Lipid compound, nucleic acid conjugate and use thereof
By conjugating specific structurally saturated lipid compounds with nucleic acids, the problem of low intracellular delivery efficiency in the prior art is solved, and efficient delivery of multiple nucleic acids and targeted genes are achieved.
Patent Information
- Application Number
- PCT/CN2024/132723
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-11-22
- Filing Date
- 2024-11-18
- Publication Date
- 2025-05-30
AI Technical Summary
The prior art is difficult to effectively improve the intracellular delivery of nucleic acids, especially the simultaneous delivery of multiple nucleic acids and targeted delivery for specific genes.
Saturated lipid compounds of a specific structure are conjugated to nucleic acids, and binding to nucleic acids through amide, hydroxy or phosphate alleles to improve the intracellular delivery and targeting effect of nucleic acids.
It significantly improves the intracellular delivery efficiency of nucleic acids, enhances the inhibitory effect on mRNA, and achieves a major breakthrough in the simultaneous delivery of multiple nucleic acids.
Smart Images

Figure PCTCN2024132723-FTAPPB-I100001 
Figure PCTCN2024132723-FTAPPB-I100002 
Figure PCTCN2024132723-FTAPPB-I100003
Abstract
Description
Lipid compound, nucleic acid conjugate and use thereof Technical Field
[0001] The present invention belongs to the field of biomedicine, and specifically relates to a lipid compound and a nucleic acid conjugate, which significantly improves the intracellular delivery of nucleic acids, improves the delivery of targeted genes, and further achieves a major breakthrough in the simultaneous delivery of multiple nucleic acids. Background Art
[0002] Nucleic acids include ribonucleic acid (RNA) and deoxyribonucleic acid (DNA). As the basic genetic material, nucleic acids not only control protein biosynthesis but also participate in life growth, inheritance, and mutation. Nucleic acids can maintain the body's normal immune function and immune system growth and metabolism; delay aging; improve bone marrow hematopoietic function and the metabolic activity of blood components; eliminate carcinogenic factors; improve dementia; inhibit the formation of lipid peroxides and cholesterol production, dilate blood vessels, improve blood flow, correct myocardial incompensation, and promote blood vessel wall regeneration; promote cell metabolism (including pancreatic insulin-secreting cells). The nucleic acid metabolite adenosine also inhibits the breakdown of sugars, slowing sugar absorption in the small intestine. Therefore, nucleic acids can be used to maintain the immune system, fight aging, treat anemia, treat cerebral thrombosis, myocardial infarction, hypertension, atherosclerosis, and treat diabetes.
[0003] However, nucleic acids, due to their large molecular weight, hydrophilicity, and / or charge, can only enter cells via endocytosis. However, the lipid bilayer of cells can capture and retain approximately 99% of nucleic acid molecules, leading to their degradation. Studies have reported that only 0.3-1% of nucleic acids actually enter cells.
[0004] Therefore, how to improve the intracellular delivery of nucleic acids has been one of the major technical problems to be solved in this field. In particular, how to effectively deliver two or more nucleic acids into cells simultaneously is a new technical problem discovered by the present inventors.
[0005] In addition, how to improve the targeted delivery of nucleic acids to specific genes is also one of the technical problems that urgently need to be solved in this field. Summary of the Invention
[0006] The technical problems to be solved by the present invention include: how to improve the intracellular delivery of nucleic acids; how to effectively deliver multiple nucleic acids into cells at the same time; and how to improve the targeted delivery of nucleic acids to specific genes.
[0007] In order to solve the above technical problems, the present invention provides a lipid compound with a specific structure and a conjugate using the lipid compound as a conjugate.
[0008] The lipid compounds of the present invention include saturated lipid compounds having a structure represented by the following formula (A) or (B):
[0009] Among them, in the compound represented by formula (A):
[0010] The Q1 is selected from -NH2 (amino), -COOH (carboxyl), -NHCO (amide), -O-, -S-, -SS-, phosphate, thiophosphate;
[0011] Said Q2 is selected from -OH (hydroxyl), -NH2 (amino), -H or -CH3 (methyl);
[0012] Said Q3 is selected from -H or C1-C10 alkyl;
[0013] The L1 is selected from a C1-C10 saturated alkane chain;
[0014] The L2 is selected from a C1-C10 saturated alkane chain;
[0015] Said X1 is selected from O or S atoms;
[0016] The X2 is selected from O, S, -OH (hydroxy), -NH2 (amino), -CH3 (methyl), -CH2CH3 (ethyl), -OCH3 (methoxy) or -OCH2CH3 (ethoxy);
[0017] Said R1 is selected from a C10-C30 saturated fatty acid chain or a saturated alkane chain;
[0018] Among them, in the compound represented by formula (B), the five-membered ring is a five-membered ring sugar structure in ribose or deoxyribose, and the 1 position thereof is selected from CH2, O or S:
[0019] The M is selected from H, O, C or a modified or unmodified nucleotide base; preferably, the M is independently selected from adenine, uracil, thymine, guanine or cytosine;
[0020] Said N1 is selected from H or C1-C3 alkyl;
[0021] Said Y is selected from H, NH2, OH, halogen, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, MOE or 2'-O-methoxyethoxy;
[0022] Said V is selected from a C1-C4 saturated alkane chain;
[0023] The U is selected from -NH2 (amino), -COOH (carboxyl) or -NHCO (amide);
[0024] Said Z1 is selected from O or S atoms;
[0025] Said Z2 is selected from a C10-C30 alkoxy group or a C10-C30 amide saturated lipid chain;
[0026] The R2 is selected from a C10-C30 alkoxy group, a C10-C30 saturated fatty acid chain or a C10-C30 amide saturated lipid chain.
[0027] The saturated lipid compound of the present invention comprises at least one selected from the following structures (L1)-(L18):
[0028] Among them, Nu, Nu1, and Nu2 independently represent a specific and independent nucleotide sequence.
[0029] The nucleic acid conjugates of the present invention include oligonucleotide conjugates, which include an oligonucleotide and a conjugate conjugated to the oligonucleotide;
[0030] The conjugate is selected from the saturated lipid compounds described above;
[0031] Preferably, the oligonucleotide conjugate comprises a single-stranded or double-stranded oligonucleotide, preferably 2-30mer in length.
[0032] The oligonucleotide conjugates of the present invention include siRNA, which contains a sense strand and an antisense strand, and each nucleotide in the siRNA is independently a modified or unmodified nucleotide.
[0033] The oligonucleotide conjugates of the present invention include oligonucleotide conjugates in which at least one nucleotide in the sense strand or the antisense strand is a modified nucleotide.
[0034] The oligonucleotide conjugates of the present invention include oligonucleotide conjugates in which all nucleotides in the sense strand and / or antisense strand are modified nucleotides.
[0035] The oligonucleotide conjugates of the present invention include oligonucleotide conjugates in which each nucleotide in the sense strand and / or antisense strand is independently a fluorine-substituted modified nucleotide or a non-fluorine-substituted modified nucleotide;
[0036] Preferably, the fluorine substitution modification is that the hydroxyl group at position 2' of the nucleotide is replaced by F;
[0037] Preferably, the non-fluorine substitution modification is that the hydroxyl group at position 2' of the nucleotide is replaced by an alkoxy group.
[0038] The oligonucleotide conjugate of the present invention comprises at least one selected from the following structures:
[0039] The present invention also provides the use of oligonucleotide conjugates for preparing drugs for treating central nervous system diseases;
[0040] Preferably, the central nervous system diseases include Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Huntington's disease, Parkinson's disease, Dravet syndrome, Charcot triad, Alexander disease, spinocerebellar ataxia or Angelman syndrome.
[0041] The present invention also provides a pharmaceutical composition comprising the oligonucleotide conjugate of the present invention and a pharmaceutically acceptable carrier;
[0042] Preferably, the pharmaceutical composition comprises drugs for treating central nervous system diseases.
[0043] It should be noted that the five-membered ring in the structure of formula (B) described above can be a five-membered sugar structure found in ribose or deoxyribose, namely, a ribo-pentofuranose five-membered furanose, which is a ribose structure capable of carrying a saturated lipid chain. This structure can be embedded in an appropriate position within a nucleic acid sequence, allowing the sequence fragment to carry a saturated lipid chain for delivery purposes.
[0044] The lipidic compound of the present invention can be combined with nucleic acid through one site or two sites, thereby improving the intracellular delivery of nucleic acid. When the nucleic acid delivered is siRNA, the gene silencing effect can be significantly improved to inhibit the target gene. The lipidic compound of the present invention can be combined by forming a bond with a hydroxyl group (such as 2, 3 or 5 hydroxyl groups) or a phosphate group (including a thiophosphate group) in the ribose molecule of the nucleic acid. Therefore, as long as there is a hydroxyl group and / or a phosphate group in the ribose molecule of the nucleic acid, it is possible to combine the lipidic compound of the present invention and significantly improve the delivery of the nucleic acid into the cell.
[0045] When the lipidic compounds of the present invention bind to nucleic acids through two sites, simultaneous delivery of two or more nucleic acids can be achieved. The aforementioned nucleic acids include double-stranded nucleic acids and single-stranded nucleic acids. When the lipidic compounds of the present invention bind to one double-stranded nucleic acid and one single-stranded nucleic acid, the targeted delivery effect for a specific gene is significantly increased compared to binding to a single double-stranded nucleic acid or a single single-stranded nucleic acid.
[0046] In the technical solution of the present invention, the saturated fatty acid chain of C10-C30 includes -(CH2) m -COOH or -(CH2) m -COOR' 16 , m and R' 16 As defined below. In the structural formula of the present invention, the wavy line means, for example, the wavy line in formula (I), The wavy line in the formula, or the wavy line in the L1 formula, The wavy lines in the figure indicate the locations where the chemical structures are connected.
[0047] The present invention also discloses a nucleic acid conjugate, comprising an oligonucleotide and a conjugate conjugated to the oligonucleotide;
[0048] The conjugate is selected from the lipid compound;
[0049] Preferably, the nucleic acid conjugate comprises a single-stranded or double-stranded oligonucleotide, preferably 2-30mer in length.
[0050] In the nucleic acid conjugates of the present invention, the active functional oligonucleotides can be selected from the following nucleic acid substances: small interfering RNA, microRNA, single-stranded RNA, antisense nucleic acid, inducible oligonucleotide, stem-loop RNA, etc. The functional oligonucleotide is composed of a single-stranded oligonucleotide or a double-stranded oligonucleotide. The small interfering RNA in the present invention is selected from a double-stranded oligonucleotide, which contains a sense strand and an antisense strand, and the sense and antisense strands are partially or completely complementary, that is, in a double-stranded nucleic acid molecule, the bases of one strand are paired with the bases on the other strand through hydrogen bond interactions to form a partial or complete complementarity. In the double-stranded oligonucleotide, the purine base adenine (A) is paired with the pyrimidine base thymine (T) or uracil (U); the purine base guanine (G) is always paired with the pyrimidine base cytosine (C). The sequences of the two complementary chains are arranged from 5'- to 3'-, and the other is arranged from 3'- to 5'-. Each nucleotide in a small interfering RNA is independently modified or unmodified. Modification refers to the substitution of any portion of a nucleotide with another group. Modifications at the 2'-position of a nucleotide can be selected from groups such as 2'-methoxy, 2'-fluoro, 2'-methoxyethyl, 2'-2,4-dinitrophenol, 2'-amino, and 2'-4'-cycloisoethyl. Each nucleoside in the sequence is linked by a phosphodiester bond, in which one of the oxygen atoms in the phosphodiester bond is replaced by a sulfur atom to form a phosphorothioate diester bond. The sense and antisense strands typically consist of 19-23 nucleotides in length and form a complementary double-stranded pair. The sense strand nucleotide sequence is a stretch of at least nine consecutive nucleotides identical to that of the target mRNA. The antisense strand typically contains two or more consecutive deoxythymidine nucleotides or two or more consecutive uracil nucleotides. Furthermore, the target mRNA typically refers to the mRNA of a gene whose protein is abnormally expressed in the cell.
[0051] Specifically, in the nucleic acid conjugate, the oligonucleotide contains a sense strand and an antisense strand, and each nucleotide in the oligonucleotide is independently a modified or unmodified nucleotide.
[0052] Optionally, the sense strand comprises the following nucleotide sequence: 5'-CAUUUUAAUCCUCACUCUAAA-3';
[0053] Optionally, the antisense strand comprises the following nucleotide sequence: 5'-UUUAGAGUGAGGAUUAAAAUGAG-3'.
[0054] Specifically, in the nucleic acid conjugate, at least one nucleotide in the sense strand or the antisense strand is a modified nucleotide.
[0055] Specifically, in the nucleic acid conjugate, all nucleotides in the sense strand and / or the antisense strand are modified nucleotides.
[0056] Specifically, in the nucleic acid conjugate, each nucleotide in the sense strand and / or the antisense strand is independently a fluorine-substituted modified nucleotide or a non-fluorine-substituted modified nucleotide;
[0057] Preferably, the fluorine substitution modification is that the hydroxyl group at position 2' of the nucleotide is replaced by F;
[0058] Preferably, the non-fluorine substitution modification is that the hydroxyl group at position 2' of the nucleotide is replaced by an alkoxy group.
[0059] The present invention also discloses the use of the nucleic acid conjugate in preparing medicines for treating central nervous system diseases.
[0060] The present invention also discloses a pharmaceutical composition comprising the nucleic acid conjugate and a pharmaceutically acceptable carrier.
[0061] Preferably, the pharmaceutical composition comprises drugs for treating central nervous system diseases.
[0062] The lipid compounds and nucleic acid conjugates described in the present invention relate to nucleic acids, such as small nucleic acid drugs. By designing a series of lipid compounds and nucleic acid conjugates and nucleotide conjugates formed therefrom, as well as optimizing and modifying the nucleic acid and nucleotide structures, the ability to deliver nucleic acids is greatly improved, allowing nucleic acids to better act on cells and improving the delivery of nucleic acids to targeted genes.
[0063] The lipid compounds provided herein have the advantages of low raw material costs, simple synthesis methods, few synthetic steps, and high yields. For example, the starting material for preparing the key lipid compound of the present invention is priced as follows: 2,2-bis(hydroxymethyl)propionic acid 4767-03-7, analytically pure 99%, ¥23 / kg. The present invention utilizes a common esterification reaction in the chemical field, eliminating complex purification, separation, chiral, and stereospecific steps. The lipid ester preparation process of the present invention is a four-step process. In the prior art, even if each step yields 80%, the overall yield is only 40% at most. However, the present invention achieves an average overall yield of 45-50%, representing a significant milestone for industrialization.
[0064] The lipid compound has multiple connection points, which adds more options to the connection design of the active compound and has a certain promoting effect on the research of active drugs. The lipid compound contains an unsaturated fatty acid carrier, preferably with a multifunctional alkane straight chain or branched chain as a carrier linker. The lipid compound can be directly or indirectly connected to any active drug. For example, an active drug connected by a linker. The lipid compound can also be directly or indirectly connected to oligonucleotides, cholesterol, polypeptides, nanoparticles, aptamers, antibodies, nanoantibodies, small molecules, or any agent with clinical application value. For example, the lipid compound can be embedded in the sense chain or antisense chain of nucleic acid to effectively improve the targeted delivery performance of nucleic acid; preferably, the lipid compound can be embedded in the sense chain or antisense chain of siRNA; preferably, the lipid compound can be embedded in single-stranded antisense oligoribonucleic acid.
[0065] The targeted genes of the lipid-nucleic acid conjugates provided by the present invention include but are not limited to: APP, SOD1, HTT, MeCP2, DUX4, HDAC2, GPR75, Ataxin 1, Ataxin 2, Ataxin 3, Ataxin 6, Ataxin 7, C9ORF72, UBE3A, Prion, PMP22, Tau, LRRK2, LINGO2, GYS1, KCNT1, IRF5, Progranulin, GFAP, TARDBP, SNCA, FUS, SCA1, SCA7, SCA8, MeCP2, PRNP, SOD1, DMPK, MAPT and TTR, etc. By targeting the aforementioned genes, the conjugates of the present invention can be used to treat diseases associated with the aforementioned genes, such as Alzheimer's disease, Alzheimer's disease (genes: APP, HDAC2, MAPT / tau), ALS (genes: SOD1, C9orf72, TARDBP, FUS), Huntington's disease (genes: HTT, ATXN6), Rett syndrome (gene: MeCP2), facioscapulohumeral muscular dystrophy (gene: DUX4), obesity (gene: GPR75), spinocerebellar ataxia (genes: ATXN1, ATXN2, ATXN3, ATXN6, ATXN7), Angelman syndrome (gene: UBE3A), Creutzfeldt-Jakob disease (gene: CRJD1), and schizophrenia (gene: SC1A). Disease / variant Creutzfeldt-Jakob disease / Goyat disease / fatal familial insomnia (gene: Prion), Charcot-Marie-Turkish disease (gene: PMP22), Parkinson's disease (gene: LRRK2, LINGO2, SNCA), glycogen synthase deficiency (gene: GYS1), epilepsy (gene: KCNT1), inflammation (gene: IRF5), frontotemporal dementia (gene: Progranulin, FUS), Alexander disease (gene: GFAP), multiple system atrophy (gene: SNCA), Lewy body dementia (gene: SNCA), myotonic dystrophy type 1 (gene: DMPK), polyneuropathy (gene: TTR). It can be seen that after knowing the disclosure of this application, for specific diseases related to genes, those skilled in the art can reasonably select the corresponding nucleic acid targeting a specific gene and conjugate it with the lipid compound of the present invention to form a corresponding conjugate, and the conjugate produced thereby is also included in the scope of the present invention.
[0066] When a nucleic acid conjugate containing one or more nucleic acids is formed by the specific lipid compound of the present invention, significant improvement in the intracellular delivery of nucleic acids is achieved, and the level of inhibition of mRNA by nucleic acids is significantly increased.
[0067] In the field of nucleic acid delivery, the intracellular delivery of a nucleic acid, such as a double-stranded nucleic acid, is difficult to achieve. Therefore, in this area, related art improvements are generally limited to how to improve the delivery of a nucleic acid, and those skilled in the art have no motivation to attempt to deliver two nucleic acids, such as a double-stranded and a single-stranded nucleic acid simultaneously. However, the inventors have pioneered a bold attempt at two nucleic acids and related lipid compounds, and unexpectedly found that: by the lipid compound of the specific structure of the present invention, a conjugate can be formed that is simultaneously conjugated with a double-stranded and a single-stranded nucleic acid, and the conjugate achieves significant improvement in intracellular delivery and significantly improves the inhibition level of mRNA. Even more surprisingly, the inventors have also found that: in terms of nucleic acid intracellular delivery and mRNA inhibition, the conjugate of the present invention achieves a synergistic effect, that is, achieves an effect superior to using double-stranded nucleic acid or single-stranded nucleic acid alone, and achieves a synergistic effect of 1+1 greater than 2.
[0068] Therefore, the present invention has achieved a groundbreaking contribution to the field of nucleic acid delivery through specific lipid compounds. BRIEF DESCRIPTION OF THE DRAWINGS
[0069] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below based on specific embodiments of the present invention in conjunction with the accompanying drawings, wherein:
[0070] Figure 1 shows the residual SOD1 mRNA level in rat B35 cells in (1) of Example 10;
[0071] Figure 2 shows the residual SOD1 mRNA level in the brain of SD rats in (2) of Example 10;
[0072] Figure 3 shows the residual SOD1 mRNA level in the brain of SD rats in (3) of Example 10;
[0073] Figure 4 shows the residual AT×N3 mRNA levels in the mouse brain in (4) of Example 10;
[0074] Figure 5 shows the residual SOD1 mRNA level in the brain of SD rats in (5) of Example 10;
[0075] Figure 6 shows the residual SOD1 mRNA level in the rat brain in (6) of Example 10;
[0076] Figure 7 shows the residual SOD1 mRNA level in the rat brain in (7) of Example 10;
[0077] Figure 8 shows the residual human MAPT mRNA level in the mouse brain in (8) of Example 10;
[0078] Figure 9 shows the residual SOD1 mRNA level in the rat brain in (9) of Example 10;
[0079] Figure 10 shows the residual SOD1 mRNA level in the rat brain in (10) of Example 10;
[0080] Figure 11 shows the residual SOD1 mRNA level in the rat brain in (11) of Example 10;
[0081] Figure 12 shows the residual SOD1 mRNA levels in various regions of the rat brain in (12) in Example 10;
[0082] FIG. 13 shows the residual SOD1 mRNA level in the rat brain in (13) of Example 10. DETAILED DESCRIPTION
[0083] The present invention includes the following embodiments.
[0084] Embodiment 1: A lipid compound having a structure represented by the following formula (I), (II) or (V):
[0085] Wherein, the W1 is selected from a direct bond or
[0086] Said X'1 is selected from O or S atoms, or does not exist;
[0087] When X'1 is selected from O or S atoms, the X2 is selected from -O-, -S-, -SH, -OH (hydroxyl), -NH2 (amino), C1-C6 alkyl, C1-C6 alkoxy, or -O-(CH2) n’ -OR'5, R'5 is selected from H, a direct bond or R'6 is H or a direct bond, X1 is selected from O or S atoms, X4 is -OH or -SH, n' is an integer from 1 to 10; when X'1 does not exist, X2 is a direct bond;
[0088] Said T1 is selected from -(CH2) m CH3, m is an integer from 10 to 30; or
[0089] wherein Q1 and Q4 are each independently selected from a direct bond, -NH2 (amino), -COOH (carboxyl), amide (-NHCO- or -CONH-), -O-, -S-, -SS-, phosphate, or thiophosphate;
[0090] The Q2 is selected from -SH, -OH (hydroxyl), -NH2 (amino), -H, C1-C6 alkyl, preferably -CH3 (methyl), -COOH (carboxyl), amide (-NHCO- or -CONH-), -O-, -S-, -SS-, phosphate, thiophosphate, or R'7 is H or a direct bond, X1 and X4 are as defined above;
[0091] Said Q3 is selected from -H or C1-C10 alkyl;
[0092] The L1 is -(CH2) l -(NR'4) t -(CH2)q-, l and q are integers from 0 to 10 and l+q=1 to 10, t is 0 or 1, and R'4 is -CO(CH2) r COOH, r is an integer from 10 to 30;
[0093] The L2 and L3 are each independently selected from a C1-C10 saturated alkane chain or a direct bond;
[0094] The R'1 is selected from a C10-C30 saturated fatty acid chain, a C10-C30 saturated alkane chain, a C10-C30 unsaturated hydrocarbon group or -(CH2) m -X3-R'3, m is an integer of 10-30, X3 is selected from a direct bond, an oxygen atom or a sulfur atom, and R'3 is selected from a saturated six-membered heterocyclic group containing nitrogen and oxygen, H, a direct bond, or R'6, X1 and X4 are as defined above; when X3 is a direct bond, R'3 is not H, a direct bond;
[0095] When W1 is a direct bond, T1 is not -(CH2) m CH3;
[0096] In formulas (II) and (V), the five-membered ring is a five-membered ring sugar structure in ribose or deoxyribose, wherein X5 is selected from -CH2-, -CH(CH3)-, -C(CH3)2-, -O-, -NH-, -N(CH3)- or -S-;
[0097] The M' is selected from H, -O-, -C- or a modified or unmodified nucleotide base;
[0098] The N1 is selected from a direct bond, H, a C1-C3 alkyl group or R'8 is H or a direct bond, and X1 and X4 are as defined above;
[0099] N2 is selected from a direct bond, H or a C1-C3 alkyl group;
[0100] Said Y is selected from H, NH2, OH, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -O-R'9 or -O-(CH2) n -O-R' 10 , R'9 is a C1-C6 alkyl group, preferably -O-CH3, n is an integer from 1 to 6, R' 10is a C1-C6 alkyl group, preferably n is 2, R' 10 is a C1 alkyl group, i.e., 2'-methoxyethoxy;
[0101] Said V is selected from a C1-C4 saturated alkane chain or does not exist;
[0102] The U' is selected from -NH2 (amino), -COOH (carboxyl), amide (-NHCO- or -CONH-) or does not exist;
[0103] Said Z1 is selected from O or S atoms;
[0104] The Z2 is selected from a C10-C30 alkoxy group, a fatty acid chain, preferably a terminal carboxyl fatty acid, an amide lipid chain, an olefin chain, or an alkane chain;
[0105] The R'2 is selected from a C10-C30 alkoxy group, a fatty acid chain, preferably a terminal carboxyl fatty acid, an amide lipid chain, an olefin chain, an alkane chain, or is absent.
