Method for detecting biomarker by using cell-free transcription reaction

Abstract

The present invention relates to a method for detecting a biomarker by using a cell-free transcription reaction. The detection method according to the present invention can not only confirm the content of flap endonuclease 1 (FEN1) contained in a target tissue, but also evaluate the efficacy of an FEN1 inhibitor, and thus can be effectively used for diagnosis or treatment of cancer.

Description

Method for detecting biomarkers using cell-free transcription reaction

[0001] The present invention relates to a method for detecting biomarkers using cell-free transcription reactions. This invention was developed with support from the Defense Acquisition Program Administration's "Future Challenge Defense Technology Research and Development" project, titled "Development of Multi-Analysis Technology for Biological Agents through the Convergence of Cell-Free Synthetic Biology and Artificial Intelligence" (Project No. UI220005TD).

[0002] The detection of tumor biomarkers in bodily fluids represents a significant advancement in cancer treatment, as it enables diagnosis without invasive tissue biopsies. Nucleases have long been considered a potential biomarker class that can indicate cancer development and progression. For example, Flap Endonuclease 1 (FEN1) plays a crucial role in DNA replication and repair and is overexpressed in abnormally proliferating cells, such as cancer cells. Therefore, FEN1 is considered not only a target for cancer treatment but also a potential biomarker. In particular, it has been actively utilized for the diagnosis and prognosis of various types of cancer, including testicular, lung, breast, prostate, stomach, and brain cancers.

[0003] However, most of the analytical methods used for the diagnosis or treatment of cancer are Western blot or enzyme-linked immunosorbent assay (ELISA), and these methods have several limitations, such as long analysis time, low sensitivity, and high cost.

[0004] On the other hand, the unique enzymatic activity of FEN1, which cleaves branched nucleic acids (FLAPs), can be exploited to generate amplified detection signals, thereby addressing some of the limitations associated with conventional detection methods. For example, a method is known that uses a fluorophore-labeled FLAP sequence as a substrate for FEN1, where the fluorophore is quenched by adsorbing the FLAP-containing DNA structure to a graphene oxide surface. When the FLAP strand is cleaved by FEN1, the fluorophore escapes from the graphene oxide surface. This method enabled the detection of picomolar concentrations of FEN1 within 120 minutes. Another technique uses gold nanoparticles to quench the fluorophore turned on by FEN1-mediated cleavage. However, these methods are problematic because they involve complex processes such as chemical modification of the DNA, assembly of complex DNA structures, and formation of DNA-nanoparticle complexes.

[0005] Meanwhile, as a technology for detecting target substances using a transcription system, a technology for a high-sensitivity sensor based on a transcription system is disclosed in Korean Patent No. 2513569, and as for a technology related to Flap DNA, a method for determining a nucleic acid cleavage enzyme protein complex and preparing the same is disclosed in Korean Patent No. 1787817. However, a method for detecting a biomarker using the cell-free transcription reaction of the present invention has not yet been disclosed.

[0006] The present invention was derived from the above-mentioned needs, and the present invention provides a method for detecting a biomarker using a cell-free transcription reaction, and by confirming that the detection method according to the present invention can not only confirm the content of Flap Endonuclease 1 (FEN1) contained in a target tissue, but also evaluate the efficacy of a FEN1 inhibitor, the present invention was completed.

[0007] In order to achieve the above object, the present invention comprises the steps of (1) adding a substrate DNA in which the oligonucleotides of SEQ ID NOs: 1 and 2 complementarily bind to the oligonucleotide of SEQ ID NO: 3, but a flap sequence is additionally linked to the 5' end of the oligonucleotide of SEQ ID NO: 1; a sensor DNA including an antisense sequence complementary to the flap at the 3' end; and T7 RNA polymerase to a one-pot;

[0008] (2) A step of adding a lysate of tissue suspected of overexpressing Flap Endonuclease 1 (FEN1) to a container containing the substrate DNA, sensor DNA, and T7 RNA polymerase;

[0009] (3) After the above step (2), the temperature is adjusted to 30 to 37°C so that FEN1 contained in the tissue lysate cleaves the flap sequence to generate trigger DNA, and the generated trigger DNA binds to the 3' end of the sensor DNA so that the sensor DNA partially forms a double strand, and then T7 RNA polymerase recognizes the double strand and initiates a cell-free transcription reaction;

[0010] (4) After the above step (3), a step of maintaining the cell-free transcription reaction for 30 minutes to 3 hours to synthesize a light-up aptamer; and

[0011] (5) A method for detecting flap endonuclease 1 (FEN1) using a cell-free transcription reaction is provided, including a step of detecting the amount of the synthesized light-up aptamer by adding a fluorophore to the reaction vessel in which the light-up aptamer is generated after the above step (4).

