Methods and compositions for treating cancers with high microsatellite instability levels

Abstract

The present disclosure relates to methods and compositions for the treatment of cancers, e.g., cancers comprising MSI-H cells, by targeting WRN for degradation (in the presence or absence of a WRN inhibitor); facilitating WRN association with chromatin (in the presence or absence of a WRN inhibitor); and / or facilitating WRN localization from the nucleolus to nuclear foci on chromatin.

Description

[0001] METHODS AND COMPOSITIONS FOR TREATING CANCERS WITH HIGH MICROSATELLITE INSTABILITY LEVELS

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit, under 35 U.S.C. § 119(e), of U.S. Provisional Patent Application No. 63 / 599,976, filed November 16, 2023, the contents of which are incorporated by reference in their entireties, and to which priority is claimed.

[0004] BACKGROUND OF THE INVENTION

[0005] The Werner (WRN) syndrome RecQ helicase has been identified as a novel synthetic lethal target for the treatment of cancers with high microsatellite instability levels (MSI-H) that are deficient in mismatch repair (dMMR) mechanisms. Microsatellite stable (MSS) cells have two DNA repair mechanisms: (1) mismatch repair (MMR) machinery; and (2) WRN to ensure genetic integrity. In MSS cells, disruption to either MMR or WRN does not lead to cell death. In MSI-high cells, however, dMMR processes are compromised, resulting in a synthetic lethal dependency on WRN. Thus, the inhibition of WRN in MSI-H cells results in cell death.

[0006] The mechanisms that regulate WRN spatiotemporal dynamics in cells, however, remain poorly understood. Understanding such mechanisms would enable additional therapeutic interventions for a variety of cancers, including cancers comprising MSI-H cells.

[0007] SUMMARY OF THE INVENTION

[0008] The present disclosure relates, in certain embodiments, to methods of modulating WRN activity in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a targeted protein degrader (TPD) composition targeting WRN.

[0009] In certain embodiments, the present disclosure relates to methods of inhibiting WRN activity in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a TPD composition targeting WRN.

[0010] In certain embodiments, the present disclosure relates to methods of treating a disorder or disease in a subject, comprising administering to the subject a therapeutically effective amount of a TPD composition targeting WRN. In certain embodiments, the present disclosure relates to methods of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a TPD composition targeting WRN.

[0011] In certain embodiments, the present disclosure relates to methods of treating cancer in a subject, comprising administering a TPD composition targeting WRN, wherein the cancer is characterized as MSI-H and / or dMMR. In certain embodiments, the cancer characterized as MSI-H and / or dMMR is selected from colorectal, gastric, bladder, endometrial, adrenocortical, uterine, cervical, esophageal, central nervous system, head and neck, breast, kidney, liver, lung, skin, prostate and ovarian cancer. In certain embodiments, the cancer characterized as MSI-H and / or dMMR is selected from adrenocortical carcinoma, glioblastoma multiforme, chronic lymphocytic leukemia, lower-grade glioma, pediatric neuroblastoma, bladder carcinoma, lung adenocarcinoma, prostate adenocarcinoma, lung squamous cell carcinoma, skin cutaneous melanoma, sarcoma, head and neck squamous cell carcinoma, liver hepatocellular carcinoma, thymoma, cholangiocarcinoma, ovarian serous cystadenocar cinoma, kidney renal clear cell carcinoma, breast carcinoma, esophageal carcinoma, mesothelioma, Wilms tumor, cervical squamous cell carcinoma, endocervical adenocarcinoma, uterine carcinosarcoma, rectal adenocarcinoma, stomach adenocarcinoma, colon adenocarcinoma, and uterine corpus endometrial carcinoma.

[0012] In certain embodiments, the TPD targeting WRN is a proteolysis-targeting chimera (PROTAC). In certain embodiments, the PROTAC comprises an E3 ligase binder. In certain embodiments, the E3 ligase binder is selected from FEM1B, RNF4, CRBN, VHL, IAP, MDM2, cIAPl, Keapl, and DCAF15.

[0013] In certain embodiments, the TPD targeting WRN is a deubiquitinating enzyme (DUB) inhibitor.

[0014] In certain embodiments, the TPD targeting WRN is a molecular glue composition.

[0015] In certain embodiments, the TPD targeting WRN is a degrader-antibody complex (DAC). In certain embodiments, the DAC comprises an anti-WRN antibody. In certain embodiments, the DAC comprises an antibody that specifically binds a cancer associated antigen. In certain embodiments, the cancer associated antigen is a cell surface antigen. In certain embodiments, the cancer is a MSI-H and / or dMMR cancer. In certain embodiments, the MSI-H and / or dMMR cancer is selected from colorectal, gastric, bladder, endometrial, adrenocortical, uterine, cervical, esophageal, central nervous system, head and neck, breast, kidney, liver, lung, skin, prostate and ovarian cancer. In certain embodiments, the DAC comprises an E3 ligase binder. In certain embodiments, the E3 ligase binder is selected from FEM1B, RNF4, CRBN, VHL, IAP, MDM2, cIAPl, Keapl, and DCAF15.

[0016] In certain embodiments, the present disclosure relates to methods of modulating WRN activity in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a WRN-chromatin tethering composition targeting WRN.

[0017] In certain embodiments, the present disclosure relates to methods of inhibiting WRN activity in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a WRN-chromatin tethering composition targeting WRN.

[0018] In certain embodiments, the present disclosure relates to methods of treating a disorder or disease in a subject, comprising administering to the subject a therapeutically effective amount of a WRN-chromatin tethering composition targeting WRN.

[0019] In certain embodiments, the present disclosure relates to methods of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a WRN-chromatin tethering composition targeting WRN.

[0020] In certain embodiments, the present disclosure relates to methods of treating cancer in a subject, comprising administering a WRN-chromatin tethering composition targeting WRN, wherein the cancer is characterized as MSI-H and / or dMMR. In certain embodiments, the cancer characterized as MSI-H and / or dMMR is selected from colorectal, gastric, bladder, endometrial, adrenocortical, uterine, cervical, esophageal, central nervous system, head and neck, breast, kidney, liver, lung, skin, prostate and ovarian cancer. In certain embodiments, the cancer characterized as MSI-H and / or dMMR is selected from adrenocortical carcinoma, glioblastoma multiforme, chronic lymphocytic leukemia, lower- grade glioma, pediatric neuroblastoma, bladder carcinoma, lung adenocarcinoma, prostate adenocarcinoma, lung squamous cell carcinoma, skin cutaneous melanoma, sarcoma, head and neck squamous cell carcinoma, liver hepatocellular carcinoma, thymoma, cholangiocarcinoma, ovarian serous cystadenocarcinoma, kidney renal clear cell carcinoma, breast carcinoma, esophageal carcinoma, mesothelioma, Wilms tumor, cervical squamous cell carcinoma, endocervical adenocarcinoma, uterine carcinosarcoma, rectal adenocarcinoma, stomach adenocarcinoma, colon adenocarcinoma, and uterine corpus endometrial carcinoma. In certain embodiments, the WRN-chromatin tethering composition comprises an anti-WRN antibody. In certain embodiments, the WRN-chromatin tethering composition comprises DNA binding moiety. In certain embodiments, the DNA binding moiety comprises a small molecule capable of binding DNA. In certain embodiments, the DNA binding moiety comprises a peptide or polypeptide capable of binding DNA. In certain embodiments, the DNA binding moiety comprises a nucleic acid capable of binding DNA.

[0021] In certain embodiments, the present disclosure relates to methods of modulating WRN activity in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a composition that modulates WRN acetylation.

[0022] In certain embodiments, the present disclosure relates to methods of inhibiting WRN activity in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a WRN acetylation agonist composition.

[0023] In certain embodiments, the present disclosure relates to methods of treating a disorder or disease in a subject, comprising administering to the subject a therapeutically effective amount of a WRN acetylation agonist composition.

[0024] In certain embodiments, the present disclosure relates to methods of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a WRN acetylation agonist composition.

[0025] In certain embodiments, the present disclosure relates to methods of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a WRN acetylation agonist composition, wherein the cancer is characterized as MSI-H and / or dMMR. In certain embodiments, the cancer characterized as MSI-H and / or dMMR is selected from colorectal, gastric, bladder, endometrial, adrenocortical, uterine, cervical, esophageal, central nervous system, head and neck, breast, kidney, liver, lung, skin, prostate and ovarian cancer. In certain embodiments, the cancer characterized as MSI-H and / or dMMR is selected from adrenocortical carcinoma, glioblastoma multiforme, chronic lymphocytic leukemia, lower-grade glioma, pediatric neuroblastoma, bladder carcinoma, lung adenocarcinoma, prostate adenocarcinoma, lung squamous cell carcinoma, skin cutaneous melanoma, sarcoma, head and neck squamous cell carcinoma, liver hepatocellular carcinoma, thymoma, cholangiocarcinoma, ovarian serous cystadenocar cinoma, kidney renal clear cell carcinoma, breast carcinoma, esophageal carcinoma, mesothelioma, Wilms tumor, cervical squamous cell carcinoma, endocervical adenocarcinoma, uterine carcinosarcoma, rectal adenocarcinoma, stomach adenocarcinoma, colon adenocarcinoma, and uterine corpus endometrial carcinoma. In certain embodiments, the WRN acetylation agonist composition enhances the activity of p300 and / or CBP. In certain embodiments, the composition that modulates WRN acetylation is a member of the sirtuin family of NAD+ dependent deacetylases. In certain embodiments, the member of the sirtuin family ofNAD+ dependent deacetylases is SIRT1.

[0026] BRIEF DESCRIPTION OF THE FIGURES

[0027] FIGs. 1A-1I. WRN inhibitors reduce WRN diffusion leading to increased levels of Y-H2AX and cell death in WRNHal° HCT-116 cells but not WRNHal° HT-29 cells. 1 A & IB: Inhibitor A treatment results in a dose-dependent decrease in WRN diffusion in WRNHal° HCT-116 cells. 1C & ID: Inhibitor B treatment results in a dose-dependent decrease in WRN diffusion in WRNHal° HCT-116 cells. IE & IF: Inhibitor B treatment results in a dose-dependent increase in y-H2AX levels and decreased viability of WRNHal° HCT-116 cells but not WRNHal° HT-29 cells. 1G & 1H: Inhibitor A treatment results in a dosedependent increase in y-H2AX levels and decreased viability of WRNHal° HCT-116 cells but not WRNHal° HT-29 cells. II: Dose-dependent effects of Inhibitor A on WRNHal° diffusive states in WRNHal° HCT-116 cells

[0028] FIGs. 2A-2H. Inhibitor B leads to chromatin trapping and degradation of WRN protein in WRNHal° HCT-116 cells but not WRNHal° U2OS cells. 2A & 2B: Inhibitor B treatment of WRNHal° HCT-116 results in WRN protein being trapped on chromatin in the nucleus. 2C & 2D: Chromatin trapping of WRN is not observed in WRNHal° U2OS cells after Inhibitor B treatment. 2E & 2F : 24hr treatment with Inhibitor B results in decreased WRN levels in WRNHal° HCT-116 cells. 2G & 2H: 24hr treatment with Inhibitor B has no effect on WRN levels in WRNHal° U2OS cells

[0029] FIG. 3. siRNA knock-down of E3 ligase RNF4 rescues Inhibitor B mediated degradation of WRN protein in WRNHal° HCT-116.

[0030] FIGs. 4A-4D. 4A & 4B: Inhibitor B mediated degradation of WRN is rescued by pre-treatment with SUMO-activating enzyme (SAE) inhibitor ML-792 in WRNHal° HCT- 116 cells. 4C: Inhibitor B mediated killing of WRNHal° HCT-116 cells is enhanced after siRNA knock-down of SUMO ligase PIAS4. 4D: Model for targeting trapped WRN to proteasomal degradation by WRN inhibitors. WRN that is bound to chromatin surveying DNA damage in MSI-H cells becomes trapped upon inhibition by WRN inhibitors. This stalled WRN is SUMOylated by the SUMO ligase PIAS4. SUMOylated WRN recruits the STUbL RNF4, leading to its ubiquitylation. Ubiquitylated WRN is extracted from chromatin by p97 / VCP, leading to its degradation by the proteasome (data not shown).

[0031] DETAILED DESCRIPTION

[0032] The present disclosure relates to methods and compositions for treating cancer, particularly cancers comprising MSI-H cells. The methods and compositions of the present disclosure generally relate to interventions capitalizing on a sequence of events identified herein as occurring upon the addition of WRN inhibitors. In this sequence of events, and as outlined in detail in the instant application, a substantial reduction in the protein motion of WRN is first observed as the helicase becomes physically bound to cellular chromatin. Once chromatin bound, WRN is modified by members of the PIAS family of sumoylating enzymes with the addition of a SUMO protein tag. Sumoylation of WRN facilitates a subsequent interaction with RNF4, an E3 ligase that further modifies WRN with the addition of ubiquitin chains. The addition of ubiquitin to WRN ultimately results in WRN being degraded by the proteasome. As described herein, interventions associated with this sequence of events can be useful in the treatment of a variety of cancers, particularly cancers comprising MSI-H cells. For example, but not by way of limitation, such interventions can enhance one or more of the sequence of events that occur upon WRN inhibitor addition, or such interventions can target corresponding activities. In certain exemplary embodiments, cells, e.g., MSI-H cells, can be treated by: (1) targeting WRN for degradation (in the presence or absence of a WRN inhibitor); (2) facilitating WRN association with chromatin (in the presence or absence of a WRN inhibitor); and / or (3) facilitating WRN localization from the nucleolus to nuclear foci on chromatin.

[0033] For clarity, but not by way of limitation, the detailed description of the presently disclosed subject matter is divided into the following subsections:

[0034] 1. Definitions;

[0035] 2. MSI-High Cancers; and

[0036] 3. Methods & Compositions for Treating MSI-High Cancers.

[0037] 1. Definitions

[0038] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which the subject matter of the present disclosure belongs. The following references provide one of skill with a general definition of many of the terms used in the present disclosure: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nded. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5thEd., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them below, unless specified otherwise.

[0039] As used herein, the use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and / or the specification can mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.”

[0040] The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, z.e., the limitations of the measurement system. For example, “about” can mean within 3 or more than 3 standard deviations, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value.

[0041] The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s)” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms or words that do not preclude additional acts or structures. The present disclosure also contemplates other embodiments “comprising,” “consisting of’ and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not.

[0042] As used herein, the term “individual” or “subject” refers to a vertebrate or an invertebrate, such as a human or non-human animal, for example, a mammal. Mammals include, but are not limited to, humans, non-human primates, farm animals, sport animals, rodents and pets. Non-limiting examples of non-human animal subjects include rodents such as mice, rats, hamsters, guinea pigs, rabbits, dogs, cats, sheep, pigs, goats, cattle, horses, apes and monkeys. In certain embodiments, the individual or subject is a human.

[0043] The term “plurality” refers to a number larger than one. In certain embodiments, the term “plurality of cells” refers to a number of cells larger than one. For example, but not by way of limitation, a plurality of proteins includes at least two cells. In certain embodiments, the term “plurality of nucleic acids” refers to a number of nucleic acids larger than one. For example, but not by way of limitation, a plurality of nucleic acids includes at least two nucleic acids. For the recitation of numeric ranges herein, each intervening number within the range is explicitly contemplated with the same degree of precision. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.

[0044] As used herein, “modulate” or “modulating” refers to increasing or decreasing, e.g., modulation of the activity of an enzyme includes increasing the activity of the enzyme as well as decreasing the activity of the enzyme.

[0045] As used herein, “treatment” (and grammatical variations thereof such as “treat” or “treating”) refers to clinical intervention in an attempt to alter the natural course of a disease in the individual being treated. Desirable effects of treatment include, but are not limited to alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. The decrease can be at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% decrease in severity of complications, signs or symptoms or in likelihood of progression to another grade. “Treatment” can also refer to inhibiting proliferation of a cancer or progression to a higher grade by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99%.

[0046] As used herein, “alkyl” includes both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms and may be unsubstituted or substituted. Thus, Ci-Cnas in “Ci-Cnalkyl” is defined to include groups having 1, 2, ...., n-1 or n carbons in a linear or branched arrangement. For example, Ci-Ce, as in “Ci-Ce alkyl” is defined to include groups having 1, 2, 3, 4, 5, or 6 carbons in a linear or branched arrangement, and specifically includes methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, pentyl, hexyl, and octyl.

[0047] As used herein, “alkenyl” refers to a non-aromatic hydrocarbon radical, straight or branched, containing at least 1 carbon to carbon double bond, and up to the maximum possible number of non aromatic carbon-carbon double bonds may be present, and may be unsubstituted or substituted. For example, “C2-C6 alkenyl” means an alkenyl radical having 2, 3, 4, 5, or 6 carbon atoms, and up to 1, 2, 3, 4, or 5 carbon-carbon double bonds respectively. Alkenyl groups include ethenyl, propenyl, butenyl and cyclohexenyl. The term “alkynyl” refers to a hydrocarbon radical straight or branched, containing at least 1 carbon to carbon triple bond, and up to the maximum possible number of nonaromatic carbon-carbon triple bonds may be present, and may be unsubstituted or substituted. Thus, “C2-C6 alkynyl” means an alkynyl radical having 2 or 3 carbon atoms and 1 carbon-carbon triple bond, or having 4 or 5 carbon atoms and up to 2 carbon-carbon triple bonds, or having 6 carbon atoms and up to 3 carbon-carbon triple bonds. Alkynyl groups include ethynyl, propynyl and butynyl.

[0048] As used herein, “heteroalkyl” includes both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms and at least 1 heteroatom within the chain or branch.

[0049] As used herein, “cycloalkyl” shall mean cyclic rings of alkanes of three to eight total carbon atoms, or any number within this range (i.e., cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl or cyclooctyl).