[0106] Embodiment 2: The lipid compound according to embodiment 1 has the structure represented by formula (I):
[0107] When W1 is When X'1 is selected from O or S atoms;
[0108] T1 is selected from
[0109] in,
[0110] The Q1 and Q4 are selected from a direct bond, -NH2 (amino), -COOH (carboxyl), amide (-NHCO- or -CONH-), -O-, -S-, -SS-, phosphate, or thiophosphate;
[0111] The Q2 is selected from -SH, -OH (hydroxyl), -NH2 (amino), -H, C1-C6 alkyl, preferably -CH3 (methyl), -COOH (carboxyl), amide (-NHCO- or -CONH-), -O-, -S-, -SS-, phosphate, thiophosphate or
[0112] Said Q3 is selected from -H or C1-C10 alkyl;
[0113] Said L2 and L3 are selected from C1-C10 saturated alkane chains or direct bonds;
[0114] Said X1 is selected from O or S atoms;
[0115] Said X2 is selected from -O-, -S-, -SH, -OH (hydroxyl), -NH2 (amino), C1-6 alkyl, preferably -CH3 (methyl), -CH2CH3 (ethyl), C1-6 alkoxy, preferably -OCH3 (methoxy), -OCH2CH3 (ethoxy) or -O-(CH2) n -OR'5, R'5 is selected from H, a direct bond or
[0116] The R'1 is selected from a C10-C30 saturated fatty acid chain, a C10-C30 saturated alkane chain, a C10-C30 unsaturated hydrocarbon group or -(CH2) m -X3-R'3, m is an integer of 10-30, X3 is selected from a direct bond, an oxygen atom or a sulfur atom, R'3 is a saturated six-membered heterocyclic group containing nitrogen and oxygen, H, a direct bond or
[0117] Embodiment 3: The lipid compound according to embodiment 2, wherein Q1 and Q4 are both amide groups (-NHCO- or -CONH-); Q2 is selected from -SH, -OH (hydroxyl), -S-, -O- or
[0118] R'1 is selected from a C10-C30 saturated fatty acid chain, a C10-C30 saturated alkane chain, preferably a C13-16 saturated alkane chain, more preferably a C15 saturated alkane chain, a C10-C30 unsaturated hydrocarbon group or -(CH2) m -X3-R'3, m is an integer of 10-30, preferably an integer of 2-5, more preferably 3, X3 is selected from a direct bond, an oxygen atom or a sulfur atom, R'3 is a saturated six-membered heterocyclic group containing nitrogen and oxygen, H, a direct bond or
[0119] Embodiment 4: The lipid compound according to embodiment 3, wherein L1 is -(CH2) l -(NR'4) t -(CH2)q-, t is 0.
[0120] Embodiment 5: The lipid compound according to embodiment 3, wherein L1 is -(CH2) l -(NR'4) t -(CH2)q-, l+q=1-10, t is 1;
[0121] L2 is selected from a C1-C10 saturated alkane chain or a direct bond;
[0122] L3 is a direct connection key;
[0123] Q2 is H;
[0124] Q3 is selected from -H or C1-C10 alkyl;
[0125] R'1 is -(CH2) m -X3-R'3, m is an integer of 10-30, X3 is selected from oxygen atom or sulfur atom, R'3 is H, direct bond or
[0126] Embodiment 6: According to the lipid compound of embodiment 2, Q1 is a direct bond, and Q4 is an amide group (-NHCO- or -CONH-);
[0127] L1 is -(CH2) l -(NR'4) t -(CH2)q-, l+q=1-10, t is 0;
[0128] L2 is a C1-C10 saturated alkane chain;
[0129] L3 is a direct connection key;
[0130] Q2 is selected from -SH, -OH (hydroxy), -S-, -O- or R'7 and X4 are as defined above.
[0131] Embodiment 7: According to any one of embodiments 1 to 6, the lipid compound, W1 is a direct bond, Q2 is selected from -SH, -OH (hydroxyl) or R'7 is H, and R'6 in R'1 is not a direct bond; or,
[0132] W1 is a direct bond, Q2 is selected from -S-, -O- or and R'7 is a direct bond, and R'6 in R'1 is not a direct bond; or,
[0133] W1 is a direct key, Q2 is not -S-, -O- and -SS-, when Q2 is When R'7 is H, and R'1 is -(CH2) m -X3-R'3, R'3 is a direct key or R'6 is a direct bond; or,
[0134] W1 is X2 is selected from -OH or -SH, Q2 is selected from -SH or -OH (hydroxyl), and R'3 and R'6 in R'1 are not directly connected; or,
[0135] W1 is X2 is selected from -OH or -SH, Q2 is selected from -S-, -O- or R'7 is a direct bond, and R'3 and R'6 in R'1 are not direct bonds; or,
[0136] W1 is X2 is selected from -OH or -SH, Q2 is not -S-, -O- and -SS-, when Q2 is When R'7 is H; R'3 in R'1 is a direct bond, or when R'3 is When , R'6 is a direct bond;
[0137] Preferably, W1 is a direct bond, and the wavy line of formula (I) is connected to X6, and X6 has the following structure R' 11 and R' 12 Each is independently selected from C1-C6 alkyl; Q1 is a direct bond or an amide group (-NHCO- or -CONH-), Q4 is an amide group (-NHCO- or -CONH-); Q2 is selected from -S-, -O- or H; L1 is -(CH2) l -(NR'4) t -(CH2)q-, l and q are integers from 0 to 10 and l+q=1 to 10, t is 0 or 1; when Q2 is H, L3 is a direct bond and t is 1; when Q2 is -S- or -O-, Q2 is connected to X7, and X7 is selected from (B'1) or (B'2),
[0138] Among them, R' 13 and R' 14 Each is independently selected from C1-C6 alkyl, n is an integer from 1 to 6;
[0139] Among them, R' 15 is a C1-C6 alkyl group; R'1 is selected from a C10-C30 saturated alkane chain, a C10-C30 unsaturated hydrocarbon group or -(CH2) m -X3-R'3, m is an integer from 10 to 30, X3 is selected from a direct bond, an oxygen atom or a sulfur atom, and R'3 is selected from a saturated six-membered heterocyclic group containing nitrogen and oxygen or a direct bond; when Q2 is H, R'3 is a direct bond, and R'3 is connected R' 18 and R' 19 Each independently selected from C1-C6 alkyl, n is an integer of 1-6, or,
[0140] Preferably, W1 is X'1 does not exist, and the X2 is a direct bond; the wavy line of formula (I) is connected to -(CH2) n -O-X6, n is an integer of 1-6, X6 is as defined above; T1 is -(CH2) m CH3; X2 connection-N(R' 20 )2, R' 20It is a C1-C6 alkyl group, preferably a C3 alkyl group, and more preferably an isopropyl group.
[0141] Embodiment 8: The lipid compound according to any one of embodiments 1-7, wherein in formula (I), R'1 is a C10-C30 saturated fatty acid chain, wherein the C10-C30 saturated fatty acid chain is -(CH2) m -COOH or -(CH2) m -COOR' 16 , m is an integer of 10-30, R' 16 An alkyl group selected from C1-C6 or Preferred The C1-C6 alkyl group is preferably methyl, ethyl, isopropyl or tert-butyl, R' 17 is a halogen, preferably Cl;
[0142] R'1 is a C10-C30 unsaturated hydrocarbon group, wherein the C10-C30 unsaturated hydrocarbon group is -(CH2) m -R'4, m is an integer of 10-30, R'4 is an unsaturated bond, preferably a triple bond; or
[0143] R'1 is -(CH2) n -X3-R'3, said -(CH2) n -X3-R'3, R'3 is a saturated six-membered heterocyclic group containing nitrogen and oxygen, X3 forms a bond with the nitrogen atom of R'3, preferably, in R'3, the six-membered heterocyclic ring contains one nitrogen atom and one oxygen atom and the nitrogen atom and the oxygen atom are located in the para position of the six-membered heterocyclic ring; and / or,
[0144] X2 is selected from -OH, -SH, -CH3 (methyl), -CH2CH3 (ethyl), -OCH3 (methoxy) or -OCH2CH3 (ethoxy), preferably -OH or -SH.
[0145] Embodiment 9: The lipid compound according to embodiment 1, wherein W1 is
[0146] X'1 is O or S; X2 is -(CH2) n’ -OR'5, R'5 is selected from H, a direct bond or X1, R'6 and X4 are as defined above, n' is an integer from 1 to 10; T1 is -(CH2) m CH3, m is an integer of 10-30.
[0147] Embodiment 10: According to the lipid compound of embodiment 9, R'5 is selected from a direct bond or R'6 is a direct bond.
[0148] Embodiment 11. The lipid compound according to any one of embodiments 1-10, wherein the wavy line in formula (I) is connected to H or X6.
[0149] Embodiment 12: The lipid compound according to embodiment 1 has the structure shown in formula (II) or (V), N1 is a direct bond, H, or
[0150] N2 is selected from a direct bond or H;
[0151] Y is a C1-C6 alkoxy group;
[0152] M' is selected from -O-, -C-, or a modified or unmodified nucleotide base;
[0153] When M' is a modified or unmodified nucleotide base, U', V and R'2 are all absent; preferably, M' is independently selected from adenine, uracil, thymine, guanine or cytosine; more preferably, M' is selected from or,
[0154] When M' is -O- or -C-, V is a C1-C4 saturated alkane chain, U' is an amide group (-NHCO- or -CONH-), and R'2 is an alkane chain.
[0155] Embodiment 13: According to the lipid compound of embodiment 12, the M' is independently selected from adenine, uracil, thymine, guanine or cytosine; preferably
[0156] Embodiment 14: The lipid compound according to embodiment 12 or 13 has a structure represented by formula (II) or (V), wherein X5 is O or S.
[0157] Embodiment 15: According to any one of embodiments 12-14, N1 is not a direct bond, R'8 is not a direct bond, and N2 is a direct bond; preferably, N2 is connected to X7 or,
[0158] N1 is a direct connection key, or and R'8 is a direct bond, and N2 is not a direct bond; preferably, N1 is connected to X6; or,
[0159] N1 is a direct connection key, or R'8 is a direct bond, and N2 is a direct bond; preferably, N1 is connected to X6, and N2 is connected to X7.
[0160] Embodiment 16: According to the lipid compound according to any one of embodiments 12-15, when N1, N2 and R'8 are directly connected, H is connected.
[0161] Embodiment 17: The lipidic compound according to embodiment 1, wherein the lipidic compound is selected from at least one of the following structures (L1)-(L36) and (L'10):
[0162] Table 1
[0163] Where U is After knowing the disclosure of this application, a person skilled in the art can reasonably infer that L'10 and L'10' shown below can synthesize a nucleic acid conjugate, and L'10' can synthesize a conjugate L'10":
[0164] Based on the disclosure of this application, those skilled in the art can also reasonably infer that a conjugate in which U is replaced by other bases (e.g., A, G, C) can be prepared using a method similar to that of preparing L10", and that the conjugate can also achieve the technical effects of the present invention and solve the technical problems of the present invention.
[0165] Embodiment 18. The lipidic compound according to embodiment 1, wherein the lipidic compound is selected from at least one of the following structures (L1')-(L36') and (L'10'):
[0166] Table 2
[0167] Wherein, E is selected from O and S, and U is
[0168] Embodiment 19: A nucleic acid conjugate comprising a nucleic acid and a conjugate conjugated to the nucleic acid;
[0169] The conjugate is selected from the lipid compound described in any one of embodiments 1-18.
[0170] Embodiment 20: The nucleic acid conjugate according to embodiment 19, wherein the conjugate is conjugated to a phosphate group or a hydroxyl group of ribose of the nucleic acid.
[0171] Embodiment 21: The nucleic acid conjugate according to embodiment 20 has the following structure: Nu————O————W1————T1; Formula (III)
[0172] or,
[0173] Wherein, Nu is a nucleic acid or a nucleic acid fragment, and other variables are defined as in Embodiments 1 to 18. Those skilled in the art can reasonably exclude the related technical solutions in Embodiments 1 to 18 that cannot conjugate nucleic acids or nucleic acid fragments.
[0174] Embodiment 22: The nucleic acid conjugate according to embodiment 21 has a structure of formula (III) or formula (VI), wherein X2 is -O-(CH2) n’ -OR'5, R'5 is selected from a direct bond or R'6 is a direct bond, n' is an integer from 1 to 10; or,
[0175] Q2 is selected from -O-, -S- or R'7 is selected from a direct bond; or
[0176] R'1 is selected from -(CH2) m -X3-R'3, m is an integer from 10 to 30, X3 is selected from oxygen atoms or sulfur atoms, direct bonds or R'6 is selected from a direct bond;
[0177] or,
[0178] Having the structure of formula (IV) or formula (VI), wherein N1 is a direct bond or R'8 is selected from a direct bond.
[0179] Embodiment 23. The nucleic acid conjugate according to embodiment 21, wherein Nu is a nucleic acid or a nucleic acid fragment, and other variables are defined as in any one of embodiments 7-10, 12-15 and 17-28.
[0180] Embodiment 24: The nucleic acid conjugate according to any one of Embodiments 21-23, wherein the direct bond is conjugated to a nucleic acid or a nucleic acid fragment. The direct bond includes a direct bond such as "-O-" and "-S-" that can be conjugated to a nucleic acid or a nucleic acid fragment. A person skilled in the art can reasonably understand that the direct bond does not include a direct bond that cannot be conjugated to a nucleic acid or a nucleic acid fragment.
[0181] Embodiment 25. The nucleic acid conjugate according to any one of Embodiments 21-24, wherein the nucleic acid is selected from single-stranded nucleic acids and fragments thereof or double-stranded nucleic acids and fragments thereof, the double-stranded nucleic acids and fragments thereof preferably have a length of 12-30mer, and the double-stranded nucleic acids and fragments thereof are preferably siRNA and fragments thereof; preferably, the double-stranded nucleic acids and fragments thereof have a molecular weight range of 6000-20000 Daltons; the single-stranded nucleic acids and fragments thereof preferably have a length of 12-30mer, and the single-stranded nucleic acids and fragments thereof are preferably single-stranded phosphosulfate oligonucleotides and fragments thereof; preferably, the single-stranded nucleic acids and fragments thereof have a molecular weight range of 3000-10000 Daltons.
[0182] Embodiment 26. The nucleic acid conjugate according to embodiment 25, wherein each nucleotide in the nucleic acid is independently a modified or unmodified nucleotide, or two adjacent nucleotides in the nucleic acid are linked by a phosphodiester bond, and one or more of the phosphodiester bonds are phosphorothioate diester bonds.
[0183] Embodiment 27. The nucleic acid conjugate according to embodiment 25 or 26, wherein each nucleotide in the nucleic acid is independently a fluorine-substituted modified nucleotide or a non-fluorine-substituted modified nucleotide;
[0184] Preferably, the fluorine substitution modification is that the 2'-hydroxyl group of the pentose of the nucleotide is replaced by F;
[0185] Preferably, the non-fluorine substitution modification is that the 2'-hydroxyl group of the pentose of the nucleotide is replaced by an alkoxy group, and the 2'-hydroxyl group is preferably replaced by a methoxy group or a 2'-methoxyethoxy group.
[0186] Embodiment 28. The nucleic acid conjugate according to any one of embodiments 25-27, wherein the conjugate is conjugated to the double-stranded nucleic acid; the double-stranded nucleic acid contains a sense strand and an antisense strand, preferably, the conjugate is conjugated to the 3' or 5' end of the sense strand or the antisense strand; preferably, the conjugate is conjugated to the 3' end of the sense strand.
[0187] Embodiment 29. The nucleic acid conjugate according to any one of Embodiments 25-27, wherein one side of the conjugate is conjugated to the double-stranded nucleic acid, and the other side is conjugated to the single-stranded nucleic acid; preferably, one side of the conjugate is conjugated to the sense strand of the double-stranded nucleic acid, and the other side is conjugated to the single-stranded nucleic acid to form the sense strand of the nucleic acid conjugate (e.g., SN-17001, SN-17024); preferably, the single-stranded nucleic acid is located at the 3' end (e.g., SN-17024) or 5' end (e.g., SN-17001) of the sense strand of the nucleic acid conjugate; preferably, the single-stranded nucleic acid is located at the 3' end of the sense strand of the nucleic acid conjugate.
[0188] Embodiment 30: The nucleic acid conjugate according to any one of embodiments 28-29, wherein the sequence of the sense strand is selected from the following sequences:
[0189] 1) CAUUUUAAUCCUCACUCUAAA (see sequence listing SEQ ID NO. 1),
[0190] 2) GCUCAGCAUUGCCUGAAUAAA (see SEQ ID NO. 2 in the sequence listing), or
[0191] 3) UGCAAAUAGUCUACAAACCAA (see sequence listing SEQ ID NO. 3),
[0192] The sequence of the antisense strand is selected from the following sequences:
[0193] 4) UUUAGAGUGAGGAUUAAAAUGAG (see sequence listing SEQ ID NO.4),
[0194] 5) UUUAUUCAGGCAAUGCUGAGCUU (see SEQ ID NO. 5 in the sequence listing), or
[0195] 6) UUGGUUUGUAGACUAUUUGCACA (see SEQ ID NO. 6 in the sequence listing).
[0196] Embodiment 31. The nucleic acid conjugate according to any one of embodiments 25-27, 29-30, wherein the single-stranded nucleic acid comprises a sequence selected from the group consisting of:
[0197] CCGTCGCCCTTCAGCACGCA (see sequence listing SEQ ID NO.7),
[0198] CGTCGCCCTTCAGCACGC (see sequence listing SEQ ID NO.8),
[0199] GTCGCCCTTCAGCACG (see sequence listing SEQ ID NO. 9), or
[0200] TCGCCCTTCAGCAC (see SEQ ID NO. 10 in the sequence listing), preferably, the single-stranded nucleic acid comprises TCGCCCTTCAGCAC. More preferably, the single-stranded nucleic acid is the aforementioned sequence.
[0201] Embodiment 32. The conjugate according to embodiment 19, wherein the conjugate is selected from at least one of the following structures (L1")-(L36") and (L'10"):
[0202] Table 3
[0203] In the above table, Nu, Nu1, and Nu2 independently represent nucleic acids or nucleic acid fragments; Nu, Nu1, and Nu2 may be the same or different;
[0204] Wherein, E is selected from O or S.
[0205] Embodiment 33: The nucleic acid conjugate according to embodiment 19, wherein the nucleic acid conjugate has the following structure:
[0206] Table 4
[0207] Table 5
[0208] , preferably, E is O.
[0209] Embodiment 34. Use of the nucleic acid conjugate described in any one of Embodiments 19-33 for preparing a drug for treating gene-related diseases.
[0210] Embodiment 35. The use described in embodiment 34, wherein the gene is selected from APP, SOD1, HTT, MeCP2, DUX4, HDAC2, GPR75, Ataxin 1, Ataxin 2, Ataxin 3, Ataxin 6, Ataxin 7, C9ORF72, UBE3A, Prion, PMP22, Tau, LRRK2, LINGO2, GYS1, KCNT1, IRF5, Progranulin, GFAP, TARDBP, SNCA, FUS, SCA1, SCA7, SCA8, MeCP2, PRNP, SOD1, DMPK, MAPT or TTR.
[0211] The use according to any one of Embodiment 36 and Embodiments 34-35, wherein the disease is a central nervous system disease; preferably, the central nervous system disease is selected from Alzheimer's disease, preferably Alzheimer's disease, ALS, Huntington's disease, Parkinson's disease, Dravet syndrome, Charcot triad, Alexander disease, spinocerebellar ataxia or Angelman syndrome; preferably, the disease is selected from Alzheimer's disease, ALS or spinocerebellar ataxia.
[0212] Embodiment 37, the use described in any one of Embodiments 34-36, wherein the drug is an injection or an oral preparation; preferably an injection administered intracranially, intrathecally, subcutaneously, intravenously, or intramuscularly.
[0213] Embodiment 38. A method for treating a gene-related disease, comprising administering to a subject a therapeutically effective amount of the conjugate of any one of embodiments 19-33.
[0214] Embodiment 39. The method of embodiment 38, wherein the gene is selected from APP, SOD1, HTT, MeCP2, DUX4, HDAC2, GPR75, Ataxin 1, Ataxin 2, Ataxin 3, Ataxin 6, Ataxin 7, C9ORF72, UBE3A, Prion, PMP22, Tau, LRRK2, LINGO2, GYS1, KCNT1, IRF5, Progranulin, GFAP, TARDBP, SNCA, FUS, SCA1, SCA7, SCA8, MeCP2, PRNP, SOD1, DMPK or TTR.
[0215] Embodiment 40, the method described in any one of Embodiments 38-39, wherein the disease is a central nervous system disease; preferably, the central nervous system disease is selected from Alzheimer's disease, preferably Alzheimer's disease, ALS, Huntington's disease, Parkinson's disease, Dravet syndrome, Charcot triad, Alexander disease, spinocerebellar ataxia or Angelman syndrome; preferably, the disease is selected from Alzheimer's disease, ALS or spinocerebellar ataxia.
[0216] Embodiment 41, the method according to any one of Embodiments 38-40, wherein the conjugate is administered in the form of an injection or an oral preparation; preferably, the injection is administered intracranially, intrathecally, subcutaneously, intravenously, or intramuscularly.
[0217] Embodiment 42. Use of the lipid compound described in any one of Embodiments 1-18 for preparing the nucleic acid conjugate described in any one of Claims 19-33.
[0218] In the following embodiments of the present invention, lipid compounds having the following structures are designed, which have the structures shown in the following formula (A) or (B):
[0219] Among them, in the compound represented by formula (A):
[0220] The Q1 is selected from -NH2 (amino), -COOH (carboxyl), -NHCO (amide), -O-, -S-, -SS-, phosphate, thiophosphate;
[0221] Said Q2 is selected from -OH (hydroxyl), -NH2 (amino), -H or -CH3 (methyl);
[0222] Said Q3 is selected from -H or C1-C10 alkyl;
[0223] The L1 is selected from a C1-C10 saturated alkane chain;
[0224] The L2 is selected from a C1-C10 saturated alkane chain;
[0225] Said X1 is selected from O or S atoms;
[0226] The X2 is selected from -O-, -S-, -SH, -OH (hydroxy), -NH2 (amino), -CH3 (methyl), -CH2CH3 (ethyl), -OCH3 (methoxy) or -OCH2CH3 (ethoxy);
[0227] Said R1 is selected from a C10-C30 saturated fatty acid chain or a saturated alkane chain;
[0228] Among them, in the compound represented by formula (B):
[0229] The M is selected from H, O, C or a nucleotide base; independently selected from a modified or unmodified base, such as adenine, uracil, thymine, guanine or cytosine;
[0230] Said N1 is selected from H or C1-C3 alkyl;
[0231] Said Y is selected from H, NH2, OH, halogen, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, MOE 2'-O-methoxyethoxy;
[0232] Said V is selected from a C1-C4 saturated alkane chain;
[0233] The U is selected from -NH2 (amino), -COOH (carboxyl) or -NHCO (amide);
[0234] Said Z1 is selected from O or S atoms;
[0235] Said Z2 is selected from a C10-C30 alkoxy group or a C10-C30 amide saturated lipid chain;
[0236] The R2 is selected from a C10-C30 alkoxy group, a C10-C30 saturated fatty acid chain or a C10-C30 amide saturated lipid chain.