[0012] In addition, the present invention comprises the steps of (1) adding a substrate DNA in which the oligonucleotides of SEQ ID NOs: 1 and 2 complementarily bind to the oligonucleotide of SEQ ID NO: 3, but a flap sequence is additionally linked to the 5' end of the oligonucleotide of SEQ ID NO: 1; a sensor DNA including an antisense sequence complementary to the flap at the 3' end; and T7 RNA polymerase to a one-pot;

[0013] (2) A step of adding a lysate of tissue suspected of overexpressing Flap Endonuclease 1 (FEN1) and a FEN1 inhibitor to a container containing the substrate DNA, sensor DNA, and T7 RNA polymerase;

[0014] (3) After the above step (2), the temperature is adjusted to 30 to 37°C so that FEN1 contained in the tissue lysate cleaves the flap sequence to generate trigger DNA, and the generated trigger DNA binds to the 3' end of the sensor DNA so that the sensor DNA partially forms a double strand, and then T7 RNA polymerase recognizes the double strand and initiates a cell-free transcription reaction;

[0015] (4) After the above step (3), a step of maintaining the cell-free transcription reaction for 30 minutes to 3 hours to synthesize a light-up aptamer; and

[0016] (5) A method for evaluating the efficacy of a FEN1 inhibitor is provided, including a step of detecting the amount of the synthesized light-up aptamer by adding a fluorophore to the reaction vessel in which the light-up aptamer is generated after the above step (4).

[0017] In addition, the present invention comprises the steps of (1) adding a substrate DNA in which the oligonucleotides of SEQ ID NOs: 1 and 2 complementarily bind to the oligonucleotide of SEQ ID NO: 3, but a flap sequence is additionally linked to the 5' end of the oligonucleotide of SEQ ID NO: 1; a sensor DNA including an antisense sequence complementary to the flap at the 3' end; and T7 RNA polymerase to a one-pot;

[0018] (2) A step of adding a lysate of tissue suspected of overexpressing Flap Endonuclease 1 (FEN1) and a candidate substance for FEN1 inhibition to a container containing the substrate DNA, sensor DNA, and T7 RNA polymerase;

[0019] (3) After the above step (2), the temperature is adjusted to 30 to 37°C so that FEN1 contained in the tissue lysate cleaves the flap sequence to generate trigger DNA, and the generated trigger DNA binds to the 3' end of the sensor DNA so that the sensor DNA partially forms a double strand, and then T7 RNA polymerase recognizes the double strand and initiates a cell-free transcription reaction;

[0020] (4) After the above step (3), a step of maintaining the cell-free transcription reaction for 30 minutes to 3 hours to synthesize a light-up aptamer; and

[0021] (5) A method for screening a FEN1 inhibitor is provided, comprising the step of detecting the amount of the synthesized light-up aptamer by adding a fluorophore to the reaction vessel in which the light-up aptamer is generated after the step (4).

[0022] The present invention relates to a method for detecting a biomarker using a cell-free transcription reaction. The detection method according to the present invention can not only confirm the content of Flap Endonuclease 1 (FEN1) contained in a target tissue, but also evaluate the efficacy of a FEN1 inhibitor.

[0023] Figure 1 shows the results of in vitro transcription from partially double-stranded template DNA. The antisense strand of DNA encoding the broccoli light-up aptamer was annealed to the sense strand of the T7 promoter under the T7 promoter, and the annealed DNA was incubated in an in vitro transcription reaction mixture at 37°C for 3 hours. The fluorescence values ​​from the broccoli aptamer (white bars) were compared with the fluorescence values ​​from the fully double-stranded template DNA (gray bars). Error bars represent the standard deviation of three independent experiments.

[0024] Figure 2 is a schematic diagram illustrating the detection process of FEN1, which combines the enzymatic activity of FEN1 and the in vitro transcription of a broccoli RNA aptamer. The endonucleolytic activity of FEN1 releases trigger DNA, which is then cleaved by FEN1 and released, binding to the T7 promoter region of a single-stranded sensor DNA, initiating transcription of the broccoli aptamer encoded in the sensor DNA.

[0025] Figure 3 shows the results of native polyacrylamide gel electrophoresis (PAGE) analysis of in vitro transcription reactions by T7 RNA polymerase after binding of the released trigger DNA and sensor DNA cleaved by FEN1. Lane M, DNA molecular weight marker; Lane 1, ON1; Lane 2, ON2; Lane 3, ON3; Lane 4, substrate DNA (ON1 + ON2 + ON3); Lane 5, sensor DNA; Lane 6, substrate DNA after incubation with FEN1; Lane 7, chemically synthesized trigger DNA (flap sequence); Lane 8, aptamer resulting from in vitro transcription reactions using a mixture of sensor DNA (lane 5) and FEN1-incubated substrate DNA (lane 6); Lane 9, broccoli aptamer purified from in vitro transcription reactions using a fully double-stranded DNA template.

