom onset and death and disease duration in genetic frontotemporal dementia: an international retrospective cohort study”. Lancet Neurol. 2020; 19: 145-156), account for 5-20% of familial and 1-5% of sporadic FTD cases (Baker M. et al., Mutations in progranulin cause tau-negative frontotemporal dementia linked to chromosome 17. Nature. 2006; 442:916-919; Cruts M. et al., Null mutations in progranulin cause ubiquitin-positive frontotemporal dementia linked to chromosome 17q21. Nature. 2006; 442:920-924.). Despite significant phenotypic heterogeneity, most GRN variation carriers receive a clinical diagnosis of FTD, with behavioural variant (bvFTD), agrammatic variant primary progressive aphasia (avPPA) and corti cobasal syndrome (CBS) being the most common phenotypes (Borroni B, and Padovani A. Dementia: a new algorithm for molecular diagnostics in FTLD. Nat Rev Neurol 2013; 9:241-242).

[0012] Comparably to other FTD subtypes, FTD due to GRN mutations is an orphan disorder. At present, there is one therapeutic agent under evaluation in a Phase 3 trial for the treatment of patients carrying GRN mutations. More specifically, the Phase 3 study is directed to the evaluation of Latonizemab, a recombinant human monoclonal IgGl antibody targeting human sortilin (SORT1) (Kurnellas M, et al, “Latozinemab, a novel progranulin-elevating therapy for frontotemporal dementia”. J Transl Med. 2023 Jun 15;21(1):387. Sortilin is involved in regulating progranulin's endocytosis and degradation, a process implicated in FTD pathophysiology. The therapy with Latozinemab aims to increase progranulin levels by blocking sortilin, and preclinical models have already demonstrated improved outcomes related to progranulin deficiency by targeting the sortilin-progranulin axis.

[0013] Alternative therapeutic strategies are under investigation in separate Phase 2 trials. The therapy DNL593 was designed as a therapeutic substitute for FTD resulting from GRN gene variations. The compound employs a "brain shuttle" technology to restore progranulin levels in the brain. This technology involves fusing progranulin protein to an antibody fragment that binds to the transferrin receptor, allowing the intravenously administered protein to cross the blood-brain barrier (Logan T. et al., et al. Rescue of a lysosomal storage disorder caused by GRNloss of function with a brain penetrant progranulin biologic. Cell. 2021;184:4651- 4668. e25). Other ongoing phase 2 trials are evaluating gene therapy-based clinical approaches. The gene therapy PBFT02 is designed to replace the faulty GRN gene and employs an adeno- associated virus serotype 1 (AAV1) as a vehicle to transport a functional version of the GRN gene directly to the brain (Buza E. & Wilson JM. “Adeno-associated virus serotype 1 -based gene therapy for FTD caused by GRN mutations”. Ann Clin Transl Neurol. 2020 Oct;7(10): 1843-1853). The therapy is administered as a single injection into the cerebrospinal fluid within the cisterna magna. A second therapy, called PR006, employs adeno-associated virus 9 (AAV9) to transport a functional version of the GRN gene directly to the brain (Elia LP, et al. “Approaches to develop therapeutics to treat frontotemporal dementia”. Neuropharmacology. 2020 Apr; 166: 107948). The therapy is delivered as a onetime injection into the cerebrospinal fluid within the cistema magna, along with a concurrent immunosuppressive regimen of steroids and sirolimus.

[0014] Despite promising results, the aforementioned therapeutic treatments of FTD entail several limitations. Since these therapies involve the exogenous expression of progranulin, they carry the risk of overdosing neurons with this factor with possible harmful gain of function effects. Moreover, although adeno-associated viruses possess a particular tropism towards the brain, this is by no means absolute. Therefore, the use of adeno-associated viruses is always associated with the risk that these viruses may introduce recombinant progranulin in cells that should not be exposed to this protein with potential toxic effects. Finally, in gene therapies, a CD8+ immunity may be developed against the cells expressing the transgene (Mendell JR. et al., “Dystrophin immunity in Duchenne’s muscular dystrophy”; N. Engl. J. Med. 2010;363: 1429-1437; Calcedo R. et al., “Class I-restricted T-cell responses to a polymorphic peptide in a gene therapy clinical trial for a- 1 -antitrypsin deficiency”. Proc. Natl. Acad. Sci. USA. 2017;114: 1655-1659).

[0015] Summary of the invention

[0016] In the light of the foregoing, there is therefore a strong need of providing new effective therapeutic approaches aiming at preventing the onset of FTD, or reducing the progression and severity of this disease, while decreasing the risk of possible adverse effects. These and other needs are met by the oligo set as defined in claim 1.

[0017] Another aspect of the present invention is the oligo set of the invention for use as a medicament, in particular for the prevention and / or therapeutic treatment of FTD.