[0050] As used herein, the term “heterocyclyl” or “heterocyclic” refers to a mono- or polycyclic ring system which can be saturated or contains one or more degrees of unsaturation and contains one or more heteroatoms. Preferred heteroatoms include N, O, and / or S, including N-oxides, sulfur oxides, and dioxides. Preferably the ring is three to tenmembered and is either saturated or has one or more degrees of unsaturation. The heterocycle may be unsubstituted or substituted, with multiple degrees of substitution being allowed. Such rings may be optionally fused to one or more of another “heterocyclic” ring(s), heteroaryl ring(s), aryl ring(s), or cycloalkyl ring(s). Examples of heterocycles include, but are not limited to, tetrahydrofuran, pyran, 1,4-dioxane, 1,3-dioxane, piperidine, piperazine, pyrrolidine, morpholine, thiomorpholine, tetrahydrothiopyran, tetrahydrothiophene, 1,3- oxathiolane, and the like. The alkyl, alkenyl, alkynyl, aryl, heteroaryl and heterocyclyl substituents may be substituted or unsubstituted, unless specifically defined otherwise.

[0051] As used herein, “aryl” is intended to mean any stable monocyclic, bicyclic or polycyclic carbon ring of up to 10 atoms in each ring, wherein at least one ring is aromatic, and may be unsubstituted or substituted. Examples of such aryl elements include phenyl, p- toluenyl (4-methylphenyl), naphthyl, tetrahydro-naphthyl, indanyl, biphenyl, phenanthryl, anthryl or acenaphthyl. In cases where the aryl substituent is bicyclic and one ring is nonaromatic, it is understood that attachment is via the aromatic ring.

[0052] As used herein, the term “halogen” refers to F, Cl, Br, and I. As used herein, the term “haloalkyl” means an alkyl group that is substituted with one or more fluorine, chlorine, bromine or iodine atoms. Examples of such haloalkyl include fluoromethyl, difluoromethyl, trifluoromethyl, pentafluoroethyl, 1,1 -difluoroethyl, chloromethyl, chlorofluoromethyl and trichloromethyl groups.

[0053] The term “substitution,” “substituted” and “substituent” refers to a functional group as described above in which one or more bonds to a hydrogen atom contained therein are replaced by a bond to non-hydrogen or non-carbon atoms, provided that normal valencies are maintained and that the substitution results in a stable compound. Substituted groups also include groups in which one or more bonds to a carbon(s) or hydrogen(s) atom are replaced by one or more bonds, including double or triple bonds, to a heteroatom. Examples of substituent groups include the functional groups described herein, and halogens (i.e., F, Cl, Br, and I); alkyl groups, such as methyl, ethyl, n-propyl, and trifluorom ethyl; hydroxyl; alkoxy groups, such as methoxy, ethoxy, n-propoxy, and isopropoxy; aryloxy groups, such as phenoxy; arylalkyloxy. Where multiple substituent moieties are disclosed or claimed, the substituted compound can be independently substituted by one or more of the disclosed or claimed substituent moieties, singly or plurally. By independently substituted, it is meant that the (two or more) substituents can be the same or different. It is understood that substituents and substitution patterns on the compounds of the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials. If a substituent is itself substituted with more than one group, it is understood that these multiple groups may be on the same carbon or on different carbons, so long as a stable structure result.

[0054] The compounds of the subject invention may have spontaneous tautomeric forms. In cases wherein compounds may exist in tautomeric forms, such as keto-enol tautomers, each tautomeric form is contemplated as being included within this invention whether existing in equilibrium or predominantly in one form.

[0055] This invention also provides isotopic variants of the compounds disclosed herein, including wherein the isotopic atom is2H and / or wherein the isotopic atom13C. Accordingly, in the compounds provided herein hydrogen can be enriched in the deuterium isotope. It is to be understood that the invention encompasses all such isotopic forms. In the compound structures depicted herein, hydrogen atoms are not shown for carbon atoms having less than four bonds to non-hydrogen atoms. However, it is understood that enough hydrogen atoms exist on said carbon atoms to satisfy the octet rule.

[0056] Except where otherwise specified, if the structure of a compound of this invention includes an asymmetric carbon atom, it is understood that the compound occurs as a racemate, racemic mixture, and isolated single enantiomer. All such isomeric forms of these compounds are expressly included in this invention. Except where otherwise specified, each stereogenic carbon may be of the R or S configuration. It is to be understood accordingly that the isomers arising from such asymmetry (e.g., all enantiomers and diastereomers) are included within the scope of this invention, unless indicated otherwise. Such isomers can be obtained in substantially pure form by classical separation techniques and by stereochemically controlled synthesis.

[0057] The compounds of the present invention include all hydrates, solvates, and complexes of the compounds used by this invention. If a chiral center or another form of an isomeric center is present in a compound of the present invention, all forms of such isomer or isomers, including enantiomers and diastereomers, are intended to be covered herein. Compounds containing a chiral center may be used as a racemic mixture, an enantiomerically enriched mixture, or the racemic mixture may be separated using well- known techniques and an individual enantiomer may be used alone. The compounds described in the present invention are in racemic form or as individual enantiomers.

[0058] In choosing the compounds of the present invention, one of ordinary skill in the art will recognize that the various substituents, i.e., Ri, R2, etc. are to be chosen in conformity with well-known principles of chemical structure connectivity.

[0059] The compounds used in the method of the present invention may be in a salt form. As used herein, a “salt” is a salt of the instant compounds which has been modified by making acid or base salts of the compounds. In the case of compounds used to treat an infection or disease caused by a pathogen, the salt is pharmaceutically acceptable. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as phenols. The salts can be made using an organic or inorganic acid. Such acid salts are chlorides, bromides, sulfates, nitrates, phosphates, sulfonates, formates, tartrates, maleates, malates, citrates, benzoates, salicylates, ascorbates, and the like. Phenolate salts are the alkali earth metal salts, sodium, potassium or lithium. The term “pharmaceutically acceptable salt” in this respect, refers to the relatively non-toxic, inorganic and organic acid or base addition salts of compounds of the present invention. These salts can be prepared in situ during the final isolation and purification of the compounds of the invention, or by separately reacting a purified compound of the invention in its free base or free acid form with a suitable organic or inorganic acid or base, and isolating the salt thus formed. Representative salts include the hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, napthylate, mesylate, glucoheptonate, lactobionate, and laurylsulphonate salts and the like.

[0060] The compounds used in the method of the present invention can be administered in admixture with suitable pharmaceutical diluents, extenders, excipients, or in carriers such as the novel programmable sustained-release multi-compartmental nanospheres (collectively referred to herein as a pharmaceutically acceptable carrier) suitably selected with respect to the intended form of administration and as consistent with conventional pharmaceutical practices. The unit will be in a form suitable for oral, nasal, rectal, topical, intravenous or direct injection or parenteral administration. The compounds can be administered alone or mixed with a pharmaceutically acceptable carrier. This carrier can be a solid or liquid, and the type of carrier is generally chosen based on the type of administration being used. The active agent can be co-administered in the form of a tablet or capsule, liposome, as an agglomerated powder or in a liquid form. Examples of suitable solid carriers include lactose, sucrose, gelatin and agar. Capsule or tablets can be easily formulated and can be made easy to swallow or chew; other solid forms include granules, and bulk powders. Tablets may contain suitable binders, lubricants, diluents, disintegrating agents, coloring agents, flavoring agents, flow- inducing agents, and melting agents. Examples of suitable liquid dosage forms include solutions or suspensions in water, pharmaceutically acceptable fats and oils, alcohols or other organic solvents, including esters, emulsions, syrups or elixirs, suspensions, solutions and / or suspensions reconstituted from non-effervescent granules and effervescent preparations reconstituted from effervescent granules. Such liquid dosage forms may contain, for example, suitable solvents, preservatives, emulsifying agents, suspending agents, diluents, sweeteners, thickeners, and melting agents. Oral dosage forms optionally contain flavorants and coloring agents. Parenteral and intravenous forms may also include minerals and other materials to make them compatible with the type of injection or delivery system chosen. 2. MSI-High Cancers

[0061] In certain embodiments, the present disclosure relates to the treatment of cancers dependent on WRN for repairing damaged DNA due to deficiencies in other repair pathways like DNA mismatch repair (dMMR). In certain embodiments, the present disclosure relates to the treatment of cancers comprising MSI-H cells. Strategies for identifying MSI-H cells and cancers comprising such cells are known in the art, e.g., MSI-PCR, which analyzes microsatellite length distributions as five specific loci, and immunohistochemistry assays comprising the detection of proteins of the MMR pathway (MSH2, MSH6, MLH1, and PSM2). Computational approaches are also known in the art, e.g., mSINGS, MSISensor, and MANTIS. Additional detail concerning such strategies is available in Bonneville, et. al., JCO Precision Oncology, 2017 doi / full / 10.1200 / PO.17.00073 (which is hereby incorporated by reference in its entirety). Such microsatellite instability, i.e., the presence of MSI-H cells, is a hallmark of numerous cancer types including colon, gastric, endometrial and ovarian tumors, among other cancer types. In certain embodiments, the MSI-H cancer treated in connection with the compositions and methods of the present disclosure include, but are not limited to, adrenocortical carcinoma, glioblastoma multiforme, chronic lymphocytic leukemia, lower-grade glioma, pediatric neuroblastoma, bladder carcinoma, lung adenocarcinoma, prostate adenocarcinoma, lung squamous cell carcinoma, skin cutaneous melanoma, sarcoma, head and neck squamous cell carcinoma, liver hepatocellular carcinoma, thymoma, cholangiocarcinoma, ovarian serous cystadenocar cinoma, kidney renal clear cell carcinoma, breast carcinoma, esophageal carcinoma, mesothelioma, Wilms tumor, cervical squamous cell carcinoma, endocervical adenocarcinoma, uterine carcinosarcoma, rectal adenocarcinoma, stomach adenocarcinoma, colon adenocarcinoma, and uterine corpus endometrial carcinoma.

[0062] 3. Methods & Compositions for Treating MSI-High Cancers

[0063] In certain embodiments, the present disclosure is directed to methods and compositions for the treatment of cancers, e.g., cancers comprising MSI-H cells, by (1) targeting WRN for degradation (in the presence or absence of a WRN inhibitor); (2) facilitating WRN association with chromatin (in the presence or absence of a WRN inhibitor); and / or (3) facilitating WRN localization from the nucleolus to nuclear foci on chromatin.

[0064] 3.1 Targeting WRN for Degradation In certain embodiments, the present disclosure is directed to methods and compositions for the treatment of cancers, e.g., cancers comprising MSI-H cells, by targeting WRN for degradation. In certain embodiments, WRN can be targeted for degradation by administration of a target protein degrader (“TPD”). In certain embodiments, WRN-specific TPDs facilitate the interaction between WRN and an enzyme involved in ubiquitinoylation, e.g., a E3 ubiquitin ligase. In certain embodiments, TPDs compositions useful in the context of the methods disclosed herein include, but are not limited to: (1) proteolysis-targeting chimera (PROTAC) protein degraders; (2) inhibitors of WRN-specific deubiquitinating enzymes (DUBs); (3) molecular glues; and (4) degrader-antibody conjugates (DACs). Such TPDs, which directly target WRN for degradation can be contrasted with WRN inhibitors, the administration of which may ultimately result in WRN degradation, but such degradation is an indirect (i.e., non-targeted) result of inhibitor binding.

[0065] For example, but not by way of limitation, the methods of the present disclosure comprise modulating WRN activity in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a TPD composition targeting WRN. In certain embodiments, the methods of the present disclosure comprise inhibiting WRN activity in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a TPD composition targeting WRN. In certain embodiments, the methods of the present disclosure comprise treating a disorder or disease in a subject, comprising administering to the subject a therapeutically effective amount of a TPD composition targeting WRN. In certain embodiments, the methods of the present disclosure comprise treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a TPD composition targeting WRN. In certain embodiments, the methods of the present disclosure comprise treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a TPD composition targeting WRN, wherein the cancer is characterized as microsatellite instability-high (MSI-H) and / or mismatch repair deficient (dMMR). In certain embodiments, the cancer characterized as MSI-H and / or dMMR is selected from colorectal, gastric, bladder, endometrial, adrenocortical, uterine, cervical, esophageal, central nervous system, head and neck, breast, kidney, liver, lung, skin, prostate and ovarian cancer. In certain embodiments, the cancer is selected from adrenocortical carcinoma, glioblastoma multiforme, chronic lymphocytic leukemia, lower-grade glioma, pediatric neuroblastoma, bladder carcinoma, lung adenocarcinoma, prostate adenocarcinoma, lung squamous cell carcinoma, skin cutaneous melanoma, sarcoma, head and neck squamous cell carcinoma, liver hepatocellular carcinoma, thymoma, cholangiocarcinoma, ovarian serous cystadenocar cinoma, kidney renal clear cell carcinoma, breast carcinoma, esophageal carcinoma, mesothelioma, Wilms tumor, cervical squamous cell carcinoma, endocervical adenocarcinoma, uterine carcinosarcoma, rectal adenocarcinoma, stomach adenocarcinoma, colon adenocarcinoma, and uterine corpus endometrial carcinoma.

[0066] In certain embodiments, the methods and composition of the present disclosure are directed to WRN-specific PROTAC protein degraders. In certain embodiments, the PROTAC comprises an E3 ligase binder. In certain embodiments, the E3 ligase binder is selected from FEM1B, RNF4, CRBN, VHL, IAP, MDM2, cIAPl, Keapl, and DCAF15.

[0067] In certain embodiments the WRN-specific PROTAC comprises a WRN-specific targeting moiety operably linked to an E3 ligase binder. In certain embodiments, the WRN- specific targeting moiety is a WRN-specific antibody. In certain embodiments, the WRN- specific targeting moiety is a WRN inhibitor. In certain embodiments, the WRN inhibitor is an inhibitor known in the art, e.g., a WRN inhibitor disclosed in one or more of: Parker et al., Biochemistry 2023, 62, 14, 2147-2160 (2023); PCT / US2019 / 035130; PCT / IB2022 / 054850; PCT / IB2022 / 059817; and US63 / 535,307, each of which is incorporated by reference in their entirety.

[0068] In certain embodiments of compositions of the present disclosure, the WRN inhibitor is a compound of formula (I), or a pharmaceutically acceptable salt thereof:

[0069] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein Rs is Ci-Ce alkyl, C2-C6 alkenyl, C2-C6 alkynyl or C3-C6 cycloalkyl.

[0070] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein Rs is C2 alkyl.

[0071] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein Re and R7 are independently selected from H or halogen.

[0072] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein Re and R7 are H.

[0073] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein Re and R7 are F.

[0074] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof:

[0075] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein Ri is NR30R31, aryl, C3-C7 cycloalkyl ring, or 4-, 5-, 6-, or 7- membered heterocyclyl ring.

[0076] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein Ri is NR30R31, R30 and R31 are independently selected from optionally substituted Ci-Ce alkyl, C2-C6 alkenyl, C2-C6 alkynyl, or H.

[0077] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein Ri is NR30R31, R30 and R31 are - CH3.

[0078] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein Ri is aryl, the aryl is fused with a 5- or 6- membered heterocyclyl ring, wherein the said 5- or 6- membered heterocyclyl ring comprises carbon atoms and at least one oxygen and / or at least one nitrogen atom, and wherein the said 5- or 6- membered heterocyclyl ring is optionally substituted with C1-C3 alkyl.

[0079] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein Ri is phenyl.

[0080] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein the phenyl is fused with a 5- membered heterocyclyl ring.

[0081] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein the phenyl is fused with a 6- membered heterocyclyl ring.

[0082] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein the 5- or 6-membered heterocyclyl ring comprises carbon atoms and one or two oxygen atoms.

[0083] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein the 5- or 6-membered heterocyclyl ring comprises carbon atoms and one or two nitrogen atoms.

[0084] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein the 5- or 6-membered heterocyclyl ring comprises carbon atoms, one or two oxygen and one or two nitrogen atoms.

[0085] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein Ri is selected from:

[0086] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein Ri is a fully saturated C3-C7 cycloalkyl ring.

[0087] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein Ri is a 4- or 7-membered heterocyclyl ring comprises carbon atoms and at least one of a nitrogen or oxygen atom.

[0088] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein Ri is substituted with C1-C4 alkoxy.

[0089] In certain embodiments, the present disclosure is directed to a compound of formula

[0090] (I), or a pharmaceutically acceptable salt thereof: wherein Ri is

[0091] In certain embodiments, the present disclosure is directed to a compound of formula

[0092] (I), or a pharmaceutically acceptable salt thereof: wherein Ri is

[0093] In certain embodiments, the present disclosure is directed to a compound of formula

[0094] (I), or a pharmaceutically acceptable salt thereof: wherein Ri is< N—

[0095] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein the said 4- or 7-membered heterocyclyl ring is optionally joined with a second substituted or unsubstituted 4-, 5-, or 6- membered heterocyclyl ring, wherein the said second 4-, 5-, or 6-membered heterocyclyl ring comprises carbon atoms and at least one of a nitrogen or oxygen atom, wherein the said 4- or 7-membered heterocyclyl ring is linked with the said second 4-, 5-, or 6-membered heterocyclyl ring by one carbon atom to form a spiro ring or two carbon atoms to form a fused ring.