[0026] Figure 4 shows the results of confirming flap cleavage and in vitro transcription of substrate DNA. (A) Results of FEN1-mediated flap cleavage reaction and in vitro transcription performed in a two-step reaction. The trigger DNA obtained from the FEN1-mediated flap cleavage reaction (step 1) was added to the in vitro transcription reaction, and the transcription reaction by T7 RNA polymerase (step 2) was performed. (B) Results of performing the FEN1-mediated flap cleavage reaction and in vitro transcription reaction combined in a single vessel by adjusting the buffer conditions required for the reaction. Error bars represent the standard deviation for three independent experiments.

[0027] Figure 5 shows the results of combining FEN1-mediated flap cleavage and in vitro transcription in a single vessel. (A) shows the fluorescence intensity according to the concentration of FEN1 from 0.1 to 100 nM, and the result of the transcription reaction for 1 hour (gray bar), and the white bar represents the fluorescence value for the buffer in which no transcription reaction occurred. (B) shows the fluorescence intensity after performing the combined FEN1-mediated flap cleavage and in vitro transcription reaction in a single vessel for 30 minutes to 3 hours. The error bars represent the standard deviation of three independent experiments.

[0028] Figure 6 shows the results of optimization of substrate DNA for FEN1 detection. (A) The effect of changing the length of the trigger DNA was confirmed by adjusting the length of the flap sequence that is cleaved from the substrate DNA by FEN1 from 20 nucleotides to 9 nucleotides. Gray bars represent signals obtained with different concentrations of FEN1, while empty bars represent background signals in the absence of FEN1. (B) Results of various concentrations of FEN1 using a 12-nucleotide trigger DNA. (C) Results of analysis for different types of endo- and exonucleases. Fluorescence change values ​​represent the fluorescence change divided by the background value obtained by subtracting the background signal in the absence of FEN1 from each fluorescence signal. Error bars represent the standard deviation for three independent experiments.

[0029] Figure 7 shows the results of confirming improved detection sensitivity using a malachite green light-up aptamer.

[0030] Figure 8 shows the results of confirming FEN1 detection in cancer cells using cancer cell lines known to overexpress FEN1 (MCF7, HepG2, HeLA, and A549). Heat-inactivated MCF7 cell lysate was used as a negative control. FEN1 detection was performed in the absence (white bars) or presence (gray bars) of substrate DNA. Error bars represent the standard deviation of three independent experiments.

[0031] Figure 9 shows the results of confirming the effect on FEN1 inhibitor. (A) The result of confirming FEN1 activity inhibition after pre-incubation for 1 hour at 37℃ under conditions including 100 nM purified human FEN1 and 100 nM FEN1 inhibitor, which is the same concentration as FEN1, and (B) The result of confirming the change in FEN1 activity after incubation by mixing and co-incubating a cell line lysate overexpressing FEN1 and 100 nM ATA (Aurintricarboxylic acid). Compared to the control reaction performed in the absence of ATA (white bar), the ATA-treated cancer cell lysate showed significantly reduced FEN1 activity (gray bar). Error bars represent the standard deviation for three independent experiments.

[0032] The present invention comprises the steps of (1) adding to a one-pot substrate DNA in which the oligonucleotides of SEQ ID NOs: 1 and 2 complementarily bind to the oligonucleotide of SEQ ID NO: 3, but a flap sequence is additionally linked to the 5' end of the oligonucleotide of SEQ ID NO: 1; a sensor DNA including an antisense sequence complementary to the flap at the 3' end; and T7 RNA polymerase;

[0033] (2) A step of adding a lysate of tissue suspected of overexpressing Flap Endonuclease 1 (FEN1) to a container containing the substrate DNA, sensor DNA, and T7 RNA polymerase;

[0034] (3) After the above step (2), the temperature is adjusted to 30 to 37°C so that FEN1 contained in the tissue lysate cleaves the flap sequence to generate trigger DNA, and the generated trigger DNA binds to the 3' end of the sensor DNA so that the sensor DNA partially forms a double strand, and then T7 RNA polymerase recognizes the double strand and initiates a cell-free transcription reaction;

[0035] (4) After the above step (3), a step of maintaining the cell-free transcription reaction for 30 minutes to 3 hours to synthesize a light-up aptamer; and

[0036] (5) A method for detecting flap endonuclease 1 (FEN1) using a cell-free transcription reaction, comprising: after the above step (4), adding a fluorophore to the reaction vessel in which the light-up aptamer is generated, and detecting the amount of the synthesized light-up aptamer.