[0237] In some embodiments, the saturated lipid chain portion is a C6-C30 acid, such as a straight-chain saturated n-hexanoic acid, n-heptanoic acid, n-octanoic acid, n-nonanoic acid, n-decanoic acid, n-undecanoic acid, n-dodecanoic acid, n-tridecanoic acid, n-tetradecanoic acid, n-pentadecanoic acid, n-hexadecanoic acid, n-heptadecanoic acid, n-octadecanoic acid, oleic acid, and linoleic acid.
[0238] In some embodiments, optional, arachidonic acid, cis-4,7,10,13,16,19-docosahexaenoic acid, vitamin A, vitamin E, cholesterol, etc., or C6-C30 alcohols (for example, hexanol, heptanol, octanol, nonanol, decanol, undecanol, dodecanol, tridecanol, tetradecanol, pentadecanol, hexadecanol, heptadecanol, octadecanol, oleyl alcohol, linolenic alcohol, arachidonic acid, cis-4,7,10,13,16,19-docosahexaenoic acid, retinol, vitamin E, cholesterol, etc.).
[0239] In some embodiments, the lipophilic moiety may contain a saturated or unsaturated lipid chain C4-C30 hydrocarbon chain (e.g., C4-C30 alkyl or alkenyl) and an optional functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne. These functional groups can be used to attach the lipophilic moiety to a double-stranded or single-stranded oligonucleotide.
[0240] In some embodiments, the lipophilic moiety contains a saturated or unsaturated C6-C18 hydrocarbon chain, such as a straight-chain C6-C18 alkyl or alkenyl group.
[0241] In one embodiment, the lipophilic moiety contains a saturated or unsaturated C16 hydrocarbon chain, such as a straight chain C16 alkyl or alkenyl group.
[0242] In some embodiments, exemplary lipid chain moieties are lipids, cholesterol, retinoic acid, bile acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexanol, hexadecylglycerol, borneol, menthol, 1,3-propylene glycol, heptadecyl, palmitic acid, myristic acid.
[0243] In some embodiments, the lipid chain portion can be directly linked to the double-stranded ribose to form a conjugate with the double-stranded ribose, wherein the portion can be conjugated to the double-stranded ribose via a linker or a carrier.
[0244] In some embodiments, the lipidic chain moiety is conjugated to the double-stranded RNA via a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfonamide bond, or a triazole with a post-site lock reaction-azide-alkyne cycloaddition.
[0245] In some embodiments, at least one lipid moiety is conjugated to the start of the 3' end of the sense strand of the duplex RNA.
[0246] In some embodiments, at least one lipid moiety is conjugated to the start of the 3' end of the antisense strand of the duplex RNA.
[0247] In some embodiments, at least one lipid moiety is conjugated to the start of the 5' end of the sense strand of the duplex RNA.
[0248] In some embodiments, at least one lipid moiety is conjugated to the start of the 5' end of the antisense strand of the duplex RNA.
[0249] In some embodiments, at least one lipid chain moiety is conjugated to any position within the sense strand sequence of the duplex RNA.
[0250] In some embodiments, at least one lipid chain moiety is conjugated to any position within the antisense strand sequence of the duplex RNA.
[0251] In some embodiments, at least one lipid chain moiety is conjugated to connect the sense strands of two sets of duplex RNAs of different sequences at the 5' and 3' ends.
[0252] In some embodiments, at least one lipid chain moiety is conjugated to connect the antisense strands of two sets of duplex RNAs of different sequences at the 5' and 3' ends.
[0253] In some embodiments, at least one lipid chain moiety is conjugated to connect the sense strands of two sets of duplex RNAs of different sequences at the 3' and 4' termini.
[0254] In some embodiments, at least one lipid chain moiety is conjugated to connect the sense strands of two sets of duplex RNAs of different sequences at the 5' and 5' ends.
[0255] In some embodiments, at least one lipid chain moiety is conjugated to connect the antisense strands of two sets of duplex RNAs of different sequences at the 3' and 4' ends.
[0256] In some embodiments, at least one lipid chain moiety is conjugated to connect the antisense strands of two sets of duplex RNAs of different sequences at the 5' and 5' ends.
[0257] In some embodiments, a phosphate or a phosphate mimetic is added to the 5' end of the antisense strand of the double-stranded RNA.
[0258] In some embodiments, the phosphate mimetic is 5'-vinylphosphonate (VP).
[0259] In some embodiments, the phosphate mimetic is a 5'-phosphonothioate.
[0260] In some embodiments, the phosphate mimetic is 5'-phosphonic acid methoxythioate.
[0261] In some embodiments, the terminus of the sense or antisense strand of the double-stranded RNA contains at least one chiral phosphorus atom. In the embodiments of the present invention, chiral modification can occur in the sense or antisense strand of the double-stranded siRNA. Each chirally pure phosphorus atom can be in the Rp configuration or the Sp configuration and combinations thereof (Iyer, RP; Gou, M; Yu, D. and Agrawal, S. “Stereoselective Synthesis of Oligonucleoside Phosphorothioates: The Nucleoside Bicyclic Oxazaphospholidines as a Novel Synthons” Tetrahedron Letters, 1998, 39, 2491; Yu, D.; Kandimalla, ER; Roskey, A.; Zhao, Q.; Chen, L.; Chen, J. and Agrawal, S. “Stereo-Enriched Phosphorothioate Oligonucleotides: Synthesis, Biophysical and Biological Properties” Bioorganic & Medicinal Chemistry, 2000, 8, 275).
[0262] In some embodiments, the siRNA further comprises at least one ASGPR ligand. ASGPR (asialoglycoprotein receptor) is a lectin highly expressed on hepatocytes that efficiently clears glycoproteins from the blood circulation. ASGPR can effectively bind to asialoglycoproteins, and thus ASGPR ligands are used for liver-specific delivery. For example, ASGPR ligands are one or more galactosamine derivatives connected by a multifunctional linker (CN 114763367 A), such as:
[0263] In the following examples of the present invention, the synthesis of the lipid compounds can be carried out using methods known and feasible in the art. For example, the synthesis of the following compounds can be carried out using a variety of methods and routes known in the art.
[0264] In the above-mentioned synthesis route, the relevant English meanings are as follows: Palmitic acid represents palmitic acid; HATU is the abbreviation of 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate; DIPEA is the abbreviation of N,N-diisopropylethylamine; DMF is the abbreviation of dimethylformamide; EDCl is the abbreviation of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide; HOBT is the abbreviation of 1-hydroxybenzotriazole; DCM is the abbreviation of dichloromethane; DMT-Cl is the abbreviation of 4,4'-dimethoxytriphenylchloromethane; Pyridine is the abbreviation of pyridine; ACN is the abbreviation of acetonitrile; yr is the abbreviation of pyridine; HCl is the abbreviation of hydrochloric acid; EtOAc is the abbreviation of ethyl acetate; DMAP is the abbreviation of 4-dimethylaminopyridine; Et3N is the abbreviation of triethylamine; NMM is the abbreviation of 4-methylmorpholine.
[0265] The synthesis routes of the above compounds are intended to illustrate that the synthesis of lipid compounds with different structures in the present invention can be carried out based on different routes in the art. Those skilled in the art can select appropriate synthesis routes and synthesis conditions based on their own raw materials and conditions.
[0266] Example 1
[0267] This example designs and synthesizes a linker with a multifunctional group having the following structure:
[0268] In this embodiment, the multifunctional linkers listed all possess the properties of polyhydroxyamine and polyhydroxycarboxyl groups. These functional groups can be used to independently connect different functional compounds to achieve the overall effect of the designed molecule. For example, hydroxyl groups can be positioned to connect small nucleic acid fragments, and two or more different independent sequence fragments can be independently connected. Amine or carboxyl groups can be connected to functional groups that are relatively stable under various conditions, such as lipid alkane chains (saturated or unsaturated), polyethylene glycol, or cholesterol functional group molecules.
[0269] Example 2
[0270] Based on the structure of the aforementioned lipid compound, this embodiment designs the phosphoramidite structure of the lipid compound monomer with the following structure. The specific structure is shown in Table 6 below.
[0271] Table 6 Lipid phosphoramidite structures
[0272] The English meanings in the above table are as follows: alkyl subsitituted group refers to an alkane substituent; Methyl is the abbreviation of methyl; Ethyl is the abbreviation of ethyl; i-Propyl is the abbreviation of isopropyl; t-Butyl is the abbreviation of tert-butyl; i-Pr is the abbreviation of isopropyl.
[0273] In this embodiment, the phosphoramidite of this partial structure is a very critical chemical reagent in the subsequent solid phase synthesis. Because the phosphoramidite is a chemical structure of trivalent phosphorus, it has a high chemical reactivity, which plays a key role in improving the yield. Since the subsequent synthesis adopts a solid phase synthesis method, the effect of purification and separation is greatly improved.
[0274] Example 3
[0275] Based on the structure of the aforementioned lipid compound, this example designed a saturated lipid linker conjugate with the following structure. The specific structure is shown in Table 7 below.
[0276] Table 7 Saturated lipid linker conjugate structures
[0277] The English meanings in the above table are as follows: Et is the abbreviation of ethyl.
[0278] In this example, since the subsequent synthesis utilizes solid-phase synthesis, the lipid chain can be linked to the phosphoramidite or directly to the solid-phase support. Considering that the lipid chain will ultimately be linked to the nucleic acid sequence, an intermediate compound will be required between the solid-phase support and the lipid chain for this purpose. Succinic acid is the optimal choice, as it ensures the connection between the two while allowing for subsequent processing to separate from the solid phase and the nucleic acid-lipid chain. Therefore, this saturated lipid-linker conjugate is an important intermediate in complementary solid-phase synthesis methods for nucleic acid-lipid chains.
[0279] Example 4
[0280] Based on the structure of the aforementioned lipid compound, this example designed the structure of the saturated lipid linker conjugate and the solid phase linker as follows. The specific structure is shown in Table 8 below.
[0281] Table 8 Saturated lipid linker conjugate solid support structure
[0282] Similar to the scheme described in Example 3 above, this example further illustrates a lipid compound monomer with a carboxyl functional group at its terminal end. Using the amino or hydroxyl groups on the solid support, the solid phase and the lipid chain of the lipid compound monomer are linked together through a condensation reaction. This allows for direct application in subsequent nucleic acid sequence synthesis.
[0283] Example 5
[0284] Based on the structure of the aforementioned lipid compound, this example designed the following lipid compound monomers as shown in Tables 1 and 2 and nucleic acid conjugates formed by the lipid compound monomers (see Tables 3-5 for specific structures).
[0285] Similar to the schemes described in Examples 2-4 above, in this example, the synthesis method for linking the lipid compound monomer with the nucleotide adopts a solid phase synthesis method.
[0286] Example 6
[0287] In this example, the aforementioned lipid compound monomers were synthesized.
[0288] (1) Synthesis of lipid compound monomer (B1)
[0289] Examples The synthesis process and specific methods of the lipid compound monomer (B1) of the present invention are described below.
[0290] Hexadecanoic acid (0.513 g, 2 mmol) was dissolved in 10 mL of dry dimethylformamide (DMF) at room temperature. Once fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (HATU, 0.78 g, 2.05 mmol) and N,N-diisopropylethylamine (DIPEA, 1 mL, 6 mmol) were gradually added in an ice bath. The reaction solution was stirred thoroughly at 0°C for 10 minutes. After the intermediate product was formed, 6-amino-2-hydroxymethyl-n-hexane-1-ol 1 (0.309 g, 2.1 mmol) was dissolved in 5 mL of dimethylformamide and added dropwise to the reaction flask. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 12 hours. The reaction solution was poured into 30 mL of saturated saline solution and solid precipitation was observed. After the solid was completely precipitated, it was filtered out and rinsed with water to remove the unreacted reagents and solvents. Finally, the product 2 (0.747 g, 97%) was dried under vacuum at room temperature and used directly in the next reaction.
[0291] Dissolve 4,4'-dimethoxytriphenylmethane (DMT-CI, 0.6 g, 1.7 mmol) in 5 mL of dichloromethane (DCM). This solution was slowly added dropwise to a solution of compound 2 (0.718 g, 1.86 mmol) in anhydrous pyridine (Py, 10 mL) at room temperature. A small amount of 4-dimethylaminopyridine (20 mg) was added to the reaction solution. The reaction solution was stirred continuously at room temperature for 14 hours. 20 mL of saturated saline solution was added to the reaction mixture, and the mixture was extracted with 2 x 50 mL of ethyl acetate (EtOAc). The organic phase was concentrated to semi-dryness by rotary evaporation and further purified by silica gel chromatography using a gradient elution, first with n-hexane solvent, then with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), and finally with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine). The product components were collected and the solvent was evaporated under reduced pressure to obtain a yellow solid 3 (0.58 g, 50%). The product 3 was directly used in the next reaction.
[0292] Dissolve compound 3 (0.58 g, 0.844 mmol) in 15 mL of dry dichloromethane, then add 0.6 mL of triethylamine. Stir and dissolve 4-dimethylaminopyridine (0.195 g, 1.6 mmol) in the reaction solution. Stir and dissolve succinic anhydride (0.127 g, 1.27 mmol) in the reaction solution at room temperature. Stir and react for 8 hours. Add succinic anhydride (32 mg, 0.32 mmol) and continue stirring at room temperature for 14 hours. Pour the reaction solution into saturated brine and extract with 2 x 50 mL of dichloromethane. Separate the organic phase, dry over anhydrous sodium sulfate, and evaporate to semi-dryness under reduced pressure. The final product B1 was purified by silica gel chromatography using a gradient elution, first with a mixed solvent (ethyl acetate / triethylamine, 100:1.5, v / v) and then with a mixed solvent (ethyl acetate / methanol / triethylamine, 10:1:0.01, v / v / v). The solvent was removed under reduced pressure to obtain a white solid compound (B1, 0.62 g, 93%). The product structure was determined as follows: 1H NMR(CDCl3):d,7.41-7.40(m,3H,trityl),7.39-7.27(m,6H,trityl),7.25-7.19(m,1H), 6.83-6.80(m,4H,trityl),4.24-4.12(m,2H),3.78(s,6H),3.19-3.16(m,2H),3.10-3.07( m, 2H), 3.03-3.01 (m, 1H), 3.00-2.99 (m, 2H), 2.56-2.54 (m, 4H), 2.15-2.12 (m, 2H), 1.60-1.57 (m, 2H), 1.43-1.39 (m, 2H), 1.34-1.20 (m, 26H), 1.19-1.17 (m, 2H), 0.89-86 (m, 3H) ppm. It can be seen that the product structure is correct.
[0293] (2) Synthesis of lipid compound monomer (B3)
[0294] Hexadecanoic acid (0.513 g, 2 mmol) was dissolved in 10 mL of dry dimethylformamide at room temperature. Once fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (0.78 g, 2.05 mmol) and N,N-diisopropylethylamine (1 mL, 6 mmol) were gradually added in an ice bath. The reaction solution was stirred thoroughly at 0°C for 10 minutes. After the intermediate product was formed, 4-amino-2-hydroxymethyl-n-butan-1-ol (0.25 g, 2.1 mmol) was dissolved in 5 mL of dimethylformamide and added dropwise to the reaction flask. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 12 hours. The reaction solution was poured into 30 mL of saturated saline solution and observed for solid precipitation. After complete solid precipitation, the solid was filtered and rinsed with water to remove any unreacted reagents and solvent. Finally, the product 5 (0.678 g, 98%) was dried under vacuum at room temperature and used directly in the next reaction.
[0295] Dissolve 4,4'-dimethoxytriphenylmethane (0.63 g, 1.9 mmol) in 4 mL of dichloromethane. This solution was slowly added dropwise to a solution of compound 5 (0.67 g, 1.86 mmol) dissolved in anhydrous pyridine (20 mL) at room temperature. A small amount of 4-dimethylaminopyridine (20 mg) was added to the reaction solution. The reaction solution was stirred continuously at room temperature for 14 hours. 30 mL of saturated saline solution was added to the reaction mixture, and extraction was performed with 2 x 50 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and further purified and separated by silica gel chromatography using a gradient elution, first with n-hexane solvent, then with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), and finally with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine). The product components were collected and the solvent was evaporated under reduced pressure to obtain a yellow solid 6 (0.76 g, 63%). The product 6 was directly used in the next reaction.
[0296] Dissolve compound 6 (0.76 g, 1.18 mmol) in 15 mL of dry dichloromethane, then add 0.8 mL of triethylamine. Stir and dissolve 4-dimethylaminopyridine (0.725 g, 5.9 mmol) in the reaction solution. Stir and dissolve succinic anhydride (0.172 g, 1.72 mmol) in the reaction solution at room temperature. Stir and react for 8 hours. Add succinic anhydride (32 mg, 0.32 mmol) and continue stirring at room temperature for 14 hours. Pour the reaction solution into saturated brine and extract with 2 x 50 mL of dichloromethane. Separate the organic phase, dry over anhydrous sodium sulfate, and evaporate to semi-dryness under reduced pressure. The final product, B3, was purified by silica gel chromatography using a gradient elution system, initially with a mixed solvent (ethyl acetate / triethylamine, 100:1.5, v / v) followed by a mixed solvent (ethyl acetate / methanol / triethylamine, 10:1:0.01, v / v / v). The solvent was then removed under reduced pressure to yield a white solid compound (B3, 0.72 g, 82%). The product structure and test data are as follows: 1H NMR(CDCl3):d,7.41-7.40(m,2H,trityl),7.39-7.27(m,6H,trityl),7.20-7.17(m,1H,trit yl),6.82-6.80(m,4H,trityl),5.12-5.11(m,1H),3.77(s,6H),3.17-3.14(m,2H),3.10-3.0 7 (m, 2H), 3.03-2.99 (m, 2H), 2.69-2.66 (m, 2H), 2.64-2.57 (m, 2H), 2.13-2.10 (m, 2H), 1.78-1.73 (m, 2H), 1.59-1.56 (m, 2H), 1.31-1.28 (m, 2H), 1.28-1.23 (m, 22H), 0.89-0.86 (m, 3H) ppm. It can be seen that the product structure is correct.
[0297] (3) Synthesis of lipid compound monomers (A4, B4)
[0298] Hexadecanoic acid (5.13 g, 20 mmol) was dissolved in 100 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. Once fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (8.4 g, 22 mmol) and N,N-diisopropylethylamine (8.7 mL, 50 mmol) were gradually added in an ice bath. The reaction solution was stirred thoroughly at 0°C for 20 minutes. After the intermediate product was formed, 3-amino-2-hydroxymethyl-n-propan-1-ol 7 (2 g, 21 mmol) was dissolved in 50 mL of dimethylformamide and added dropwise to the reaction flask. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 12 hours. The reaction solution was poured into 500 mL of saturated saline solution, and solid precipitation was observed. After the solid was completely precipitated, it was filtered out and rinsed with water to remove the unreacted reagents and solvents. Finally, the product 8 (6.25 g, 95%) was dried under vacuum at room temperature and used directly in the next reaction.
[0299] 4,4'-Dimethoxytriphenylmethane (6.2 g, 18.8 mmol) was dissolved in 20 mL of dichloromethane. This solution was slowly added dropwise to a solution of compound 8 (6.1 g, 18.6 mmol) dissolved in anhydrous pyridine (100 mL) at room temperature. The reaction solution was stirred continuously at room temperature for 14 hours. 300 mL of saturated saline solution was added to the reaction mixture, and the mixture was extracted with 2 × 250 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and purified by silica gel chromatography using a gradient elution system: first with n-hexane, then with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), and finally with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine). The product fractions were collected and the solvent was evaporated under reduced pressure to yield 9 (6.93 g, 59%) as a yellow solid. This product 9 was used directly in the next reaction.
[0300] Dissolve compound 9 (4.75 g, 7.52 mmol) in 50 mL of dry dichloromethane, then add 3.3 mL of triethylamine. Stir and dissolve 4-dimethylaminopyridine (0.72 g, 5.9 mmol) in the reaction solution. Stir and dissolve succinic anhydride (1.13 g, 11.3 mmol) in the reaction solution at room temperature. Stir and react for 8 hours. Add succinic anhydride (100 mg, 1 mmol) and continue stirring at room temperature for 14 hours. Pour the reaction solution into saturated brine and extract with 2 x 250 mL of dichloromethane. Separate the organic phase, dry over anhydrous sodium sulfate, and evaporate to semi-dryness under reduced pressure. Purify the product by silica gel chromatography using a gradient elution system, initially with a mixed solvent (ethyl acetate / triethylamine, 100:1.5, v / v) followed by a mixed solvent (ethyl acetate / methanol / triethylamine, 10:1:0.01, v / v / v). The final product, B4, was eluted. The solvent was removed under reduced pressure to yield a pale yellow solid compound (B4, 4.5 g, 82%). The product structure was verified as follows: 1 H NMR(CDCl3):d,7.42-7.40(m,2H,trityl),7.31-7.27(m,4H,trityl),7.25-7.18(m ,2H,trityl),6.83-6.80(m,4H,trityl),5.14-5.11(m,1H),3.79(s,6H),3.78-3.7 0 (m, 1H), 3.31-3.30 (m, 1H), 3.20-3.19 (m, 2H), 3.02-2.98 (m, 3H), 2.64-2.56 (m, 4H), 2.09-2.05 (m, 2H), 1.54-1.51 (m, 2H), 1.31-1.23 (m, 22H), 0.89-0.86 (m, 3H) ppm. It can be seen that the product structure is correct.
[0301] Dissolve compound 9 (4.8 g, 7.6 mmol) in 100 mL of dry dichloromethane, then quickly add N,N,N'N'-tetraisopropyl 2-cyanoethoxyphosphite (3.4 mL, 11.4 mmol). Stir the reaction solution at room temperature under nitrogen for 20 minutes. Add 20 mL of tetrazole (0.64 g, 9.12 mmol) dissolved in dry dichloromethane to the reaction solution, and continue stirring at room temperature under nitrogen for 2 hours. Pour the reaction solution into saturated brine and extract with 2 × 150 mL of dichloromethane. Separate the organic phase, dry over anhydrous sodium sulfate, and evaporate to dryness under reduced pressure. Purification and separation were continued using a silica gel column using a gradient elution system: first washing with n-hexane, then with (n-hexane / ethyl acetate, 5:1, v / v, 1% triethylamine), and finally with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine). The product fractions were collected and the solvent was removed under reduced pressure to yield A4 (5.2 g, 85%) as a white solid. The product structure was verified as follows: 1 H NMR(CDCl3):d,7.45-7.34(m,3H,trityl),7.33-7.27(m,6H,trityl),7.25-7.21(m,1H,trityl),6.84 -6.79(m,4H,trityl),4.15-4.09(m,1H),4.03-4.02(m,1H),3.91-3.86(m,2H),3.79(s,6H),3.78-3.7 5(m,2H),3.61-3.55(m,4H),3.21-3.17(m,2H),3.11-3.08(m,1H),2.66-2.62(m,2H),2.12-2.08(m,2H ),1.58-1.54(m,2H),1.32-1.25(m,22H),1.20-1.17(m,6H),1.12-1.11(m,6H),0.90-0.86(m,3H)ppm. 31 P NMR (CDCl3): d, 149.16, 148.96 ppm. It can be seen that the product structure is correct.