[0096] In certain embodiments, the present disclosure is directed to a compound of formula

[0097] (I), or a pharmaceutically acceptable salt thereof: wherein Ri is

[0098] In certain embodiments, the present disclosure is directed to a compound of formula

[0099] (I), or a pharmaceutically acceptable salt thereof: wherein Ri is a 5- or 6-membered heterocyclyl ring, wherein the said 5- or 6-membered heterocyclyl ring is a fully saturated ring comprising carbon atoms and at least one of a nitrogen atom or oxygen atom, wherein the said 5- or 6-membered heterocyclyl ring is linked with a second substituted or unsubstituted 4-, 5-, or 6- membered heterocyclyl ring to form a spiro ring, or the said 5- or 6-membered heterocyclyl ring is joined with a second substituted or unsubstituted 4-, 5-, or 6- membered heterocyclyl ring to form a fused ring, wherein the said second 4-, 5-, or 6- membered heterocyclyl ring is a saturated ring comprising carbon atoms and at least one of a nitrogen atom or oxygen atom.

[0100] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein Ri is

[0101] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein Ri is a pyrazole ring, wherein the pyrazole ring is joined with a second substituted or unsubstituted 4-, 5-, or 6- membered heterocyclyl ring to form a fused ring, wherein the said second 4-, 5-, or 6- membered heterocyclyl ring is a saturated ring comprising carbon atoms and at least one of a nitrogen atom or oxygen atom.

[0102] In certain embodiments, the present disclosure is directed to a compound of formula

[0103] (I), or a pharmaceutically acceptable salt thereof: wherein Ri is

[0104] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein Ri is a pyridinyl ring, wherein the pyridinyl ring is joined with a second substituted or unsubstituted 4-, 5-, or 6-membered heterocyclyl ring to form a fused ring.

[0105] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein Ri is selected from:

[0106] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein n is 0, X is N, Y is C, R2 is NR.sR.9. and R3 is H, wherein when R2 is NRsRg, Rs and R9 are independently selected from H, Ci- C4 alkyl, and -C(O)Rn, wherein Rn is a substituted or unsubstituted 5- or 6-membered heterocyclyl ring.

[0107] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof:

[0108] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein n is 1, X and Y are C, R2 is NR.sR.9 and R3 is H or R2 and R3 join together to form a substituted fused 4-membered heterocyclyl ring, wherein the substituted 4-membered heterocyclyl ring is substituted with -C(O)Rn, and wherein Rn is a substituted 5- or 6-membered heterocyclyl ring; wherein when R2 is NRsRg, Rs and Rg are independently selected from H, C1-C4 alkyl, and -C(O)Rn, wherein Rn is a substituted 5- or 6-membered heterocyclyl ring.

[0109] In certain embodiments, the present disclosure is directed to a compound of formula

[0110] (I), or a pharmaceutically acceptable salt thereof: wherein n is 1, X and Y are C, R2 is NRsRg and R3 is H, wherein Rs and R9 are independently selected from H, C1-C4 alkyl, and - C(O)Rn, wherein Rn is a substituted 5- or 6-membered heterocyclyl ring.

[0111] In certain embodiments, the present disclosure is directed to a compound of formula

[0112] (I), or a pharmaceutically acceptable salt thereof: wherein n is 1, X and Y are C, R2 is

[0113] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein n is 1, X and Y are C, R2 and R3 join together to form a substituted fused 4-membered heterocyclyl ring, wherein the substituted 4-membered heterocyclyl ring is substituted with -C(O)Rn, and wherein Rn is a substituted 5- or 6-membered heterocyclyl ring; wherein when R2 is NRsRg, Rs and R9 are independently selected from H, C1-C4 alkyl, and -C(O)Rn, wherein Rn is a substituted 5- or 6-membered heterocyclyl ring.

[0114] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein the said fused ring i

[0115] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein n is 2, X is C, Y is N, and R2 and R3 join together to form an unsubstituted or substituted fused 4- or 5-membered heterocyclyl ring, wherein when the 5-membered heterocyclyl ring is substituted, the substituents are selected from a 5- or 6-membered heterocyclyl ring or -C(O)Rn, wherein Rn is a C1-C3 alkyl or substituted 5- or 6-membered heterocyclyl ring.

[0116] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein the said fused 4- or 5-membered heterocyclyl ring is selected from:

[0117] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein n is 2, X is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio is Ci-Ce alkyl, Ci-Ce alkenyl, a C3-C7 cycloalkyl ring, a 5- or 6-membered heterocyclyl ring, wherein Rio is optionally substituted with -OH, C1-C3 alkoxy, an optionally substituted C3-C5 cycloalkyl ring, halogen, -S(O2)CH3, and / or - C(O)N(CH3)2.

[0118] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein n is 2, X is C, Y is N, R2 is H, R3 is -C(0)Rio, and Rio is Ci-Ce alkyl, Ci-Ce alkenyl, a C3-C5 cycloalkyl ring, a 5- or 6- membered heterocyclyl ring, wherein Rio is optionally substituted with -OH, C1-C3 alkoxy, an optionally substituted C3-C5 cycloalkyl ring, halogen, -S(O2)CH3, and / or -C(O)N(CH3)2.

[0119] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein R3 is selected from:

[0120] In certain embodiments, the present disclosure is directed to a compound of formula

[0121] (I), or a pharmaceutically acceptable salt thereof: wherein n is 2, X is C, Y is N, R2 is H, R3 is -S(02)RIO, and Rio is C1-C4 alkyl, C1-C4 alkenyl, a C3-C5 cycloalkyl ring, a 5- or 6- membered heterocyclyl ring, wherein Rio is optionally substituted with -OH, C1-C3 alkoxy, an optionally substituted C3-C5 cycloalkyl ring, halogen, -S(O2)CH3, and / or -C(O)N(CH3)2.

[0122] In certain embodiments, the present disclosure is directed to a compound of formula

[0123] (I), or a pharmaceutically acceptable salt thereof: wherein R3 is selected from:

[0124] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein n=2, X is C, Y is N, R2 is H, R3 is substituted or unsubstituted 5- or 6-membered heterocyclyl ring.

[0125] In certain embodiments, the present disclosure is directed to a compound of formula

[0126] (I), or a pharmaceutically acceptable salt thereof: wherein R3 is .

[0127] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein n is 2, X is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, wherein Rio wherein A, W, P, S, T, and Z are independently selected from H, C, N, S, or O and wherein = refers to a single or a double bond; wherein T is N or C; wherein when T is N, Rio i are independently selected from N or C; and wherein when T is C, Rio ; wherein when N=M and M=Z are both single bonds, M is C(O) and Z is N or C substituted with H or C1-C3 alkyl; and when one of N = M and M=Z is a single-bond and one is a double-bond, M and Z are independently selected from C or N, optionally substituted with H or C1-C3 alkyl.

[0128] In certain embodiments, the present disclosure is directed to a compound of formula

[0129] (I), or a pharmaceutically acceptable salt thereof: wherein Rio is selected from:

[0130] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein n is 2, X is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio are independently selected from H, -OH, or C1-C3 alkyl, or R12 and R13 j oin together to form a fused substituted or unsubstituted 5- or 6- membered heterocyclyl ring, wherein when the 5- or 6- membered heterocyclyl ring is substituted, the substituents are selected from C1-C3 alkyl.

[0131] In certain embodiments, the present disclosure is directed to a compound of formula

[0132] (I), or a pharmaceutically acceptable salt thereof: wherein Rio is selected from:

[0133] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein n is 2, X is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio wherein when U is N+, R15 is O', Rie and R17 are H, and U= V is a double bond; wherein when U is C, R15 is -OH or -NR19R20; wherein when R15 is -OH, Rie is a carbonyl, R17 and Ris join together to form a fused 5- or 6- membered heterocyclyl ring, and U = V is a single bond.

[0134] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein n is 2, X is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio , wherein when U is C, R15 is NR19R20,

[0135] U= V is a double-bond and Rie, R17, Ris, R19, and R20 are independently selected from H, -CH3, -C(O)R2i, -S(O2)R2i, and -S(O)R2iR22, wherein R21 and R22 are independently selected from C1-C3 alkyl, C3-C5 cycloalkyl ring, or 5- or 6- membered heterocyclyl ring or R.21 and R22 join together to form a substituted or unsubstituted C3-C5 cycloalkyl ring.

[0136] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein Rio is selected from:

[0137] In certain embodiments, the present disclosure is directed to a compound of formula

[0138] (I), or a pharmaceutically acceptable salt thereof: wherein is 0 or 1, and R23 is C1-C4 alkyl, wherein the C1-C4 alkyl is optionally substituted with halogens selected from F or Cl.

[0139] In certain embodiments, the present disclosure is directed to a compound of formula

[0140] (I), or a pharmaceutically acceptable salt thereof: wherein is 0, and R23 is C1-C4 alkyl, wherein the C1-C4 alkyl is optionally substituted with halogens selected from F or Cl.

[0141] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein R4 is selected from:

[0142] In certain embodiments, the present disclosure is directed to a compound of formula

[0143] (I), or a pharmaceutically acceptable salt thereof: wherein is 1, and R23 is C1-C4 alkyl, wherein the C1-C4 alkyl is optionally substituted with halogens selected from F or Cl.

[0144] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein R4 is selected from:

[0145] In certain embodiments, the present disclosure is directed to a compound of formula

[0146] (I), or a pharmaceutically acceptable salt thereof: wherein is 1 or 2, x is 1 or 2, and R24 is C1-C4 alkyl, wherein the C1-C4 alkyl is optionally substituted with halogens from F or Cl.

[0147] In certain embodiments, the present disclosure is directed to a compound of formula

[0148] (I), or a pharmaceutically acceptable salt thereof: wherein R4 is F

[0149] In certain embodiments, the present disclosure is directed to a compound of formula

[0150] (I), or a pharmaceutically acceptable salt thereof: wherein single or double bond; wherein when L = G is a double bond, G and L are independently selected from C or N, R25 and R29 are independently selected from H, halogen, or -C(O), R26 and R27 are independently selected from H, Ci-Ce alkyl, Ci-Ce haloalkyl, -OR28, or - S(O)mR28 wherein m is 0-2, R28 is a methyl or trihalomethyl group, or either R25 or R27 join with R26 to form a C4-C7 cycloalkyl ring or a 5- or 6- membered heterocyclyl ring, optionally substituted with -OH, alkyl, haloalkyl, or halogen.

[0151] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein R4 is selected from:

[0152] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein the compound is selected from:

[0153]

[0154] In certain embodiments, the present disclosure is directed to a compound of formula

[0155] (I), or a pharmaceutically acceptable salt thereof: wherein the compound is selected from:

[0156] In certain embodiments, the present disclosure is directed to a compound of formula

[0157] In certain embodiments, the present disclosure is directed to a compound of formula (I), or a pharmaceutically acceptable salt thereof: wherein the compound is selected from:

[0158] In certain embodiments, the present disclosure is directed to a compound of formula

[0159] 5 (I), or a pharmaceutically acceptable salt thereof: wherein the compound is selected from:

[0160]

[0161] In certain embodiments, the present disclosure is directed to methods and compositions for the treatment of cancers by targeted WRN degradation through inhibiting deubiquitinating enzymes (DUBs), which remove ubiquitin conjugates from WRN protein.

[0162] In certain embodiments, the methods and composition of the present disclosure are directed to WRN-specific molecular glues. Without being bound by theory, molecular glues are thought to exert their degradative effect by tightening and simplifying the connection of an E3 ligase with a target protein for ubiquitination and subsequent degradation. Strategies for identifying molecular glues capable of specifically targeting WRN for degradation are known in the art, e.g., screening and data mining of structure-based information. Such strategies are described in Sasso et al., Biochemistry 2023, 62, 3, 601-623 (2022), which is hereby incorporated by reference in its entirety.

[0163] In certain embodiments, the methods and compositions of the present disclosure are directed to WRN-specific DACs. In certain embodiments, the WRN-specific DACs of the present disclosure combine PROTAC activity with the targeting activity of an antibody. For example, but not by way of limitation, a WRN-specific DAC of the present disclosure can comprise a WRN-specific PROTAC, e.g., as described in detail above, operably linked to an antibody, e.g., a monoclonal antibody. In certain embodiments, the antibody component of the WRN-specific DAC is selected such that it allows for the desired targeting of the WRN-specific PROTAC component of the WRN-specific DAC. For example, the antibody component can be selected to provide for targeting to cells expressing a particular surface marker, e.g., a cell surface marker associated with cancer. In certain embodiments, the cell surface marker is associated with an MSI-H cancer. In certain embodiments, the MSI-H cancer is selected from: adrenocortical carcinoma, glioblastoma multiforme, chronic lymphocytic leukemia, lower-grade glioma, pediatric neuroblastoma, bladder carcinoma, lung adenocarcinoma, prostate adenocarcinoma, lung squamous cell carcinoma, skin cutaneous melanoma, sarcoma, head and neck squamous cell carcinoma, liver hepatocellular carcinoma, thymoma, cholangiocarcinoma, ovarian serous cystadenocar cinoma, kidney renal clear cell carcinoma, breast carcinoma, esophageal carcinoma, mesothelioma, Wilms tumor, cervical squamous cell carcinoma, endocervical adenocarcinoma, uterine carcinosarcoma, rectal adenocarcinoma, stomach adenocarcinoma, colon adenocarcinoma, and uterine corpus endometrial carcinoma.

[0164] 3.2 Facilitating WRN Association with Chromatin

[0165] In certain embodiments, the present disclosure is directed to methods and compositions for the treatment of cancers, e.g., cancers comprising MSI-H cells, by facilitating WRN association with chromatin. For example, but not by way of limitation, compositions facilitating WRN association with chromatin can comprise a WRN-binding component operably linked to a chromatin binding component. In certain embodiments, the WRN-binding component can be an inhibitor, e.g., one of the WRN inhibitors disclosed herein, a WRN-specific antibody, or any other composition capable of selectively binding WRN. In certain embodiments, the chromatin binding component can be a DNA binding protein, e.g., a known chromatin modification reader, a known chromatin modification writer, or a known chromatin modification eraser. Exemplary readers, writers, and erasers are summarized in Ji et al., PNAS, 112 (12) 3841-3846 (2015), which is incorporated herein by reference in its entirety.

[0166] As used herein, “WRN-chromatin tethering compositions” are compositions that directly facilitate the interaction between WRN and chromatin, e.g., bifunctional molecules that bind both WRN, via WRN binding component, and chromatin, via DNA binding component. WRN-chromatin tethering compositions can be contrasted with the WRN inhibitors disclosed herein, where the association of WRN with chromatin in the case of the WRN inhibitors disclosed herein is an indirect (i.e., non-targeted) result of inhibitor binding. WRN-chromatin tethering compositions, on the other hand, target both WRN and chromatin to effectuate tethering.

[0167] 3.3 Facilitating WRN Localization to Nuclear Foci on Chromatin

[0168] In certain embodiments, the present disclosure is directed to methods and compositions for the treatment of cancers, e.g., cancers comprising MSI-H cells, by facilitating WRN localization from the nucleolus to nuclear foci on chromatin. In certain embodiments, compositions facilitating WRN localization from the nucleolus to nuclear foci on chromatin comprise a composition that modulates WRN acetylation. In certain embodiments, such compositions promote WRN acetylation and thus are described as WRN acetylation agonists.

[0169] As used herein, “a composition that modulates WRN acetylation” and “a WRN acetylation agonist” encompasses: (1) compositions that promote the acetylation of WRN, which has been shown to induce relocalization of WRN from the nucleolus to nuclear foci on chromatin; as well as (2) compositions that inhibit de-acetyl ati on of WRN (thus preserving the acetylated form of WRN). In certain embodiments, the WRN acetylation agonist enhances the activity of p300 and / or CBP. In certain embodiments, the composition that modulates WRN acetylation is a member of the sirtuin family of NAD+ dependent deacetylases. In certain embodiments, the member of the sirtuin family of NAD+ dependent deacetylases that modulates WRN acetylation is SIRT1.

[0170] EXEMPLARY EMBODIMENTS

[0171] In certain embodiments, the present disclosure relates to methods of modulating WRN activity in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a targeted protein degrader (TPD) composition targeting WRN.

[0172] In certain embodiments, the present disclosure relates to methods of inhibiting WRN activity in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a TPD composition targeting WRN.

[0173] In certain embodiments, the present disclosure relates to methods of treating a disorder or disease in a subject, comprising administering to the subject a therapeutically effective amount of a TPD composition targeting WRN.

[0174] In certain embodiments, the present disclosure relates to methods of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a TPD composition targeting WRN.

[0175] In certain embodiments, the present disclosure relates to methods of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a TPD composition targeting WRN, wherein the cancer is characterized as microsatellite instability-high (MSI-H) and / or mismatch repair deficient (dMMR). In certain embodiments, the cancer is characterized as MSI-H and / or dMMR is selected from colorectal, gastric, bladder, endometrial, adrenocortical, uterine, cervical, esophageal, central nervous system, head and neck, breast, kidney, liver, lung, skin, prostate and ovarian cancer.

[0176] In certain embodiments, the TPD targeting WRN is a proteolysis-targeting chimera (PROTAC).

[0177] In certain embodiments, the PROTAC comprises an E3 ligase binder.