[0037] The sensor DNA is preferably a DNA transcribed into any one light-up aptamer selected from among broccoli aptamer, malachite green aptamer, spinach2 aptamer, baby spinach aptamer, mbaby spinach aptamer, mango aptamer, BFR (Blue Fluorescent RNA) aptamer and sulforhodamine B aptamer; more preferably, the broccoli aptamer is a broccoli aptamer transcribed from the base sequence of SEQ ID NO: 5, and the malachite green aptamer is a malachite green aptamer transcribed from the base sequence of SEQ ID NO: 6, but is not limited thereto.

[0038] The above fluorophore is preferably one selected from among DFHBI (3,5-difluoro-4-hydroxybenzylidene imidazolinone), DFHBI-1T, thiazole orange T01, thiazole orange T03, sulforhodamine B, and hoechst, but is not limited thereto.

[0039] The tissue suspected of overexpressing the above Flap Endonuclease 1 (FEN1) may be a cancer tissue, and the cancer is preferably, but not limited to, lung cancer, breast cancer, liver cancer, cervical cancer, testicular cancer, prostate cancer, stomach cancer, or brain cancer.

[0040] The length of the trigger DNA generated in the above step (3) is preferably 12 to 20 bases, more preferably 12 bases, but is not limited thereto.

[0041] In addition, the present invention comprises the steps of (1) adding a substrate DNA in which the oligonucleotides of SEQ ID NOs: 1 and 2 complementarily bind to the oligonucleotide of SEQ ID NO: 3, but a flap sequence is additionally linked to the 5' end of the oligonucleotide of SEQ ID NO: 1; a sensor DNA including an antisense sequence complementary to the flap at the 3' end; and T7 RNA polymerase to a one-pot;

[0042] (2) A step of adding a lysate of tissue suspected of overexpressing Flap Endonuclease 1 (FEN1) and a FEN1 inhibitor to a container containing the substrate DNA, sensor DNA, and T7 RNA polymerase;

[0043] (3) After the above step (2), the temperature is adjusted to 30 to 37°C so that FEN1 contained in the tissue lysate cleaves the flap sequence to generate trigger DNA, and the generated trigger DNA binds to the 3' end of the sensor DNA so that the sensor DNA partially forms a double strand, and then T7 RNA polymerase recognizes the double strand and initiates a cell-free transcription reaction;

[0044] (4) After the above step (3), a step of maintaining the cell-free transcription reaction for 30 minutes to 3 hours to synthesize a light-up aptamer; and

[0045] (5) A method for evaluating the efficacy of a FEN1 inhibitor, comprising the step of adding a fluorophore to the reaction vessel in which the light-up aptamer is generated after the above step (4) and detecting the amount of the synthesized light-up aptamer.

[0046] The method for evaluating the efficacy of the above FEN1 inhibitor is to compare the amount of light-up aptamer synthesized when the FEN1 inhibitor is added and when it is not added in step (2), and the lower the amount of light-up aptamer synthesized when the FEN1 inhibitor is added compared to when it is not added, the higher the efficacy of the FEN1 inhibitor can be evaluated.

[0047] The above FEN1 inhibitor is preferably one selected from among ATA (Aurintricarboxylic acid), FEN1-IN-1 (1-[(2,3-Dihydro-1,4-benzodioxin-2-yl)methyl]-3-hydroxythieno[3,2-d]pyrimidine-2,4(1H,3H)-dione), FEN1-IN-4 (1-(Cyclopropylmethyl)-3-hydroxyquinazoline-2,4(1H,3H)-dione), and NSC-13755 (2-Nitro-4-stibonobenzoic acid), but is not limited thereto.

[0048] In the present invention, 'detection' means confirming the presence or absence of a target substance, including quantitative or semi-quantitative determination of the target substance.

[0049] The detection sensitivity of the target material of the present invention can be expressed by the LOD (limit of detection) value, which means the minimum target material concentration that can detect and distinguish between the presence and absence of the target material.

[0050] In addition, the present invention comprises the steps of (1) adding a substrate DNA in which the oligonucleotides of SEQ ID NOs: 1 and 2 complementarily bind to the oligonucleotide of SEQ ID NO: 3, but a flap sequence is additionally linked to the 5' end of the oligonucleotide of SEQ ID NO: 1; a sensor DNA including an antisense sequence complementary to the flap at the 3' end; and T7 RNA polymerase to a one-pot;

[0051] (2) A step of adding a lysate of tissue suspected of overexpressing Flap Endonuclease 1 (FEN1) and a candidate substance for FEN1 inhibition to a container containing the substrate DNA, sensor DNA, and T7 RNA polymerase;

[0052] (3) After the above step (2), the temperature is adjusted to 30 to 37°C so that FEN1 contained in the tissue lysate cleaves the flap sequence to generate trigger DNA, and the generated trigger DNA binds to the 3' end of the sensor DNA so that the sensor DNA partially forms a double strand, and then T7 RNA polymerase recognizes the double strand and initiates a cell-free transcription reaction;

[0053] (4) After the above step (3), a step of maintaining the cell-free transcription reaction for 30 minutes to 3 hours to synthesize a light-up aptamer; and

[0054] (5) A method for screening a FEN1 inhibitor, comprising the step of adding a fluorophore to the reaction vessel in which the light-up aptamer is generated after the step (4) and detecting the amount of the synthesized light-up aptamer.