[0302] (4) Synthesis of lipid compound monomers (A5, B5)
[0303] 4,4'-Dimethoxytriphenylmethane (1.8 g, 5.3 mmol) was dissolved in 5 mL of dichloromethane and slowly added dropwise to a solution of 3-hydroxy-2-hydroxymethyl-2-methyl-propionic acid 10 (0.8 g, 5.97 mmol) in anhydrous pyridine (10 mL) at room temperature. The solution was stirred continuously at room temperature for 14 hours. 20 mL of water was added to the reaction mixture, and the mixture was extracted with 2 × 50 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and purified by silica gel chromatography using a gradient elution system, first with n-hexane and then with (n-hexane / ethyl acetate, 1:1, v / v). The product fractions were collected and the solvent was removed under reduced pressure to yield 12 (1.5 g, 58%) as a yellow solid, which was used directly in the next reaction.
[0304] Hexadecanoic acid (16.20 g, 63.28 mmol) was dissolved in 240 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. Once fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (26.4 g, 69.61 mmol) and N,N-diisopropylethylamine (27.5 mL, 158.2 mmol) were gradually added in an ice bath. The reaction solution was stirred thoroughly at 0°C for 10 minutes. After the intermediate product was formed, tert-butyl N-(tert-butoxycarbonyl)-1,2-diaminoethane N-(2-aminoethyl)carbamate 13 (10.2 g, 63.2 mmol) was dissolved in 50 mL of dichloromethane and added dropwise to the reaction flask. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 6 hours. The dichloromethane was removed by rotary evaporation under reduced pressure, and the reaction solution was then poured into 500 mL of saturated saline solution. Solid precipitation was observed. After complete solid precipitation, the solid was filtered and rinsed with water and 50 mL of ethyl acetate to remove unreacted reagents and solvent. Finally, the product 14 (23.5 g, 93%) was dried under vacuum at room temperature and used directly in the next reaction.
[0305] Compound 14 (23.5 g, 59 mmol) was dissolved in 300 mL of a mixed solvent (methanol (MeOH) and dichloromethane, v / v, 1:1). The reaction solution was mixed with 40 mL of a 4M aqueous hydrochloric acid solution. The reaction mixture was stirred at room temperature for 30 minutes and then for 24 hours. The methanol and dichloromethane were removed by rotary evaporation. 100 mL of ethyl acetate was added, the reaction solution and ethyl acetate were thoroughly mixed, and then concentrated by rotary evaporation. The concentrate was mixed with 150 mL of a mixed solvent (n-hexane and ethyl acetate, v / v, 1:1). Solid product 15 gradually precipitated and was filtered and vacuum-evaporated to dryness. Product 15 (20 g, 90%) was used directly in the next reaction.
[0306] Compound 12 (18.4 g, 31.1 mmol) was dissolved in 200 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. Once fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (10.4 g, 27.4 mmol) and N,N-diisopropylethylamine (22 mL, 74.2 mmol) were gradually added in an ice bath. The reaction solution was stirred thoroughly at 0°C for 20 minutes. After the intermediate product was formed, compound 15 (8.6 g, 25.7 mmol) was dissolved in 50 mL of dichloromethane and added dropwise to the reaction flask. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 12 hours. The dichloromethane was removed by rotary evaporation under reduced pressure. The reaction solution was then poured into 500 mL of saturated saline solution and extracted with 2 × 250 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and further purified and separated by silica gel chromatography using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), continuing to elute with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally eluting with (ethyl acetate, 1% triethylamine) and collecting the product components. The solvent was evaporated under reduced pressure to obtain a yellow solid 16 (13 g, 59%).
[0307] Dissolve compound 16 (2.7 g, 3.77 mmol) in 50 mL of dry dichloromethane, then add 2.6 mL of triethylamine. Stir and dissolve 4-dimethylaminopyridine (0.72 g, 5.9 mmol) in the reaction solution. Stir and dissolve succinic anhydride (0.57 g, 5.6 mmol) in the reaction solution at room temperature. Stir and react for 8 hours. Add succinic anhydride (100 mg, 1 mmol) and continue stirring at room temperature for 14 hours. Pour the reaction solution into saturated brine and extract with 2 x 250 mL of ethyl acetate. Separate the organic phase, dry over anhydrous sodium sulfate, and evaporate to semi-dryness under reduced pressure. The final product, B5, was purified by silica gel chromatography using a gradient elution system, initially with a mixed solvent (ethyl acetate / triethylamine, 100:1.5, v / v) followed by a mixed solvent (ethyl acetate / methanol / triethylamine, 10:2:0.01, v / v / v). The solvent was then removed under reduced pressure to yield compound B5 as a pale yellow solid (2.5 g, 78%). The product structure was verified as follows: 1 H NMR (CDCl3): d, 7.39-7.37 (m, 3H, trityl), 7.29-7.26 (m, 6H, trityl), 7.21-7.18 (m, 1H, trityl), 6.84-6.81 (m, 4H, trityl), 4.34-4.32 (m, 1H), 4.16-4.14 (m, 1H), 3.78 (s, 6H), 3.35-3.27 (m, 3H), 3.25-2.97 (m, 3H), 2.54-2.50 (m, 4H), 2.08-2.00 (m, 2H), 1.30-1.19 (m, 31H), 0.88-0.86 (m, 3H) ppm. It can be seen that the product structure is correct.
[0308] Dissolve compound 16 (7.16 g, 10 mmol) in 100 mL of dry dichloromethane, then quickly add N,N,N'N'-tetraisopropyl 2-cyanoethoxyphosphite (3.6 mL, 12 mmol). Stir the reaction solution at room temperature under nitrogen for 20 minutes. Add 22 mL of tetrazole (0.68 g, 10 mmol) dissolved in dry dichloromethane to the reaction solution, and continue stirring at room temperature under nitrogen for 2 hours. Pour the reaction solution into saturated brine and extract with 2 × 150 mL of dichloromethane. Separate the organic phase, dry over anhydrous sodium sulfate, and evaporate to semi-dryness under reduced pressure. Purification and separation were continued using a silica gel column using a gradient elution system: first washing with n-hexane, then with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), then with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally with (n-hexane / ethyl acetate, 1:2, v / v, 1% triethylamine). The product fractions were collected and the solvent was removed under reduced pressure to yield A5 (7 g, 82%) as a white solid. The product structure was verified as follows: 1 H NMR(CDCl3):d,7.42-7.40(m,3H,trityl),7.30-7.27(m,6H,trityl),7.23-7.21(m,1H, trityl),6.84-6.82(m,4H,trityl),4.14-4.09(m,1H),3.79(s,6H),3.77-3.71(m,4H), 3.70-3.66(m,4H),3.55-3.49(m,2H),2.56-2.53(m,2H),2.04-2.00(m,2H),1.55-1.51( m,2H),1.31-1.20(m,22H),1.16-1.11(m,6H),1.09-1.08(m,6H),0.88-0.87(m,3H)ppm. 31 P NMR (CDCl3): d, 148.57, 148.48 ppm. It can be seen that the product structure is correct.
[0309] (5) Chemical synthesis of lipid compound monomers (A6-R1-R5, B6-R1-R5)
[0310] Hexadecanoic acid (16.20 g, 63.28 mmol) was dissolved in 250 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1.5:1) at room temperature. Once fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (26.4 g, 69.61 mmol) and N,N-diisopropylethylamine (27.5 mL, 158.2 mmol) were gradually added in an ice bath. The reaction solution was stirred thoroughly at 0°C for 20 minutes. After the intermediate product was formed, tert-butyl N-(tert-butoxycarbonyl)-1,3-diaminopropane N-(3-aminopropyl)carbamate 17 (11 g, 63.13 mmol) was dissolved in 50 mL of dichloromethane and added dropwise to the reaction flask. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 6 hours. The dichloromethane was removed by rotary evaporation under reduced pressure, and the reaction solution was then poured into 500 mL of saturated saline solution to observe the precipitation of solids. After complete precipitation, the solids were filtered and rinsed with water and 50 mL of ethyl acetate to remove unreacted reagents and solvent. Finally, the product 19-R3 (25 g, 95%) was dried under vacuum at room temperature and used directly in the next reaction.
[0311] Using the same chemical reaction process, the reactant hexadecanoic acid was replaced by tetradecanoic acid, pentadecanoic acid, heptadecanoic acid, and octadecanoic acid to obtain the products 19-R1 (24 g, 94%), 19-R2 (26 g, 96%), 19-R4 (21 g, 91%), and 19-R5 (22 g, 93%), respectively.
[0312] Compound 19-R3 (25 g, 62 mmol) was dissolved in 200 mL of methanol. The reaction solution was mixed with 35 mL of 4 M hydrochloric acid and 35 mL of dioxane. The reaction mixture was stirred at room temperature for 30 minutes and then for 24 hours. The methanol and dioxane were removed by rotary evaporation. 100 mL of ethyl acetate was added, the reaction mixture and ethyl acetate were thoroughly mixed, and then concentrated by rotary evaporation. The concentrate was mixed with 150 mL of a mixed solvent (1:1 v / v ratio of hexane and ethyl acetate). Solid product 20-R3 gradually precipitated. After filtration and vacuum drying, product 20-R3 (19 g, 91%) was used directly in the next reaction.
[0313] Using the same chemical reaction preparation process, compounds 19-R1, 19-R2, 19-R4, and 19-R5 were post-treated and precipitated to obtain products 20-R1 (17 g, 88%), 20-R2 (15 g, 89%), 20-R4 (19 g, 85%), and 20-R5 (14 g, 82%), respectively.
[0314] Compound 12 (18.4 g, 31.1 mmol) was dissolved in 200 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. Once fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (9.4 g, 24.8 mmol) and N,N-diisopropylethylamine (21.5 mL, 124 mmol) were gradually added in an ice bath. The reaction solution was stirred thoroughly at 0°C for 20 minutes. After the intermediate product was formed, compound 20-R3 (8.6 g, 25.7 mmol) was dissolved in 50 mL of dichloromethane and added dropwise to the reaction flask. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 4 hours. The dichloromethane was removed by rotary evaporation under reduced pressure. The reaction solution was then poured into 500 mL of saturated saline solution and extracted with 2 × 250 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and further purified and separated by silica gel chromatography using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), continuing to elute with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally eluting with (ethyl acetate, 1% triethylamine) and collecting the product components. The solvent was evaporated under reduced pressure to obtain a yellow solid 21-R3 (12 g, 57%).
[0315] Using the same chemical reaction preparation process, compounds 20-R1, 20-R2, 20-R4, and 20-R5 were reacted and then separated and purified by silica gel chromatography to obtain products 21-R1 (9 g, 51%), 21-R2 (11 g, 55%), 21-R4 (14 g, 55%), and 21-R5 (13 g, 56%), respectively.
[0316] Dissolve compound 21-R3 (2.26 g, 3.1 mmol) in 50 mL of dry dichloromethane, then add 2.5 mL of triethylamine. Stir and dissolve 4-dimethylaminopyridine (0.72 g, 5.9 mmol) in the reaction solution. Stir and dissolve succinic anhydride (0.47 g, 4.65 mmol) in the reaction solution at room temperature. Stir and react for 8 hours. Add succinic anhydride (100 mg, 1 mmol) and continue stirring at room temperature for 14 hours. Pour the reaction solution into saturated brine and extract with 2 x 250 mL of ethyl acetate. Separate the organic phase, dry over anhydrous sodium sulfate, and evaporate to dryness under reduced pressure. Purification was performed by silica gel chromatography using a gradient elution system, initially with a mixed solvent (ethyl acetate / triethylamine, 100:1.5, v / v) followed by a mixed solvent (ethyl acetate / methanol / triethylamine, 10:2:0.01, v / v / v) to elute the final product, B6-R3. The solvent was then removed under reduced pressure to yield a pale yellow solid, compound B6-R3 (2.1 g, 75%). The product structure was verified as follows: 1 H NMR(CDCl3):d,7.39-7.37(m,2H,trityl),7.29-7.26(m,6H,trityl),7.25-7.21(m,1H,trit yl),6.84-6.81(m,4H,trityl),4.29-4.26(m,1H),4.22-4.20(m,1H),3.78(s,6H),3.28-3.2 4 (m, 2H), 3.23-3.17 (m, 3H), 3.16-3.10 (m, 3H), 3.05-3.00 (m, 3H), 2.53-2.48 (m, 4H), 2.17-2.14 (m, 2H), 1.61-1.58 (m, 4H), 1.54-1.52 (m, 2H), 1.31-1.22 (m, 22H), 0.88-0.85 (m, 3H) ppm. It can be seen that the product structure is correct.
[0317] Using the same chemical reaction preparation process, the compounds 21-R1, 21-R2, 21-R4, and 21-R5 were reacted and then separated and purified by silica gel chromatography to obtain products B6-R1 (1.5 g, 70%), B6-R2 (2.4 g, 74%), B6-R4 (2.1 g, 71%), and B6-R5 (1.8 g, 68%), respectively.
[0318] Dissolve compound 21-R3 (4.5 g, 6.16 mmol) in 80 mL of dry dichloromethane, then quickly add N,N,N',N'-tetraisopropyl 2-cyanoethoxyphosphite (2.3 mL, 7.34 mmol). Stir the reaction solution at room temperature under nitrogen for 20 minutes. Add 20 mL of tetrazole (1.37 mL, 0.45 M, 6.16 mmol) dissolved in dry dichloromethane to the reaction solution, followed by N,N,N',N'-tetraisopropyl 2-cyanoethoxyphosphite (0.5 mL, 0.26 mmol). Continue stirring at room temperature under nitrogen for 2 hours. Pour the reaction solution into saturated brine and extract with 2 × 150 mL of dichloromethane. Separate the organic phase, dry over anhydrous sodium sulfate, and evaporate to dryness under reduced pressure. Purification and separation were continued using a silica gel column using a gradient elution: first washing with n-hexane, then with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), then with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally with (n-hexane / ethyl acetate, 1:2, v / v, 1% triethylamine). The product fractions were collected and the solvent was evaporated under reduced pressure to obtain A6-R3 (4.9 g, 85%) as a white solid. The product structure verification information is as follows: 1 H NMR(CDCl3):d,7.42-7.40(m,2H,trityl),7.30-7.26(m,6H,trityl),7.23-7.21(m,1H,trityl),6.87 -6.82(m,4H,trityl),4.14-4.11(m,2H),3.79(s,6H),3.78-3.72(m,2H),3.71-3.67(m,2H),3.55-3.5 0(m,2H),3.31-3.26(m,4H),3.24-3.22(m,2H),2.55-2.53(m,2H),2.17-2.14(m,2H),1.63-1.60(m,2H ),1.53-1.51(m,2H),1.29-1.25(m,22H),1.22-1.15(m,6H),1.11-1.09(m,6H),0.88-0.86(m,3H)ppm. 31 P NMR (CDCl3): d, 148.95, 148.52 ppm. It can be seen that the product structure is correct.
[0319] The same chemical reaction preparation process is used to react compounds 21-R1, 21-R2, 21-R4, and 21-R5, and then separated and purified by silica gel chromatography to obtain the products.
[0320] A6-R1:(3.8g,91%); 1 H NMR(CDCl3):d,7.42-7.40(m,2H,trityl),7.30-7.23(m,6H,trityl),7.21-7.19(m,1H,trityl),6.88-6.81(m,4H,trityl),4.14-4.11(m,2H),3.79(s,6H),3.77-3.71(m,2H),3.70-3.66(m,2H),3.57-3.47(m,2H),3.31-3.25(m,4H),3.23-3.15(m,2H),2.55-2.52(m,2H),2.17-2.14(m,2H),1.80-1.60(m,2H),1.53-1.51(m,2H),1.28-1.24(m,18H),1.22-1.16(m,6H),1.14-1.08(m,6H),0.89-0.86(m,3H)ppm。 31 P NMR(CDCl3):d,148.56,148.48ppm。
[0321] A6-R2(4.2g,90%); 1 H NMR(CDCl3):d,7.42-7.40(m,2H,trityl),7.30-7.23(m,6H,trityl),7.22-7.20(m,1H,trityl),6.87-6.82(m,4H,trityl),4.13-4.11(m,2H),3.79(s,6H),3.78-3.71(m,2H),3.70-3.66(m,2H),3.55-3.50(m,2H),3.31-3.24(m,4H),3.23-3.14(m,2H),2.55-2.53(m,2H),2.17-2.14(m,2H),1.63-1.60(m,2H),1.58-1.51(m,2H),1.28-1.19(m,18H),1.16-1.11(m,6H),1.09-1.08(m,6H),0.89-0.86(m,3H)ppm。 31 P NMR(CDCl3):d,148.59,148.52ppm。
[0322] A6-R4(3.6g,88%); 1H NMR(CDCl3):d,7.42-7.40(m,2H,trityl),7.30-7.23(m,6H,trityl),7.23-7.20(m,1H,trityl),6.87 -6.82(m,4H,trityl),4.14-4.11(m,2H),3.79(s,6H),3.78-3.72(m,2H),3.71-3.66(m,2H),3.55-3.5 0(m,2H),3.31-3.24(m,4H),3.23-3.12(m,2H),2.55-2.53(m,2H),2.17-2.14(m,2H),1.67-1.61(m,2H ),1.60-1.53(m,2H),1.29-1.19(m,24H),1.16-1.11(m,6H),1.09-1.08(m,6H),0.89-0.86(m,3H)ppm. 31 P NMR(CDCl3):d,148.59,148.52ppm.
[0323] A6-R5 (4.1 g, 89%); 1 H NMR(CDCl3):d,7.42-7.40(m,2H,trityl),7.30-7.23(m,6H,trityl),7.23-7.19(m,1H,trityl), 6.88-6.81(m,4H,trityl),4.13-4.11(m,2H),3.79(s,6H),3.78-3.70(m,2H),3.70-3.67(m,2H), 3.55-3.49(m,2H),3.31-3.22(m,4H),3.15-3.12(m,2H),2.56-2.52(m,2H),2.18-2.14(m,2H),1. 61-1.52(m,4H),1.28-1.20(m,26H),1.16-1.10(m,6H),1.09-1.08(m,6H),0.89-0.86(m,3H)ppm. 31 P NMR(CDCl3):d,148.56,148.49ppm.
[0324] It can be seen that the product structure is correct.
[0325] (6) Synthesis of lipid compound monomers (B7, B8)
[0326] DL-Calcium glycerate hydrate (2.5 g) was dissolved in 10 mL of anhydrous pyridine at room temperature. This solution was slowly added to 10 mL of anhydrous pyridine containing 4,4'-dimethoxytriphenylmethane (6 g, 17.7 mmol). The solution was stirred at room temperature for 1 hour, then the reaction solution was heated to 45°C and stirred for 12 hours. 40 mL of water was added to the reaction solution, and the product was extracted with 2 × 50 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and purified by silica gel column chromatography, initially washing with n-hexane and then eluting with a gradient elution (n-hexane / ethyl acetate, 3:1; 1:1; 1; 3; v / v, with 1% triethylamine). The product fractions were collected and the solvent was removed under reduced pressure to yield 24 (1.5 g, 58%) as a yellow solid, which was used directly in the next reaction.
[0327] Compound 23 (0.9 g, 2.2 mmol) was dissolved in 20 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. Once fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (0.76 g, 2 mmol) and N,N-diisopropylethylamine (2 mL, 13.2 mmol) were gradually added in an ice bath. The reaction solution was stirred thoroughly at 0°C for 20 minutes. After the intermediate product was formed, compound 15 (0.65 g, 2.2 mmol) was dissolved in 5 mL of dichloromethane and added dropwise to the reaction flask. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 12 hours. The dichloromethane was removed by rotary evaporation under reduced pressure. The reaction solution was then poured into 100 mL of saturated saline solution and extracted with 2 × 150 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and further purified and separated by silica gel chromatography using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), continuing to elute with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally eluting with (ethyl acetate, 1% triethylamine) and collecting the product components. The solvent was evaporated under reduced pressure to obtain a yellow solid 24 (0.84 g, 59%).
[0328] Compound 24 (0.84 g, 1.22 mmol) was dissolved in 50 mL of dry dichloromethane, followed by the addition of 0.85 mL of triethylamine. 4-Dimethylaminopyridine (0.72 g, 5.9 mmol) was stirred and dissolved in the reaction solution. Succinic anhydride (0.183 g, 1.83 mmol) was stirred and dissolved in the reaction solution at room temperature. The reaction was stirred for 8 hours. Succinic anhydride (50 mg, 0.2 mmol) was added and the mixture was stirred at room temperature for 14 hours. The reaction solution was poured into saturated brine and extracted with 2 × 250 mL of ethyl acetate. The organic phase was separated, dried over anhydrous sodium sulfate, and evaporated to semi-dryness under reduced pressure. The final product, B7, was purified by silica gel chromatography using a gradient elution system, initially with a mixed solvent (ethyl acetate / triethylamine, 100:1.5, v / v) followed by a mixed solvent (ethyl acetate / methanol / triethylamine, 10:2:0.01, v / v / v). The solvent was then removed under reduced pressure to yield compound B7 as a pale yellow solid (0.87 g, 75%). The product structure was verified as follows: 1 H NMR(CDCl3):d,7.82(m,2H),7.41-7.39(m,3H,trityl),7.29-7.27(m,6H,trityl),7.25-7 .19(m,1H,trityl),6.82-6.80(m,4H,trityl),5.34-5.32(m,1H),3.78(s,6H),3.55-3.52( m, 2H), 3.46-3.41 (m, 2H), 3.34-3.31 (m, 3H), 3.00-2.96 (m, 2H), 2.72-2.70 (m, 2H), 2.69-2.59 (m, 1H), 2.08-2.05 (m, 2H), 1.52-1.50 (m, 2H), 1.30-1.22 (m, 22H), 0.89-0.86 (m, 3H) ppm. It can be seen that the product structure is correct.
[0329] Using the same chemical reaction process, reactant 15 was replaced by 20-R3 to obtain product B8 (0.42 g, 77%). The product structure verification information is as follows: 1H NMR(CDCl3):d,7.47(m,2H,trityl),7.41-7.39(m,3H,trityl),7.30-7.27(m,6H,trityl),7.25-7.19(m,1 H,trityl),6.82-6.80(m,4H,trityl),6.18(m,1H),5.40-5.39(m,1H),3.78(s,6H),3.57-3.56(m,1H),3.5 5-3.54(m,1H),3.45-3.42(m,2H),3.37-3.34(m,1H),3.34-3.29(m,1H),3.08-3.03(m,3H),2.75-2.68(m,2H),2.20-2.17(m,2H),1.74-2.051.71(m,2H),1.62-1.59(m,2H),1.31-1.13(m,22H),0.89-0.86(m,3H)ppm. It can be seen that the product structure is correct.
[0330] (7) Synthesis of lipid compound monomers (A9, B9)
[0331] Hexadecanoic acid 18-R3 (12.80 g, 50 mmol) was dissolved in 150 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. Once fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (21.2 g, 55 mmol) and N,N-diisopropylethylamine (22 mL, 125 mmol) were gradually added in an ice bath. The reaction solution was stirred thoroughly at 0°C for 10 minutes. After the intermediate product was formed, tert-butyl N-(tert-butyloxycarbonyl)-1,4-diaminobutane N-(4-aminoethyl)carbamate 25 (9.5 g, 51 mmol) was dissolved in 50 mL of dichloromethane and added dropwise to the reaction flask. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 6 hours. The dichloromethane was removed by rotary evaporation under reduced pressure, and the reaction solution was then poured into 500 mL of saturated saline solution to observe the precipitation of solids. After complete precipitation, the solids were filtered and rinsed with water and 2 × 50 mL of ethyl acetate to remove unreacted reagents and solvent. Finally, the product 26-R3 (10.5 g, 93%) was dried under vacuum at room temperature and used directly in the next reaction.
[0332] The same chemical reaction process was used to prepare the product 26-R2 (7.8 g, 91%) by replacing the reactant hexadecanoic acid with pentadecanoic acid.