[0178] In certain embodiments, the E3 ligase binder is selected from FEM1B, RNF4, CRBN, VHL, IAP, MDM2, cIAPl, Keapl, and DCAF15

[0179] In certain embodiments, the PROTAC comprises a compound selected from either A) or B), which are defined as: (Formula I)

[0180] Rs is Ci-Ce alkyl, C2-C6 alkenyl, C2-C6 alkynyl or C3-C6 cycloalkyl;

[0181] Re and R7 are independently selected from H or halogen;

[0182] Ri is NR30R31, aryl, C3-C7 cycloalkyl ring, or 4-, 5-, 6-, or 7- membered heterocyclyl ring; wherein when Ri is NR30R31, R30 and R31 are independently selected from optionally substituted Ci-Ce alkyl, C2-C6 alkenyl, C2-C6 alkynyl, or H; wherein when Ri is aryl, the aryl is fused with a 5- or 6-membered heterocyclyl ring, wherein the said 5- or 6-membered heterocyclyl ring comprises carbon atoms and at least one oxygen and / or at least one nitrogen atom, and wherein the said 5- or 6- membered heterocyclyl ring is optionally substituted with C1-C3 alkyl; wherein when Ri is C3-C7 cycloalkyl ring, the said C3-C7 cycloalkyl is a fully saturated ring; wherein when Ri is a 4- or 7-membered heterocyclyl ring, the said 4- or 7-membered heterocyclyl ring comprises carbon atoms and at least one of a nitrogen or oxygen atom, or the said 4- or 7-membered heterocyclyl ring is optionally linked with a second substituted or unsubstituted 4-, 5-, or 6-membered heterocyclyl ring, wherein the said second 4-, 5-, or 6-membered heterocyclyl ring comprises carbon atoms and at least one of a nitrogen or oxygen atom, wherein the said 4- or 7-membered heterocyclyl ring is linked with the said second 4-, 5-, or 6-membered heterocyclyl ring by one carbon atom to form a spiro ring or two carbon atoms to form a fused ring; wherein when Ri is a 5- or 6-membered heterocyclyl ring, the said 5- or 6-membered heterocyclyl ring is a fully saturated ring comprising carbon atoms and at least one of a nitrogen atom or oxygen atom, wherein the said 5- or 6-membered heterocyclyl ring is linked with a second substituted or unsubstituted 4-, 5-, or 6- membered heterocyclyl ring to form a spiro ring, or the said 5- or 6-membered heterocyclyl ring is joined with a second substituted or unsubstituted 4-, 5-, or 6-membered heterocyclyl ring to form a fused ring, wherein the said second 4-, 5-, or 6-membered heterocyclyl ring is a saturated ring comprising carbon atoms and at least one of a nitrogen atom or oxygen atom, or the 5-membered heterocyclyl ring is a pyrazole ring, wherein the pyrazole ring is joined with a second substituted or unsubstituted 4-, 5-, or 6- membered heterocyclyl ring to form a fused ring, wherein the said second 4- , 5-, or 6- membered heterocyclyl ring is a saturated ring comprising carbon atoms and at least one of a nitrogen atom or oxygen atom, or the 6-membered heterocyclyl ring is a pyridinyl ring, wherein the pyridinyl ring is joined with a second substituted or unsubstituted 4-, 5-, or 6- membered heterocyclyl ring to form a fused ring; or n is 0, 1, or 2, X and Y are independently selected from C or N, R2 and R3 are independently selected from H, -NRsRo, -C(0)Rio, -S(02)RIO, substituted or unsubstituted C2-C3 alkenyl, or substituted or unsubstituted 5- or 6-membered heterocyclyl ring, or R2 and R3 join together to form an unsubstituted or substituted fused 4-, 5-, or 6-membered heterocyclyl ring, wherein when the 4-, 5-, or 6-membered heterocyclyl ring is substituted, the substituents are selected from a 5- or 6- membered heterocyclyl ring or -C(O)Rn, wherein Rn is a C1-C3 alkyl or substituted 5- or 6- membered heterocyclyl ring; wherein when n is 0, X is N, Y is C, R2 is NRsRo, and R3 is H; wherein when n is 1, X and Y are C, R2 is NRsRo and R3 is H or R2 and R3 join together to form a substituted fused 4-membered heterocyclyl ring, wherein the substituted 4-membered heterocyclyl ring is substituted with -C(O)Rn, and wherein Rn is a substituted 5- or 6-membered heterocyclyl ring; wherein when R2 is NRsRo, Rs and R9 are independently selected from H, C1-C4 alkyl, and -C(O)Rn, wherein Rn is a substituted or unsubstituted 5- or 6-membered heterocyclyl ring; wherein when n is 2,

[0183] X is C, Y is N, and R2 and R3 join together to form an unsubstituted or substituted fused 4- or 5-membered heterocyclyl ring, wherein when the 5- membered heterocyclyl ring is substituted, the substituents are selected from a 5- or 6-membered heterocyclyl ring or -C(O)Rn, wherein Rn is a C1-C3 alkyl or substituted 5- or 6-membered heterocyclyl ring, or

[0184] X is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio is Ci-Ce alkyl, Ci-Ce alkenyl, a C3-C7 cycloalkyl ring, a 5- or 6-membered heterocyclyl ring, wherein Rio is optionally substituted with -OH, C1-C3 alkoxy, an optionally substituted C3-C5 cycloalkyl ring, halogen, -S(O2)CH3, and / or - C(O)N(CH3)2, or

[0185] X is C, Y is N, R2 is H, R3 is substituted or unsubstituted 5- or 6-membered heterocyclyl ring, or

[0186] X is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio is selected from: wherein A, W, P, S, T, U, V, and Z are independently selected from H, C, N, S, or O and wherein = refers to a single or a double bond; wherein when Rio wherein when T is

[0187] N, Rio are independently selected from N or C; and wherein when T is C, Rio wherein when N = M and M=Z are both single bonds, M is C(O) and Z is N or C substituted with H or C1-C3 alkyl; and when one of N = M and M=Z is a single-bond and one is a double-bond, M and Z are independently selected from C or N, optionally substituted with H or C1-C3 alkyl; wherein when Rw is , R12, R13, and R14 are independently selected from H, -OH, or C1-C3 alkyl, or R12 and R13 join together to form a fused substituted or unsubstituted 5- or 6- membered heterocyclyl ring, wherein when the said 5- or 6- membered heterocyclyl ring is substituted, the substituents are selected from C1-C3 alkyl; wherein when wherein when U is N+, R15 is O', Rie and R17 are H, and U = V is a double bond; wherein when U is C, R15 is -OH or -NR19R20; wherein when R15 is -OH, Rie is a carbonyl, R17 and Ris join together to form a fused 5- or 6- membered heterocyclyl ring, and U= V is a single bond, or Rie is H or CH3, R17 and Ri8 are H, and U=V is a double bond; wherein when R15 is NR19R20, U=V is a doublebond and Rie, R17, Ri8, R19, and R20 are independently selected from H, -CH3, -C(O)R2i, -S(O2)R2i, and - S(O)R2iR22, wherein R21 and R22 are independently selected from C1-C3 alkyl, C3-C5 cycloalkyl ring, or 5- or 6- membered heterocyclyl ring or R21 and R22 join together to form a substituted or unsubstituted C3-C5 cycloalkyl ring;

[0188] R4 is selected from wherein L and G are independently selected from C, N, or O, n is 0, 1, or 2, and x is 1 or 2; wherein when alkyl, wherein the C1-C4 alkyl is optionally substituted with halogens selected from F or

[0189] Cl; wherein when

[0190] C4 alkyl, wherein the C1-C4 alkyl is optionally substituted with halogens selected from F or Cl; wherein when single or double bond; wherein when L

[0191] = G is a double bond, G and L are independently selected from C or N, R25 and R29 are independently selected from H, halogen, or -C(O), R26 and R27 are independently selected from H, Ci-Ce alkyl, Ci-Ce haloalkyl, -OR28, or -S(O)mR28, wherein m is 0-2, R28 is a methyl or trihalomethyl group, or either R25 or R27 join with R26 to form a C4-C7 cycloalkyl ring or a 5- or 6- membered heterocyclyl ring, optionally substituted with -OH, alkyl, haloalkyl, or halogen; or

[0192] B) A compound of formula (I), wherein:

[0193] Rs is Ci-Ce alkyl, Ci-Ce alkenyl, Ci-Ce alkynyl or C3-C6 cycloalkyl;

[0194] Re and R7 are independently selected from H or halogen; wherein when n is 0, 1, or 2, X and Y are independently selected from C or N, R2 and R3 are independently selected from H, -NRsRo, -C(0)Rio, -S(02)RIO, substituted or unsubstituted C2-C3 alkenyl, or substituted or unsubstituted 5- or 6-membered heterocyclyl ring, or R2 and R3 join together to form an unsubstituted or substituted fused 4-, 5-, or 6-membered heterocyclyl ring, wherein when the 4-, 5-, or 6-membered heterocyclyl ring is substituted, the substituents are selected from a 5- or 6- membered heterocyclyl ring or -C(O)Rn, wherein Rn is a C1-C3 alkyl or substituted 5- or 6- membered heterocyclyl ring; wherein when n is 0, X is N, Y is C, R2 is NRsRo, and R3 is H; wherein when n is 1, X and Y are C, R2 is NRsRo and R3 is H or R2 and R3 join together to form a substituted fused 4-membered heterocyclyl ring, wherein the substituted 4-membered heterocyclyl ring is substituted with -C(O)Rn, and wherein Rn is a substituted 5- or 6-membered heterocyclyl ring; wherein when R2 is NRsRo, Rs and R9 are independently selected from H, C1-C4 alkyl, and -C(O)Rn, wherein Rn is a substituted or unsubstituted 5- or 6-membered heterocyclyl ring; wherein when n is 2,

[0195] X is C, Y is N, and R2 and R3 join together to form an unsubstituted or substituted fused 4- or 5-membered heterocyclyl ring, wherein when the 5- membered heterocyclyl ring is substituted, the substituents are selected from a 5- or 6-membered heterocyclyl ring or -C(O)Rn, wherein Rn is a C1-C3 alkyl or substituted 5- or 6-membered heterocyclyl ring, or

[0196] X is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio is Ci-Ce alkyl, Ci-Ce alkenyl, a C3-C7 cycloalkyl ring, a 5- or 6-membered heterocyclyl ring, wherein Rio is optionally substituted with -OH, C1-C3 alkoxy, an optionally substituted C3-C5 cycloalkyl ring, halogen, -S(O2)CH3, and / or - C(O)N(CH3)2, or X is C, Y is N, R2 is H, R3 is substituted or unsubstituted 5- or 6-membered heterocyclyl ring, or

[0197] X is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio is selected from: wherein A, W, P, S, T, U, V, and Z are independently selected from H, C, N, S, or O and wherein = refers to a single or a double bond; wherein when Rio wherein when T is

[0198] N, Rio are independently selected from N or C; and wherein when T is C, Rio wherein when N = M and M=Z are both single bonds, M is C(O) and Z is N or C substituted with H or C1-C3 alkyl; and when one of N = M and M=Z is a single-bond and one is a double-bond, M and Z are independently selected from C or N, optionally substituted with H or C1-C3 alkyl; wherein when Rio is R12, R13, and R14 are independently selected from H, -OH, or C1-C3 alkyl, or R12 and R13 join together to form a fused substituted or unsubstituted 5- or 6- membered heterocyclyl ring, wherein when the 5- or 6- membered heterocyclyl ring is substituted, the substituents are selected from Ci- C3 alkyl; wherein when wherein when U is N+, R15 is O', Rie and R17 are H, and U = V is a double bond; wherein when U is C, R15 is -OH or -NR19R20; wherein when R15 is -OH, Rie is a carbonyl, R17 and Ris join together to form a fused 5- or 6- membered heterocyclyl ring, and U = V is a single bond; wherein when R15 is NR19R20, U=V is a doublebond and Rie, R17, Ri8, R19, and R20 are independently selected from H, -CH3, -C(O)R2i, -S(O2)R2i, and - S(O)R2iR22, wherein R21 and R22 are independently selected from C1-C3 alkyl, C3-C5 cycloalkyl ring, or 5- or 6- membered heterocyclyl ring or R21 and R22 join together to form a substituted or unsubstituted C3-C5 cycloalkyl ring; or independently selected from C, N, or O, n is 0, 1, or 2, and x is 1 or 2; wherein when alkyl, wherein the C1-C4 alkyl is optionally substituted with halogens selected from F or Cl; wherein when

[0199] C4 alkyl, wherein the C1-C4 alkyl is optionally substituted with halogens selected from F or Cl; wherein when single or double bond; wherein when

[0200] L=G is a double bond, G and L are independently selected from C or N, R25 and R29 are independently selected from H, halogen, or -C(O), R26 and R27 are independently selected from H, Ci-Ce alkyl, Ci-Ce haloalkyl, -OR28, or -S(O)mR28, wherein m is 0-2, R28 is a methyl or trihalomethyl group, or either R25 or R27 join with R26 to form a C4-C7 cycloalkyl ring or a 5- or 6- membered heterocyclyl ring, optionally substituted with -OH, alkyl, haloalkyl, or halogen;

[0201] Ri is 5- or 6-membered saturated or unsaturated heterocyclyl comprising carbon atoms and at least one heteroatom selected from N, O and S, wherein the said 5- or 6-membered saturated or unsaturated heterocyclyl is optionally substituted by 1 or 2 substituted or unsubstituted C1-C4 alkyl, wherein the said 5- or 6-membered saturated or unsaturated heterocyclyl is optionally fused with a C3-C7 cycloalkyl or C3-C7 heterocycloalkyl, wherein the C3-C7 heterocycloalkyl comprises carbon atoms and at least one heteroatom selected from N, O and S.

[0202] In certain embodiments, the PROTAC comprises a compound represented by formula (I) that is selected from:

[0203]

[0204] In certain embodiments, the cancer is a MSI-H and / or dMMR cancer.

[0205] In certain embodiments, the MSI-H and / or dMMR cancer is selected from colorectal, gastric, bladder, endometrial, adrenocortical, uterine, cervical, esophageal, central nervous system, head and neck, breast, kidney, liver, lung, skin, prostate and ovarian cancer

[0206] In certain embodiments, the TPD targeting WRN is a deubiquitinating enzymes (DUB) inhibitor.

[0207] In certain embodiments, the TPD targeting WRN is a molecular glue composition.

[0208] In certain embodiments, the TPD targeting WRN is a degrader-antibody complex (DAC).

[0209] In certain embodiments, the DAC comprises an anti-WRN antibody.

[0210] In certain embodiments, the DAC comprises an antibody that specifically binds a cancer associated antigen.

[0211] In certain embodiments, the cancer associated antigen is a cell surface antigen.

[0212] In certain embodiments, the cancer is a MSI-H and / or dMMR cancer.

[0213] In certain embodiments, the MSI-H and / or dMMR cancer is selected from colorectal, gastric, bladder, endometrial, adrenocortical, uterine, cervical, esophageal, central nervous system, head and neck, breast, kidney, liver, lung, skin, prostate and ovarian cancer.

[0214] In certain embodiments, the DAC comprises an E3 ligase binder.

[0215] In certain embodiments, the E3 ligase binder is selected from FEM1B, RNF4, CRBN, VHL, IAP, MDM2, cIAPl, Keapl, and DCAF15.

[0216] In certain embodiments, the DAC comprises a compound selected from either A) or

[0217] B), which are defined as: (Formula I)

[0218] Rs is Ci-Ce alkyl, C2-C6 alkenyl, C2-C6 alkynyl or C3-C6 cycloalkyl;

[0219] Re and R7 are independently selected from H or halogen;

[0220] Ri is NR30R31, aryl, C3-C7 cycloalkyl ring, or 4-, 5-, 6-, or 7- membered heterocyclyl ring; wherein when Ri is NR30R31, R30 and R31 are independently selected from optionally substituted Ci-Ce alkyl, C2-C6 alkenyl, C2-C6 alkynyl, or H; wherein when Ri is aryl, the aryl is fused with a 5- or 6-membered heterocyclyl ring, wherein the said 5- or 6-membered heterocyclyl ring comprises carbon atoms and at least one oxygen and / or at least one nitrogen atom, and wherein the said 5- or 6- membered heterocyclyl ring is optionally substituted with C1-C3 alkyl; wherein when Ri is C3-C7 cycloalkyl ring, the said C3-C7 cycloalkyl is a fully saturated ring; wherein when Ri is a 4- or 7-membered heterocyclyl ring, the said 4- or 7-membered heterocyclyl ring comprises carbon atoms and at least one of a nitrogen or oxygen atom, or the said 4- or 7-membered heterocyclyl ring is optionally linked with a second substituted or unsubstituted 4-, 5-, or 6-membered heterocyclyl ring, wherein the said second 4-, 5-, or 6-membered heterocyclyl ring comprises carbon atoms and at least one of a nitrogen or oxygen atom, wherein the said 4- or 7-membered heterocyclyl ring is linked with the said second 4-, 5-, or 6-membered heterocyclyl ring by one carbon atom to form a spiro ring or two carbon atoms to form a fused ring; wherein when Ri is a 5- or 6-membered heterocyclyl ring, the said 5- or 6-membered heterocyclyl ring is a fully saturated ring comprising carbon atoms and at least one of a nitrogen atom or oxygen atom, wherein the said 5- or 6-membered heterocyclyl ring is linked with a second substituted or unsubstituted 4-, 5-, or 6- membered heterocyclyl ring to form a spiro ring, or the said 5- or 6-membered heterocyclyl ring is joined with a second substituted or unsubstituted 4-, 5-, or 6-membered heterocyclyl ring to form a fused ring, wherein the said second 4-, 5-, or 6-membered heterocyclyl ring is a saturated ring comprising carbon atoms and at least one of a nitrogen atom or oxygen atom, or the 5-membered heterocyclyl ring is a pyrazole ring, wherein the pyrazole ring is joined with a second substituted or unsubstituted 4-, 5-, or 6- membered heterocyclyl ring to form a fused ring, wherein the said second 4- , 5-, or 6- membered heterocyclyl ring is a saturated ring comprising carbon atoms and at least one of a nitrogen atom or oxygen atom, or the 6-membered heterocyclyl ring is a pyridinyl ring, wherein the pyridinyl ring is joined with a second substituted or unsubstituted 4-, 5-, or 6- membered heterocyclyl ring to form a fused ring; or n is 0, 1, or 2, X and Y are independently selected from C or N, R2 and R3 are independently selected from H, -NRsRg, -C(0)Rio, -S(02)RIO, substituted or unsubstituted C2-C3 alkenyl, or substituted or unsubstituted 5- or 6-membered heterocyclyl ring, or R2 and R3 join together to form an unsubstituted or substituted fused 4-, 5-, or 6-membered heterocyclyl ring, wherein when the 4-, 5-, or 6-membered heterocyclyl ring is substituted, the substituents are selected from a 5- or 6- membered heterocyclyl ring or -C(O)Rn, wherein Rn is a C1-C3 alkyl or substituted 5- or 6- membered heterocyclyl ring; wherein when n is 0, X is N, Y is C, R2 is NRsRo, and R3 is H; wherein when n is 1, X and Y are C, R2 is NRsRo and R3 is H or R2 and R3 join together to form a substituted fused 4-membered heterocyclyl ring, wherein the substituted 4-membered heterocyclyl ring is substituted with -C(0)Rn, and wherein Rn is a substituted 5- or 6-membered heterocyclyl ring; wherein when R2 is NRsRo, Rs and R9 are independently selected from H, C1-C4 alkyl, and -C(0)Rn, wherein Rn is a substituted or unsubstituted 5- or 6-membered heterocyclyl ring; wherein when n is 2,