[0055] The method for screening the above FEN1 inhibitor is to compare the amount of light-up aptamer synthesized in the case where the FEN1 inhibitory candidate is added and in the case where the FEN1 inhibitory candidate is not added in step (2), and if the amount of light-up aptamer synthesized in the case where the FEN1 inhibitory candidate is added is less than in the case where the FEN1 inhibitory candidate is not added, it can be determined to be a FEN1 inhibitor.

[0056]

[0057] Hereinafter, the present invention will be described in more detail using examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

[0058]

[0059] [Materials and Methods]

[0060] 1. Materials

[0061] T7 RNA polymerase, ribonucleoside triphosphates, RNase inhibitor, and 10× FEN1 reaction buffer were purchased from Engenomics (Daejeon, Korea). Oligonucleotides were synthesized by Macrogen (Daejeon, Korea). MCF-7, HepG2, and A549 cell lines were purchased from the Korean Cell Line Bank (Seoul, Korea). Recombinant human FEN1 was purchased from Abcam (Cambridge, UK). Trypsin-EDTA solution, antibiotic solution (100× antibiotic-antimycotic solution), Dulbecco's Modified Eagle's Medium (DMEM), and fetal bovine serum (FBS) were purchased from Thermo Fisher Scientific (Waltham, MA, USA). 3,5-Difluoro-4-hydroxybenzylidene imidazolinone (DFHBI-1T) was purchased from Tocris Biosciences (Bristol, UK). 1-[(2,3-Dihydro-1,4-benzodioxin-2-yl)methyl]-3-hydroxythieno[3,2-d]pyrimidine-2,4(1H,3H)-dione (FEN1-IN-1) was purchased from Axon Medchem (Groningen, The Netherlands). 1-(Cyclopropylmethyl)-3-hydroxyquinazoline-2,4(1H,3H)-dione (FEN1-IN-4) was purchased from Cellecchem (Houston, TX, USA). 2-Nitro-4-stibonobenzoic acid (NSC-13755) was purchased from AOBIUS (Gloucester, MA, USA). All other reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA).

[0062]

[0063] 2. Detection of FEN1 activity by in vitro transcription

[0064] Assay samples containing FEN1 were added to 20 μl of a reaction mixture consisting of 40 mM Tris-HCl (pH 7.9); 10 mM MgCl2; 10 mM dithiothreitol; 2 mM spermidine; 100 U T7 RNA polymerase; 16 U RNase inhibitor; 1 mM each of ATP, GTP, CTP, and UTP; 250 nM substrate DNA; and 100 nM sensor DNA. After incubation at 37°C for 1 h, 80 μl of a solution containing 40 mM Tris-HCl (pH 7.0), 5 mM MgCl2, 125 mM KCl, and 10 μM DFHBI-1T was added to the reaction mixture. Afterwards, incubate at 37°C for 5 minutes and CLARIOstar(λ 흡수 , 472 nm; λ 방출 , 507 nm) was used to measure the fluorescence of the mixture.

[0065]

[0066] 3. Measurement of FEN1 activity in cancer cell lysates

[0067] Human cervical cancer cell line HeLa, breast cancer cell line MCF-7, lung cancer cell line A549, and liver cancer cell line HepG2 were cultured in 90-mm cell culture dishes (SPL Life Science, Pocheon, Korea) containing DMEM supplemented with 10% FBS and antibiotic-antimycotic solution (1× antibiotic-antimycotic solution). 1×10 5 After seeding each cell in the medium at a density of cells / mL, they were cultured at 37°C and 5% CO2. To prepare cell lysate, 7 × 10 harvested cells were added to 2 mL of pre-chilled Dulbecco's phosphate-buffered saline. 6The cells were resuspended at a density of 10 cells / mL and disrupted by sonication on ice. The supernatant was then collected by centrifugation at 12,300 × g for 10 min. The total protein amount of the recovered lysate was determined using the Bradford protein assay.