[0333] Compound 26-R3 (10.5 g, 24.6 mmol) was dissolved in 100 mL of a mixed solvent (methanol and dichloromethane, v / v, 1:1). The reaction solution was mixed with 30 mL of a 4 M aqueous hydrochloric acid solution. The reaction mixture was stirred at room temperature for 30 minutes and then for 20 hours. The methanol and dichloromethane were removed by rotary evaporation. 100 mL of ethyl acetate was added, the reaction solution and ethyl acetate were thoroughly mixed, and then concentrated by rotary evaporation. The concentrate was mixed with 150 mL of a mixed solvent (n-hexane and ethyl acetate, v / v, 1:1). Solid product 27-R3 gradually precipitated. After filtration and vacuum drying, product 27-R3 (9.5 g, 90%) was used directly in the next reaction.
[0334] The same chemical reaction preparation process was used to post-treat compound 26-R2 and precipitate it to obtain product 27-R2 (11.2 g, 85%).
[0335] Compound 12 (8.72 g, 20 mmol) was dissolved in 40 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. Once fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (7.6 g, 20 mmol) and N,N-diisopropylethylamine (7 mL, 40 mmol) were gradually added in an ice bath. The reaction solution was stirred thoroughly at 0°C for 20 minutes. After the intermediate product was formed, compound 27-R3 (5.8 g, 16 mmol) was dissolved in 50 mL of dichloromethane and added dropwise to the reaction flask. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 4 hours. The dichloromethane was removed by rotary evaporation under reduced pressure. The reaction solution was then poured into 250 mL of saturated saline solution and extracted with 2 × 200 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and further purified and separated by silica gel chromatography using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), continuing to elute with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally eluting with (ethyl acetate, 1% triethylamine) and collecting the product components. The solvent was evaporated under reduced pressure to obtain a yellow solid 28-R3 (9 g, 59%).
[0336] The same chemical reaction preparation process was used to react compound 27-R2, and then separated and purified by silica gel chromatography to obtain product 28-R2 (11 g, 55%).
[0337] Dissolve compound 28-R3 (1.33 g, 2.0 mmol) in 20 mL of dry dichloromethane, then add 1.4 mL of triethylamine. Dissolve 4-dimethylaminopyridine (0.02 g, 5.9 mmol) in the reaction solution with stirring. Add succinic anhydride (0.3 g, 3.0 mmol) to the reaction solution at room temperature and stir for 8 hours. Add succinic anhydride (20 mg, 0.2 mmol) and continue stirring at room temperature for 14 hours. Pour the reaction solution into saturated brine and extract with 2 × 100 mL of ethyl acetate. Separate the organic phase, dry over anhydrous sodium sulfate, and evaporate to semi-dryness under reduced pressure. Purification was performed by silica gel chromatography using a gradient elution system, initially with a mixed solvent (ethyl acetate / triethylamine, 100:1.5, v / v) followed by a mixed solvent (ethyl acetate / methanol / triethylamine, 10:2:0.01, v / v / v) to elute the final product B9. The solvent was then removed under reduced pressure to yield a pale yellow solid compound B9 (1.5 g, 78%). The product structure was verified as follows: 1 H NMR (CDCl3): d, 7.40-7.38 (m, 2H, trityl), 7.30-7.27 (m, 6H, trityl), 6.84-6.80 (m, 4H, trityl), 6.70 (m, 1H), 4.33-4.30 (m, 1H), 4.18-4.16 (m, 1H), 3.79 (s, 6H), 3.27-3.21 (m, 7H), 3.04-3.03 (m, 2H), 2.55-2.51 (m, 2H), 1.60-1.58 (m, 3H), 1.46-1.44 (m, 4H), 1.31-1.20 (m, 24H), 0.89-0.86 (m, 3H) ppm. It can be seen that the product structure is correct.
[0338] Dissolve compound 28-R3 (5.3 g, 7.1 mmol) in 70 mL of dry dichloromethane, then quickly add N,N,N',N'-tetraisopropyl 2-cyanoethoxyphosphite (2.8 mL, 9.23 mmol). Stir the reaction solution at room temperature under nitrogen for 20 minutes. Add 14 mL of tetrazole (6.39 mmol, 0.45 M) dissolved in dry dichloromethane to the reaction solution, and continue stirring at room temperature under nitrogen for 2 hours. Pour the reaction solution into saturated brine and extract with 2 × 100 mL of dichloromethane. Separate the organic phase, dry over anhydrous sodium sulfate, and evaporate to dryness under reduced pressure. Purification and separation were continued using a silica gel column using a gradient elution: first washing with n-hexane, then with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), then with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally with (n-hexane / ethyl acetate, 1:2, v / v, 1% triethylamine). The product fractions were collected and the solvent was evaporated under reduced pressure to obtain A9-R3 (5.6 g, 82%) as a white solid. The product structure verification information is as follows: 1 H NMR(CDCl3):d,7.43-7.41(m,2H,trityl),7.31-7.22(m,6H,trityl),7.23-7.21(m,1H,trityl),6 .84-6.82(m,4H,trityl),6.67(m,1H),5.29(m,1H),3.78(s,6H),3.77-3.66(m,4H,3.54-3.51(m,2 H),3.28-3.24(m,2H),3.22-3.17(m,4H),2.55-2.53(m,2H),2.09-2.04(m,2H),1.56-1.55(m,2H), 1.45-1.42(m,4H),1.30-1.22(m,26H),1.20-1.15(m,6H),1.11-1.08(m,6H),0.89-0.86(m,3H)ppm. 31 P NMR (CDCl3): d, 148.44, 148.40 ppm. It can be seen that the product structure is correct.
[0339] Using the same chemical reaction process, compound 28-R2 was reacted and purified by silica gel chromatography to obtain product A9-R2 (3.3 g, 89%). The product structure verification information is as follows: 1H NMR(CDCl3):d,7.42-7.41(m,2H,trityl),7.31-7.27(m,6H,trityl),7.22-7.21(m,1H,trit yl),6.83-6.82(m,4H,trityl),4.12-4.11(m,1H),3.79(s,6H),3.77-3.66(m,4H),3.54-3.5 2(m,3H),3.28-3.22(m,2H),3.20-3.17(m,3H),2.55-2.53(m,2H),2.09-2.06(m,2H),1.58-1 .55(m,2H),1.45-1.43(m,4H),1.29-1.20(m,29H),1.11-1.08(m,6H),0.89-0.86(m,6H)ppm. 31 P NMR (CDCl3): d, 148.50, 148.46 ppm. It can be seen that the product structure is correct.
[0340] (8) Synthesis of lipid compound monomers (A10, B10)
[0341] Hexadecanoic acid 18-R3 (6.4 g, 25 mmol) was dissolved in 100 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. Once fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (10.5 g, 27.5 mmol) and N,N-diisopropylethylamine (11 mL, 63.2 mmol) were gradually added in an ice bath. The reaction solution was stirred thoroughly at 0°C for 10 minutes. After the intermediate product was formed, tert-butyl N-(tert-butoxycarbonyl)-1,5-diaminopentane N-(4-aminoethyl)carbamate 29 (5.1 g, 25.2 mmol) was dissolved in 50 mL of dichloromethane and added dropwise to the reaction flask. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 6 hours. The dichloromethane was removed by rotary evaporation under reduced pressure, and the reaction solution was then poured into 200 mL of saturated saline solution to observe the precipitation of solids. After complete precipitation, the solids were filtered and rinsed with water and 50 mL of ethyl acetate to remove unreacted reagents and solvent. Finally, the product 30-R3 (11 g, 91%) was dried under vacuum at room temperature and used directly in the next reaction.
[0342] The same chemical reaction process was used to prepare the product 30-R2 (9.5 g, 94%) by replacing the reactant hexadecanoic acid with pentadecanoic acid.
[0343] Compound 30-R3 (11 g, 24.9 mmol) was dissolved in 100 mL of a mixed solvent (methanol and dichloromethane, v / v, 1:1). The reaction solution was mixed with 30 mL of a 4 M aqueous hydrochloric acid solution. The reaction mixture was stirred at room temperature for 30 minutes and then for 20 hours. The methanol and dichloromethane were removed by rotary evaporation. 100 mL of ethyl acetate was added, the reaction solution and ethyl acetate were thoroughly mixed, and then concentrated by rotary evaporation. The concentrate was mixed with 100 mL of a mixed solvent (n-hexane and ethyl acetate, v / v, 1:1). Solid product 31-R3 gradually precipitated. After filtration and vacuum drying, product 31-R3 (10 g, 90%) was used directly in the next reaction.
[0344] The same chemical reaction preparation process was used to post-treat compound 30-R2 and precipitate it to obtain product 31-R2 (8.8 g, 87%).
[0345] Compound 12 (8.72 g, 20 mmol) was dissolved in 40 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. Once fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (7.6 g, 20 mmol) and N,N-diisopropylethylamine (7 mL, 40 mmol) were gradually added in an ice bath. The reaction solution was stirred thoroughly at 0°C for 20 minutes. After the intermediate product was formed, compound 31-R3 (6 g, 16 mmol) was dissolved in 50 mL of dichloromethane and added dropwise to the reaction flask. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 4 hours. The dichloromethane was removed by rotary evaporation under reduced pressure. The reaction solution was then poured into 250 mL of saturated saline solution and extracted with 2 × 200 mL of ethyl acetate. The organic phase was concentrated by rotary evaporation to semi-dryness and further purified and separated by silica gel chromatography using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), continuing to elute with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally eluting with (ethyl acetate, 1% triethylamine) and collecting the product components. The solvent was evaporated under reduced pressure to obtain a yellow solid 32-R3 (9 g, 59%).
[0346] The same chemical reaction preparation process was used to react compound 31-R2, and then separated and purified by silica gel column chromatography to obtain product 32-R2 (7.5 g, 54%).
[0347] Dissolve compound 32-R3 (1.4 g, 1.8 mmol) in 40 mL of dry dichloromethane, then add 1.2 mL of triethylamine. Stir and dissolve 4-dimethylaminopyridine (0.02 g, 0.17 mmol) in the reaction solution. Stir and dissolve succinic anhydride (0.57 g, 5.6 mmol) in the reaction solution at room temperature. Stir and react for 8 hours. Add succinic anhydride (276 mg, 2.7 mmol) and continue stirring at room temperature for 14 hours. Pour the reaction solution into saturated brine and extract with 2 × 150 mL of ethyl acetate. Separate the organic phase, dry over anhydrous sodium sulfate, and evaporate to dryness under reduced pressure. The final product, B10, was purified by silica gel chromatography using a gradient elution system, initially with a mixed solvent (ethyl acetate / triethylamine, 100:1.5, v / v) followed by a mixed solvent (ethyl acetate / methanol / triethylamine, 10:2:0.01, v / v / v). The solvent was then removed under reduced pressure to afford a pale yellow solid, compound B10-R3 (1.16 g, 75%). The product structure was verified as follows: 1 H NMR(CDCl3):d,7.40-7.38(m,2H,trityl),7.30-7.27(m,6H,trityl),7.23-7.19(m,1H,tr ityl),6.84-6.81(m,4H,trityl),6.68(m,1H),4.34-4.31(m,1H),4.18-4.15(m,1H),3.78( s, 6H), 3.27-3.18 (m, 6H), 3.15-3.14 (m, 1H), 3.05-3.01 (m, 2H), 2.57-2.50 (m, 4H), 2.15-2.14 (m, 2H), 1.57-1.49 (m, 2H), 1.47-1.43 (m, 5H), 1.31-1.18 (m, 26H), 0.89-0.86 (m, 3H) ppm. It can be seen that the product structure is correct.
[0348] Dissolve compound 32-R3 (6.1 g, 8 mmol) in 70 mL of dry dichloromethane, then quickly add N,N,N',N'-tetraisopropyl 2-cyanoethoxyphosphite (3.14 mL, 10.4 mmol). Stir the reaction solution at room temperature under nitrogen for 20 minutes. Add 16 mL of tetrazole (7.2 mmol, 0.45 M) dissolved in dry dichloromethane to the reaction solution, and continue stirring at room temperature under nitrogen for 2 hours. Pour the reaction solution into saturated brine and extract with 2 × 120 mL of dichloromethane. Separate the organic phase, dry over anhydrous sodium sulfate, and evaporate to dryness under reduced pressure. Purification and separation were continued using a silica gel column using a gradient elution: first washing with n-hexane, then with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), then with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally with (n-hexane / ethyl acetate, 1:2, v / v, 1% triethylamine). The product fractions were collected and the solvent was evaporated under reduced pressure to obtain A10-R3 (6.44 g, 84%) as a white solid. The product structure verification information is as follows: 1 H NMR(CDCl3):d,7.42-7.40(m,2H,trityl),7.31-7.27(m,6H,trityl),7.26-7.22(m,1H,trityl),6 .84-6.82(m,4H,trityl),6.76(m,1H),5.29(m,1H),3.79(s,6H),3.78-3.68(m,4H),5.54-3.51(m,3 H),3.27-3.25(m,2H),3.18-3.14(m,4H),2.55-2.52(m,2H),2.12-2.09(m,2H),1.66-1.58(m,2H), 1.48-1.40(m,4H),1.31-1.22(m,28H),1.16-1.15(m,6H),1.11-1.09(m,6H),0.89-0.86(m,3H)ppm. 31 P NMR (CDCl3): d, 148.47, 148.43 ppm. It can be seen that the product structure is correct.
[0349] Using the same chemical reaction process, compound 32-R2 was reacted and purified by silica gel chromatography to obtain product A10-R2 (3.25 g, 91%). The product structure verification information is as follows: 1H NMR(CDCl3):d,7.42-7.40(m,2H,trityl),7.31-7.27(m,6H,trityl),7.23-7.21(m,1H,trityl), 6.83-6.82(m,4H,trityl),4.12-4.11(m,1H),3.79(s,6H),3.71-3.67(m,2H),3.53-3.52(m,2H), 3.27-3.25(m,2H),3.18-3.14(m,4H),2.55-2.52(m,2H),2.12-2.11(m,2H),1.60-1.59(m,2H),1. 48-1.40(m,4H),1.31-1.22(m,29H),1.16-1.11(m,6H),1.09-1.08(m,6H),0.89-0.86(m,3H)ppm. 31 P NMR (CDCl3): d, 148.53, 148.49 ppm. It can be seen that the product structure is correct.
[0350] (9) Synthesis of lipid compound monomer (A11)
[0351] Dissolve 4,4'-dimethoxytriphenylmethane (6.8 g, 20 mmol) in 10 mL of dichloromethane. Slowly add this solution dropwise to a solution of 2'-methoxyuridine 50 (5.16 g, 20 mmol) in anhydrous pyridine (30 mL) at room temperature, along with a small amount of 0.2 mL of 4-(dimethylaminopyridine). Stir the solution at room temperature for 14 hours. Add 50 mL of water to the reaction mixture, and extract with 2 × 80 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and further purified by silica gel chromatography using a gradient elution method, first washing with (n-hexane / ethyl acetate, 3:1, v / v), then with (n-hexane / ethyl acetate, 2:1, v / v), and finally with (n-hexane / ethyl acetate, 1:1, v / v). The product components were collected and the solvent was evaporated under reduced pressure to give a white foamy solid 51 (9.5 g, 58%). The product 51 was used directly in the next reaction.
[0352] Dissolve 1-hydroxyhexadecanol (2.42 g, 10 mmol) in 80 mL of dry dichloromethane, then quickly add N,N,N',N'-tetraisopropylphosphite (3.2 g, 12 mmol) and diisopropylethylamine (3.6 mL, 24 mmol). Stir the reaction solution at room temperature under nitrogen for 2 hours. Add a solution of compound 51 (5.7 g, 10 mmol) in 25 mL of dichloromethane to the reaction solution, along with tetrazole (5 mL, 0.45 M). Continue stirring at room temperature for two hours. Pour the reaction solution into saturated brine and extract with 2 × 80 mL of dichloromethane. Separate the organic phase, dry over anhydrous sodium sulfate, and evaporate to dryness under reduced pressure. Purification was performed by silica gel chromatography using a gradient elution system, first with a mixed solvent (n-hexane / ethyl acetate, 10:1, v / v, 1% triethylamine) and then with another mixed solvent (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine). The solvent was removed under reduced pressure to yield Compound A11 (6.9 g, 74%) as a transparent, nearly white foam. The product structure was verified as follows: 1 H NMR(CD3CN):d,8.08-8.03(m,2H),7.42-7.40(m,3H,trityl),7.30-7.27(m,6H,trityl),7.23 -7.21(m,1H,trityl),6.85-6.82(m,4H,trityl),5.99-5.98(m,2H),5.20-5.16(m,2H),4.50(m ,1H),4.40(m,1H),4.24(m,2H),3.83-3.80(m,2H),3.79(s,6H),3.61-3.57(m,4H),1.70(m,2H) ,1.50(m,2H),1.31-1.21(m,26H),1.04-1.03(m,6H),0.89-0.86(m,6H),1.09-1.08(m,6H)ppm. 31 P NMR (CDCl3): d, 149.08, 148.63 ppm. It can be seen that the product structure is correct.
[0353] (10) Synthesis of lipid compound monomer (A12)
[0354] 4,4'-Dimethoxytriphenylmethane (18 g, 0.053 mol) was dissolved in a mixed solvent (40 mL of dichloromethane, 8.7 mL of triethylamine, and 0.1 mL of 4-(dimethylamino)pyridine). 1,3-Propanediol (21 g, 0.265 mol) was added dropwise to the above solution with stirring, and stirring was continued at room temperature for 12 hours. The reaction solution was poured into 100 mL of saturated brine and extracted with 300 mL of dichloromethane. The organic phase was separated, dried over anhydrous sodium sulfate, and evaporated to semi-dryness under reduced pressure. Purification was performed by silica gel chromatography using a gradient elution system, first with a mixed solvent (n-hexane / ethyl acetate, 3:1, v / v) and then with another mixed solvent (n-hexane / ethyl acetate, 1:1, v / v). The solvent was then removed under reduced pressure to yield the orange compound 1-O-dimethoxytrityl-1,3-propanediol (49, 16 g, 80%). The product structure verification information is as follows: 1 H NMR (CDCl3): d, 7.43-7.41 (2H, m), 7.33-7.27 (6H, m), 7.29-7.27 (1H, m), 6.85-6.82 (4H, m), 3.79-3.75 (7H, m), 3.29-3.27 (2H, m), 2.20-2.18 (1H, br), 1.88-1.83 (2H, br), 1.57 (1H, s). It can be seen that the product structure is correct.
[0355] 1-O-Dimethoxytrityl-1,3-propanediol 49 (4.5 g, 12 mmol) was dissolved in 80 mL of dry dichloromethane. N,N,N',N'-tetraisopropylphosphite (3.85 g, 14.4 mmol) and diisopropylethylamine (4.4 mL, 24 mmol) were then quickly added to the solution. The reaction solution was stirred at room temperature under nitrogen for 15 minutes. 1-Hydroxyhexadecanol (3.9 g, 15.6 mmol) was added to the reaction solution, along with tetrazole (6 mL, 0.45 M, 3 mmol). The reaction was stirred at room temperature for another hour.
[0356] The reaction solution was poured into saturated brine and extracted with 2 × 60 mL of dichloromethane. The organic phase was separated, dried over anhydrous sodium sulfate, and evaporated to semi-dryness under reduced pressure. Purification was performed by silica gel chromatography using a gradient elution, first with a mixed solvent (n-hexane / ethyl acetate, 10:1, v / v, 1% triethylamine), then with another mixed solvent (n-hexane / ethyl acetate, 5:1, v / v, 1% triethylamine). The solvent was removed under reduced pressure to obtain a transparent, nearly white foam, Compound A12 (5 g, 56%). The product structure verification information is as follows: 1H NMR(DMSO-d6):d,7.42-7.40(m,3H,trityl),7.30-7.27(m,6H,trityl),7.23-7.21(m,1H,trityl),6.84-6.82(m,4H,trityl),3.71(s,6H) ,3.67-3.62(m,2H),3.48-3.42(m,4H),3.06-3.02(m,2H),1.81-1.77( m,2H),1.25-1.17(m,25H),1.11-1.07(m,10H),0.85-0.82(m,3H)ppm. 31 P NMR (DMSO-d6): d, 145.12, 144.96 ppm. It can be seen that the product structure is correct.
[0357] (11) Synthesis of lipid compound monomer (A19)
[0358] Hexadecanoic acid (5 g, 16.64 mmol) was dissolved in 25 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1.5:1) at room temperature. Once fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (6.6 g, 17.47 mmol) and N,N-diisopropylethylamine (8.7 mL, 49.92 mmol) were gradually added in an ice bath. The reaction solution was stirred thoroughly at 0°C for 20 minutes. After the intermediate product was formed, tert-butyl N-(tert-butoxycarbonyl)-1,3-diaminopropane N-(3-aminopropyl)carbamate 37 (2.9 g, 16.64 mmol) was dissolved in 10 mL of dichloromethane and added dropwise to the reaction flask. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 5 hours. The dichloromethane was removed by rotary evaporation under reduced pressure, and the reaction solution was then poured into 500 mL of saturated saline solution. Solid precipitation was observed. After complete solid precipitation, the solid was filtered and rinsed with water and 50 mL of ethyl acetate to remove unreacted reagents and solvent. Finally, the product 38 (4.7 g, 92%) was dried under vacuum at room temperature and used directly in the next reaction.
[0359] Compound 38 (4.6 g, 10.1 mmol) was dissolved in 30 mL of methanol. The reaction solution was mixed with 10 mL of 4 M hydrochloric acid and 30 mL of dioxane was added. The reaction mixture was stirred continuously for 30 minutes in an ice bath, then heated and stirred at room temperature for 18 hours. The methanol and dioxane were removed by rotary evaporation. 50 mL of ethyl acetate was added, the reaction solution and ethyl acetate were thoroughly mixed, and then concentrated by rotary evaporation. The concentrate was mixed with 100 mL of a mixed solvent (n-hexane and ethyl acetate, v / v, 1:1). Solid product 39 gradually precipitated and was filtered and vacuum-evaporated to dryness. Product 39 (4 g, 90%) was used directly in the next reaction.
[0360] Compound 12 (4.7 g, 7.94 mmol) was dissolved in 50 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. Once fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (3 g, 7.9 mmol) and N,N-diisopropylethylamine (5.5 mL, 26.48 mmol) were gradually added in an ice bath. The reaction solution was stirred thoroughly at 0°C for 20 minutes. After the intermediate product was formed, compound 39 (2.6 g, 6.62 mmol) was dissolved in 20 mL of dichloromethane and added dropwise to the reaction flask. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 5 hours. The dichloromethane was removed by rotary evaporation under reduced pressure. The reaction solution was then poured into 500 mL of saturated saline solution and extracted with 2 × 250 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and further purified and separated by silica gel chromatography using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 2:1, v / v, 1% triethylamine), continuing to elute with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally eluting with (ethyl acetate, 1% triethylamine) and collecting the product components. The solvent was evaporated under reduced pressure to obtain a yellow solid 40 (3.4 g, 67%).