[0018] A further aspect of the invention is a pharmaceutical composition comprising the oligo set of the invention, and a pharmaceutically acceptable carrier, diluent and / or vehicle.

[0019] A still further aspect of the invention is an in vitro method for modulating splicing of the progranulin pre-mRNA that comprises contacting said pre-mRNA with the oligo set of the invention.

[0020] Other features and advantages of the present invention are defined in the appended claims which form an integral part of the description.

[0021] Description of the invention

[0022] As it will be illustrated in more detail below, the present inventors have devised a new effective approach that enables the removal of mutated and / or non-mutated exons (exon skipping) from the progranulin pre-mRNA by using antisense oligonucleotides specifically designed against different splicing consensus sequences. More particularly, the inventors have surprisingly found that antisense oligonucleotide-mediated skipping of a GRN- encoding exon carrying an FTD-causing mutation together with the neighboring exon encoding for the remaining half of the same granulin peptide not only led to the removal of the disease-associated mutation but also resulted in the restoration of the translational reading frame of the progranulin transcript (Figures 5 and 6), which can be properly translated by the ribosomal cell machinery to generate a protease-cleavable progranulin precursor lacking only one granulin domain.

[0023] A first aspect of the present invention is therefore an oligo set comprising or consisting or consisting essentially of a first antisense oligonucleotide and a second antisense oligonucleotide, said first and second antisense oligonucleotides being capable of hybridizing to a first nucleotide target sequence and a second nucleotide target sequence, respectively, on a pre-mature RNA transcript (pre-mRNA) from a human Granulin gene (GRN) carrying a null mutation, wherein said first nucleotide target sequence is located within a first exon or at a first ex on / intron junction or at a first intron / exon junction of the progranulin pre-mRNA, wherein said second nucleotide target sequence is located within a second exon or at a second exon / intron junction or at a second intron / exon junction of the progranulin pre- mRNA, said first and second nucleotide target sequences comprising a respective splicing consensus sequence, wherein:

[0024] (i) said first exon is exon 3 and said second exon is exon 4, and wherein either exon 3 and / or exon 4 carry the GRN null mutation;

[0025] (ii) said first exon is exon 5 and said second exon is exon 6, and wherein either exon 5 and / or exon 6 carry the GRN null mutation;

[0026] (iii) said first exon is exon 7 and said second exon is exon 8, and wherein either exon 7 and / or exon 8 carry the GRN null mutation;

[0027] (iv) said first exon is exon 9 and said second exon is exon 10, and wherein either exon 9 and / or exon 10 carry the GRN null mutation;

[0028] (v) said first exon is exon 10 and said second exon is exon 11, and wherein either exon 10 and / or exon 11 carry the GRN null mutation; or

[0029] (vi) said first exon is exon 11 and said second exon is exon 12, and wherein either exon 11 and / or exon 12 carry the GRN null mutation.

[0030] As used herein, the terms "antisense oligonucleotide", "antisense oligomer", "antisense oligo" or "antisense compound" are interchangeable and refer to a sequence of cyclic subunits, each bearing a base-pairing moiety, linked by intersubunit linkages that allow the base-pairing moieties to hybridize to a target sequence in a nucleic acid (typically an RNA) by Watson-Crick base pairing, to form a nucleic acid: oligonucleotide heteroduplex within the target sequence.

[0031] The term "null mutation" as used herein, refers to a nonsense mutation or a frameshift mutation that results in a lack of function for the gene harboring the mutation, such as e.g. the complete lack of production of the encoded gene product.

[0032] The term "exon skipping" as used herein, refers to the removal of certain exons from a RNA transcript during splicing. As well known in the art, splicing is the process during which introns are removed from pre-mRNA to produce mature mRNA.

[0033] In a first aspect, the present invention provides an oligo set comprising a first and a second antisense oligonucleotides able to induce skipping of one or more exons from a human progranulin pre-mRNA, preferably the skipping of an exon pair encoding for a granulin domain of the progranulin precursor, wherein either one or both exons may carry a null mutation.

[0034] Exemplary null mutations of the GRN gene that are amenable to exon skipping according to the present invention include, but are not limited, to c.709-l>A (n.a.), c.813-816del (exon 8; p.Thr272SerfsX10), c.833-834del (exon 8; p.Thr278SerfsX7), c.775A>T (exon 8; p.Lys259X), and C.1477OT (exon 12; p.Arg493X). The aforementioned mutations are numbered according to the sequence of the GRN cDNA as set forth in SEQ ID NO. 2.