[0068]

[0069] 4. Analysis of FEN1 inhibitors

[0070] The above in vitro transcription analysis assays were performed in the presence of Aurintricarboxylic acid (ATA), FEN1-IN-1 (1-[(2,3-Dihydro-1,4-benzodioxin-2-yl)methyl]-3-hydroxythieno[3,2-d]pyrimidine-2,4(1H,3H)-dione), FEN1-IN-4 (1-(Cyclopropylmethyl)-3-hydroxyquinazoline-2,4(1H,3H)-dione), and NSC-13755 (2-Nitro-4-stibonobenzoic acid), which have been reported to inhibit human FEN1. Each FEN1 inhibitor was pre-incubated with FEN1 for 30 min at 37°C, and FEN1 activity was measured.

[0071]

[0072] Example 1. Oligonucleotide-induced in vitro transcription as a signal generation module.

[0073] In this Example 1, protein synthesis was confirmed using a DNA molecule forming a partial double strand in the T7 promoter region as a template for in vitro transcription mediated by T7 RNA polymerase.

[0074] As a result, the broccoli light-up RNA aptamer sequence encoded by single-stranded DNA was transcribed by T7 RNA polymerase by annealing complementary oligonucleotides and the T7 promoter region, which produced an equivalent amount of broccoli aptamer as when DNA having a double-stranded structure was used as a template (Fig. 1).

[0075] These results suggest that short oligonucleotides can be used as effective switch molecules to turn on transcription reactions in vitro.

[0076]

[0077] Example 2. Confirmation of FEN1 detection using cleaved flap strands of probe DNA.

[0078] A DNA construct (hereinafter referred to as "substrate DNA") was prepared to generate the sense strand of the T7 promoter in response to FEN1 activity. As shown in Fig. 2, the substrate DNA was prepared using three types of annealing synthetic oligonucleotides (ON1, ON2, and ON3) designed to form a double-flap structure during structural assembly, and the respective DNA sequences used in the present invention are disclosed in Table 1.

[0079] DNA sequence used in the present invention Gene sequence (5'->3') Sequence number Substrate DNA ON1-flapATGGCTTTTAA1 ON2CGGGATCCCAATAAGCCG2 ON3TTAAAAGCCATCGGCTTATTGGGATCCCG3 Trigger DNA TAATACGACTCACTATAGGG4 Sensor DNA Broccoli Aptamer GAGCCACACTCTACTCGACAGATACGAATATCTGGACCCGACCGTCTCCCCTATAGTGAGTCGTATTA5 Malachite Green Aptamer GGATCCATTCGTTACCTGGCTCTCGCCAGTCGGGATCCTATAGTGAGTCGTATTA6

[0080] - Flap sequence: TAATACGACTCACTATAGGG (SEQ ID NO: 4) - ON1 sequence: Flap sequence + SEQ ID NO: 1

[0081]

[0082] Before conducting quantitative experiments using the designed experimental device, gel electrophoresis analysis was performed to stepwise confirm the reaction shown in Fig. 2.

[0083] As a result, as disclosed in FIG. 3, the bands identified in lanes 1, 2, and 3 were oligonucleotides ON1, ON2, and ON3, respectively, and matched the predicted sizes. The 'substrate DNA' generated by the annealing process involving ON1, ON2, and ON3 was detected in lane 4. The visualization of the single-stranded sensor DNA (the antisense strand of the DNA encoding the broccoli aptamer with the T7 promoter) was confirmed in lane 5. When the substrate DNA was incubated with FEN1, two distinct bands were identified in lane 6. The size of the smaller band identified in lane 6 matched the chemically generated flap sequence, i.e., the sense strand of the T7 promoter, as shown in lane 7. This indicates that FEN1 effectively removed (released) the flap sequence DNA (trigger DNA) from the substrate DNA, as disclosed in FIG. 2.

[0084] After incubating substrate DNA with recombinant human FEN1, the resulting mixture was transferred to an in vitro transcription reaction vessel containing sensor DNA to perform transcription. As a result, RNA products were confirmed to accumulate in lane 8. Notably, these RNA products were identical in size to the broccoli aptamers generated independently from double-stranded DNA, as confirmed by their presence in lane 9. When the broccoli aptamers were supplied with DFHBI-1T and their fluorescence was measured, it was confirmed that the amount of FEN1 used in the initial reaction was proportional to the amount of FEN1 used (Fig. 4A). These results indicate that flap cleavage activity can be used to detect FEN1 by generating a trigger that initiates in vitro transcription of the fluorescent RNA aptamer.

[0085] These initial experiments were conducted in two steps: generation of trigger DNA (a cleaved flap sequence encoding the sensor strand of the T7 promoter) by FEN1 (Step 1); and in vitro transcription by T7 RNA polymerase using the partially double-stranded sensor DNA, in which the cleaved trigger DNA was ligated to the single-stranded sensor DNA (Step 2). The analysis (testing) of this two-step setup took more than 4 hours to complete.