[0221] X is C, Y is N, and R2 and R3 join together to form an unsubstituted or substituted fused 4- or 5-membered heterocyclyl ring, wherein when the 5- membered heterocyclyl ring is substituted, the substituents are selected from a 5- or 6-membered heterocyclyl ring or -C(O)Rn, wherein Rn is a C1-C3 alkyl or substituted 5- or 6-membered heterocyclyl ring, or

[0222] X is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio is Ci-Ce alkyl, Ci-Ce alkenyl, a C3-C7 cycloalkyl ring, a 5- or 6-membered heterocyclyl ring, wherein Rio is optionally substituted with -OH, C1-C3 alkoxy, an optionally substituted C3-C5 cycloalkyl ring, halogen, -S(O2)CH3, and / or - C(O)N(CH3)2, or

[0223] X is C, Y is N, R2 is H, R3 is substituted or unsubstituted 5- or 6-membered heterocyclyl ring, or

[0224] X is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio is selected from: wherein A, W, P, S, T, U, V, and Z are independently selected from H, C, N, S, or O and wherein = refers to a single or a double bond; wherein when Rio wherein when T is

[0225] N, Rio are independently selected from N or C; and wherein when T is C, Rio wherein when N = M and M=Z are both single bonds, M is C(O) and Z is N or C substituted with H or C1-C3 alkyl; and when one of N=M and M=Z is a single-bond and one is a double-bond, M and Z are independently selected from C or N, optionally substituted with H or C1-C3 alkyl; wherein when Rw is , R12, R13, and R14 are independently selected from H, -OH, or C1-C3 alkyl, or R12 and R13 join together to form a fused substituted or unsubstituted 5- or 6- membered heterocyclyl ring, wherein when the said 5- or 6- membered heterocyclyl ring is substituted, the substituents are selected from C1-C3 alkyl; wherein when wherein when U is N+, R15 is O', Rw and R17 are H, and U = V is a double bond; wherein when U is C, R15 is -OH or -NR19R20; wherein when R15 is -OH, Ri6 is a carbonyl, R17 and Ris join together to form a fused 5- or 6- membered heterocyclyl ring, and U= V is a single bond, or Ri6 is H or CH3, R17 and Ris are H, and U = V is a double bond; wherein when R15 is NR19R20, U=V is a doublebond and Rie, R17, Ri8, R19, and R20 are independently selected from H, -CH3, -C(O)R2i, -S(O2)R2i, and - S(O)R2iR22, wherein R21 and R22 are independently selected from C1-C3 alkyl, C3-C5 cycloalkyl ring, or 5- or 6- membered heterocyclyl ring or R21 and R22 join together to form a substituted or unsubstituted C3-C5 cycloalkyl ring;

[0226] R4 is selected from wherein L and G are independently selected from C, N, or O, n is 0, 1, or 2, and x is 1 or 2; wherein when alkyl, wherein the C1-C4 alkyl is optionally substituted with halogens selected from F or Cl; wherein when C4 alkyl, wherein the C1-C4 alkyl is optionally substituted with halogens selected from F or Cl; wherein when single or double bond; wherein when L

[0227] = G is a double bond, G and L are independently selected from C or N, R25 and R29 are independently selected from H, halogen, or -C(O), R26 and R27 are independently selected from H, Ci-Ce alkyl, Ci-Ce haloalkyl, -OR28, or -S(O)mR28, wherein m is 0-2, R28 is a methyl or trihalomethyl group, or either R25 or R27 join with R26 to form a C4-C7 cycloalkyl ring or a 5- or 6- membered heterocyclyl ring, optionally substituted with -OH, alkyl, haloalkyl, or halogen;

[0228] OR

[0229] B) A compound of formula (I), wherein:

[0230] Rs is Ci-Ce alkyl, Ci-Ce alkenyl, Ci-Ce alkynyl or C3-C6 cycloalkyl;

[0231] Re and R7 are independently selected from H or halogen; wherein when n is 0, 1, or 2, X and Y are independently selected from C or N, R2 and R3 are independently selected from H, -NRsRg, -C(0)Rio, -S(02)RIO, substituted or unsubstituted C2-C3 alkenyl, or substituted or unsubstituted 5- or 6-membered heterocyclyl ring, or R2 and R3 join together to form an unsubstituted or substituted fused 4-, 5-, or 6-membered heterocyclyl ring, wherein when the 4-, 5-, or 6-membered heterocyclyl ring is substituted, the substituents are selected from a 5- or 6- membered heterocyclyl ring or -C(O)Rn, wherein Rn is a C1-C3 alkyl or substituted 5- or 6- membered heterocyclyl ring; wherein when n is 0, X is N, Y is C, R2 is NRsRo, and R3 is H; wherein when n is 1, X and Y are C, R2 is NRsRo and R3 is H or R2 and R3 join together to form a substituted fused 4-membered heterocyclyl ring, wherein the substituted 4-membered heterocyclyl ring is substituted with -C(0)Rn, and wherein Rn is a substituted 5- or 6-membered heterocyclyl ring; wherein when R2 is NRsRo, Rs and R9 are independently selected from H, C1-C4 alkyl, and -C(0)Rn, wherein Rn is a substituted or unsubstituted 5- or 6-membered heterocyclyl ring; wherein when n is 2,

[0232] X is C, Y is N, and R2 and R3 join together to form an unsubstituted or substituted fused 4- or 5-membered heterocyclyl ring, wherein when the 5- membered heterocyclyl ring is substituted, the substituents are selected from a 5- or 6-membered heterocyclyl ring or -C(O)Rn, wherein Rn is a C1-C3 alkyl or substituted 5- or 6-membered heterocyclyl ring, or

[0233] X is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio is Ci-Ce alkyl, Ci-Ce alkenyl, a C3-C7 cycloalkyl ring, a 5- or 6-membered heterocyclyl ring, wherein Rio is optionally substituted with -OH, C1-C3 alkoxy, an optionally substituted C3-C5 cycloalkyl ring, halogen, -S(O2)CH3, and / or - C(O)N(CH3)2, or

[0234] X is C, Y is N, R2 is H, R3 is substituted or unsubstituted 5- or 6-membered heterocyclyl ring, or

[0235] X is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio is selected from: wherein A, W, P, S, T, U, V, and Z are independently selected from H, C, N, S, or O and wherein = refers to a single or a double bond; wherein when Rio wherein when T is

[0236] N, Rio are independently selected from N or C; and wherein when T is C, Rio wherein when N = M and M=Z are both single bonds, M is C(O) and Z is N or C substituted with H or C1-C3 alkyl; and when one of N=M and M=Z is a single-bond and one is a double-bond, M and Z are independently selected from C or N, optionally substituted with H or C1-C3 alkyl; wherein when Rio is R12, R13, and R14 are independently selected from H, -OH, or C1-C3 alkyl, or R12 and R13 join together to form a fused substituted or unsubstituted 5- or 6- membered heterocyclyl ring, wherein when the 5- or 6- membered heterocyclyl ring is substituted, the substituents are selected from Ci- C3 alkyl; wherein when wherein when U is N+, R15 is O', Rie and R17 are H, and U = V is a double bond; wherein when U is C, R15 is -OH or -NR19R20; wherein when R15 is -OH, Rie is a carbonyl, R17 and Ris join together to form a fused 5- or 6- membered heterocyclyl ring, and U= V is a single bond; wherein when R15 is NR19R20, U=V is a doublebond and Rie, R17, Ri8, R19, and R20 are independently selected from H, -CH3, -C(O)R2i, -S(O2)R2i, and - S(O)R2iR22, wherein R21 and R22 are independently selected from C1-C3 alkyl, C3-C5 cycloalkyl ring, or 5- or 6- membered heterocyclyl ring or R21 and R22 join together to form a substituted or unsubstituted C3-C5 cycloalkyl ring; wherein L and G are independently selected from C, N, or O, n is 0, 1, or 2, and x is 1 or 2; wherein when alkyl, wherein the C1-C4 alkyl is optionally substituted with halogens selected from F or Cl; wherein when C4 alkyl, wherein the C1-C4 alkyl is optionally substituted with halogens selected from F or Cl; wherein when single or double bond; wherein when

[0237] L=G is a double bond, G and L are independently selected from C or N, R25 and R29 are independently selected from H, halogen, or -C(O), R26 and R27 are independently selected from H, Ci-Ce alkyl, Ci-Ce haloalkyl, -OR28, or -S(O)mR28, wherein m is 0-2, R28 is a methyl or trihalomethyl group, or either R25 or R27 join with R26 to form a C4-C7 cycloalkyl ring or a 5- or 6- membered heterocyclyl ring, optionally substituted with -OH, alkyl, haloalkyl, or halogen;

[0238] Ri is 5- or 6-membered saturated or unsaturated heterocyclyl comprising carbon atoms and at least one heteroatom selected from N, O and S, wherein the said 5- or 6-membered saturated or unsaturated heterocyclyl is optionally substituted by 1 or 2 substituted or unsubstituted C1-C4 alkyl, wherein the said 5- or 6-membered saturated or unsaturated heterocyclyl is optionally fused with a C3-C7 cycloalkyl or C3-C7 heterocycloalkyl, wherein the C3-C7 heterocycloalkyl comprises carbon atoms and at least one heteroatom selected from N, O and S.

[0239] In certain embodiments, the DAC comprises a compound represented by formula

[0240] (I) that is selected from:

[0241] In certain embodiments, the present disclosure relates to a method of modulating WRN activity in a subject. The method comprises administering to the subject a therapeutically effective amount of a WRN-chromatin tethering composition targeting WRN.

[0242] In certain embodiments, the method comprises administering to the subject a therapeutically effective amount of a WRN-chromatin tethering composition targeting WRN.

[0243] In certain embodiments, the present disclosure relates to a method of treating a disorder or disease in a subject, comprising administering to the subject a therapeutically effective amount of a WRN-chromatin tethering composition targeting WRN.

[0244] In certain embodiments, the present disclosure relates to a method of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a WRN-chromatin tethering composition targeting WRN.

[0245] In certain embodiments, the present disclosure relates to a method of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a WRN-chromatin tethering composition targeting WRN, wherein the cancer is characterized as microsatellite instability-high (MSI-H) and / or mismatch repair deficient (dMMR).

[0246] In certain embodiments, the cancer characterized as MSI-H and / or dMMR is selected from colorectal, gastric, bladder, endometrial, adrenocortical, uterine, cervical, esophageal, central nervous system, head and neck, breast, kidney, liver, lung, skin, prostate and ovarian cancer.

[0247] In certain embodiments, the WRN-chromatin tethering composition targeting WRN comprises an anti-WRN antibody.

[0248] In certain embodiments, the WRN-chromatin tethering composition targeting WRN comprises a DNA binding moiety.

[0249] In certain embodiments, the DNA binding moiety comprises a small molecule capable of binding DNA.

[0250] In certain embodiments, the DNA binding moiety comprises a peptide or polypeptide capable of binding DNA.

[0251] In certain embodiments, the DNA binding moiety comprises a nucleic acid capable of binding DNA.

[0252] In certain embodiments, the present disclosure relates to a method of modulating WRN activity in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a composition that modulates WRN acetylation.

[0253] In certain embodiments, the present disclosure relates to a method of inhibiting WRN activity in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a WRN acetylation agonist composition.

[0254] In certain embodiments, the present disclosure relates to a method of treating a disorder or disease in a subject, comprising administering to the subject a therapeutically effective amount of a WRN acetylation agonist composition.

[0255] In certain embodiments, the present disclosure relates to a method of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a WRN acetylation agonist composition.

[0256] In certain embodiments, the present disclosure relates to a method of treating cancer in a subject, comprising administering a WRN acetylation agonist composition, wherein the cancer is characterized as microsatellite instability-high (MSI-H) and / or mismatch repair deficient (dMMR).

[0257] In certain embodiments, the cancer characterized as MSI-H and / or dMMR is selected from colorectal, gastric, bladder, endometrial, adrenocortical, uterine, cervical, esophageal, central nervous system, head and neck, breast, kidney, liver, lung, skin, prostate and ovarian cancer. In certain embodiments, the WRN acetylation agonist enhances the activity of p300 and / or CBP.

[0258] In certain embodiments, the composition that modulates WRN acetylation is a member of the sirtuin family of NAD+ dependent deacetylases.

[0259] In certain embodiments, the member of the sirtuin family of NAD+ dependent deacetylases is SIRT1.

[0260] EXAMPLES

[0261] The presently disclosed subject matter will be better understood by reference to the following example, which is provided as exemplary of the presently disclosed subject matter, and not by way of limitation.

[0262] Materials & Methods

[0263] Single Molecule Tracking (SMT). Cells were seeded on tissue culture treated 384- well glass-bottom plates at 6000 cells per well. Seeded cells were then incubated at 37 °C and 5% CO2 to allow adhesion overnight. For all SMT experiments, cells were incubated with 50 pM of JF549-HTL (Cat. No. GAI 110, Promega) and 50 nM Hoechst 33342 for an hour in complete medium. Cells were then washed three times in DPBS and twice in imaging media, which is fluoroBrite DMEM media (Cat. No. Al 896701, Thermo Fisher) supplemented with GlutaMAX (Cat. No. 35050079, Thermo Fisher) and the same serum and antibiotics as growth media. Where appropriate, compounds (i.e., Inhibitor A or Inhibitor B) were serially diluted in an Echo Qualified 384-Well Low Dead Volume Source Microplate (0018544, Beckman Coulter) to generate dose-titration source material. Compounds were administered at a final 1 : 1000 dilution in cell culture medium. Each dose of a compound has at least 5 replicates per plate and 3 plate replicates, 20 DMSO control wells and 2 no dye control wells were randomized across each plate. Unless otherwise specified, compounds were allowed to incubate for 4 hours at 37 °C prior to image acquisition.

[0264] All image acquisition using SMT was performed on a custom-built microscope based on a Nikon Ti2, motorized stage, stage top environmental chamber (OKO labs), quadband filter cube (Chroma), custom laser launch with 405 nm, and 561 nm wavelengths, delivering >10 mW and >150 mW of power to the back focal plane of the objective, respectively. Fluorescence emission was passed through a high-speed filter wheel (Finger Lakes Instruments) and collected with a backlit CMOS camera (Prime 95b, Teledyne). Images were acquired with a 60X 1.27 NA water immersion objective (Nikon). For each field of view, 200 SMT frames were collected. 10 frames of the Hoechst channel were collected for downstream registration of trajectories to nuclei.

[0265] Image acquisition yielded one JF549 movie and one Hoechst movie per field of view (FOV). The JF549 movie was used to track the motion of individual JF549 molecules, while the Hoechst movie was used for nuclear segmentation.

[0266] For tracking, a custom pipeline was employed that operates in three sequential steps. First, dye molecules are detected using a generalized log likelihood ratio detector. The position of each detected emitter is then estimated using a Levenberg-Marquardt fitting routine with an integrated 2D Gaussian spot model starting from an initial guess afforded by the radial symmetry method. Detected emitters were then linked into trajectories using a custom algorithm.

[0267] For nuclear segmentation, all frames of the Hoechst movie were averaged to generate a mean projection. This mean projection was then segmented with a UNET -based convolutional neural network trained on human-labeled nuclei. Each spot was then assigned to at most one nucleus using its subpixel coordinates.

[0268] Differential Viability. All cell lines used were obtained from ATCC. To assess microsatellite unstable sensitivity, the human colorectal cancer cell line HCT-116 (CVCL_1724) was used. The MSS cell lines HT-29 (CVCL_0320) and U2OS (CVCL_0042) were used to assess general off-target cytotoxic effects.

[0269] All cell lines were cultured in McCoy 5 A media (ThermoFisher Cat# 16600082) supplemented with 10% fetal bovine serum (Cytiva Cat# SH30071.03IH25), lx penicillin / streptomycin (ThermoFisher Cat# 15140122), lx non-essential ammino acids (ThermoFisher Cat# 11140050), 2 mM GlutaMAX (ThermoFisher Cat# 35050079). Cells were cultured at 37 °C in a humidified 5% CO2 incubator.

[0270] To seed cells, cells were trypsinized and resuspended in complete culture media to the desired concentration (HCT-116: 10,000 cells / mL; HT-29: 25,000 cells / mL; U2OS: 7,000 cells / mL). Cell suspensions were seeded in 50 pL of complete culture media and onto 384-well white clear-bottom plates (ThermoFisher Cat# 164610) using a Multidrop™ Combi liquid dispenser in the slowest setting in triplicate. After 24 h, cells were treated with compounds in a 10-pt, 3.16 step serial dilution using an Echo acoustic liquid dispenser (Beckman). DMSO was backfilled to a final concentration of 0.1%. 10 pM etoposide (Cpos) and DMSO (Cneg) were used as reference compounds. 96 h post compound addition, plates were evacuated to decant all media. To measure viability, cellular ATP concentrations were measured by adding 20 pL of lx CellTiterGlo 2.0 solution (1 partPBS, 1 part CellTiterGlo2.0 stock solution; Promega Cat# G9241) using a Multidrop™ Combi liquid dispenser and measuring the luminescence on a SpectraMax iD3 (Molecular Devices).