[0361] Compound 40 (3 g, 3.88 mmol) was dissolved in 40 mL of dry dichloromethane. N,N,N',N'-tetraisopropyl 2-cyanoethoxyphosphite (1.5 mL, 5.04 mmol) was then quickly added to the above solution. The reaction solution was stirred at room temperature under nitrogen for 20 minutes. 20 mL of tetrazole (1.37 mL, 0.45 M, 6.16 mmol) dissolved in dry dichloromethane was added to the above reaction solution. N,N,N',N'-tetraisopropyl 2-cyanoethoxyphosphite (0.22 mL, 0.11 mmol) was then added to the reaction solution. The reaction was stirred at room temperature under nitrogen for 5 hours. The reaction solution was poured into saturated brine and extracted with 2 × 100 mL of dichloromethane. The organic phase was separated, dried over anhydrous sodium sulfate, and evaporated to semi-dryness under reduced pressure. Purification and separation were continued using a silica gel column using a gradient elution: first washing with n-hexane, then with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), then with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally with (n-hexane / ethyl acetate, 1:2, v / v, 1% triethylamine). The product fractions were collected and the solvent was removed under reduced pressure to yield A19 (2.9 g, 84%) as a white solid. The product structure was verified as follows: 1 H NMR(CDCl3):d,7.42-7.39(m,2H,trityl),7.30-7.26(m,6H,trityl),7.23-7.21(m,1H,trityl) l),6.84-6.81(m,4H,trityl),3.79(s,6H),3.77-3.70(m,2H),3.69(s,3H),3.69-3.65(m,2H), 3.53-3.51(m,4H),3.29-3.23(m,4H),3.23-3.13(m,2H),2.31-2.28(m,2H),2.17-2.14(m,2H) ,2.04(s,1H),1.63-1.59(m,2H),1.31-1.20(m,22H),1.16-1.14(m,6H),1.10-1.08(m,6H)ppm. 31 P NMR (CDCl3): d, 148.53, 148.46 ppm. It can be seen that the product structure is correct.
[0362] (12) Synthesis of lipid compound monomer (A20)
[0363] Hexadecanedioic acid 42 (0.286 g, 1 mmol) was dissolved in 5 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1.5:1) at room temperature. Once fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (0.338 g, 1 mmol) and N,N-diisopropylethylamine (0.4 mL, 4 mmol) were gradually added in an ice bath. The reaction solution was stirred thoroughly at 0°C for 20 minutes. After the intermediate product was formed, N-fluorenylmethyloxycarbonyl-1,3-diaminopropane hydrochloride 41 (0.332 g, 1 mmol) was dissolved in 2 mL of dichloromethane and added dropwise to the reaction flask. The reaction solution was warmed to room temperature (25°C) and stirred for 5 hours. Extraction was then performed with 2 × 50 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and further purified and separated by silica gel chromatography, eluted with (ethyl acetate / dichloromethane / methanol, 75:20:5, v / v), and the product components were collected. The solvent was evaporated under reduced pressure to give 43 as a yellow solid (2.58 g, 87%).
[0364] 2-Chlorotrityl chloride 44 (1.6 g, 5.1 mmol) was dissolved in 5 mL of dichloromethane. This solution was slowly added dropwise to a mixture of compound 43 (2.58 g, 4.57 mmol) in 10 mL of a mixed solvent (dichloromethane / N,N-diisopropylethylamine, 8.4:1.6, v / v) at room temperature. The solution was stirred continuously at room temperature for 4 hours. The reaction solution was poured into 50 mL of saturated saline solution and extracted with 2 × 50 mL of ethyl acetate. The solvent was evaporated under reduced pressure to yield 45 (5 g, 58%) as a yellow solid. This product was used directly in the next reaction.
[0365] Compound 45 (5 g, 2.9 mmol) was dissolved in 10 mL of dry dimethylformamide. 1,8-Diazabicyclo[5.4.0]undec-7-ene (DBU) (1 mL) was slowly added dropwise at room temperature. The solution was stirred continuously at room temperature for 1 hour. The reaction solution was poured into 50 mL of saturated saline solution and extracted with 2 × 50 mL of ethyl acetate. The solvent was evaporated under reduced pressure to afford 46 (4.7 g, 95%) as a yellow solid. The crude product was used directly in the next reaction.
[0366] The crude product, compound 46 (4.7 g, 7.6 mmol), was dissolved in 20 mL of dimethylformamide. The reaction mixture was mixed with 3-O-4,4'-dimethoxytrityl-2-hydroxy-2-methylpropionic acid 12 (2.3 g, 5.3 mmol) at 0°C. 2-(7-Azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.7 g, 5.8 mmol) and N,N-diisopropylethylamine (3 mL) were added and stirred for 20 minutes. The temperature of the reaction solution was slowly raised to room temperature, and stirring was continued for 2 hours. The reaction solution was mixed with 20 mL of saturated sodium chloride aqueous solution and extracted with 2 × 50 mL of ethyl acetate. The organic phase was dried over anhydrous sodium sulfate and concentrated by rotary evaporation to obtain crude product 47. The purification was continued using a silica gel chromatography column. The purification and separation were continued using a silica gel chromatography column, using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), continuing to elute with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally eluting with (n-hexane / ethyl acetate, 1:2, v / v, 1% triethylamine), collecting the product components, and draining the solvent under reduced pressure to obtain compound 47 (1.4 g, 56%).
[0367] Compound 47 (1.4 g, 1.35 mmol) was dissolved in 20 mL of dry dichloromethane. N,N,N',N'-tetraisopropyl 2-cyanoethoxyphosphite (0.61 mL, 2.03 mmol) was then quickly added to the above solution. The reaction solution was stirred at room temperature under nitrogen for 20 minutes. 20 mL of tetrazole (2.7 mL, 0.45 M, 1.22 mmol) dissolved in dry dichloromethane was added to the above reaction solution. N,N,N',N'-tetraisopropyl 2-cyanoethoxyphosphite (0.1 mL, 0.33 mmol) was then added to the reaction solution. The reaction was stirred at room temperature under nitrogen for 5 hours. The reaction solution was poured into saturated brine and extracted with 2 × 100 mL of dichloromethane. The organic phase was separated, dried over anhydrous sodium sulfate, and evaporated to semi-dryness under reduced pressure. Purification and separation were continued using a silica gel column using a gradient elution: first washing with n-hexane, then with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), then with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally with (n-hexane / ethyl acetate, 1:2, v / v, 1% triethylamine). The product fractions were collected and the solvent was removed under reduced pressure to obtain A20 (1.48 g, 90%) as a white solid. The product structure was verified as follows: 1H NMR(CDCl3):d,7.42-7.40(m,2H,trityl),7.30-7.18(m,22H,trityl),6.84-6 .81(m,4H,trityl),3.79(s,6H),3.76-3.69(m,3H),3.68-3.51(m,2H),3.29-3 .22(m,4H),3.14(m,2H),2.55-2.51(m,2H),2.17-2.14(m,2H),2.05(s,1H),1. 67-1.61(m,2H),1.29-1.16(m,30H),1.16-1.14(m,6H),1.11-1.08(m,6H)ppm. 31 P NMR (CDCl3): d, 148.53, 148.46 ppm. It can be seen that the product structure is correct.
[0368] (13) Synthesis of lipid compound monomers (A21, B21)
[0369] 5-Hexynoic acid 33 (4.84 g, 43.2 mmol) was dissolved in 50 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. Once fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (16.5 g, 43.2 mmol) and N,N-diisopropylethylamine (15 mL, 68.2 mmol) were gradually added in an ice bath. The reaction solution was stirred thoroughly at 0°C for 60 minutes. After the intermediate product was formed, tert-butyl N-(tert-butoxycarbonyl)-1,3-diaminopropane N-(2-aminoethyl)carbamate 17 (7.53 g, 43.2 mmol) was dissolved in 50 mL of dichloromethane and added dropwise to the reaction flask. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 6 hours. The dichloromethane was removed by rotary evaporation under reduced pressure, and the reaction solution was poured into 500 mL of saturated saline solution and extracted with 2 × 250 mL of ethyl acetate. The ethyl acetate was removed by rotary evaporation under reduced pressure to obtain crude product 34 (5.5 g, 93%), which was dried under vacuum at room temperature and used directly in the next reaction.
[0370] Compound 34 (5.5 g, 40.1 mmol) was dissolved in 50 mL of a mixed solvent (methanol and dichloromethane, v / v, 1:1). The reaction solution was mixed with 20 mL of a 4 M aqueous hydrochloric acid solution. The reaction mixture was stirred at room temperature for 30 minutes and then for 24 hours. The methanol and dichloromethane were removed by rotary evaporation. 100 mL of ethyl acetate was added, the reaction solution and ethyl acetate were thoroughly mixed, and then concentrated by rotary evaporation. The concentrate was mixed with 150 mL of a mixed solvent (n-hexane and ethyl acetate, v / v, 1:1). Solid product 35 gradually precipitated and was filtered and vacuum-evaporated to dryness. Product 35 (5.1 g, 90%) was used directly in the next reaction.
[0371] Compound 12 (11.8 g, 20.0 mmol) was dissolved in 200 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. Once fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (7.6 g, 20.0 mmol) and N,N-diisopropylethylamine (7 mL, 23.6 mmol) were gradually added in an ice bath. The reaction solution was stirred thoroughly at 0°C for 15 minutes. After the intermediate product was formed, compound 35 (2.8 g, 20.1 mmol) was dissolved in 50 mL of dichloromethane and added dropwise to the reaction flask. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 12 hours. The dichloromethane was removed by rotary evaporation under reduced pressure. The reaction solution was then poured into 500 mL of saturated saline solution and extracted with 2 × 250 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and further purified and separated by silica gel chromatography using a gradient elution, first with n-hexane solvent, then with (n-hexane / ethyl acetate, 1:2, v / v, 1% triethylamine), then with (n-hexane / ethyl acetate, 1:4, v / v, 1% triethylamine), and finally with (ethyl acetate, 1% triethylamine). The product components were collected and the solvent was evaporated under reduced pressure to obtain a yellow solid 36 (8.8 g, 59%).
[0372] Compound 36 (1.17 g, 2.0 mmol) was dissolved in 25 mL of dry dichloromethane, followed by the addition of 1.4 mL of triethylamine. 4-Dimethylaminopyridine (0.2 g, 1.6 mmol) was stirred and dissolved in the reaction solution. Succinic anhydride (0.3 g, 3 mmol) was stirred and dissolved in the reaction solution at room temperature. The reaction was stirred for 8 hours. Succinic anhydride (50 mg, 0.5 mmol) was added and stirring continued at room temperature for 14 hours. The reaction solution was poured into saturated brine and extracted with 2 × 250 mL of ethyl acetate. The organic phase was separated, dried over anhydrous sodium sulfate, and evaporated to semi-dryness under reduced pressure. The final product, B21, was purified by silica gel chromatography using a gradient elution system, initially with a mixed solvent (ethyl acetate / triethylamine, 100:1.5, v / v) followed by a mixed solvent (ethyl acetate / methanol / triethylamine, 100:10:1, v / v / v). The solvent was then removed under reduced pressure to yield compound B21 as a pale yellow solid (0.97 g, 81%). The product structure was verified as follows: 1 H NMR (CDCl3): d, 7.39-7.37 (m, 2H, trityl), 7.30-7.27 (m, 6H, trityl), 7.23-7.21 (m, 1H, trityl), 6.84-6.81 (m, 4H, trityl), 3.79 (s, 6H), 3.28-3.20 (m, 4H), 3.03-3.00 (m, 4H), 2.53-2.51 (m, 4H), 2.33-2.30 (m, 2H), 2.25-2.22 (m, 2H), 1.97 (m, 1H), 1.87-1.83 (m, 2H), 1.58-1.54 (m, 2H), 1.28-1.23 (m, 5H) ppm. It can be seen that the product structure is correct.
[0373] Compound 36 (6.5 g, 11.1 mmol) was dissolved in 80 mL of dry dichloromethane. N,N,N'N'-tetraisopropyl 2-cyanoethoxyphosphite (4.0 mL, 13.3 mmol) was then quickly added to the above solution. The reaction solution was stirred in an ice bath under nitrogen for 20 minutes. 23.4 mL of tetrazole (10.5 mmol) dissolved in dry dichloromethane was added to the above reaction solution, and the reaction was continued in an ice bath under nitrogen for 3 hours. The reaction solution was poured into saturated brine and extracted with 2 × 150 mL of ethyl acetate. The organic phase was separated, dried over anhydrous sodium sulfate, and evaporated to semi-dryness under reduced pressure. Purification and separation were continued using a silica gel column using a gradient elution: first washing with n-hexane, then with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), then with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally with (n-hexane / ethyl acetate, 1:2, v / v, 1% triethylamine). The product fractions were collected and the solvent was removed under reduced pressure to yield A21 (7.4 g, 80%) as a white solid. The product structure was verified as follows: 1 H NMR(CDCl3):d,7.42-7.39(m,2H,trityl),7.30-7.27(m,6H,trityl),7.23-7.21(m,1H,trityl) l),6.84-6.81(m,4H,trityl),3.79(s,6H),3.78-3.76(m,2H),3.71-3.68(m,2H),3.29-3.23( m,4H),3.17-3.15(m,2H),2.56-2.52(m,2H),2.32-3.22(m,4H),1.96-1.95(m,1H),1.87-1.84 (m,2H),1.71(s,1H),1.53(m,2H),1.28-1.26(m,5H),1.16-1.12(m,6H),1.10-1.08(m,6H)ppm. 31 P NMR (CDCl3): d, 148.62, 148.54 ppm. It can be seen that the product structure is correct.
[0374] (14) Chemical synthesis of lipid compound monomer (A22)
[0375] Hexadecanedioic acid monomethyl ester 53 (6 g, 20 mmol) was dissolved in 20 mL of a mixed solvent (dried dimethylformamide) at room temperature. Once fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (8 g, 40 mmol) and N,N-diisopropylethylamine (7 mL, 40 mmol) were gradually added in an ice bath. The reaction solution was stirred thoroughly at 0°C for 20 minutes. After the intermediate product was formed, 1,7-Bis-Boc-1,4,7-triazaheptane nicosulfuron 52 (6.2 g, 20 mmol) was dissolved in 10 mL of dimethylformamide and added dropwise to the reaction flask. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 10 hours. The reaction solution was poured into 100 mL of saturated saline solution and extracted with 2 × 150 mL of ethyl acetate. The solvent was evaporated under reduced pressure to give 54 (12 g, 85%) as a yellow solid. The crude product was used directly in the next reaction.
[0376] Compound 54 (12 g, 20 mmol) was dissolved in 50 mL of methanol. The reaction solution was mixed with 30 mL of 4 M aqueous hydrochloric acid. The mixture was stirred at room temperature for 60 minutes. After rotary evaporation, 50 mL of ethyl acetate was added. Rotary evaporation was continued to remove methanol and excess water, yielding a viscous crude product 55 (9 g, 90%), which was used directly in the next reaction.
[0377] Crude compound 55 (3.73 g, 8.14 mmol) and 5-hydroxyvaleric acid (2.85 g, 20.35 mmol) were dissolved in 50 mL of dimethyl sulfoxide (DMSO) and stirred at room temperature for 20 minutes. This reaction mixture was then mixed with benzotriazol-1-yloxytris(dimethylamino)phosphonium hexafluorophosphate (BOP, 9 g, 20.3 mmol) and N,N-diisopropylethylamine (3 mL, 40.6 mmol) and stirred at room temperature for another 4 hours. The reaction solution was mixed with 50 mL of water to produce a white precipitate. After washing with water and filtration, product 57 (3.6 g, 76%) was obtained. This product was used directly in the next reaction.
[0378] Compound 57 was eluted with pyridine and rotary evaporated twice, then dried and set aside. 2-Chlorotrityl chloride (2 g, 6 mmol) was dissolved in 5 mL of pyridine and slowly added dropwise to a solution of compound 57 (3.6 g, 6.1 mmol) in 20 mL of pyridine at room temperature. The solution was stirred continuously at room temperature for 4 hours. The reaction solution was poured into 50 mL of saturated saline solution and extracted with 2 × 100 mL of ethyl acetate. The solvent was removed under reduced pressure to yield crude yellow solid 58. Further purification was performed using a silica gel column using a gradient elution system (ethyl acetate / methanol, 3:1, v / v), followed by (ethyl acetate / methanol, 5:1, v / v), and finally (ethyl acetate / methanol, 10:1, v / v). The product fractions were collected and the solvent removed under reduced pressure to yield compound 58 (2.2 g, 41%).
[0379] Compound 58 (2.1 g, 2.36 mmol) was dissolved in 30 mL of dry dichloromethane, and N,N,N',N'-tetraisopropyl 2-cyanoethoxyphosphite (926 mg, 3.07 mmol) was quickly added to the above solution. The reaction solution was stirred at room temperature under nitrogen for 20 minutes. 5 mL of thioethyltetrazole (ETT, 307 mg, 2.36 mmol) dissolved in dry dichloromethane was added to the above reaction solution, and the reaction was continued to stir at room temperature under nitrogen for 2 hours. The reaction solution was poured into saturated brine (25 mL) and saturated sodium bicarbonate aqueous solution (25 mL), extracted with 2 × 150 mL of ethyl acetate, and the organic phase was separated, dried over anhydrous sodium sulfate, and evaporated to semi-dryness under reduced pressure. Purification and separation were continued using a silica gel column using a gradient elution system: first washing with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), then washing with (n-hexane / ethyl acetate, 0:1, v / v, 1% triethylamine), and finally washing with (ethyl acetate / methanol, 20:1, v / v, 1% triethylamine). The product fractions were collected and the solvent was removed under reduced pressure to yield A22 (2 g, 78%) as a nearly white solid. The product structure was verified as follows: 1H NMR(CDCl3):d,7.42-7.40(m,3H,trityl),7.30-7.27(m,6H,trityl),7.23-7.21(m,1H,trityl), 6.84-6.82(m,4H,trityl),4.12-4.11(m,1H),3.81-3.80(m,1H),3.78(s,6H),3.59-3.55(m,4H), 3.49-3.47(m,3H),3.40-3.42(m,2H),3.41-3.40(m,7H),3.06-3.04(m,3H),2.64-2.59(m,2H),2. 31-2.29(m,4H),2.28-2.16(m,4H),1.70-1.58(m,8H),1.29-1.23(m,28H),1.17-1.15(m,8H)ppm. 31 P NMR (CDCl3): d, 147.32, 147.23 ppm. It can be seen that the product structure is correct.
[0380] (15) Synthesis of Compounds C1-C14
[0381] The synthesis methods of compounds C1-C14 are similar, and only appropriate raw materials need to be selected and replaced according to the structures of the compounds.
[0382] This example uses compound C1 as an example to illustrate the preparation method. In this step, the solid phase support of (C1) is prepared by connecting the conjugated molecule (B1) to the solid phase support.
[0383] The lipid compound monomer hemisuccinate (B1, 50 mg, 0.072 mmol) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (10 mg, 0.026 mmol) were dissolved in 1.25 mL of anhydrous acetonitrile at room temperature. N,N-Diisopropylethylamine (10 μL) was added to the reaction solution. Once all reagents were dissolved, 125 mg of long-chain aminoalkane glass frit (500°A, native lcaa-CPG, Chemgenes, USA) was added to the reaction solution. The solid and liquid phases were stirred at 300 rpm at room temperature. After the reaction was continued for 2 hours, the residual liquid was filtered, and the long-chain aminoalkane glass frit solid support was washed three times with acetonitrile (3 × 1 mL). 0.5 mL of a 10% v / v solution of capping reagent A, acetic anhydride, in tetrahydrofuran and 0.5 mL of capping reagent B, N-methylimidazole, in a mixture of pyridine and acetonitrile (15:10:75 v / v / v), were mixed with long-chain aminoalkane glass sand and stirred at room temperature for 1 hour. The reaction solution was filtered, and the long-chain aminoalkane glass sand solid support was rinsed three times with acetonitrile and dried under reduced pressure for 2 hours using a vacuum pump. This resulted in a glass sand solid support (603C, 130 mg). Weigh 8.3 mg of the long-chain aminoalkane glass sand C1 solid support and add it to 100 mL of a 3% trichloroacetic acid solution in dichloromethane. The mixture was stirred for 30 seconds and allowed to stand for 1 minute. The supernatant was taken and the visible light absorption was measured at 498 nm. The absorbance was 0.309, and the loading of the lipid compound monomer C1 was calculated to be 53.25 μmol / g.
[0384] Example 7
[0385] In this example, the siRNA conjugate structure was designed and synthesized based on the structure of the lipid compound shown in the previous examples.
[0386] This embodiment involves two designs: a double-stranded siRNA RNA coupled to a lipid compound, or a double-stranded siRNA RNA coupled to a lipid compound and linked to a single-stranded phosphosulfate oligonucleotide. Single-stranded phosphosulfate oligonucleotides include single-stranded phosphate oligonucleotides formed by thiolation of double-bonded oxygen atoms and / or single-bonded hydroxyl oxygen atoms in the phosphate moiety.
[0387] The structures of the conjugates include the specific structures in Tables 3-5 above.
[0388] In the above siRNA structure of this example, capital letters C, G, U and A represent the base composition of nucleotides; lowercase letters g, t and a represent the base composition of 2'-deoxynucleotides; lowercase letter m represents that the nucleotide adjacent to the right of letter m is a 2'-methoxy-modified nucleotide (i.e., the pentose 2'-OH of the nucleotide is replaced by a methoxy group); lowercase letter f represents that the nucleotide adjacent to the left of letter f is a 2'-fluorine-modified nucleotide (i.e., the pentose 2'-OH of the nucleotide is replaced by a fluorine group); capital bold T, G, A represent The uppercase bold C indicates a 2'-O-methoxyethoxy-modified nucleotide; the uppercase bold C indicates a 5-methyl-2'-O-methoxyethoxy-modified C nucleotide; the uppercase italic C indicates a 5-methyl-2'-deoxy-modified C nucleotide; the lowercase letter s indicates that the two nucleotides adjacent to the letter s are connected by a phosphorothioate diester bond (i.e., the non-bridging oxygen atom in the phosphodiester bond is replaced by a sulfur atom), and there are no other letters between the two adjacent nucleotides, indicating a phosphodiester bond connection; ss represents the sense strand; and as represents the antisense strand.
[0389] According to literature reports, the currently feasible structure may be a gyroid complementary structure, and the synthesis process basically adopts the traditional solid-phase synthesis method.
[0390] This embodiment relates to a method for preparing the nucleic acid-lipid conjugate. The preparation process of the nucleic acid conjugate refers to the cyclic reaction shown below (this reaction is merely to illustrate the principle of the method of the present invention, and the preparation method of the present invention is not limited thereto. Those skilled in the art can prepare the conjugate of the present invention by appropriately adjusting the preparation method according to the present disclosure).
[0391] In the aforementioned figure, B is selected from the following formulas (B1), (B2), and (B3), and DMT is a dye. Therefore, according to some embodiments of the present invention, the A-series lipid compound monomer intermediate has any of the structures shown in the following formulas, thereby forming a monomer that can be used to synthesize a conjugate containing a nucleic acid:
[0392] Wherein, M in formula (B2) is selected from one of TEA (triethylamine), trimethylamine, triisopropylamine and tripropylamine. Wherein, R in formula (B3) 1 R 2 Can be independently selected from 2,2,2-trichloroethyl, phenyl, o-chlorophenyl and cyanoethyl. (B1), (B2), (B3) Indicates the site where lipid compounds (e.g., L1 to L36) can be covalently linked.
[0393] The nucleic acid conjugates of the present invention are prepared by solid-phase phosphoramidite chemical synthesis, depending on the nucleic acid to be prepared, such as an RNA sequence. Unmodified or modified RNA phosphoramidites are commercially available, unless otherwise specified.
[0394] As an practicable manner, the solid phase support for solid phase synthesis of the desired nucleotide is selected from a commercially available general solid phase support, such as HL UnyLinker TM 300 Oligonucleotide Synthesis Support, Kinovate Life Sciences, or, Long chain alkylamine controlled pore glass, CPG 500°A, 1000°A; Chemgenes.
[0395] CPG is the abbreviation of porous glass sand; Lcaa is the abbreviation of long chain alkane amino; SPS is the abbreviation of sodium polydisulfide propane sulfonate.
[0396] The loading capacity of the solid phase support is usually in the micromoles of compound that can be connected and loaded per gram of solid phase support (30-200 μmol / g).