[0086] The present invention confirmed that the salt conditions for in vitro transcription were compatible with those for flap cleavage, allowing for testing in a simple, single-pot reaction (Fig. 5A). The single-pot reaction not only enhanced the convenience of the assay but also significantly reduced the time required to obtain the maximum fluorescence signal (Fig. 5B). This time reduction may be due to the increased availability of trigger DNA generated by FEN1. Nevertheless, the detection sensitivity of FEN1 was unsatisfactory, and when the assay was performed in a two-step or single-pot reaction, FEN1 could not be detected at concentrations below 10 nM (Fig. 4).

[0087]

[0088] Example 3. Optimization of substrate DNA sequence to improve detection sensitivity.

[0089] In substrate DNA, the FEN1 detectability was confirmed by controlling the number of ON1 flap sequences. Specifically, the FEN1 detectability was confirmed by decreasing the number of nucleotides from the 3' end of the flap sequence (5'-TAATACGACTCACTATAGGG-3') by 1 nucleotide. As a result, when the ON1 flap sequence (20 nucleotides) was gradually reduced from the 3' end in the substrate DNA, there was an optimal length that provided lower background and higher signal, as shown in Figure 6A. For example, due to the reduced background and improved signal intensity, the analysis using ON1 containing 12 nucleotides increased the signal-to-background ratio from 2.1 to 18.3.

[0090] As a result, 0.1 nM FEN1 could be detected (Fig. 6B). The detection sensitivity could be further improved by replacing the sensor DNA with a sensor DNA encoding a malachite green light-up RNA aptamer, and fluorescence analysis was performed for different types of endo- and exonucleases other than the FEN1 enzyme. When endo- and exonucleases other than FEN1 were used, no fluorescence was detected (Fig. 6C). In the experiment using the sensor DNA encoding the malachite green aptamer, the estimated limit of detection (LOD) for FEN1 was approximately 40 pM (Fig. 7).

[0091] Furthermore, we confirmed that the method of the present invention can detect FEN1 in biological matrices. A series of cancer cell lines known to overexpress FEN1 were lysed by sonication, and FEN1 activity was tested in the cell lysates. The tested cell lysates exhibited varying levels of FEN1 activity (Figure 8). Heat-treated cell lysates did not produce broccoli fluorescence, indicating that the signal was generated by biologically active FEN1.

[0092]

[0093] Example 4. Confirmation of the possibility of evaluating the activity of FEN1 inhibitors.

[0094] The applicability of the method of the present invention to the evaluation of FEN1 inhibitors was verified. Using the method of the present invention, the inhibitory effects of four FEN1 inhibitors (ATA, FEN1-IN-1, FEN1-IN-4, and NSC-13755) on FEN1 activity were confirmed. The tested inhibitors reduced the assay signal (Fig. 9A).

[0095] Furthermore, when FEN1 detection was performed after pre-incubation with biological samples and inhibitors, the signal was reduced to the same level as the negative control (Fig. 9B). These results indicate that the transcription-based FEN1 detection method can be expanded to screen and evaluate novel FEN1 inhibitors.

Claims

1. (1) A step of adding substrate DNA, wherein the oligonucleotides of sequence numbers 1 and 2 complementarily bind to the oligonucleotide of sequence number 3, and a flap sequence is additionally linked to the 5' end of the oligonucleotide of sequence number 1; sensor DNA, which includes an antisense sequence complementary to the flap at the 3' end; and T7 RNA polymerase to a one-pot; (2) a step of adding a lysate of a tissue suspected of overexpressing Flap Endonuclease 1 (FEN1) to a container containing the substrate DNA, sensor DNA, and T7 RNA polymerase; (3) After the above step (2), the temperature is adjusted to 30 to 37°C so that FEN1 contained in the tissue homogenate cleaves the flap sequence to generate trigger DNA, and the generated trigger DNA binds to the 3' end of the sensor DNA so that the sensor DNA partially forms a double strand, and then T7 RNA polymerase recognizes the double strand and initiates a cell-free transcription reaction; (4) After the above step (3), a step of maintaining the cell-free transcription reaction for 30 minutes to 3 hours to synthesize a light-up aptamer; and (5) A method for detecting flap endonuclease 1 (FEN1) using a cell-free transcription reaction, comprising: a step of detecting the amount of the synthesized light-up aptamer by adding a fluorophore to the reaction vessel in which the light-up aptamer is generated after the step (4); 2. A method for detecting flap endonuclease 1 (FEN1) using a cell-free transcription reaction, characterized in that the sensor DNA in the first paragraph is DNA transcribed by any one light-up aptamer selected from among broccoli aptamer, malachite green aptamer, spinach2 aptamer, baby spinach aptamer, mbaby spinach aptamer, mango aptamer, BFR (Blue Fluorescent RNA) aptamer, and sulforhodamine B aptamer.