[0271] Percent viability was calculated by the following equation: %V = (T- CPos) / (CPos - Cneg) * 100, where %V is percent viability and T is the measured luminescence of the wells treated with test compound. The effective compound concentration leading to a 50% reduction in viability (ECso), and the resulting cell viability measured at the highest tested compound tested (cmax) was carried out by fitting a 4-parameter non-linear regression using GraphPad Prism. At least three biological replicates were done per compound tested

[0272] DNA Damage Induction Assay. Cell lines and growth conditions are identical to the above conditions. Rationale of using these cells is stated above as, with the use of MSS cell lines to assess general DNA damage inducing compounds.

[0273] To seed cells for the assay, cells were trypsinized and resuspended in complete culture media to the desired concentration (HCT-116: 50,000 cells / mL; HT-29: 60,000 cells / mL; U2OS: 30,000 cells / mL). Cell suspensions were seeded in 50 pL of complete culture media and onto 384-well black clear-bottom optical plastic plates (Greiner Bio-One Cat# 781097) using a Multidrop™ Combi liquid dispenser in the slowest setting in triplicate. After 24 h, cells were treated with compounds in a 10-pt, 3.16 step serial dilution using an Echo acoustic liquid dispenser and incubated at 37 °C in a humidified 5% CO2 incubator. 10 pM etoposide (Cpos) and DMSO (Cneg) were used as reference compounds.

[0274] 24 h after compound treatments, cells were fixed in 4% paraformaldehyde for 10 min, washed three times with PBS, then blocked and permeabilized in PBS containing 10% goat serum and 0.1% triton X-100 for at least 30 min. After blocking and permeabilization, plates were evacuated to decant all media. Primary antibody against yH2A.X (Ser 139) raised in mice (Millipore Sigma, Cat# 05-636, clone JBW3201) in blocking / permeabilization solution was added to plates and incubated for 3 h at 25 °C. After 1° antibody incubation, plates were evacuated and decanted to remove all media. Blocking / permeabilization solution containing the DNA counterstain Hoechst, and a secondary antibody against mice (raised in goats) conjugated to a AlexaFluor 647 fhiorophore (ThermoFisher Cat# A32728), were added to empty plates, and incubated for 30 min at 25 °C, in the dark. After 2° antibody incubation, plates were washed 3 times in PBS, and sealed with thermal foil seals. Sealed plates were imaged using an ImageXpress Micro slit confocal microscope (Molecular Devices) using a 40x water immersion objective, and 6 fields of views per well. Exposure parameters were optimized to prevent pixel saturation for each channel. Images were analyzed using MetaXpress Custom Module Editor, by using a Hoechst mask to identify nuclei, then measuring the integrated AlexaFluor 648 intensity across all nuclei in the FOV and then averaged.

[0275] Percent yH2A.X signal was calculated by using the following equation: %S = (T- Cpos) / (CPos - Cneg) * 100, where %S is percent yH2A.X signal and T is the measured yH2A.X fluorescence of the wells treated with test compounds, , Cposand Cnegare reference compounds defined above. The effective compound concentration leading to a 50% induction of yH2A.X signal (EC50), and the resulting cell yH2A.X signal measured at the highest tested compound tested (cmax) was carried out by fitting a 4-parameter non-linear regression using GraphPad Prism. At least three biological replicates were done per compound tested.

[0276] Cell Line Engineering. WRNHal° HCT116 and U2OS were generated by nucleofection of ribonucleoprotein (RNP) complexes (DeWitt et al., 2017) using a guide (5’ - AAAGATGAGTGAAAAAAAAT - 3’) targeting the N-terminus of the WRN gene locus and a megamer coding for the Halo tag as a donor template (5’ -

[0277] TATTGTATCTGTTTTGTTTTGTGATTCTAGCTCTTATAACCTATGCTTGG ACCTAGGTGTCATAACTTACTTTAAATATGTATGTTTGGTTTTCATTCATATTG ACAGTACTACCTCTCAGTTTTCTTTCAGATATTGTTTTGTATTTACCCATGAAG ACATTGTTTTTTGGACTCTGCAAATACCACATTTCAAAGATGGCAGAAATCGG TACTGGCTTTCCATTCGACCCCCATTATGTGGAAGTCCTGGGCGAGCGCATGC ACTACGTCGATGTTGGTCCGCGCGATGGCACCCCTGTGCTGTTCCTGCACGGT AACCCGACCTCCTCCTACGTGTGGCGCAACATCATCCCGCATGTTGCACCGAC CCATCGCTGCATTGCTCCAGACCTGATCGGTATGGGCAAATCCGACAAACCAG ACCTGGGTTATTTCTTCGACGACCACGTCCGCTTCATGGATGCCTTCATCGAAG CCCTGGGTCTGGAAGAGGTCGTCCTGGTCATTCACGACTGGGGCTCCGCTCTG GGTTTCCACTGGGCCAAGCGCAATCCAGAGCGCGTCAAAGGTATTGCATTTAT GGAGTTCATCCGCCCTATCCCGACCTGGGACGAATGGCCAGAATTTGCCCGCG AGACCTTCCAGGCCTTCCGCACCACCGACGTCGGCCGCAAGCTGATCATCGAT CAGAACGTTTTTATCGAGGGTACGCTGCCGATGGGTGTCGTCCGCCCGCTGAC TGAAGTCGAGATGGACCATTACCGCGAGCCGTTCCTGAATCCTGTTGACCGCG AGCCACTGTGGCGCTTCCCAAACGAGCTGCCAATCGCCGGTGAGCCAGCGAA CATCGTCGCGCTGGTCGAAGAATACATGGACTGGCTGCACCAGTCCCCTGTCC CGAAGCTGCTGTTCTGGGGCACCCCAGGCGTTCTGATCCCACCGGCCGAAGCC GCTCGCCTGGCCAAAAGCCTGCCTAACTGCAAGGCTGTGGACATCGGCCCGGG TCTGAATCTGCTGCAAGAAGACAACCCGGACCTGATCGGCAGCGAGATCGCG CGCTGGCTGTCGACGCTCGAGATTTCCGGCGAAAACCTGTATTTTCAGAGCAG TGAAAAAAAATTGGAAACAACTGCACAGCAGCGGAAATGTCCTGAATGGATG AATGTGCAGAATAAAAGATGTGCTGTAGAAGAAAGAAAGGTATGTTGTTCAT TGACTATTCTTTTGGGTGAGAAATTTAATTTATATTTGACTGTGCAAAGAGTCA GTTGTTACTTGTAAACTTCAAGTCATTGTTTAGGTCAGAG - 3’). RNPs were assembled with Alt-R™ S.p. HiFi Cas9 Nuclease V3 (IDT, 1081060) in a 10 pl reaction of

[0278] 1 pM of Cas9, 120 pmol sgRNA, and 100 pmol ssODN in Cas9 buffer (20 mM HEPES 7.5, 150 mM KC1, 10% glycerol, 1 mM TCEP). Reactions were gently mixed for 30s and incubated for lOmin at room temperature. RNP complexes and 200k cells resuspended in 20 pl buffer SE (Lonza) were added to a nucleofection strip and the mixture pulsed with program EH-100 (Lonza 4D-Nucleofector). Cells were sorted into single cells and plated into 96-well plates. Clones were Sanger sequenced to identify positive clones containing the desired HaloTag sequence.

[0279] HaloTag Protein Labeling. Cells were seeded in black 384-well plates using a combidrop multidrop dispenser and seeded for at least 24 h in complete growth media. To label HaloTagged proteins, JF549 (Promega, GAI 110) was added to cells using an Echo acoustic liquid dispenser to a final concentration of 25 pM. Cells were incubated at 37 °C for

[0280] 2 h, and subsequently washed 5 times in PBS, with the final wash le aving the wells empty. After washing, cells were either fixed in 4% paraformaldehyde (Electron Microscopy Sciences, 15710), or growth media was replenished to perform subsequent compound treatments. Quantifications were done by measuring the total intensity of the Halo dye signal and using the Hoechst channel as a nuclear mask. siRNA Treatments and Imaging. ON-TARGETplus siRNF4 (Horizon Discovery, L-006557-00-0005), ON-TARGETplus siPIAS4 (Horizon Discovery, L-006445-00-0005), and ON-TARGETplus Non-targeting Control siRNA#3 (Horizon Discovery, D-001810-03- 50) were resuspended to a final concentration of 20 uM in lx siRNA Buffer (Horizon Discovery, B-002000-UB-100). siRNA oligos were transferred onto black 384 pClear plates using an Echo acoustic dispenser to yield a final oligo concentration of 20 nM. 5 pL of opti- MEM (Gibco, 31985062) was added to resuspend transferred oligos. RNA oligodipid complexes were formed by adding 0.3 pL of Lipofectamine RNAiMAX (Invitrogen, 13778075) in 5 pL of opti-MEM. Complexes were incubated for 5 min before dispensing 50 pL of HCT-116 cells (100K cells / mL) and incubating in growth conditions described above After 24 h, growth media was exchanged, and labeled with HaloTag dye as described above. Compounds, or DMSO, were added at a final concentration of 10 pM, treated for 24 h, and subsequently fixed 4% PFA. Cells were permeabilized with 0.1% triton X-100 for 20 min to remove non-specific dye staining and imaged as described above or harvested for Western blot analysis as described above.

[0281] WRN In-Situ Trapping Assay . WRNHal° Cells (HCT116 or U2OS) were seeded in black 384-well plates using a combidrop multidrop dispenser and seeded for 48 h in complete media at 100K cells / mL (HCT116) or 30 K cells / mL (U2OS). Cells were labeled with HaloTag Dye as described above, and subsequently treated with desired compounds as described above for 8 h ([ML-792] = 1 pM, [Compound] = 10 pM). Following compound treatments, samples were decanted to remove all media and treated with ice cold CSK buffer (25 mM PIPES pH 7.0, 300 mM NaCl, 2 mM MgC12, 0.3 % triton X-100, 200 mM sucrose) for 2 min, on ice. Without removing buffer in wells, cells were fixed in 4% PFA supplemented with Hoechst for 15 min and washed with lx PBS 5 times using an AquaMax Plate washer (Molecular Devices). Samples were then imaged and analyzed as described above. Percent Trapped WRN was calculated by taking the WRNHALOintensities and dividing by the intensities of WRNHALOsignal in un-permeabilized cells.

[0282] WRN Imaging Degradation Assays. Cell lines and growth conditions are identical to the above conditions. Rationale of using these cells is stated above as, with the use of MSS cell lines to assess general DNA damage inducing compounds.

[0283] To seed cells for the assay, cells were trypsinized and resuspended in complete culture media to the desired concentration (WRNHal° HCT-116: 50,000 cells, WRNHal° U2OS: 30,000 cells / mL). Cell suspensions were seeded in 50 pL of complete culture media and onto 384-well black clear-bottom optical plastic plates (Greiner Bio-One Cat# 781097) using a Multidrop™ Combi liquid dispenser in the slowest setting in triplicate. After 24 h, cells were labeled with Halo dye as described above and subsequently treated with compounds in a 10-pt, 3.16 step serial dilution using an Echo acoustic liquid dispenser and incubated at 37 °C in a humidified 5% CO2 incubator. 10 pM Halo-PROTAC3 (CpOs; Promega, GA3110) and DMSO (Cneg) were used as reference compounds. 24 h after compound treatments, cells were fixed in 4% paraformaldehyde for 10 min, washed three times with PBS, then blocked and permeabilized in PBS containing 10% goat serum and 0.1% triton X-100 containing the DNA counterstain Hoechst for 30 min. Plates were washed 3 times in PBS, and sealed with thermal foil seals.

[0284] Sealed plates were imaged using an ImageXpress Micro slit confocal microscope (Molecular Devices) using a 40x water immersion objective, and 6 fields of views per well. Exposure parameters were optimized to prevent pixel saturation for each channel. Images were analyzed using MetaXpress Custom Module Editor, by using a Hoechst mask to identify nuclei, then measuring the average Halo dye intensity across all nuclei in the FOV, averaged, and then background subtracted.

[0285] Percent WRNHal° signal was calculated by using the following equation: %S = (T- Cpos) / (Cpos - Cneg) * 100, where %S is percent WRNHal° signal and T is the measured WRN-Hal° fluorescence of the wells treated with test compound. The effective compound concentration leading to a 50% induction of WRNHal° signal (EC50), and the resulting cell WRNHal° signal measured at the highest tested compound tested (cmax) was carried out by fitting a 4-parameter non-linear regression using GraphPad Prism. At least three biological replicates were done per compound tested.

[0286] Western Blotting. Samples were lysed in lx NuPAGE LDS sample buffer (Invitrogen, NP0008), sonicated, and heated at 75 °C for 10 min. Samples were normalized to protein concentration and volume using a Pierce 660 reagent kit (Invitrogen, 22660). SDS- Page was performed using standard protocols (ref). Western blot transfers were performed using an iBlot2 nitrocellulose membrane system (Invitrogen, IB23001). Membranes were blocked with Pierce™ Protein-Free Blocking Buffer (Thermo Scientific, 37572) for 30 min at room temperature, and subsequently probed with the following antibodies in blocking solution: anti-WRN clone EPR6392 (abeam, abl24673, 1 :1,000), anti-GAPDH-HRP (CST, 31460, 1 :5,000) and incubated at 4 °C overnight. The following day, blots were washed 3 times, 10 min per wash, with lx TBS-T and probed for 30 in with goat anti-Rabbit IgG (H+L)-HRP in 5% milk-TBS-T solution (Invitrogen, 31460, 1 :5,000). Blots were washed as described previously and visualized using Immobilon Forte Wester HRP substrate solution (Millipore Sigma, WBLUFOIOO), incubating membranes for 1 min and subsequently imaged using an iBright CL 1500 imaging system (Invitrogen). Example 1: Small Molecule Inhibition of WRN Leads to a Change in WRN Dynamics

[0287] As depicted in FIGs. 1A-1I, treatment of MSI-H cells with exemplary WRN inhibitors, Inhibitor A or Inhibitor B, elicits a statistically and biologically significant decrease in cellular dynamics. This slowdown in dynamics is evident by a dose-dependent decrease in the diffusion coefficient of WRN in the presence of inhibitor relative to DMSO control (FIGs. 1 A-1D), and an increase in the “fraction bound” (FIG. II). The fraction bound in this range of diffusion coefficient usually corresponds to DNA-bound proteins that tend to move slowly. These data indicate that small molecule inhibition of WRN is leading to an increase in chromatin association of WRN, which results in a slowdown of WRN dynamics.

[0288] Given that WRN is required for DNA repair in MSI-H cells, inhibition of WRN leads to a dose-dependent increase in the DNA damage response as measured by phosphorylation of H2AX (FIG. IE and 1G). Consequently, cell-dependent cell death in MSI-H cells and not MSS cells was observed (FIGs. IF and 1H).

[0289] Taken together, these data suggest that small molecule inhibition of WRN is leading to a higher engagement of WRN to chromatin. This prevents WRN from repairing DNA, leading to an increase in DNA damage and subsequent cell death.

[0290] Example 2: WNR Inhibition Leads to Chromatin Trapping and Degradation

[0291] Having observed a decrease in diffusion coefficient upon WRN inhibition, and an increase in the fraction of WRN bound to DNA, it was tested whether this was indeed due to a higher proportion of WRN bound to DNA (FIGs. 2A-2H). Cells treated with Inhibitor B for 2hrs were permeabilized with a mild detergent (TritonX-100) and fixed with paraformaldehyde to enable subcellular localization of WRN protein. An increase in WRN signal is observed in HCT-116 MSI-H cells (FIG. 2A & 2B) but not in U20S MSS cells (FIG. 2C & 2D). In a timecourse experiment, it was determined that longer exposure to WRN Inhibitor B resulted in an overall lowering of WRN protein levels in the MSI-H cells HCT-116 (FIG. 2E & 2F), but not in MSS cells U2OS (FIG. 2G & 2H). The difference in WRN protein levels between HCT-116 & U2OS cells (compare FIGs. 2E & 2F vs. FIGs. 2G & 2H) is consistent with proteasome-dependent degradation of inhibited WRN in MSI- H cells. These results are specific to treatment with a WRN inhibitor, e.g., Inhibitor B, as no retention of WRN signal was observed when this experiment was repeated with other DNA damaging compounds such as etoposide (data not shown). To determine that WRN levels in HCT-116 cells decrease due to proteosome degradation, WRNHal° HCT-116 cells can be plated for 24hrs in black 384-well plates at a density of 2,500 cells per well for imagining and in six-well plates at a density of 180,000 cells per well for Western blot analysis. Cells can then be treated for 6hrs with lOuM Inhibitor B in combination with luM carfilzomib. Cells can then be processed for image analysis or Western blotting as previously described.

[0292] Taken together, these results indicate that inhibition of WRN in MSI-H cells, e.g., via administration of WRN inhibitors such as Inhibitor B, leads to an increase in chromatin bound-WRN, which over time leads to a proteasome-dependent lowering of WRN protein levels in MSI-H cancer cells.