[0035] In the present invention, the first nucleotide target sequence on the progranulin pre-mRNA with which the first antisense oligonucleotide of the oligo set hybridizes may be contained entirely within a first exon or located at a first exon / intron or intron / first exon junction. The second nucleotide target sequence on the progranulin pre-mRNA with which the second antisense oligonucleotide of the oligo set hybridizes may be contained entirely within a second exon or located at a second exon / intron or intron / second exon junction. Said first and second target sequences may comprise a mRNA splicing consensus sequence selected from a splice donor site, a splice acceptor site, an exonic splicing element, and / or a cryptic splice site. The target sequence may also include some flanking intronic sequences when the donor or acceptor splice sites are targeted.

[0036] Unless specified or apparent, the expression “splicing consensus sequence” may be understood to encompass either a sequence comprising or consisting of a splice donor site, i.e. a 5 '-splice site at the exon-intron border, a sequence comprising or consisting of a splice acceptor site, i.e. a 3 '-splice site at the intron-exon border, or a sequence comprising or consisting of a cryptic splice site (these are splice sites that may become activated when the natural splice site is blocked). As is known, cryptic splice sites are splice sites found in eukaryotic genomes within both introns and exons, which are not detectably used in wildtype pre-mRNA, but are only selected as a result of a mutation elsewhere in the gene, most often at the authentic splice site.

[0037] In a preferred embodiment, the first antisense oligonucleotide of the invention is capable of hybridizing to a first nucleotide target sequence located within exon 7 of a preprocessed progranulin mRNA and the second antisense oligonucleotide of the invention is capable of hybridizing to a second nucleotide target sequence located within exon 8 of a preprocessed progranulin mRNA, or at any of the boundaries between said exons and the corresponding flanking introns on the pre-mRNA. Preferably, the first and / or the second nucleotide target sequences according to the invention comprise, consist essentially or consist of a nucleotide sequence selected from SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15 and / or SEQ ID NO. 16.

[0038] More specifically, the nucleotide sequence set forth in SEQ ID NO. 13 is located at the junction of the 5’ end of exon 7 with the preceding flanking intron, the nucleotide sequence set forth in SEQ ID NO. 14 is located at the junction of the 3’ end of exon 7 with the subsequent flanking intron, the nucleotide sequence set forth in SEQ ID NO. 15 is located within exon 8, and the nucleotide sequence set forth in SEQ ID NO. 16 is located at the junction of the 3’ end of exon 8 with the subsequent flanking intron.

[0039] The antisense oligonucleotides of the oligo set according to the invention have a sufficient sequence complementarity to the respective nucleotide target sequences on the progranulin pre-mRNA to block such sequences in an effective manner. Such blocking of progranulin pre-mRNA serves to modulate splicing, either by masking a binding site for a native protein that would otherwise modulate splicing and / or by altering the structure of the targeted transcript.

[0040] In one embodiment, the first and / or second antisense oligonucleotides according to the invention may be 100% complementary to the respective nucleotide target sequences on the progranulin pre-mRNA. In another embodiment, the first and / or second antisense oligonucleotides according to the invention may include a number of mismatches, as long as the heteroduplexes formed between said oligonucleotides and said nucleotide target sequences are sufficiently stable to effect splice modulation. Preferably, an antisense oligonucleotide according to the invention has about or at least about 70% sequence complementarity, e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity, between the oligonucleotide and the respective nucleotide target sequence.

[0041] A preferred first and / or second antisense oligonucleotide according to the invention comprises or consists of or consists essentially of from 10 to 60 nucleotides, more preferred from 15 to 50 nucleotides, more preferred from 17 to 40 nucleotides, more preferred from 18 to 30 nucleotides. In a preferred embodiment, the first and / or second antisense oligonucleotide according to the invention comprises or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides.

[0042] According to the invention, the first and / or second antisense oligonucleotides in the oligo set according to the invention may comprise one or more nucleotide subunits that are modified to increase nuclease resistance, and / or to increase the affinity of said first and / or second antisense oligonucleotides for the respective nucleotide target sequences. Therefore, the first and / or second antisense oligonucleotide according to the invention may comprise at least one nucleotide analogue or equivalent, such as e.g. a nucleotide subunit having a modified base, and / or a modified backbone, and / or a non-natural internucleoside linkage, or a combination of these modifications.

[0043] In a preferred embodiment, the first and / or the second antisense oligonucleotides in the oligo set according to the invention are a phosphorodiamidate morpholino oligomer (PMO). As it is well known in the art, morpholino oligonucleotides have an uncharged backbone in which the deoxyribose sugar of DNA is replaced by a six membered ring and the phosphodiester linkage is replaced by a phosphorodiamidate linkage.

[0044] Also contemplated according to the invention are peptide nucleic acids (PNAs), locked nucleic acids (LNAs), and 2'-O-Methyl oligonucleotides.