3. A method for detecting flap endonuclease 1 (FEN1) using a cell-free transcription reaction, characterized in that in the second paragraph, the broccoli aptamer is a broccoli aptamer transcribed from the base sequence of sequence number 5, and the malachite green aptamer is a malachite green aptamer transcribed from the base sequence of sequence number 6.

4. A method for detecting flap endonuclease 1 (FEN1) using a cell-free transcription reaction, characterized in that in paragraph 1, the fluorophore is any one selected from DFHBI (3,5-difluoro-4-hydroxybenzylidene imidazolinone), DFHBI-1T, thiazole orange T01, thiazole orange T03, sulforhodamine B, and hoechst.

5. A method for detecting Flap Endonuclease 1 (FEN1) using a cell-free transcription reaction, characterized in that the tissue suspected of overexpressing the Flap Endonuclease 1 (FEN1) in paragraph 1 is cancer tissue.

6. A method for detecting flap endonuclease 1 (FEN1) using a cell-free transcription reaction, characterized in that the cancer in paragraph 5 is lung cancer, breast cancer, liver cancer, cervical cancer, testicular cancer, prostate cancer, stomach cancer, or brain cancer.

7. A method for detecting flap endonuclease 1 (FEN1) using a cell-free transcription reaction, characterized in that the trigger DNA generated in step (3) in the first paragraph has a length of 12 to 20 bases. 8.(1) A step of adding a substrate DNA in which the oligonucleotides of sequence numbers 1 and 2 complementarily bind to the oligonucleotide of sequence number 3, but a flap sequence is additionally linked to the 5' end of the oligonucleotide of sequence number 1; a sensor DNA including an antisense sequence complementary to the flap at the 3' end; and T7 RNA polymerase to a one-pot; (2) a step of adding a lysate of tissue suspected of overexpressing Flap Endonuclease 1 (FEN1) and a FEN1 inhibitor to a container containing the substrate DNA, sensor DNA, and T7 RNA polymerase; (3) After the above step (2), the temperature is adjusted to 30 to 37°C so that FEN1 contained in the tissue homogenate cleaves the flap sequence to generate trigger DNA, and the generated trigger DNA binds to the 3' end of the sensor DNA so that the sensor DNA partially forms a double strand, and then T7 RNA polymerase recognizes the double strand and initiates a cell-free transcription reaction; (4) After the above step (3), a step of maintaining the cell-free transcription reaction for 30 minutes to 3 hours to synthesize a light-up aptamer; and (5) A method for evaluating the efficacy of a FEN1 inhibitor, comprising: after the step (4), adding a fluorophore to the reaction vessel in which the light-up aptamer is generated, and detecting the amount of the synthesized light-up aptamer.

9. A method for evaluating the efficacy of a FEN1 inhibitor, characterized in that the FEN1 inhibitor in claim 8 is any one selected from ATA (Aurintricarboxylic acid), FEN1-IN-1 (1-[(2,3-Dihydro-1,4-benzodioxin-2-yl)methyl]-3-hydroxythieno[3,2-d]pyrimidine-2,4(1H,3H)-dione), FEN1-IN-4 (1-(Cyclopropylmethyl)-3-hydroxyquinazoline-2,4(1H,3H)-dione), and NSC-13755 (2-Nitro-4-stibonobenzoic acid). 10.(1) A step of adding a substrate DNA in which the oligonucleotides of sequence numbers 1 and 2 complementarily bind to the oligonucleotide of sequence number 3, but a flap sequence is additionally linked to the 5' end of the oligonucleotide of sequence number 1; a sensor DNA including an antisense sequence complementary to the flap at the 3' end; and T7 RNA polymerase to a one-pot; (2) a step of adding a lysate of a tissue suspected of overexpressing Flap Endonuclease 1 (FEN1) and a candidate substance for FEN1 inhibition to a container containing the substrate DNA, sensor DNA, and T7 RNA polymerase; (3) After the above step (2), the temperature is adjusted to 30 to 37°C so that FEN1 contained in the tissue homogenate cleaves the flap sequence to generate trigger DNA, and the generated trigger DNA binds to the 3' end of the sensor DNA so that the sensor DNA partially forms a double strand, and then T7 RNA polymerase recognizes the double strand and initiates a cell-free transcription reaction; (4) After the above step (3), a step of maintaining the cell-free transcription reaction for 30 minutes to 3 hours to synthesize a light-up aptamer; and (5) A method for screening a FEN1 inhibitor, comprising: a step of detecting the amount of the synthesized light-up aptamer by adding a fluorophore to the reaction vessel in which the light-up aptamer is generated after the step (4);

Images