[0293] Example 3: WRN inhibition Results in WRN Degradation by Ubiquitin Ligase RNF4

[0294] Because the degradation of WRN is proteasome-dependent, the possibility that ubiquitin E3 ligase was responsible for modifying WRN with ubiquitin to target it for degradation was explored. To this end, an siRNA screen was performed in WRNHal° HCT- 116 cells focused on the ubiquitin pathway to identify components of the ubiquitin- proteasome system that would rescue the WRN degradation phenotype. This phenotypic screen identified the ubiquitin ligase RNF4 as rescuing the WRN inhibition degradation phenotype when the ligase was depleted. To validate the results of the screen, Western blot analysis was performed, which indeed shows WRN protein levels rescued when RNF4 is depleted from HCT-116 cells (FIG. 3). This data concludes that upon WRN inhibition, RNF4 is recruited to WRN and ubiquitylates it, targeting it for degradation by the proteasome.

[0295] Example 4: PIAS4-RNF4 SUMO-Ubiquitin Axis is Degrades Inhibited WRN

[0296] As RNF4 is a SUMO Targeted Ubiquitin Ligase (STUbL), the following experiments were performed to determine whether the SUMO cascade was involved in the degradation of WRN. Although SUMO, itself, does not target proteins for the proteasome, it can function as a signal to recruit ubiquitin ligases such as RNF4 to ubiquitylate target proteins. This was tested in the instant context by co-treating cells with WRN inhibitor, e.g., Inhibitor B, and the SUMO El inhibitor ML792. As previously reported, treatment with WRN inhibitor led to WRN degradation (FIG 4A, top middle panel, and FIG. 4B). This degradation phenotype, however, was rescued when co-treatment with ML792 was performed (FIG. 4A, top right panel and FIG. 4B). These data indicate that WRN inhibition leads to its degradation through the SUM0-RNF4 signaling axis.

[0297] While the SUM0-RNF4 axis is involved in WRN degradation, no changes in WRN inhibitor efficacy were observed upon inhibition of that axis, suggesting that WRN degradation is not necessary for the compound efficacy. A shift in the EC50 of WRN inhibitor B was observed, however, when RNF4 was depleted (FIG. 4C). In addition, stronger killing of cells was observed when the SUMO E3 ligase was depleted, and cells were treated with WRN inhibitor. Accordingly, perturbation of the SUMO cascade could, along with WRN inhibition, show therapeutic potential.

[0298] Taken together, these data elucidate the mechanism of WRN inhibition (FIG. 4D). As summarized herein, WRN inhibition leads to its chromatin trapping, which recruits the SUMOylation machinery. SUMOylated WRN functions as a recruiting signal for RNF4, which subsequently ubiquitylates WRN and targets it for degradation by the proteasome. This pathway can be modulated and enhanced for improved therapeutic outcomes.

[0299] Although the presently disclosed subject matter and its advantages have been described in detail, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the present disclosure. Moreover, the scope of the present application is not intended to be limited to the particular embodiments of the process, machine, manufacture, and composition of matter, means, methods and steps described in the specification. Accordingly, the appended claims are intended to comprise within their scope such processes, machines, manufacture, compositions of matter, means, methods or steps.

[0300] Various patents, patent applications, publications, product descriptions and protocols are cited throughout this application, the disclosure of which are incorporated herein by reference in their entireties for all purposes.

Claims

WHAT IS CLAIMED IS:

1. A method of modulating Wemer syndrome RecQ helicase (WRN) activity in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a targeted protein degrader (TPD) composition targeting WRN.

2. A method of inhibiting WRN activity in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a TPD composition targeting WRN.

3. A method of treating a disorder or disease in a subject, comprising administering to the subject a therapeutically effective amount of a TPD composition targeting WRN.

4. A method of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a TPD composition targeting WRN.

5. A method of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a TPD composition targeting WRN, wherein the cancer is characterized as microsatellite instability-high (MSI-H) and / or mismatch repair deficient (dMMR).

6. The method according to claim 5, wherein the cancer characterized as MSI-H and / or dMMR is selected from colorectal, gastric, bladder, endometrial, adrenocortical, uterine, cervical, esophageal, central nervous system, head and neck, breast, kidney, liver, lung, skin, prostate and ovarian cancer.

7. A method of any one of claims 1 -6, wherein the TPD targeting WRN is a proteolysistargeting chimera (PROTAC).

8. A method according to claim 7, wherein the PROTAC comprises an E3 ligase binder.

9. A method according to claim 8, wherein the E3 ligase binder is selected from FEM1B, RNF4, CRBN, VHL, IAP, MDM2, cIAPl, Keapl, and DCAF15.

10. A method according to any one of claims 7-9, wherein the PROTAC comprises a compound selected from either A) or B), which are defined as:(Formula I)Rs is Ci-Ce alkyl, C2-C6 alkenyl, C2-C6 alkynyl or C3-C6 cycloalkyl;Re and R7 are independently selected from H or halogen;Ri is NR30R31, aryl, C3-C7 cycloalkyl ring, or 4-, 5-, 6-, or 7- membered heterocyclyl ring; wherein when Ri is NR30R31, R30 and R31 are independently selected from optionally substituted Ci-Ce alkyl, C2-C6 alkenyl, C2-C6 alkynyl, or H; wherein when Ri is aryl, the aryl is fused with a 5- or 6-membered heterocyclyl ring, wherein the said 5- or 6-membered heterocyclyl ring comprises carbon atoms and at least one oxygen and / or at least one nitrogen atom, and wherein the said 5- or 6- membered heterocyclyl ring is optionally substituted with C1-C3 alkyl; wherein when Ri is C3-C7 cycloalkyl ring, the said C3-C7 cycloalkyl is a fully saturated ring; wherein when Ri is a 4- or 7-membered heterocyclyl ring, the said 4- or 7-membered heterocyclyl ring comprises carbon atoms and at least one of a nitrogen or oxygen atom, or the said 4- or 7-membered heterocyclyl ring is optionally linked with a second substituted or unsubstituted 4-, 5-, or 6-membered heterocyclyl ring, wherein the said second 4-, 5-, or 6-membered heterocyclyl ring comprises carbon atoms and at least one of a nitrogen or oxygen atom, wherein the said 4- or 7-membered heterocyclyl ring is linked with the said second 4-, 5-, or 6-membered heterocyclyl ring by one carbon atom to form a spiro ring or two carbon atoms to form a fused ring; wherein when Ri is a 5- or 6-membered heterocyclyl ring,the said 5- or 6-membered heterocyclyl ring is a fully saturated ring comprising carbon atoms and at least one of a nitrogen atom or oxygen atom, wherein the said 5- or 6-membered heterocyclyl ring is linked with a second substituted or unsubstituted 4-, 5-, or 6- membered heterocyclyl ring to form a spiro ring, or the said 5- or 6-membered heterocyclyl ring is joined with a second substituted or unsubstituted 4-, 5-, or 6-membered heterocyclyl ring to form a fused ring, wherein the said second 4-, 5-, or 6-membered heterocyclyl ring is a saturated ring comprising carbon atoms and at least one of a nitrogen atom or oxygen atom, or the 5-membered heterocyclyl ring is a pyrazole ring, wherein the pyrazole ring is joined with a second substituted or unsubstituted 4-, 5-, or 6- membered heterocyclyl ring to form a fused ring, wherein the said second 4- , 5-, or 6- membered heterocyclyl ring is a saturated ring comprising carbon atoms and at least one of a nitrogen atom or oxygen atom, or the 6-membered heterocyclyl ring is a pyridinyl ring, wherein the pyridinyl ring is joined with a second substituted or unsubstituted 4-, 5-, or 6- membered heterocyclyl ring to form a fused ring; or the 6-membered heterocyclyl ring is, unless n =2, X is C, Y is N,n is 0, 1, or 2, X and Y are independently selected from C or N, R2 and R3 are independently selected from H, -NRsRg, -C(0)Rio, -S(02)RIO, substituted or unsubstituted C2-C3 alkenyl, or substituted or unsubstituted 5- or 6-membered heterocyclyl ring, or R2 and R3 join together to form an unsubstituted or substituted fused 4-, 5-, or 6-membered heterocyclyl ring, wherein when the 4-, 5-, or 6-membered heterocyclyl ring is substituted, the substituents are selected from a 5- or 6- membered heterocyclyl ring or -C(O)Rn, wherein Rn is a C1-C3 alkyl or substituted 5- or 6- membered heterocyclyl ring;wherein when n is 0, X is N, Y is C, R2 is NRsRo, and R3 is H; wherein when n is 1, X and Y are C, R2 is NRsRo and R3 is H or R2 and R3 join together to form a substituted fused 4-membered heterocyclyl ring, wherein the substituted 4-membered heterocyclyl ring is substituted with -C(0)Rn, and wherein R11 is a substituted 5- or 6-membered heterocyclyl ring; wherein when R2 is NRsRo, Rs and R9 are independently selected from H, C1-C4 alkyl, and -C(0)Rn, wherein Rn is a substituted or unsubstituted 5- or 6-membered heterocyclyl ring; wherein when n is 2,X is C, Y is N, and R2 and R3 join together to form an unsubstituted or substituted fused 4- or 5-membered heterocyclyl ring, wherein when the 5- membered heterocyclyl ring is substituted, the substituents are selected from a 5- or 6-membered heterocyclyl ring or -C(O)Rn, wherein Rn is a C1-C3 alkyl or substituted 5- or 6-membered heterocyclyl ring, orX is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio is Ci-Ce alkyl, Ci-Ce alkenyl, a C3-C7 cycloalkyl ring, a 5- or 6-membered heterocyclyl ring, wherein Rio is optionally substituted with -OH, C1-C3 alkoxy, an optionally substituted C3-C5 cycloalkyl ring, halogen, -S(O2)CH3, and / or - C(O)N(CH3)2, orX is C, Y is N, R2 is H, R3 is substituted or unsubstituted 5- or 6-membered heterocyclyl ring, orX is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio is selected from:wherein A, W, P, S, T, U, V, and Z are independently selected from H, C, N, S, or O and wherein = refers to a single or a double bond;wherein when Riowherein when T isN, Rio is, and M and Z are independently selected from N or C; and wherein when T is C, Rio; wherein when N = M and M=Z are both single bonds, M is C(O) and Z is N or C substituted with H or C1-C3 alkyl; and when one of N = M and M=Z is a single-bond and one is a double-bond, M and Z are independently selected from C or N, optionally substituted with H or C1-C3 alkyl; wherein when Rw is, R12, R13, and R14 are independently selected from H, -OH, or C1-C3 alkyl, or R12 and R13 join together to form a fused substituted or unsubstituted 5- or 6- membered heterocyclyl ring, wherein when the said 5- or 6- membered heterocyclyl ring is substituted, the substituents are selected from C1-C3 alkyl; wherein whenwherein when U is N+, R15 is O', Rie and R17 are H, and U = V is a double bond; wherein when U is C, R15 is -OH or -NR19R20;wherein when R15 is -OH, Rie is a carbonyl, R17 and Ris join together to form a fused 5- or 6- membered heterocyclyl ring, and U= V is a single bond, or Rie is H or CH3, R17 and Ri8 are H, and U=V is a double bond; wherein when R15 is NR19R20, U=V is a doublebond and Rie, R17, Ri8, R19, and R20 are independently selected from H, -CH3, -C(0)R2i, -S(O2)R2i, and - S(O)R2iR22, wherein R21 and R22 are independently selected from C1-C3 alkyl, C3-C5 cycloalkyl ring, or 5- or 6- membered heterocyclyl ring or R21 and R22 join together to form a substituted or unsubstituted C3-C5 cycloalkyl ring;R4 is selected fromindependently selected from C, N, or O, n is 0, 1, or 2, and x is 1 or 2; wherein whenalkyl, wherein the C1-C4 alkyl is optionally substituted with halogens selected from F orCl;wherein whenC4 alkyl, wherein the C1-C4 alkyl is optionally substituted with halogens selected from F or Cl; X wherein when R4 is , L = G is a single or double bond; wherein when L= G is a double bond, G and L are independently selected from C or N, R25 and R29 are independently selected from H, halogen, or -C(O), R26 and R27 are independently selected from H, Ci-Ce alkyl, Ci-Ce haloalkyl, -OR28, or -S(O)mR28, wherein m is 0-2, R28 is a methyl or trihalomethyl group, or either R25 or R27 join with R26 to form a C4-C7 cycloalkyl ring or a 5- or 6- membered heterocyclyl ring, optionally substituted with -OH, alkyl, haloalkyl, or halogen;orB) A compound of formula (I), wherein:Rs is Ci-Ce alkyl, Ci-Ce alkenyl, Ci-Ce alkynyl or C3-C6 cycloalkyl;Re and R7 are independently selected from H or halogen; wherein when n is 0, 1, or 2, X and Y are independently selected from C or N, R2 and R3 are independently selected from H, -NR8R9, -C(0)Rio, -S(02)RIO, substituted or unsubstituted C2-C3 alkenyl, or substituted or unsubstituted 5- or 6-membered heterocyclyl ring, or R2 and R3 join together to form an unsubstituted or substituted fused4-, 5-, or 6-membered heterocyclyl ring, wherein when the 4-, 5-, or 6-membered heterocyclyl ring is substituted, the substituents are selected from a 5- or 6- membered heterocyclyl ring or -C(O)Rn, wherein Rn is a C1-C3 alkyl or substituted 5- or 6- membered heterocyclyl ring; wherein when n is 0, X is N, Y is C, R2 is NRsRo, and R3 is H; wherein when n is 1, X and Y are C, R2 is NRsRo and R3 is H or R2 and R3 join together to form a substituted fused 4-membered heterocyclyl ring, wherein the substituted 4-membered heterocyclyl ring is substituted with -C(0)Rn, and wherein Rn is a substituted 5- or 6-membered heterocyclyl ring; wherein when R2 is NRsRo, Rs and R9 are independently selected from H, C1-C4 alkyl, and -C(0)Rn, wherein Rn is a substituted or unsubstituted 5- or 6-membered heterocyclyl ring; wherein when n is 2,X is C, Y is N, and R2 and R3 join together to form an unsubstituted or substituted fused 4- or 5-membered heterocyclyl ring, wherein when the 5- membered heterocyclyl ring is substituted, the substituents are selected from a 5- or 6-membered heterocyclyl ring or -C(O)Rn, wherein Rn is a C1-C3 alkyl or substituted 5- or 6-membered heterocyclyl ring, orX is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio is Ci-Ce alkyl, Ci-Ce alkenyl, a C3-C7 cycloalkyl ring, a 5- or 6-membered heterocyclyl ring, wherein Rio is optionally substituted with -OH, C1-C3 alkoxy, an optionally substituted C3-C5 cycloalkyl ring, halogen, -S(O2)CH3, and / or - C(O)N(CH3)2, orX is C, Y is N, R2 is H, R3 is substituted or unsubstituted 5- or 6-membered heterocyclyl ring, orX is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio is selected from:wherein A, W, P, S, T, U, V, and Z are independently selected from H, C, N, S, or O and wherein = refers to a single or a double bond; wherein when Riowherein when T isN, Rio is, and M and Z are independently selected from N or C; and wherein when T is C, Riowherein when N = M and M=Z are both single bonds, M is C(O) and Z is N or C substituted with H or C1-C3 alkyl; and when one of N = M and M=Z is a single-bond and one is a double-bond, M and Z are independently selected from C or N, optionally substituted with H or C1-C3 alkyl; wherein when Rio isR12, R13, and R14 are independently selected from H, -OH, or C1-C3 alkyl, or R12 and R13 join together to form a fused substituted or unsubstituted 5- or 6- membered heterocyclyl ring, wherein when the 5- or 6- membered heterocyclyl ring is substituted, the substituents are selected from Ci- C3 alkyl;wherein whenwherein when U is N+, R15 is O', Ri6 and R17 are H, and U = V is a double bond; wherein when U is C, R15 is -OH or -NR19R20; wherein when R15 is -OH, Ri6 is a carbonyl, R17 and Ris join together to form a fused 5- or 6- membered heterocyclyl ring, and U = V is a single bond; wherein when R15 is NR19R20, U=V is a doublebond and Rie, R17, Ri8, R19, and R20 are independently selected from H, -CH3, -C(0)R2i, -S(O2)R2i, and - S(O)R2iR22, wherein R21 and R22 are independently selected from C1-C3 alkyl, C3-C5 cycloalkyl ring, or 5- or 6- membered heterocyclyl ring or R21 and R22 join together to form a substituted or unsubstituted C3-C5 cycloalkyl ring;, wherein L and G are independently selected from C, N, or O, n is 0, 1, or 2, and x is 1 or 2; wherein whenalkyl, wherein the C1-C4 alkyl is optionally substituted with halogens selected from F or Cl;wherein whenC4 alkyl, wherein the C1-C4 alkyl is optionally substituted with halogens selected from F or Cl; wherein whensingle or double bond; wherein whenL=G is a double bond, G and L are independently selected from C or N, R25 and R29 are independently selected from H, halogen, or -C(O), R26 and R27 are independently selected from H, Ci-Ce alkyl, Ci-Ce haloalkyl, -OR28, or -S(O)mR28, wherein m is 0-2, R28 is a methyl or trihalomethyl group, or either R25 or R27 join with R26 to form a C4-C7 cycloalkyl ring or a 5- or 6- membered heterocyclyl ring, optionally substituted with -OH, alkyl, haloalkyl, or halogen;Ri is 5- or 6-membered saturated or unsaturated heterocyclyl comprising carbon atoms and at least one heteroatom selected from N, O and S, wherein the said 5- or 6-membered saturated or unsaturated heterocyclyl is optionally substituted by 1 or 2 substituted or unsubstituted C1-C4 alkyl, wherein the said 5- or 6-membered saturated or unsaturated heterocyclyl is optionally fused with a C3-C7 cycloalkyl or C3-C7 heterocycloalkyl, wherein the C3-C7 heterocycloalkyl comprises carbon atoms and at least one heteroatom selected from N, O and S.