[0045] Peptide Nucleic Acid (PNA)-based molecules (Nielsen, et al. (1991) Science 254, 1497- 1500) are true mimics of DNA molecules in terms of base-pair recognition. The backbone of the PNA is composed of N-(2-aminoethyl)-glycine units linked by peptide bonds, wherein the nucleobases are linked to the backbone by methylene carbonyl bonds. Since the backbone of a PNA molecule contains no charged phosphate groups, PNA-RNA hybrids are usually more stable than RNA-RNA or RNA-DNA hybrids, respectively (Egholm et al (1993) Nature 365, 566-568).

[0046] Locked nucleic acids (LNAs) are a class of nucleic acid analogues in which the 2'-carbon atom is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety.

[0047] The use of structural modifications of antisense oligonucleotides is well established and known to the person skilled in the art.

[0048] In one embodiment of the invention, the first nucleotide target sequence on the progranulin pre-mRNA is located within exon 3 or at one of the junction sites of said exon with corresponding flanking introns, and the second nucleotide target sequence is located within exon 4 or at one of the junction sites of said exon with corresponding flanking introns.

[0049] Preferably, at least one of exon 3 or exon 4 of the GRN gene carries a null mutation. According to this embodiment of the invention, the oligo set of the invention is particularly suitable for use in excluding at the same time both exons 3 and 4 from mutant progranulin pre-mRNA during mRNA processing in a cell so as to generate a translatable transcript lacking the coding sequence for granulin G.

[0050] In another embodiment of the invention, the first nucleotide target sequence on the progranulin pre-mRNA is located within exon 5 or at one of the junction sites of said exon with corresponding flanking introns, and the second nucleotide target sequence is located within exon 6 or at one of the junction sites of said exon with corresponding flanking introns.

[0051] Preferably, at least one of exon 5 or exon 6 of the GRN gene carries a null mutation. According to this embodiment of the invention, the oligo set of the invention is particularly suitable for use in excluding at the same time both exons 5 and 6 from mutant progranulin pre-mRNA during mRNA processing in a cell to generate a translatable transcript lacking the coding sequence for granulin F.

[0052] In a still another embodiment of the invention, the first nucleotide target sequence on the progranulin pre-mRNA is located within exon 7 or at one of the junction sites of said exon with corresponding flanking introns, and the second nucleotide target sequence is located within exon 8 or at one of the junction sites of said exon with corresponding flanking introns.

[0053] Preferably, at least one of exon 7 or exon 8 of the GRN gene carries a null mutation. In a more preferred embodiment, exon 8 carries a mutation selected from the group consisting of c.813-816del (p.Thr272SerfsX10), c.833-834del (p.Thr278SerfsX7), and c.775A>T (p.Lys259X), and any combinations thereof.

[0054] According to this embodiment of the invention, the oligo set of the invention is particularly suitable for use in excluding at the same time both exons 7 and 8 from mutant progranulin pre-mRNA during mRNA processing in a cell to generate a translatable transcript lacking the coding sequence for granulin B (as shown in Figure 4).

[0055] More preferably, the first antisense oligonucleotide in the oligo set according to the invention is directed to a target sequence on exon 7 on the progranulin pre-mRNA that comprises or consists of a nucleotide sequence selected from SEQ ID NO. 13 and SEQ ID NO. 14.

[0056] A preferred first antisense oligonucleotide according to this embodiment comprises or consists of or consist essentially of a nucleotide sequence selected from SEQ ID NO. 17 and SEQ ID NO. 18. Still more preferably, the second antisense oligonucleotide in the oligo set according to the invention is directed to a target sequence on exon 8 on the progranulin pre-mRNA that comprises or consists of a nucleotide sequence selected from SEQ ID NO. 15 and SEQ ID NO. 16.

[0057] A preferred second antisense oligonucleotide according to this embodiment comprises or consists of or consist essentially of a nucleotide sequence selected from SEQ ID NO. 19 and SEQ ID NO. 20.

[0058] Accordingly, a particularly preferred oligo set according to the invention comprises or consists of a first antisense oligonucleotide that comprises or consists of or consist essentially of a nucleotide sequence selected from SEQ ID NO. 17 and SEQ ID NO. 18, and / or a second antisense oligonucleotide that comprises or consists of or consist essentially of a nucleotide sequence selected from SEQ ID NO. 19 and SEQ ID NO. 20.

[0059] In a further embodiment of the invention, the first nucleotide target sequence on the progranulin pre-mRNA is located within exon 9 or at one of the junction sites of said exon with corresponding flanking introns, and the second nucleotide target sequence is located within exon 10 or at one of the junction sites of said exon with corresponding flanking introns.

[0060] Preferably, at least one of exon 9 or exon 10 of the GRN gene carries a null mutation. According to this embodiment of the invention, the oligo set of the invention is particularly suitable for use in excluding at the same time both exons 9 and 10 from mutant progranulin pre-mRNA during mRNA processing in a cell to generate a translatable transcript lacking the coding sequence for granulin A.