[0397] The method for preparing the nucleic acid conjugate of the present invention utilizes phosphoramidite solid-phase synthesis, employing the cyclic reaction described above, to sequentially link nucleoside monomers or lipid compound monomers in a 3'-5' direction based on the nucleic acid sequence. Each linking step involves four steps: deprotection, coupling, capping, and oxidation (see the cyclic reaction described above).
[0398] This example takes the preparation of a conjugate containing rat SOD1 siRNA sense and antisense sequences (numbered SN-16983) as an example to illustrate the preparation method of the conjugate.
[0399] In this example, the siRNA targeting mouse SOD1 is the sequence numbered SN-16983, wherein ss is the sense strand and as is the antisense strand:
[0400] Justice chain (ss):
[0401] 5'-mCsmAsmUmUmUmUAfmAUfCfCfmUmCmAmCmUmCmUmAsmAsmA-3'-L3;
[0402] Antisense strand (as):
[0403] 5'-mUsUfsmUmAmGAfmGUfGfmAmGmGmAUfmUAfmAmAmAmUmGsmAsmG-3';
[0404] The capital letters C, G, U, and A represent the base composition of the nucleotides; the lowercase letter m indicates that the nucleotide to the right of the letter m is a 2'-methoxy-modified nucleotide; the lowercase letter f indicates that the nucleotide to the left of the letter f is a 2'-fluorine-modified nucleotide; the lowercase letter s indicates that the two nucleotides to the left and right of the letter s are connected by a phosphorothioate diester bond; the absence of other letters between the two adjacent nucleotides indicates a phosphodiester bond. L3 is the structural portion of the conjugate of the lipid chain of formula , and the specific structure is described in the previous examples.
[0405] In the embodiments, the nucleic acid conjugate preparation method utilizes phosphoramidite solid-phase synthesis to sequentially link nucleoside monomers or lipid compound monomers in a 3'-5' direction according to the sequence described above. Each linking step involves four reactions: deprotection, coupling, capping, and oxidation.
[0406] Specifically, the solid phase synthesis reagent preparation method is as follows:
[0407] The deprotection reagent is a 3% v / v solution of trichloroacetic acid or dichloroacetic acid in dichloromethane. The nucleoside monomer is dissolved in anhydrous acetonitrile at a concentration of 0.05M-0.1M, and a small amount of 3A° molecular sieves is added for anhydrous treatment. The coupling activator is 5-ethylthio-1H-tetrazole in anhydrous acetonitrile at a concentration of 0.25M or 0.45M. Other activators include 1H-tetrazole, 5-benzylthio-1H-tetrazole, 4,5-dicyanoimidazole, and the like. Specifically, capping reagent A is a tetrahydrofuran solution of acetic anhydride at a concentration of (10%, v / v), capping reagent B is a mixed solvent of N-methylimidazole in pyridine and acetonitrile at a concentration of (15:10:75, v / v / v). Specifically, the oxidizing reagent is iodine in water and pyridine solution (0.05M, 95% pyridine aqueous solution), the sulfurizing reagent is (t-Butylformyl)amino-3H-1,2,4-dithiazoline-3-thione) at a concentration of (0.05M, pyridine / acetonitrile), and the cleavage and deprotection reagent is 28% concentrated aqueous ammonia.
[0408] Specifically, the reaction conditions and process of solid phase synthesis are as follows:
[0409] On the synthesizer, the 4,4'-dimethoxytrityl protecting group on the solid support or the nucleoside monomer attached to the support is treated with a solution of trichloroacetic acid in dichloromethane (3%, v / v) at a molar ratio of 1:30. The solid-phase reaction is carried out at room temperature for 1.5 minutes, repeated three times. The deprotection solution is added dropwise when the eluent from the solid support turns colorless from red. After repeated washing with anhydrous acetonitrile, the nucleoside monomer (or A6-R3, the lipid monomer used to synthesize L3) and the coupling activator are added (in a 1:1 ratio), with a molar ratio of solid support to nucleoside monomer of 1:5-1:6. The reaction is repeated at room temperature for 3-4 minutes per cycle. After two cycles, the reaction is stopped. After washing with anhydrous acetonitrile, the oxidizing agent solution is added, with a molar ratio of solid support to oxidizing agent of 1:6. The reaction is continued at room temperature for approximately 2 minutes, repeated twice. After the coupling reaction, if a sulfurization step is required, add a sulfurization reagent solution at a molar ratio of 1:6 between the solid support and the sulfurization reagent. The reaction time between the oxidizing reagent and the solid support is approximately 4-5 minutes at room temperature. Repeat this procedure twice. For the capping reaction, add a capping reagent at a molar ratio of 1:80 between the solid support and the capping reagent at room temperature. Repeat this procedure twice. Repeat the deprotection, coupling, oxidation, and capping steps until the last nucleotide is coupled. Transfer the solid support carrying the sense or antisense strand of the nucleic acid sequence to a small glass vial, add 28% ammonia solution, and seal the vial tightly with a glass cap. At 55°C, hydrolyze and remove the base protecting groups in the sense or antisense strand, simultaneously separating the sense or antisense strand from the solid support. The reaction continues for 16 hours. The resulting small nucleic acid sequence solution is separated from the solid support by filtration. After concentration, the crude small nucleic acid sequence product is obtained.
[0410] Specifically, the process of the preparative high pressure liquid chromatography purification, separation and desalting method is as follows:
[0411] Small nucleic acids were purified using a preparative anion exchange chromatography column (Source 15Q) by gradient elution with NaBr. Mobile phase A: 20 mM sodium phosphate (pH 8.0); mobile phase B: 20 mM sodium phosphate (pH 8.0), 1 M sodium bromide in 10% acetonitrile in water. The column temperature was 65°C, and the flow rate was 10 mL / min. The elution gradient started with mobile phase A, followed by an increase in mobile phase B from 0% to 20% over 12 minutes. Over the next 15 minutes, mobile phase B was increased from 20% to 50%. The product eluate was collected and analyzed for components, combined, and desalted using a reversed-phase chromatography column or by dialysis. After concentration and freeze-drying, the purified small nucleic acid was obtained. The synthesized sense and antisense strands were tested for purity using anion exchange liquid chromatography (AEx-HPLC), and the molecular weight of the entire sequence was analyzed by reversed-phase liquid chromatography-mass spectrometry (LC-MS) to confirm the sequence of the synthesized nucleic acid.
[0412] Specifically, the annealing method process is as follows:
[0413] According to the aforementioned implementation method, the synthesized sense chain (ss chain) and antisense chain (as chain) were mixed in an equimolar ratio in normal saline for injection, heated at 90°C for 5 minutes, then slowly cooled to room temperature, and stored in a refrigerator at 4°C for 12 hours to form a double-stranded structure through hydrogen bonding to obtain an siRNA conjugate.
[0414] The present invention can prepare all conjugates of the present invention with desired structures in a similar manner according to the principles and ideas of the above-mentioned preparation methods, which is completely feasible for those skilled in the art.
[0415] Example 8
[0416] In this embodiment, the conjugate synthesized in Example 7 is further illustrated. In this embodiment, conjugates numbered SN-16983, 16996 were synthesized. The sequence of the conjugate is as follows, where ss is the sense strand and as is the antisense strand:
[0417] SN-16983:
[0418] Sense strand (ss): 5′-mCsmAsmUmUmUmUAfmAUfCfCfmUmCmAmCmUmCmUmAsmAsmA-3′-L3′;
[0419] Antisense strand (as): 5′-mUsUfsmUmAmGAfmGUfGfmAmGmGmAUfmUAfmAmAmAmAmUmGsmAsmG-3′;
[0420] SN-16996:
[0421] Sense strand (ss): 5'-mCsmAsmUmUmUmUAfmAUfCfCfmUmCmAmCmUmCmUmAsmAsmA-L17'-TsAGsGAstsastsastststsCstsasCAsGCsT 3';
[0422] Antisense strand (as) 5'-mUsUfsmUmAmGAfmGUfGfmAmGmGmAUfmUAfmAmAmAmAmUmGsmAsmG-3'.
[0423] The monomers (phosphoramidites) required for synthesis are:
[0424] mC represents 2'-methoxycytidine phosphoramidite, for example, CAS: 199593-09-4,
[0425] mG represents 2'-methoxyguanosine phosphoramidite, for example, CAS: 150780-67-9,
[0426] mA represents 2'-methoxyadenosine phosphoramidite, for example, CAS: 11-782-31-5,
[0427] mU represents 2'-methoxyuridine phosphoramidite, for example, CAS: 110764-79-9,
[0428] fC represents 2'-fluorocytidine phosphoramidite, for example, CAS: 159414-99-0,
[0429] fG represents 2'-fluoroguanosine phosphoramidite,
[0430] fA represents 2'-fluoroadenosine phosphoramidite, for example, CAS: 136834-22-5,
[0431] fU represents 2'-fluorouridine phosphoramidite,
[0432] t represents thymidine phosphoramidite, for example, CAS: 98796-51-1,
[0433] C represents 2'-methoxyethoxy 5-methylcytosine phosphoramidite, for example, CAS: 163759-94-2,
[0434] G represents 2'-methoxyethoxyguanosine phosphoramidite, for example, CAS: 251647-55-9,
[0435] A represents 2'-methoxyethoxyadenosine phosphoramidite, for example, CAS: 251647-53-7,
[0436] T represents 2'-methoxyethoxythymidine phosphoramidite,
[0437] C represents 5-methylcytosine deoxynucleoside phosphoramidite, for example, 105931-57-5,
[0438] Lowercase letter a represents the base composition of 2'-deoxynucleotide, for example, dA amidite, CAS: 98796-53-3,
[0439] The lowercase letter g represents the base composition of 2'-deoxynucleotide, for example, dG amidite, CAS: 93183-15-4,
[0440] The above monomers were all purchased from Shanghai Zhaowei Technology Development Co., Ltd.
[0441] The lipid compound monomer A6 (ie, L3 or L17) phosphoramidite synthesized in this example was synthesized by referring to the corresponding preparation method in Example 6.
[0442] The above monomers were synthesized on an RNA / DNA automatic synthesizer (MerMode-12).
[0443] Example 9
[0444] The structures of the conjugates synthesized in the above examples were confirmed by the following instruments and software:
[0445] Instruments: CTC injector, Agilent 1100 Series liquid chromatograph, FINNIGAN LTQ MASS 004 mass spectrometer.
[0446] Software: LTQ Tune, Xcalibur, ProMass for Xcalibur.
[0447] The relevant workflow is as follows.
[0448] 2.1 Mobile phase preparation
[0449] 2.1.1 Reagent specifications
[0450] 1) HPLC grade H2O (reagent water), ACN (acetonitrile);
[0451] 2) Purity ≥99%: HFIP (hexafluoroisopropanol), DIEA (N,N-diisopropylethylamine), EDTA (ethylenediaminetetraacetic acid), and ammonia.
[0452] 2.1.2 Mobile Phase A & B
[0453] 2.1.2.1 EDTA Stock Solution 1mM: 1mM EDTA+1ml ammonia water in 1L 15% ACN / water (v:v);
[0454] 2.1.2.2 Phase A: 750μl HFIP+375μl DIEA+10ml EDTA stock solution in 990ml Water;
[0455] 2.1.2.3 Phase B: 750μl HFIP+375μl DIEA+10ml EDTA stock solution in 990ml65% ACN / water (v:v).
[0456] 2.2 Preparation of sample loading solution
[0457] According to the LC-MS injection requirements, the sample was prepared to 0.5 OD / 200 μl (about 0.014 nmol / μl).
[0458] 2.3 Instrument method settings
[0459] 2.3.1 Column specifications
[0460] XBridge Oligonucleotide BEH C18 Column 2.5μm, 4.6×50mm.
[0461] 2.3.2 Method Settings
[0462] Flow rate: 0.8 ml / min, injection volume: 10 μl;
[0463] MS parameters: polarity: negative; data type: Centroid; ion source: ESI;
[0464] Scan range (m / z): 550-1600; Run time: 2 min;
[0465] Sheath gas flow rate (arb): 45;
[0466] Aux Gas flow rate (arb): 10;
[0467] Sweep Gas flow rate (arb): 10;
[0468] ISpray voltage {kV}I: 3.00;
[0469] Capillary temperature {℃}: 350.0;
[0470] Capillary voltage {V}: -35;
[0471] Tube lens {V}: -135.
[0472] In the present invention, the mass spectrometry analysis data of the conjugate containing the sense and antisense strands of siRNA are as follows.
[0473] Table 9
[0474] Example 10
[0475] In this example, biological data testing was performed on siRNA and / or single-stranded phosphosulfate oligonucleotides, as well as the siRNA conjugates synthesized in Example 7, including in vitro and in vivo assays and image scanning. In this example, the siRNA conjugates, siRNA, and / or single-stranded phosphosulfate oligonucleotides were dissolved in a solvent (PBS buffer; manufacturer: Absin; product number: abs962) to prepare a PBS solution. This solution can be used as an injection. This solution was used in cell experiments and rat experiments.
[0476] (1) Residual SOD1 mRNA levels in rat B35 cells
[0477] The different siRNA conjugates or solvent (PBS) mentioned in Example 7 were used to test the residual SOD1 mRNA level in mouse B35 cells. The results are shown in Figure 1.
[0478] After overnight incubation, 12K rat B35 cells were added with siRNA conjugates to a final concentration of 2 μM and incubated for 24 hours. Following incubation, cells were washed with PBS, and RNA was extracted using the RNeasy mini kit (Qiagen). RT-PCR was then performed to generate cDNA using the following protocol.
[0479] Table 10
[0480] The RT-PCR procedure was as follows: 25°C for 10 min → 37°C for 2 h → 85°C for 5 min → 4°C for standby.
[0481] The generated cDNA was quenched by TaqMan TM For Fast qPCR experiments, perform two technical replicates for each sample using the following formula.
[0482] Table 11
[0483] qPCR in QuantStudio TM 6Pro (Thermo Fisher) with the following procedures:
[0484] 50℃2min→95℃20s→95℃1s→60℃20s→4℃standby.
[0485] qPCR was used to measure SOD1 gene expression. It can be seen that when the lipid compound has the structure of Formula (I) and R'1 is an alkane chain, within the C13 to C16 alkane chain range, the conjugate with R'1 being a C15 alkane chain achieved the best intracellular delivery and the best mRNA inhibition level.
[0486] (2) Residual SOD1 mRNA levels in SD rat brain
[0487] siRNA (SN-981), different siRNA conjugates mentioned in Example 7, or vehicle (PBS) were used to test the residual SOD1 mRNA level in the brain of SD rats.
[0488] On day 0, SD rats were intracranial injected with vehicle (without siRNA and siRNA conjugates), PBS solution containing 0.9 mg siRNA or siRNA conjugates, and on day 7, Brain tissue RNA was extracted using RNA extraction reagent (Thermo Fisher), and cDNA was generated using the previously described RT-PCR method. Rat SOD1 gene expression was measured using the previously described qPCR method, with three rats in each group. The results are shown in Figure 2.
[0489] SN-981 (which has a sense strand and an antisense strand as shown below) is a double-stranded nucleic acid that is not conjugated to a lipid compound. SN-981 is used for delivery of nucleic acids without the lipid compound of the present invention.
[0490] Table 12
[0491] Experimental results demonstrate that using the lipidic compounds of the present invention to deliver nucleic acids significantly improves intracellular delivery and mRNA inhibition compared to delivery without the lipidic compounds of the present invention. When the lipidic compound has the structure of Formula (I), Q1 and Q4 are amide groups (-NHCO- or -CONH-), and R'1 is an alkane chain, the conjugate with R'1 being a C15 alkane chain, within the C13 to C16 alkane chain range, achieved the best intracellular delivery and mRNA inhibition.
[0492] (3) Residual SOD1 mRNA levels in SD rat brain
[0493] siRNA (SN-981), different siRNA conjugates mentioned in Example 7, or vehicle (PBS) were used to test the residual SOD1 mRNA level in the brain of SD rats.
[0494] On day 0, SD rats were intracranial injected with vehicle (without siRNA and siRNA conjugates), PBS solution containing 0.9 mg siRNA or siRNA conjugates, and on day 7, the above-mentioned Methods: RNA was extracted from brain tissue, and the expression of SOD1 gene in rats was detected by RT-PCR and qPCR methods as described above. There were 3 rats in each group. The results are shown in Figure 3.
[0495] The experimental results demonstrated that when the lipid compound has the structure of formula (I), Q1 and Q4 are amide groups (-NHCO- or -CONH-) and R'1 is an alkane chain, the C3 alkane chain has the best effect within the alkane chain range of C2 to C5, indicating that the conjugate in which the two amide groups in the left structure of the lipid compound are separated by 3 C atoms achieves the best intracellular delivery and the best level of mRNA inhibition.
[0496] (4) Remaining ATXN3 mRNA levels in mouse brain
[0497] The siRNA conjugates or solvent (PBS) involved in the above Example 7 were respectively used to test the residual ATXN3 mRNA level in the mouse brain. The specific siRNA conjugate structures are shown in Table 13 below.
[0498] Table 13 siRNA conjugate structures
[0499] On day 0, mice were intracranial injected with vehicle (without SN-17011) or PBS solution containing 0.5 mg SN-17011. On day 30, the mice were treated with the same Methods: Brain mRNA was extracted, and mouse ATXN3 gene expression levels were measured using the previously described RT-PCR and qPCR methods. The mouse ATXN3 probe was Mm00804702_m1, and the mouse HPRT probe was Mm03024075_m1. Two to three mice were included in each group. The results are shown in Figure 4. As can be seen, the L3' conjugate achieved significant intracellular delivery and enhanced mRNA inhibition at various target sites.
[0500] (5) Residual SOD1 mRNA levels in SD rat brain
[0501] The solvent (PBS) and the siRNA conjugates mentioned in Example 7 were respectively used to measure the residual SOD1 mRNA level in the brain of SD rats.
[0502] On day 0, SD rats were intracranially injected with vehicle (without SN-16983) or PBS solution containing 0.1, 0.3, or 0.9 mg SN-16983. On day 7, the same Methods: Brain tissue RNA was extracted, and rat SOD1 gene expression was measured using the aforementioned RT-PCR and qPCR methods. Three rats were included in each group. The results are shown in Figure 5. As can be seen, the conjugate formed by L3' at different concentrations achieved significant intracellular delivery and enhanced the level of mRNA inhibition.
[0503] (6) Residual SOD1 mRNA levels in rat brain
[0504] The remaining SOD1 mRNA level in rat brain was tested using known drugs, the siRNA conjugates mentioned in Example 7, or the solvent (PBS). The structures of the known drugs and siRNA conjugates are shown in Table 14 below.
[0505] Table 14 Known drug or conjugate structures
[0506] On day 0, SD rats were intracranial injected with vehicle (without SN-16983 and AD-68981), PBS solution containing 0.9 mg SN-16983 or AD-68981, and on day 7, the same solution was used as above. Methods: Brain tissue RNA was extracted, and rat SOD1 gene expression was measured using the aforementioned RT-PCR and qPCR methods. Three rats were included in each group. The results are shown in Figure 6. It can be seen that the conjugate formed by L3' of the present invention is more effective than the known drug (AD-68981 disclosed in US20220125823A1).
[0507] (7) Residual SOD1 mRNA levels in rat brain
[0508] The different siRNA conjugates or solvent (PBS) mentioned in Example 7 were used to measure the residual SOD1 mRNA level in rat brain.
[0509] On day 0, SD rats were injected with vehicle (without SN-16983 or SN-17002) or PBS solution containing 0.6 mg SN-16983 or SN-17002 at the foramen magnum. On day 7, the same Methods: Brain tissue RNA was extracted, and rat SOD1 gene expression was measured using the aforementioned RT-PCR and qPCR methods. Three rats were included in each group. The results are shown in Figure 7. As can be seen, when the lipid compound has the structure of Formula (I), Q1 and Q4 are amide groups (-NHCO- or -CONH-), and R'1 is an alkane chain or an alkane chain substituted with a carboxyl group, the conjugate formed by the lipid compound further modified with COOH on the alkane chain achieves better intracellular delivery and mRNA inhibition.
[0510] (8) Remaining human MAPT mRNA levels in mouse brain
[0511] The siRNA conjugates or the solvent (PBS) involved in the above Example 7 were respectively used to test the level of residual human MAPT mRNA in the mouse brain. The specific siRNA conjugate structures are shown in Table 15 below.
[0512] Table 15 siRNA conjugate structure
[0513] On day 0, human MAPT transgenic mice were intracranially injected with vehicle (without SN-68081) or PBS solution containing 500 mg SN-68081. On day 30, the mice were treated with the same Methods: Brain tissue mRNA was extracted, and human MAPT gene expression levels were measured using the aforementioned RT-PCR and qPCR methods. The human MAPT probe was Hs00902194_m1, and the aforementioned mouse HPRT was used as the internal control. Two to three mice were included in each group. The results are shown in Figure 8. As can be seen, the conjugates formed by L16' of the present invention achieved significantly improved intracellular delivery and mRNA inhibition for different nucleic acid targets at various sites.
[0514] (9) Residual SOD1 mRNA levels in rat brain
[0515] The different siRNA conjugates or the solvent (PBS) mentioned in Example 7 were used to test the residual SOD1 mRNA level in rat brain.
[0516] On day 0, SD rats were intracranial injected with vehicle (without SN-16995 and SN-16996) or PBS solution containing 0.6 mg SN-16995 or SN-16996. On day 7, the rats were treated with the same Methods: Brain tissue RNA was extracted, and the expression of rat SOD1 gene was detected by the aforementioned RT-PCR and qPCR methods. Three rats were included in each group. The results are shown in Figure 9. It can be seen that in the conjugates of the present application, the conjugate conjugate and the double-stranded nucleic acid, especially the siRNA double-stranded ribonucleic acid and the single-stranded phosphosulfate oligonucleotide conjugate mode will affect the effect. When one side of the conjugate is conjugated to the sense strand of the double-stranded nucleic acid and the other side is conjugated to the single-stranded nucleic acid to form the sense strand of the nucleic acid conjugate, compared with the conjugate formed by the single-stranded nucleic acid being located at the 5' end of the sense strand of the nucleic acid conjugate, the conjugate formed by the single-stranded nucleic acid being located at the 3' end of the sense strand of the nucleic acid conjugate achieves better intracellular delivery and mRNA inhibition level.
[0517] (10) Residual SOD1 mRNA levels in rat brain
[0518] The different siRNA conjugates or the solvent (PBS) mentioned in Example 7 were used to test the residual SOD1 mRNA level in rat brain.
[0519] On day 0, SD rats were injected with vehicle (without siRNA conjugate) or PBS solution containing 0.6 mg siRNA conjugate into the foramen magnum. On day 7, the same Methods: Brain tissue RNA was extracted, and rat SOD1 gene expression was measured using the aforementioned RT-PCR and qPCR methods. Five to six rats were included in each group. The results are shown in Figure 10. As can be seen, among the conjugates of the present application, compared to conjugates containing only double-stranded nucleic acids, such as siRNA double-stranded ribonucleic acids, conjugates simultaneously conjugated to double-stranded nucleic acids and single-stranded phosphosulfate oligonucleotides via a lipid compound achieved superior intracellular delivery and mRNA inhibition. Among the conjugates simultaneously conjugated to double-stranded nucleic acids and single-stranded phosphosulfate oligonucleotides via a lipid compound, single-stranded phosphosulfate oligonucleotides with 16 nucleotides within the 14-20 nucleotide range achieved the best intracellular delivery and mRNA inhibition.
[0520] (11) Residual SOD1 mRNA levels in rat brain
[0521] The different siRNA conjugates or the solvent (PBS) mentioned in Example 7 were used to test the residual SOD1 mRNA level in rat brain.