11. The method of claim 10, wherein the compound of formula (I) is selected from:

12. A method according to any one of claims 7-11, wherein the cancer is a MSI-H and / or dMMR cancer.

13. A method according to claim 12, wherein the MSI-H and / or dMMR cancer is selected from colorectal, gastric, bladder, endometrial, adrenocortical, uterine, cervical, esophageal, central nervous system, head and neck, breast, kidney, liver, lung, skin, prostate and ovarian cancer14. A method according to any one of claims 1-6, wherein the TPD targeting WRN is a deubiquitinating enzymes (DUB) inhibitor.

15. A method according to any one of claims 1-6, wherein the TPD targeting WRN is a molecular glue composition.

16. A method according to any one of claims 1-6, wherein the TPD targeting WRN is a degrader-antibody complex (DAC).

17. A method according to claim 16, wherein the DAC comprises an anti -WRN antibody.

18. A method according to claim 16, wherein the DAC comprises an antibody that specifically binds a cancer associated antigen.

19. A method according to claim 18, wherein the cancer associated antigen is a cell surface antigen.

20. A method according to any one of claims 14-19 wherein the cancer is a MSI-H and / or dMMR cancer.

21. A method according to claim 20, wherein the MSI-H and / or dMMR cancer is selected from colorectal, gastric, bladder, endometrial, adrenocortical, uterine, cervical, esophageal, central nervous system, head and neck, breast, kidney, liver, lung, skin, prostate and ovarian cancer.

22. A method according to any one of claims 16-19, wherein the DAC comprises an E3 ligase binder.

23. A method according to claim 22, wherein the E3 ligase binder is selected from FEM1B, RNF4, CRBN, VHL, IAP, MDM2, cIAPl, Keapl, and DCAF15.

24. A method according to any one of claims 16-23, wherein DAC comprises a compound selected from either A) or B), which are defined as:Rs is Ci-Ce alkyl, C2-C6 alkenyl, C2-C6 alkynyl or C3-C6 cycloalkyl;Re and R7 are independently selected from H or halogen;Ri is NR30R31, aryl, C3-C7 cycloalkyl ring, or 4-, 5-, 6-, or 7- membered heterocyclyl ring; wherein when Ri is NR30R31, R30 and R31 are independently selected from optionally substituted Ci-Ce alkyl, C2-C6 alkenyl, C2-C6 alkynyl, or H;wherein when Ri is aryl, the aryl is fused with a 5- or 6-membered heterocyclyl ring, wherein the said 5- or 6-membered heterocyclyl ring comprises carbon atoms and at least one oxygen and / or at least one nitrogen atom, and wherein the said 5- or 6- membered heterocyclyl ring is optionally substituted with C1-C3 alkyl; wherein when Ri is C3-C7 cycloalkyl ring, the said C3-C7 cycloalkyl is a fully saturated ring; wherein when Ri is a 4- or 7-membered heterocyclyl ring, the said 4- or 7-membered heterocyclyl ring comprises carbon atoms and at least one of a nitrogen or oxygen atom, or the said 4- or 7-membered heterocyclyl ring is optionally linked with a second substituted or unsubstituted 4-, 5-, or 6-membered heterocyclyl ring, wherein the said second 4-, 5-, or 6-membered heterocyclyl ring comprises carbon atoms and at least one of a nitrogen or oxygen atom, wherein the said 4- or 7-membered heterocyclyl ring is linked with the said second 4-, 5-, or 6-membered heterocyclyl ring by one carbon atom to form a spiro ring or two carbon atoms to form a fused ring; wherein when Ri is a 5- or 6-membered heterocyclyl ring, the said 5- or 6-membered heterocyclyl ring is a fully saturated ring comprising carbon atoms and at least one of a nitrogen atom or oxygen atom, wherein the said 5- or 6-membered heterocyclyl ring is linked with a second substituted or unsubstituted 4-, 5-, or 6- membered heterocyclyl ring to form a spiro ring, or the said 5- or 6-membered heterocyclyl ring is joined with a second substituted or unsubstituted 4-, 5-, or 6-membered heterocyclyl ring to form a fused ring, wherein the said second 4-, 5-, or 6-membered heterocyclyl ring is a saturated ring comprising carbon atoms and at least one of a nitrogen atom or oxygen atom, or the 5-membered heterocyclyl ring is a pyrazole ring, wherein the pyrazole ring is joined with a second substituted or unsubstituted 4-, 5-, or 6- membered heterocyclyl ring to form a fused ring, wherein the said second 4- , 5-, or 6- membered heterocyclyl ring is a saturated ring comprising carbon atoms and at least one of a nitrogen atom or oxygen atom, orthe 6-membered heterocyclyl ring is a pyridinyl ring, wherein the pyridinyl ring is joined with a second substituted or unsubstituted 4-, 5-, or 6- membered heterocyclyl ring to form a fused ring; orn is 0, 1, or 2, X and Y are independently selected from C or N, R2 and R3 are independently selected from H, -NRsRg, -C(0)Rio, -S(02)RIO, substituted or unsubstituted C2-C3 alkenyl, or substituted or unsubstituted 5- or 6-membered heterocyclyl ring, or R2 and R3 join together to form an unsubstituted or substituted fused 4-, 5-, or 6-membered heterocyclyl ring, wherein when the 4-, 5-, or 6-membered heterocyclyl ring is substituted, the substituents are selected from a 5- or 6- membered heterocyclyl ring or -C(O)Rn, wherein Rn is a C1-C3 alkyl or substituted 5- or 6- membered heterocyclyl ring; wherein when n is 0, X is N, Y is C, R2 is NRsRg, and R3 is H; wherein when n is 1, X and Y are C, R2 is NRsRg and R3 is H or R2 and R3 join together to form a substituted fused 4-membered heterocyclyl ring, wherein the substituted 4-membered heterocyclyl ring is substituted with -C(O)Rn, and wherein Rn is a substituted 5- or 6-membered heterocyclyl ring; wherein when R2 is NRsRg, Rs and R9 are independently selected from H, C1-C4 alkyl, and -C(O)Rn, wherein Rn is a substituted or unsubstituted 5- or 6-membered heterocyclyl ring; wherein when n is 2,X is C, Y is N, and R2 and R3 join together to form an unsubstituted or substituted fused 4- or 5-membered heterocyclyl ring, wherein when the 5- membered heterocyclyl ring is substituted, the substituents are selected from a 5- or 6-membered heterocyclyl ring or -C(O)Rn, wherein Rn is a C1-C3 alkyl or substituted 5- or 6-membered heterocyclyl ring, orX is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio is Ci-Ce alkyl, Ci-Ce alkenyl, a C3-C7 cycloalkyl ring, a 5- or 6-membered heterocyclyl ring, wherein Rio is optionally substituted with -OH, C1-C3 alkoxy, an optionally substituted C3-C5 cycloalkyl ring, halogen, -S(O2)CH3, and / or - C(O)N(CH3)2, orX is C, Y is N, R2 is H, R3 is substituted or unsubstituted 5- or 6-membered heterocyclyl ring, orX is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio is selected from:wherein A, W, P, S, T, U, V, and Z are independently selected from H, C, N, S, or O and wherein = refers to a single or a double bond; wherein when Riowherein when T isN, Rio is, and M and Z are independently selected from N or C; and wherein when T is C, Riowherein when N=M and M=Z are both single bonds, M is C(O) and Z is N or C substituted with H or C1-C3 alkyl; and when one of N=M and M=Z is a single-bond and one is a double-bond, M and Z are independently selected from C or N, optionally substituted with H or C1-C3 alkyl;wherein when Rw is, R12, R13, and R14 are independently selected from H, -OH, or C1-C3 alkyl, or R12 and R13 join together to form a fused substituted or unsubstituted 5- or 6- membered heterocyclyl ring, wherein when the said 5- or 6- membered heterocyclyl ring is substituted, the substituents are selected from C1-C3 alkyl; wherein whenwherein when U is N+, Rw is O', Rie and R17 are H, and U = V is a double bond; wherein when U is C, R15 is -OH or -NR19R20; wherein when R15 is -OH, Rw is a carbonyl, R17 and Rw join together to form a fused 5- or 6- membered heterocyclyl ring, and U= V is a single bond, or R is H or CH3, R17 and Rw are H, and U = V is a double bond; wherein when Rw is NR19R20, U=V is a doublebond and Rw, R17, RW, R19, and R20 are independently selected from H, -CH3, -C(O)R2i, -S(O2)R2i, and - S(O)R2iR22, wherein R21 and R22 are independently selected from C1-C3 alkyl, C3-C5 cycloalkyl ring, or 5- or 6- membered heterocyclyl ring or R21 and R22 join together to form a substituted or unsubstituted C3-C5 cycloalkyl ring;R4 is selected fromwherein L and G are independently selected from C, N, or O, n is 0, 1, or 2, and x is 1 or 2; wherein whenalkyl, wherein the C1-C4 alkyl is optionally substituted with halogens selected from F orCl; wherein whenC4 alkyl, wherein the C1-C4 alkyl is optionally substituted with halogens selected from F or Cl; wherein whensingle or double bond; wherein when L= G is a double bond, G and L are independently selected from C or N, R25 and R29 are independently selected from H, halogen, or -C(O), R26 and R27 are independently selected from H, Ci-Ce alkyl, Ci-Ce haloalkyl, -OR28, or -S(O)mR28, wherein m is 0-2, R28 is a methyl or trihalomethyl group, or either R25 or R27 join with R26 to form a C4-C7 cycloalkyl ring or a 5- or 6- membered heterocyclyl ring, optionally substituted with -OH, alkyl, haloalkyl, or halogen;ORB) A compound of formula (I), wherein:Rs is Ci-Ce alkyl, Ci-Ce alkenyl, Ci-Ce alkynyl or C3-C6 cycloalkyl;Re and R7 are independently selected from H or halogen; wherein when n is 0, 1, or 2, X and Y are independently selected from C or N, R2 and R3 are independently selected from H, -NRsRg, -C(0)Rio, -S(02)RIO, substituted or unsubstituted C2-C3 alkenyl, or substituted or unsubstituted 5- or 6-membered heterocyclyl ring, or R2 and R3 join together to form an unsubstituted or substituted fused 4-, 5-, or 6-membered heterocyclyl ring, wherein when the 4-, 5-, or 6-membered heterocyclyl ring is substituted, the substituents are selected from a 5- or 6- membered heterocyclyl ring or -C(O)Rn, wherein Rn is a C1-C3 alkyl or substituted 5- or 6- membered heterocyclyl ring; wherein when n is 0, X is N, Y is C, R2 is NRsRg, and R3 is H; wherein when n is 1, X and Y are C, R2 is NRsRg and R3 is H or R2 and R3 join together to form a substituted fused 4-membered heterocyclyl ring, wherein the substituted 4-membered heterocyclyl ring is substituted with -C(O)Rn, and wherein Rn is a substituted 5- or 6-membered heterocyclyl ring; wherein when R2 is NRsRg, Rs and R9 are independently selected from H, C1-C4 alkyl, and -C(O)Rn, wherein Rn is a substituted or unsubstituted 5- or 6-membered heterocyclyl ring;wherein when n is 2,X is C, Y is N, and R2 and R3 join together to form an unsubstituted or substituted fused 4- or 5-membered heterocyclyl ring, wherein when the 5- membered heterocyclyl ring is substituted, the substituents are selected from a 5- or 6-membered heterocyclyl ring or -C(O)Rn, wherein Rn is a C1-C3 alkyl or substituted 5- or 6-membered heterocyclyl ring, orX is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio is Ci-Ce alkyl, Ci-Ce alkenyl, a C3-C7 cycloalkyl ring, a 5- or 6-membered heterocyclyl ring, wherein Rio is optionally substituted with -OH, C1-C3 alkoxy, an optionally substituted C3-C5 cycloalkyl ring, halogen, -S(O2)CH3, and / or - C(O)N(CH3)2, orX is C, Y is N, R2 is H, R3 is substituted or unsubstituted 5- or 6-membered heterocyclyl ring, orX is C, Y is N, R2 is H, R3 is -C(0)Rio, or -S(02)RIO, and Rio is selected from:wherein A, W, P, S, T, U, V, and Z are independently selected from H, C, N, S, or O and wherein = refers to a single or a double bond; wherein when Riowherein when T isN, Rioare independently selectedfrom N or C; and wherein when T is C, Riowherein when N=M and M=Z are both single bonds, M is C(O) and Z is N or C substituted with H or C1-C3 alkyl; and when one of N=M and M=Z is a single-bond and one is a double-bond, M and Z are independently selected from C or N, optionally substituted with H or C1-C3 alkyl; wherein when Rio isR12, R13, and R14 are independently selected from H, -OH, or C1-C3 alkyl, or R12 and R13 join together to form a fused substituted or unsubstituted 5- or 6- membered heterocyclyl ring, wherein when the 5- or 6- membered heterocyclyl ring is substituted, the substituents are selected from Ci- C3 alkyl; wherein whenwherein when U is N+, R15 is O', Rie and R17 are H, and U = V is a double bond; wherein when U is C, R15 is -OH or -NR19R20; wherein when R15 is -OH, Rie is a carbonyl, R17 and Ris join together to form a fused 5- or 6- membered heterocyclyl ring, and U= V is a single bond; wherein when R15 is NR19R20, U=V is a doublebond and Rie, R17, Ri8, R19, and R20 are independently selected from H, -CH3, -C(0)R2i, -S(O2)R2i, and - S(O)R2iR22, wherein R21 and R22 are independentlyselected from C1-C3 alkyl, C3-C5 cycloalkyl ring, or 5- or 6- membered heterocyclyl ring or R21 and R22 join together to form a substituted or unsubstituted C3-C5 cycloalkyl ring; orR4 is selected fromwherein L and G are independently selected from C, N, or O, n is 0, 1, or 2, and x is 1 or 2; wherein whenalkyl, wherein the C1-C4 alkyl is optionally substituted with halogens selected from F orCl; wherein whenC4 alkyl, wherein the C1-C4 alkyl is optionally substituted with halogens selected from F or Cl; wherein whensingle or double bond; wherein whenL=G is a double bond, G and L are independently selected from C or N, R25 and R29 are independently selected from H, halogen, or -C(O), R26 and R27 are independently selected from H, Ci-Ce alkyl, Ci-Ce haloalkyl, -OR28, or -S(O)mR28, wherein m is 0-2, R28 is a methyl or trihalomethyl group, or either R25 or R27 join with R26 to form a C4-C7 cycloalkyl ring or a 5- or 6- membered heterocyclyl ring, optionally substituted with -OH, alkyl, haloalkyl, or halogen;Ri is 5- or 6-membered saturated or unsaturated heterocyclyl comprising carbon atoms and at least one heteroatom selected from N, O and S, wherein the said 5- or 6-membered saturated or unsaturated heterocyclyl is optionally substituted by 1 or 2 substituted or unsubstituted C1-C4 alkyl, wherein the said 5- or 6-membered saturated or unsaturated heterocyclyl is optionally fused with a C3-C7 cycloalkyl or C3-C7 heterocycloalkyl, wherein the C3-C7 heterocycloalkyl comprises carbon atoms and at least one heteroatom selected from N, O and S.

25. A method according to claim 24, wherein the compound of formula (I) is selected from:

26. A method of modulating WRN activity in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a WRN-chromatin tethering composition targeting WRN.

27. A method of inhibiting WRN activity in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a WRN-chromatin tethering composition targeting WRN.

28. A method of treating a disorder or disease in a subject, comprising administering to the subject a therapeutically effective amount of a WRN-chromatin tethering composition targeting WRN.

29. A method of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a WRN-chromatin tethering composition targeting WRN.

30. A method of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a WRN-chromatin tethering composition targeting WRN, wherein the cancer is characterized as microsatellite instability-high (MSI-H) and / or mismatch repair deficient (dMMR).

31. The method according to claim 30, wherein the cancer characterized as MSI-H and / or dMMR is selected from colorectal, gastric, bladder, endometrial, adrenocortical, uterine, cervical, esophageal, central nervous system, head and neck, breast, kidney, liver, lung, skin, prostate and ovarian cancer.

32. A method of any one of claims 26-31, wherein the WRN-chromatin tethering composition targeting WRN comprises an anti-WRN antibody.

33. A method according to claim 32, wherein the WRN-chromatin tethering composition targeting WRN comprises a DNA binding moiety.

34. A method according to claim 33, wherein the DNA binding moiety comprises a small molecule capable of binding DNA.

35. A method according to claim 33, wherein the DNA binding moiety comprises a peptide or polypeptide capable of binding DNA.

36. A method according to claim 33, wherein the DNA binding moiety comprises a nucleic acid capable of binding DNA.

37. A method of modulating WRN activity in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a composition that modulates WRN acetylation.

38. A method of inhibiting WRN activity in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a WRN acetylation agonist composition.

39. A method of treating a disorder or disease in a subject, comprising administering to the subject a therapeutically effective amount of a WRN acetylation agonist composition.

40. A method of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a WRN acetylation agonist composition.

41. A method of treating cancer in a subject, comprising administering a WRN acetylation agonist composition, wherein the cancer is characterized as microsatellite instability-high (MSI-H) and / or mismatch repair deficient (dMMR).

42. A method according to claim 41, wherein the cancer characterized as MSI-H and / or dMMR is selected from colorectal, gastric, bladder, endometrial, adrenocortical, uterine, cervical, esophageal, central nervous system, head and neck, breast, kidney, liver, lung, skin, prostate and ovarian cancer.

43. A method according to any one of claims 37-42, wherein the WRN acetylation agonist enhances the activity of p300 and / or CBP.

44. A method according to claim 43, wherein the composition that modulates WRN acetylation is a member of the sirtuin family of NAD+ dependent deacetylases.

45. A method according to claim 44, wherein the member of the sirtuin family of NAD+ dependent deacetylases is SIRT1.

Images