[0061] In a still further embodiment of the invention, the first nucleotide target sequence on the progranulin pre-mRNA is located within exon 10 or at one of the junction sites of said exon with corresponding flanking introns, and the second nucleotide target sequence is located within exon 11 or at one of the junction sites of said exon with corresponding flanking introns.

[0062] Preferably, at least one of exon 10 or exon 11 of the GRN gene carries a null mutation. According to this embodiment of the invention, the oligo set of the invention is particularly suitable for use in excluding at the same time both exons 10 and 11 from mutant progranulin pre-mRNA during mRNA processing in a cell to generate a translatable transcript lacking the coding sequence for granulin C.

[0063] In a yet further embodiment of the invention, the first nucleotide target sequence on the progranulin pre-mRNA is located within exon 11 or at one of the junction sites of said exon with corresponding flanking introns, and the second nucleotide target sequence is located within exon 12 or at one of the junction sites of said exon with corresponding flanking introns.

[0064] Preferably, at least one of exon 11 or exon 12 of the GRN gene carries a null mutation. In a preferred embodiment, exon 12 carries the C.1477OT (p.Arg493X) mutation.

[0065] According to this embodiment of the invention, the oligo set of the invention is particularly suitable for use in excluding at the same time both exons 11 and 12 from mutant progranulin pre-mRNA during mRNA processing in a cell to generate a translatable transcript lacking the coding sequence for granulin D.

[0066] Any of the oligo set as above defined may further comprise one or more additional antisense oligonucleotides suitable to induce exon skipping from the progranulin pre-mRNA.

[0067] According to one embodiment, the oligo set of the invention may comprise or consist of or consist essentially of:

[0068] (i) a first antisense oligonucleotide hybridizing on the progranulin pre-mRNA with a first nucleotide target sequence that is located at the junction of the 5’ end of exon 7 with the preceding flanking intron,

[0069] (ii) a second antisense oligonucleotide hybridizing on the progranulin pre-mRNA with a second nucleotide target sequence that is located within exon 8, and (iii) a third antisense oligonucleotide hybridizing on the progranulin pre-mRNA with a third nucleotide target sequence that is located at the junction of the 3’ end of said exon 8 with the subsequent flanking intron.

[0070] Preferably, the first antisense oligonucleotide is capable of hybridizing with a first target sequence comprising or consisting of the nucleotide sequence of SEQ ID NO. 13, the second antisense oligonucleotide is capable of hybridizing with a second target sequence comprising or consisting of the nucleotide sequence of SEQ ID NO. 15 and / or the third antisense oligonucleotide is capable of hybridizing with a third target sequence comprising or consisting of the nucleotide sequence of SEQ ID NO. 16.

[0071] A preferred oligo set according to the above-described embodiment comprises or consists of a first antisense oligonucleotides consisting of the nucleotide sequence of SEQ ID NO. 17, a second antisense oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 19 and a third antisense oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 20.

[0072] According to another embodiment, the oligo set of the invention may comprise or consist of:

[0073] (i) a first antisense oligonucleotide hybridizing on the progranulin pre-mRNA with a first nucleotide target sequence that is located at the junction of the 3’ end of exon 7 with the subsequent flanking intron,

[0074] (ii) a second antisense oligonucleotide hybridizing on the progranulin pre-mRNA with a second nucleotide target sequence that is located within exon 8, and (iii) a third antisense oligonucleotide hybridizing on the progranulin pre-mRNA with a third nucleotide target sequence that is located at the junction of the 3’ end of said exon 8 with the subsequent flanking intron.

[0075] Preferably, the first antisense oligonucleotide is capable of hybridizing with a first target sequence comprising or consisting of the nucleotide sequence of SEQ ID NO. 14, the second antisense oligonucleotide is capable of hybridizing with a second target sequence comprising or consisting of the nucleotide sequence of SEQ ID NO. 15 and / or the third antisense oligonucleotide is capable of hybridizing with a third target sequence comprising or consisting of the nucleotide sequence of SEQ ID NO. 16.

[0076] In this embodiment, a preferred oligo set comprises or consists of a first antisense oligonucleotides consisting of the nucleotide sequence of SEQ ID NO. 18, a second antisense oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 19 and a third antisense oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 20.

[0077] In the embodiments as above illustrated, the nucleotide target sequence within exon 8 preferably encompasses a cryptic splice site.