[0522] On day 0, SD rats were intracranial injected with vehicle (without siRNA conjugate), PBS solution containing 0.3, 0.6, or 0.9 mg of SN-17004 or SN-17006, and on day 7, the same solution was used as above. Methods: Brain tissue RNA was extracted, and rat SOD1 gene expression was measured using the aforementioned RT-PCR and qPCR methods. Three rats were included in each group. The results are shown in Figure 11. As can be seen, for conjugates formed by simultaneous conjugation of a double-stranded nucleic acid and a single-stranded phosphosulfate oligonucleotide with a lipid compound, when the length and conjugation position of the single-stranded phosphosulfate oligonucleotide are identical, and when the lipid compound has the structure of Formula (I), Q1 and Q4 are amide groups (-NHCO- or -CONH-), and R'1 is an alkane chain or an alkane chain substituted with a carboxyl group, the conjugate formed by the lipid compound further modified with COOH on the alkane chain achieves better intracellular delivery and mRNA inhibition.
[0523] (12) Residual SOD1 mRNA levels in various regions of the rat brain
[0524] The siRNA conjugates involved in the above Example 7 were respectively used to test the residual SOD1 mRNA levels in various regions of the rat brain.
[0525] On day 0, SD rats were injected with PBS solution containing 0.9 mg SN-17006 into the foramen magnum. On day 14, Methods: RNA was extracted from various brain tissues, and rat SOD1 gene expression was measured using the aforementioned RT-PCR and qPCR methods. The vehicle group was set as 100% for comparison. Three rats were included in each group. The results are shown in Figure 12. As can be seen, the conjugates of the present invention improved intracellular delivery and mRNA inhibition in different brain regions. This demonstrates that the conjugates of the present invention can improve nucleic acid intracellular delivery and mRNA inhibition in different cell types.
[0526] (13) Residual SOD1 mRNA levels in rat brain
[0527] siRNA (SN-981), single-stranded oligonucleotide (SN-17035), the siRNA conjugate described in Example 7, or vehicle (PBS) were used to test the residual SOD1 mRNA level in rat brain.
[0528] On day 0, SD rats were intracranial injected with vehicle (without SN-17006, SN-17035, and SN-981), PBS solution containing 0.6 mg SN-17006, 0.6 mg SN-17035, or 0.6 mg SN-981, and on day 7, the same solution was injected intracranially. Methods: RNA was extracted from brain tissues, and the expression of SOD1 gene in rats was detected by RT-PCR and qPCR methods as described above. There were 3 rats in each group.
[0529] SN-17035 is a single-stranded oligonucleotide with the following sequence:
[0530] Table 16
[0531] The results are shown in Figure 13. Intracellular delivery of a single double-stranded nucleic acid is generally difficult to achieve, let alone the simultaneous delivery of both double-stranded and single-stranded nucleic acids. However, this example demonstrates that the lipidic compounds of the present invention, with their specific structures, can form conjugates simultaneously conjugated with both double-stranded and single-stranded nucleic acids. This conjugate achieves significant improvements in intracellular delivery and significantly increases the level of mRNA inhibition. Using the mRNA level corresponding to PBS (100.0±5.2) as a reference, SN-17006 (mRNA level 33.9±8.6) reduced mRNA levels by approximately 66.1%, while SN-17035 (mRNA level 95.5±5.3) and SN-981 (mRNA level 89.7±2.0) only reduced mRNA levels by approximately 4.5% and approximately 10.3%, respectively. Therefore, this example also demonstrates that the conjugates of the present invention achieve a synergistic effect, that is, an effect superior to that achieved by using either double-stranded or single-stranded nucleic acids alone, achieving a synergistic effect of 1+1 greater than 2.
[0532] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will readily appreciate that other variations or modifications based on the above descriptions are possible. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.
Claims
1. A lipid compound, characterized in that Having a structure shown in the following formula (I), (II) or (V): Wherein, W1 is selected from a direct bond or Said X'1 is selected from O or S atoms, or does not exist; When X'1 is selected from O or S atoms, the X2 is selected from -O-, -S-, -SH, -OH (hydroxyl), -NH2 (amino), C1-C6 alkyl, C1-C6 alkoxy, or -O-(CH2) n’ -OR'5, R'5 is selected from H, a direct bond or R'6 is H or a direct bond, X1 is selected from O or S atoms, X4 is -OH or -SH, n' is an integer of 1-10; when X'1 does not exist, X2 is a direct bond; The T1 is selected from -(CH2) m CH3, m is an integer from 10 to 30; or, wherein Q1 and Q4 are each independently selected from a direct bond, -NH2 (amino), -COOH (carboxyl), amide (-NHCO- or -CONH-), -O-, -S-, -SS-, phosphate, or thiophosphate; The Q2 is selected from -SH, -OH (hydroxyl), -NH2 (amino), -H, C1-C6 alkyl, preferably -CH3 (methyl), -COOH (carboxyl), amide (-NHCO- or -CONH-), -O-, -S-, -SS-, phosphate, thiophosphate, or R'7 is H or a direct bond, X1 and X4 are as defined above; Said Q3 is selected from -H or C1-C10 alkyl; The L1 is -(CH2) l -(NR'4) t -(CH2)q-, l and q are integers from 0 to 10 and l+q=1 to 10, t is 0 or 1, and R'4 is -CO(CH2) r COOH, r is an integer from 10 to 30; The L2 and L3 are each independently selected from a C1-C10 saturated alkane chain or a direct bond; The R'1 is selected from a C10-C30 saturated fatty acid chain, a C10-C30 saturated alkane chain, a C10-C30 unsaturated hydrocarbon group or -(CH2) m -X3-R'3, m is an integer of 10-30, X3 is selected from a direct bond, an oxygen atom or a sulfur atom, and R'3 is selected from a saturated six-membered heterocyclic group containing nitrogen and oxygen, H, a direct bond, or R'6, X1 and X4 are as defined above; when X3 is a direct bond, R'3 is not H, a direct bond; When W1 is a direct bond, T1 is not -(CH2) m CH3; In formula (II) and (V), the five-membered ring is a five-membered ring sugar structure in ribose or deoxyribose, wherein X5 is selected from -CH2-, -CH(CH3)-, -C(CH3)2-, -O-, -NH-, -N(CH3)- or -S-; The M' is selected from H, -O-, -C- or a modified or unmodified nucleotide base; The N1 is selected from a direct bond, H, a C1-C3 alkyl or R'8 is H or a direct bond, and X1 and X4 are as defined above; N2 is selected from a direct bond, H or a C1-C3 alkyl group; The Y is selected from H, NH2, OH, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -O-R'9 or -O-(CH2) n -O-R' 10 , R'9 is a C1-C6 alkyl group, preferably -O-CH3, n is an integer from 1 to 6, R' 10 is a C1-C6 alkyl group, preferably n is 2, R' 10 is C1 alkyl, i.e. 2'-methoxyethoxy; Said V is selected from a C1-C4 saturated alkane chain or does not exist; The U' is selected from -NH2 (amino), -COOH (carboxyl), amide (-NHCO- or -CONH-) or does not exist; Said Z1 is selected from O or S atoms; The Z2 is selected from a C10-C30 alkoxy group, a fatty acid chain, preferably a terminal carboxyl fatty acid, an amide lipid chain, an olefin chain, or an alkane chain; The R'2 is selected from C10-C30 alkoxy, fatty acid chain, preferably terminal carboxyl fatty acid, amide lipid chain, olefin chain, alkane chain or absent.
2. The lipid compound according to claim 1, characterized in that Having the structure shown in formula (I): When W1 is When X'1 is selected from O or S atoms; T1 is selected from in, The Q1 and Q4 are selected from a direct bond, -NH2 (amino), -COOH (carboxyl), amide (-NHCO- or -CONH-), -O-, -S-, -SS-, phosphate, or thiophosphate; The Q2 is selected from -SH, -OH (hydroxyl), -NH2 (amino), -H, C1-C6 alkyl, preferably -CH3 (methyl), -COOH (carboxyl), amide (-NHCO- or -CONH-), -O-, -S-, -SS-, phosphate, thiophosphate or Said Q3 is selected from -H or C1-C10 alkyl; The L2 and L3 are selected from C1-C10 saturated alkane chains or direct bonds; Said X1 is selected from O or S atoms; The X2 is selected from -O-, -S-, -SH, -OH (hydroxyl), -NH2 (amino), C1-6 alkyl, preferably -CH3 (methyl), -CH2CH3 (ethyl), C1-6 alkoxy, preferably -OCH3 (methoxy), -OCH2CH3 (ethoxy) or -O-(CH2) n -OR'5, R'5 is selected from H, a direct bond or The R'1 is selected from a C10-C30 saturated fatty acid chain, a C10-C30 saturated alkane chain, a C10-C30 unsaturated hydrocarbon group or -(CH2) m -X3-R'3, m is an integer of 10-30, X3 is selected from a direct bond, an oxygen atom or a sulfur atom, and R'3 is a saturated six-membered heterocyclic group containing nitrogen and oxygen, H, a direct bond or 3. The lipid compound according to claim 2, characterized in that Q1 and Q4 are both amide groups (-NHCO- or -CONH-); Q2 is selected from -SH, -OH (hydroxyl), -S-, -O- or R'1 is selected from a C10-C30 saturated fatty acid chain, a C10-C30 saturated alkane chain, preferably a C13-16 saturated alkane chain, more preferably a C15 saturated alkane chain, a C10-C30 unsaturated hydrocarbon group or -(CH2) m -X3-R'3, m is an integer of 10-30, preferably an integer of 2-5, more preferably 3, X3 is selected from a direct bond, an oxygen atom or a sulfur atom, R'3 is a saturated six-membered heterocyclic group containing nitrogen and oxygen, H, a direct bond or 4. The lipid compound according to claim 3, characterized in that L1 is -(CH2) l -(NR'4) t -(CH2)q-, t is 0.
5. The lipid compound according to claim 3, characterized in that L1 is -(CH2) l -(NR'4) t -(CH2)q-, l+q=1-10, t is 1; L2 is selected from a C1-C10 saturated alkane chain or a direct bond; L3 is a direct connection key; Q2 is H; Q3 is selected from -H or C1-C10 alkyl; R'1 is -(CH2) m -X3-R'3, m is an integer of 10-30, X3 is selected from oxygen atom or sulfur atom, R'3 is H, direct bond or 6. The lipid compound according to claim 2, characterized in that The Q1 is a direct bond, and Q4 is an amide group (-NHCO- or -CONH-); L1 is -(CH2) l -(NR'4) t -(CH2)q-, l+q=1-10, t is 0; L2 is a C1-C10 saturated alkane chain; L3 is a direct connection key; Q2 is selected from -SH, -OH (hydroxy), -S-, -O- or R'7 and X4 are as defined above.
7. The lipid compound according to any one of claims 1 to 6, characterized in that W1 is a direct bond, Q2 is selected from -SH, -OH (hydroxyl) or R'7 is H, and R'6 in R'1 is not a direct bond; or, W1 is a direct bond, Q2 is selected from -S-, -O- or and R'7 is a direct bond, and R'6 in R'1 is not a direct bond; or, W1 is a direct bond, Q2 is not -S-, -O-, or -SS-. When Q2 is When R'7 is H, and R'1 is -(CH2) m -X3-R'3, R3 is a direct key or R'6 is a direct bond; or, W1 is X2 is selected from -OH or -SH, Q2 is selected from -SH or -OH (hydroxyl), and R'3 and R'6 in R'1 are not directly connected; or, W1 is X2 is selected from -OH or -SH, Q2 is selected from -S-, -O- or R'7 is a direct bond, and R'3 and R'6 in R'1 are not direct bonds; or, W1 is X2 is selected from -OH or -SH, Q2 is not -S-, -O- and -SS-, when Q2 is When R'7 is H; R'3 in R'1 is a direct bond, or when R'3 is When , R'6 is a direct bond; Preferably, W1 is a direct bond, and the wavy line of formula (I) is connected to X6, and X6 has the following structure: R' 11 and R' 12 Each is independently selected from C1-C6 alkyl; Q1 is a direct bond or an amide group (-NHCO- or -CONH-), Q4 is an amide group (-NHCO- or -CONH-); Q2 is selected from -S-, -O- or H; L1 is -(CH2) l -(NR'4) t -(CH2)q-, l and q are integers of 0-10 and l+q=1-10, t is 0 or 1; when Q2 is H, L3 is a direct bond and t is 1; when Q2 is -S- or -O-, Q2 is connected to X7, and X7 is selected from (B'1) or (B'2), Among them, R' 13 and R' 14 Each is independently selected from C1-C6 alkyl, preferably C3 alkyl, more preferably isopropyl, and n is an integer of 1-6; Among them, R' 15 is a C1-C6 alkyl group, n is an integer of 1-6; R'1 is selected from a C10-C30 saturated alkane chain, a C10-C30 unsaturated hydrocarbon group or -(CH2) m -X3-R'3, m is an integer of 10-30, X3 is selected from a direct bond, an oxygen atom or a sulfur atom, and R'3 is selected from a saturated six-membered heterocyclic group containing nitrogen and oxygen or a direct bond; when Q2 is H, R'3 is a direct bond, and R'3 is connected R' 18 and R' 19 Each is independently selected from C1-C6 alkyl, n is an integer of 1-6, or, Preferably, W1 is X'1 does not exist, and the X2 is a direct bond; the wavy line of formula (I) is connected to -(CH2) n -O-X6, n is an integer of 1-6, X6 is as defined above; T1 is -(CH2) m CH3; X2 connection -N(R' 20 )2, R' 20 It is a C1-C6 alkyl group, preferably a C3 alkyl group, and more preferably an isopropyl group.
8. The lipid compound according to any one of claims 1 to 7, characterized in that In formula (I), R'1 is a C10-C30 saturated fatty acid chain, wherein the C10-C30 saturated fatty acid chain is -(CH2) m -COOH or -(CH2) m -COOR' 16 , m is an integer of 10-30, R' 16 An alkyl group selected from C1-C6 or Best The C1-C6 alkyl group is preferably methyl, ethyl, isopropyl or tert-butyl. 17 is halogen, preferably Cl; or R'1 is a C10-C30 unsaturated hydrocarbon group, wherein the C10-C30 unsaturated hydrocarbon group is -(CH2) m -R'4, m is an integer of 10-30, R'4 is an unsaturated bond, preferably a triple bond; or, R'1 is -(CH2) n -X3-R'3, -(CH2) n -X3-R'3, R'3 is a saturated six-membered heterocyclic group containing nitrogen and oxygen, X3 forms a bond with the nitrogen atom of R'3, preferably, in R'3, the six-membered heterocyclic ring contains one nitrogen atom and one oxygen atom and the nitrogen atom and the oxygen atom are located in the para position of the six-membered heterocyclic ring; and / or, X2 is selected from -OH, -SH, -CH3 (methyl), -CH2CH3 (ethyl), -OCH3 (methoxy) or -OCH2CH3 (ethoxy), preferably -OH or -SH.
9. The lipid compound according to claim 1, characterized in that W1 is X'1 is O or S; X2 is -(CH2) n’ -OR'5, R'5 is selected from H, a direct bond or X1, R'6 and X4 are as defined above, n' is an integer from 1 to 10; T1 is -(CH2) m CH3, m is an integer of 10-30.
10. The lipid compound according to claim 9, characterized in that R'5 is selected from a direct bond or R'6 is a direct bond.
11. The lipid compound according to any one of claims 1 to 10, characterized in that The wavy line in formula (I) is connected to H or X6.
12. The lipid compound according to claim 1, characterized in that Having the structure shown in formula (II) or (V), N1 is a direct bond, H, or N2 is selected from a direct bond or H; Y is a C1-C6 alkoxy group; M' is selected from -O-, -C-, or a modified or unmodified nucleotide base; When M' is a modified or unmodified nucleotide base, U', V and R'2 are absent; preferably, M' is independently selected from adenine, uracil, thymine, guanine or cytosine; more preferably, M' is selected from or, When M' is -O- or -C-, V is a C1-C4 saturated alkane chain, U' is an amide group (-NHCO- or -CONH-), and R'2 is a C10-C30 alkane chain.
13. The lipid compound according to claim 12, characterized in that It has a structure represented by formula (II) or (V), wherein X5 is O or S.
14. The lipid compound according to any one of claims 12 to 13, characterized in that N1 is not a direct bond, and R'8 is not a direct bond, and N2 is a direct bond; preferably, N2 is connected to X7 or, N1 is a direct key, or and R'8 is a direct bond, and N2 is not a direct bond; preferably, N1 is connected to X6; or, N1 is a direct key, or And R'8 is a direct bond, and N2 is a direct bond; preferably, N1 is connected to X6, and N2 is connected to X7.
15. The lipid compound according to any one of claims 12 to 14, characterized in that When N1, N2 and R'8 are directly connected, H is connected.
16. The lipid compound according to claim 1, characterized in that The lipid compound is selected from at least one of the following structures (L1)-(L36) and (L'10): Among them, U is 17. The lipid compound according to claim 1, characterized in that The lipid compound is selected from at least one of the following structures (L1')-(L36') and (L'10'): Wherein, E is selected from O and S, and U is 18. A nucleic acid conjugate, characterized in that comprising a nucleic acid and a conjugate conjugated to the nucleic acid; The conjugate is selected from the lipid compound according to any one of claims 1 to 17; Preferably, the conjugate is conjugated to a phosphate group or a hydroxyl group of a ribose of a nucleic acid; More preferably, the nucleic acid conjugate has the following structure: Nu——O——W1——T1, Formula (III) or, Wherein, Nu is a nucleic acid or a nucleic acid fragment, and other variables are defined as defined in any one of claims 1-17.
19. The nucleic acid conjugate according to claim 18, characterized in that It has the structure of formula (III), wherein X2 is -O-(CH2) n’ -OR'5, R'5 is selected from a direct bond or R'6 is a direct bond, n' is an integer from 1 to 10; or, Q2 is selected from -O-, -S- or R'7 is selected from a direct bond; or, R'1 is selected from -(CH2) m -X3-R'3, m is an integer from 10 to 30, X3 is selected from oxygen atoms or sulfur atoms, direct bonds or R'6 is selected from a direct bond; or, Having the structure of formula (IV) or formula (VI), wherein N1 is a direct bond or R'8 is selected from a direct bond.
20. The nucleic acid conjugate according to claim 18, characterized in that Nu is a nucleic acid or a nucleic acid fragment, and the other variables are defined as in any one of claims 7-10, 12-14 and 16-17.
21. The nucleic acid conjugate according to any one of claims 18 to 20, characterized in that: The direct linkage is conjugated to the nucleic acid or nucleic acid fragment.
22. The nucleic acid conjugate according to any one of claims 18 to 21, characterized in that The nucleic acid is selected from single-stranded nucleic acid and fragments thereof or double-stranded nucleic acid and fragments thereof, the double-stranded nucleic acid and fragments thereof preferably have a length of 12-30mer, and the double-stranded nucleic acid and fragments thereof are preferably siRNA and fragments thereof; preferably, the molecular weight range of the double-stranded nucleic acid and fragments thereof is: 6000-20000 Daltons; the single-stranded nucleic acid and fragments thereof preferably have a length of 12-30mer, and the single-stranded nucleic acid and fragments thereof are preferably single-stranded phosphosulfate oligonucleotides and fragments thereof; preferably, the molecular weight range of the single-stranded nucleic acid and fragments thereof is: 3000-10000 Daltons.
23. The nucleic acid conjugate according to claim 22, characterized in that Each nucleotide in the nucleic acid is independently a modified or unmodified nucleotide, or two adjacent nucleotides in the nucleic acid are linked by a phosphodiester bond, and one or more of the phosphodiester bonds are thiophosphate diester bonds; Preferably, each nucleotide in the nucleic acid is independently a fluorine-substituted modified nucleotide or a non-fluorine-substituted modified nucleotide; Preferably, the fluorine substitution modification is that the 2'-hydroxyl group of the pentose of the nucleotide is replaced by F; Preferably, the non-fluorine substitution modification is that the 2'-hydroxyl group of the pentose of the nucleotide is replaced by an alkoxy group, and the 2'-hydroxyl group is preferably replaced by a methoxy group or a 2'-methoxyethoxy group.
24. The nucleic acid conjugate according to claim 22 or 23, characterized in that The conjugate is conjugated to the double-stranded nucleic acid; the double-stranded nucleic acid contains a sense strand and an antisense strand, preferably, the conjugate is conjugated to the 3' or 5' end of the sense strand or the antisense strand; preferably, the conjugate is conjugated to the 3' end of the sense strand.
25. The nucleic acid conjugate according to any one of claims 22 to 25, characterized in that One side of the conjugate is conjugated to the double-stranded nucleic acid, and the other side is conjugated to the single-stranded nucleic acid; preferably, one side of the conjugate is conjugated to the sense strand of the double-stranded nucleic acid, and the other side is conjugated to the single-stranded nucleic acid to form the sense strand of the nucleic acid conjugate; preferably, the single-stranded nucleic acid is located at the 3' or 5' end of the sense strand of the nucleic acid conjugate; preferably, the single-stranded nucleic acid is located at the 3' end of the sense strand of the nucleic acid conjugate.
26. The nucleic acid conjugate according to any one of claims 24 to 25, characterized in that The sequence of the sense strand is selected from the following sequences: 1)CAUUUUAAUCCUCACUCUAAA, 2) GCUCAGCAUUGCCUGAAUAAA, or, 3)UGCAAAUAGUCUACAAACCAA, The sequence of the antisense strand is selected from the following sequences: 4)UUUAGAGUGAGGAUUAAAAUGAG, 5) UUUAUUCAGGCAAUGCUGAGCUU, or 6)UUGGUUUGUAGACUAUUUGCACA.
27. The nucleic acid conjugate according to any one of claims 22 to 25, characterized in that The single-stranded nucleic acid comprises 14-20 nucleotides, preferably 16 nucleotides, and preferably comprises a sequence selected from the following: CCGTCGCCCTTCAGCACGCA, CGTCGCCCTTCAGCACGC, GTCGCCCTTCAGCACG, or, TCGCCCTTCAGCAC; Preferably, the single-stranded nucleic acid comprises TCGCCCTTCAGCAC.
28. The conjugate according to claim 18, characterized in that The conjugate is selected from at least one of the following structures (L1")-(L36") and (L'10"): In the above table, Nu, Nu1, and Nu2 independently represent nucleic acids or nucleic acid fragments; Nu, Nu1, and Nu2 may be the same or different; Wherein, E is selected from O or S.
29. The nucleic acid conjugate according to claim 18, characterized in that The nucleic acid conjugate has the following structure: , preferably, E is O.
30. Use of the lipid compound according to any one of claims 1 to 17 for preparing the nucleic acid conjugate according to any one of claims 18 to 29.
31. Use of the nucleic acid conjugate according to any one of claims 18 to 29 for preparing a drug for treating gene-related diseases; Preferably, the gene is selected from APP, SOD1, HTT, MeCP2, DUX4, HDAC2, GPR75, Ataxin 1, Ataxin 2, Ataxin 3, Ataxin 6, Ataxin 7, C9ORF72, UBE3A, Prion, PMP22, Tau, LRRK2, LINGO2, GYS1, KCNT1, IRF5, Progranulin, GFAP, TARDBP, SNCA, FUS, SCA1, SCA7, SCA8, MeCP2, PRNP, SOD1, DMPK, MAPT or TTR; Preferably, the disease is a central nervous system disease; preferably, the central nervous system disease is selected from Alzheimer's disease, preferably Alzheimer's disease, ALS, Huntington's disease, Parkinson's disease, Dravet syndrome, Charcot triad, Alexander disease, spinocerebellar ataxia or Angelman syndrome; preferably, the disease is selected from Alzheimer's disease, ALS or spinocerebellar ataxia; Preferably, the drug is an injection or an oral preparation; preferably, it is an injection administered intracranially, intrathecally, subcutaneously, intravenously, or intramuscularly.
Citation Information
Patent Citations
Extrahepatic delivery
US20220125823A1
Compounds, conjugates and uses thereof
CN114763367A