[0078] As aforesaid, the oligo set of the invention advantageously enable rescuing endogenous loss of expression of a null GRN allele by selectively targeting on the GRN pre-mRNA the exon harboring the null mutation in combination with the neighboring exon encoding for the remaining part of the same granulin peptide. Both targeted exons are then omitted from the mutated progranulin mRNA, leading to the conversion of an out-of-frame mRNA to an inframe mRNA, thereby restoring translation and the production of a functional progranulin precursor, albeit lacking one of the granulin domains. Since the effects of the antisense oligonucleotides are confined to the cell populations which express the GNR gene and to the specific progranulin pre-mRNA, the use of the oligo set of the invention is advantageously associated with absent or significantly reduced occurrence of off-target effects and toxicities. These features make the oligo set of the invention particularly suitable for use in therapy.

[0079] Thus, a yet further aspect of the invention is the oligo set as above defined, for use as a medicament.

[0080] Preferably, the oligo set according to the invention is suitable for the prevention and / or therapeutic treatment of FTD.

[0081] The present invention also provides a pharmaceutical composition comprising the oligo set as above defined, in combination with at least one pharmaceutically acceptable vehicle, excipient and / or diluent. The pharmaceutical composition for use according to the invention is suitable to be administered as a medicament to any mammals, including human beings, preferably as a therapy against a neurodegenerative disease as described above with reference to the antisense oligonucleotides.

[0082] The term "pharmaceutically acceptable" refers to compounds and compositions which may be administered to mammals without undue toxicity at concentrations consistent with effective activity of the active ingredient. Suitable pharmaceutically acceptable carriers (excipients) can be, for example, fillers, disintegrants, glidants and lubricants. Suitable diluents include but are not limited to sterile water, saline buffers, including Phosphate Buffered Saline (PBS). Lipid-based vectors have been used in nucleic acid therapies in a variety of methods. For example, in one embodiment, the antisense oligonucleotide is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In another embodiment, oligonucleotide complexes with mono- or polycationic lipids are formed without the presence of a neutral lipid.

[0083] The selection of the carrier, vehicle or diluent as well as of any other excipient required for the preparation of the desired pharmaceutical composition falls within the ability of the person skilled in the art.

[0084] The person skilled in the art is also able to identify the dose of antisense oligonucleotide required, which mainly depends on the condition to be treated and the patient's characteristics.

[0085] The pharmaceutical composition for use according to the invention can be formulated into any suitable dosage form, for example for administration via the topical, oral, enteral or parenteral route.

[0086] As used herein, parenteral administration includes, but is not limited to, administration of a pharmaceutical composition by subcutaneous, transdermal and intramuscular injection, implantation of sustained release depots, intravenous and intrathecal injection administration. In one embodiment, the pharmaceutical compositions according to the invention is administered directly to the cerebrospinal fluid, for example by means of intrathecal (IT), intracerebroventricular (ICV) or cisterna magna injection and / or infusion.

[0087] The present invention further provides an in vitro method for modulating splicing of the progranulin pre-mRNA, which comprises contacting said pre-mRNA with an oligo set as above defined.

[0088] Preferably, the progranulin pre-mRNA is contained within a cell cultured in vitro, more preferably a cell selected from the group consisting of neurons, astrocytes, microglia, endothelial cells, fibroblasts and induced pluripotent stem cells (iPSCs).

[0089] The oligo set of the present invention may be provided to target cells in vitro by any suitable means, including addition to culture medium. In one embodiment, the oligo set of the invention may be added to a in vitro culture of fibroblasts or iPSC derived neuronal cells obtained from a patient harboring a null mutation in the GRN gene, such as e.g c.709-l>A, c.813-816del, c.833-834del, c.775A>T and / or C.1477OT.

[0090] The following experimental section is provided purely by way of illustration and is not intended to limit the scope of the invention as defined in the appended claims. In the following experimental section reference is made to the appended drawings, wherein:

[0091] Figure l is a schematic representation of the human GRN gene. The arrows show the contribution of each exon to the protein sequence of each granulin;

[0092] Figure 2 is a schematic representation of the exon coding reading frame of the human GRN gene indicating representative mutations in exons 7, 8, and 12 of GRN gene (most representative mutations according to GENFI: Thr272fs (rs63749877; 201 individuals, 95 families); Arg493X (rs63751294; 55 individuals, 22 families); IVS7- I G^A (50 individuals, 18 families);

[0093] Figure 3 shows the target regions on progranulin pre-mRNA of antisense oligonucleotides (AONs) employed to skip exon 7 and 8 simultaneously: A- AON against the 3' splice site (3’ss) of exon 7 (AON of SEQ ID NO. 17); B-AON against the 5' splice site (5’ss) of exon 7 (AON of SEQ ID NO. 18); C- AON against a cryptic 5’ss sequence within exon 8 (AON of SEQ ID NO. 19); D- AON against the 5’ss of exon 8 (AON of SEQ ID NO. 20);

[0094] Figure 4 is a schematic representation of a progranulin precursor protein that contains a continuous open reading frame lacking only the granulin B sequence, compared to the wild-type protein;

[0095] Figure 5 shows the results of AON-mediated exon skipping using a minigene system (pTB) transfected in HeLa cells. Figure 5A, on the left, shows a schematic representation of the a-globin fibronectin GRN exons 7 and 8 minigene (black, shaded, and white boxes respectively, with intervening sequences (introns) shown as lines). Figure 5B, on the right, shows that AON treatment of the minigene pre-mRNA including exons 7 and 8 of the GRN gene (lane 1, 481bp) can induce the skipping of these exons from the mature RNA (appearance of a 244bp band). The skipping occurs when using both the 7 5’ss AON (SEQ ID NO. 18) (lane 2) and 7 3’ss AON (SEQ ID NO. 17) (lane 3). The Asc negative control oligo has no effect on exon 7 and 8 inclusion;

[0096] Figure 6 shows the results of AON-mediated exon skipping on the endogenous GRN pre-mRNA in HeLa cells. AON binding to said pre-mRNA, which contains exons 7 and 8 (giving a band of 516bp, lane 1) when amplified using a forward oligo on exon 5 and a reverse oligo on exon 9 induces skipping of exons 7 and 8 giving rise to an amplified band of 279bp, using both the 7 5’ss AON (SEQ ID NO. 18) (lane 2) and 7 3’ss AON (SEQ ID NO. 17) (lane 3). The Asc negative control oligo has no effect on exon 7 and 8 inclusion.

[0097] Declaration under Art 170 bis, paragraphs 2 and 4, of the Italian Industrial Property Code

[0098] The present invention has been attained in accordance with the provisions established by Article 170-bis, paragraphs 2 and 4 of the Italian Industrial Property Code.

[0099] EXAMPLES

[0100] To demonstrate the efficacy, safety and therapeutic potential of the antisense oligonucleotides of the invention, the present inventors carried out dedicated proof-of- principle studies using functional in vitro assays.

[0101] Example 1: Functional splicing assay using a minigene

[0102] In order to test the antisense oligonucleotides of the invention, the present inventors employed a minigene system (pTB) transfected in HeLa cells, which contained only exons 7 and 8 of the GRN pre-mRNA, cloned in the central intron (Baralle D, Baralle M. Splicing in action: assessing disease causing sequence changes. J Med Genet. 2005 42: 737-48). In these experiments, the combinations of oligos was as follows: set 1 A+C+D: oligos of SEQ ID NOs. 17, 19 and 20; set 2 B+C+D: oligos of SEQ ID NOs. 18, 19 and 20 (Figure 3). As control oligos, the inventors used the (ASc) Standard Control Oligo lOOnmol TOT available from Gene Tools LLC. As shown in Figure 5, both set of three oligos were able to achieve the skipping of exons 7 and 8. The way the experiment was performed was as follows: first, approximately 60,000 Hela cells were plated in a pl2 well using D-MEM as a culture medium. The medium was changed in the afternoon and 1ml fresh D-MEM was added to the cells. After this step, 5 pl of each selected AON (stock, ImM) was added to the medium for a final concentration of 5 pM / ml and cells were incubated overnight in incubator. In the second day, the cells were collected following trypsinization and centrifuged for 5 minutes at 10,000g. The pellets were resuspended in 350pL of RLT buffer (Qiagen) and mixed gently for 5 minutes. After transferring the lysate in a new tube, one volume of 70% Ethanol (350pL) was added to the lysate. The resulting 700pL of sample were transferred to a RNeasy Mini spin column (Qiagen) placed in a 2mL collection tube. The tube was then centrifuged 15 sec at 8,000g and the flow / through discarded. This step was followed by another washing step using 700pL of RW 1 buffer to the column (the sample was centrifuged for 15 sec at 8,000g and the flow through discarded. This was followed by washes using 500pL RPE buffer to the column that were removed by centrifuging 15 sec at 8,000g and the flow through was discarded. The column was then placed in a new 2mL collection tube and centrifuged 1 min at 15,000g to completely remove any buffer residue. The column was then placed in a 1.5 collection tube and 20pL of RNase free water were added. Finally, the column was centrifuge 1 min at 8,000g to elute the RNA and its concentration was measured using a BioPhotometer D30. From this RNA, cDNA was prepared according to standard protocols: 500 ng of RNA were reversely transcribed using random primers (Eurofins) and Moloney murine leukaemia virus reverse transcriptase (M-MLV, Invitrogen) according to manufacturer's instructions. To amplify the spliced and unspliced mRNA transcripts, for the pTB reporter plasmid RT-PCR was performed using the following primers and RT-PCR conditions: Bra2 (antisense): 5’TAGGATCCGGTCACCAGGAAGTTGGTTAAATCA-3’ (SEQ ID NO. 21) and alfa2-3 (sense) 5’-CAACTTCAAGCTCCTAAGCCACTGC-3’ (SEQ ID NO. 22) and PCR conditions were as follows: 1’ 95°C initial, (94°C 45” 60°C 1’ 72°C 45” 40 cycles), 72°C 10’ final. Finally, PCR products were separated by capillary electrophoresis (DNA screening cartridge, Qiaxcel) and splicing transitions were quantified using Qiaxcel software (QIAxcel ScreenGel (vl.4.0).

[0103] Example 2: Functional splicing assay on endogenous progranulin pre-mRNA in HeLa cells

[0104] To further validate the antisense oligonucleotides of the invention, the present inventors conducted dedicated experiments on the endogenous progranulin pre-mRNA in HeLa cells using the set of oligos as described in the paragraph above (Figure 3). These experiments showed that skipping of exons 7 and 8 can also be achieved in this functional assay, as reported in Figure 6. The protocol used for these experiments in terms of addition of AONs, RNA purification, and cDNA preparation follows the same steps used for the pTB plasmid described above. The only difference resides in the identity of the sense and antisense primers used in the RT-PCR reaction that are as follows: GRN exon 5 For 5’- CCATCCAGTGCCCTGATAGTC-3’ (SEQ ID NO. 23) and GRN exon 9 Rev 5’- TATAGCCATCTGGGCAGCTCACCTCCA -3’ (SEQ ID NO. 24).

Claims

CLAIMS1. An oligo set comprising a first antisense oligonucleotide and a second antisense oligonucleotide, said first and second antisense oligonucleotides being capable of hybridizing to a first nucleotide target sequence and a second nucleotide target sequence, respectively, on a pre-mature RNA transcript (pre-mRNA) from a human Granulin gene (GRN) carrying a null mutation, wherein said first nucleotide target sequence is located within a first exon or at a first exon / intron or intron / exon junction of the progranulin pre- mRNA, wherein said second nucleotide target sequence is located within a second exon or at a second exon / intron or intron / exon junction of the progranulin pre-mRNA, said first and second nucleotide target sequences comprising a respective splicing consensus sequence, wherein:(i) said first exon is exon 3 and said second exon is exon 4, and wherein either exon 3 and / or exon 4 carry the GRN null mutation;(ii) said first exon is exon 5 and said second exon is exon 6, and wherein either exon 5 and / or exon 6 carry the GRN null mutation;(iii) said first exon is exon 7 and said second exon is exon 8, and wherein either exon 7 and / or exon 8 carry the GRN null mutation;(iv) said first exon is exon 9 and said second exon is exon 10, and wherein either exon 9 and / or exon 10 carry the GRN null mutation;(v) said first exon is exon 10 and said second exon is exon 11, and wherein either exon 10 and / or exon 11 carry the GRN null mutation; or(vi) said first exon is exon 11 and said second exon is exon 12, and wherein either exon 11 and / or exon 12 carry the GRN null mutation.

2. The oligo set according to claim 1, wherein the null mutation in the human GRN gene is selected from the group consisting of c.709-l>A, c.813-816del, C.1477OT, c.833-834del, c.775A>T, and any combination thereof.

3. The oligo set according to claim 1 or 2, wherein the first and / or the second antisense oligonucleotides consist of a nucleotide sequence selected from the group consisting of SEQID NOs 17 - 20.

4. The oligo set according to any of claims 1 to 3, wherein the first and / or the second antisense oligonucleotides are a phosphorodiamidate morpholino oligomer (PMO), a Peptide Nucleic acid (PNA) or a Locked Nucleic Acid (LNA).

5. The oligo set according to any of claims 1 to 4, wherein the first and / or the second nucleotide target sequences on the progranulin pre-mRNA consist of a nucleotide sequence selected from the group consisting of SEQ ID NOs. 13 - 16.

6. A pharmaceutical composition comprising an oligo set according to any of claims 1 to 5, and at least a pharmaceutically acceptable vehicle, excipient and / or diluent.

7. The oligo set according to any of claims 1 to 5, or the pharmaceutical composition according to claim 6, for use as a medicament.

8. The oligo set or the pharmaceutical composition according to claim 7, for use in the prevention and / or therapeutic treatment of FTD.

9. The pharmaceutical composition according to any of claims 6 to 8, which is in a pharmaceutical form suitable for administration via the subcutaneous, intradermal, intravenous, intraarterial, intraperitoneal, intramuscular, intrathecal, or intraventricular route.

10. An in vitro method for modulating splicing of a progranulin pre-mRNA, comprising contacting said pre-mRNA with an oligo set according to any of claims 1 to 5.

11. The in vitro method according to claim 10, wherein the progranulin pre-mRNA is within a cell selected from the group consisting of neurons, astrocytes, microglia, endothelial cells, fibroblasts and induced pluripotent stem cells (iPSCs).

Images