Co-culture system and method for synthesizing target compound

Abstract

Disclosed is a co-culture system for synthesizing a target compound. The co-culture system comprises at least one feeding strain of bacteria and at least one production strain of bacteria, wherein the feeding strain of bacteria provides a precursor compound, and the production strain of bacteria produces the target compound by using the precursor compound; and the co-culture system also comprises an antibiotic, wherein one of the production strain of bacteria and the feeding strain of bacteria is resistant to the antibiotic, and the other is not resistant to the antibiotic. Further disclosed is a method for synthesizing a target compound by using the co-culture system.

Description

Co-cultivation system and method for synthesizing target compounds Technical Field

[0001] The present invention relates to a co-cultivation system and method for synthesizing a target compound, and in particular to controlling the dynamics of a strain in a co-cultivation system for synthesizing a target compound. Background Art

[0002] Terpenes are widely used in various industrial applications, such as flavors, fragrances, biofuels, pharmaceuticals, rubber, and pesticides. These compounds are produced by plants, but usually in low concentrations that do not support industrial demand.

[0003] Terpenoids are compounds derived from mevalonic acid or deoxy-D-xylulose 5-phosphate, with a molecular skeleton based on isoprene units (C5 units), and their oxygenated derivatives. These oxygenated derivatives can be alcohols, aldehydes, ketones, carboxylic acids, esters, and more. The metabolites produced during the production of terpenoid molecules are often complex, requiring multiple steps and involving complex chemical reactions, leading to low yields, incorrect stereochemistry, and high costs.

[0004] In one method for synthesizing terpenoids, two strains, such as a feeder strain and a producer strain, are cultured in a culture medium according to the isoprene unit biosynthesis pathway to produce terpenoids. However, the strain population can vary during the growth phase, leading to variations in the total terpene production. Under varying conditions and metabolic loads, the faster-growing strain will dominate the culture. This currently makes it difficult to control the ratio of feeder strains to producer strains within a desired range throughout the entire culture process.

[0005] There are some existing technologies for regulating the growth rate of strains (such as mutant strains) in co-culture systems ((Aulakh, Simran Kaur et al., Nature Chemical Biology (2023): 1-11. https: / / doi.org / 10.1038 / s41589-023-01341-2), toxin-antitoxins (US10188114B2)). In addition, some technologies use quorum sensing (Scott et al. Nature Microbiology 2017, 2, 17083; DOI: 10.1038 / nmicrobiol.2017.83) or optogenetics (Lalwani, Makoto A., et al. ACS Synthetic Biology). 10.8(2021):2015-2029.doi.org / 10.1021 / acssynbio.1c00182) for strain growth control, which controls strain growth by adjusting the expression of antibiotic resistance or toxic proteins (Gutiérrez Mena, Joaquín, Sant Kumar, and Mustafa Khammash. Nature Communications 13.1(2022):4808.https: / / doi.org / 10.1038 / s41467-022-32392-z, Yurtsev, Eugene Anatoly, Arolyn Conwill, and Jeff Gore. Proceedings of the National Academy of Sciences 113.22(2016):6236-6241.www.pnas.org / cgi / doi / 10.1073 / pnas.1523317113, Liu, Feng, et al.ACS synthetic biology 8.8(2019):1713-1722.DOI:10.1021 / acssynbio.9b00110; Blanchard, Andrew E., Chen Liao, and Ting Lu. Cellular and Molecular Bioengineering 9(2016):443-454. https: / / doi.org / 10.1007 / s12195-016-0447-6, Fedorec, Alex JH, et al. Nature communications 12.1(2021):1977.https: / / doi.org / 10.1038 / s41467-021-22240-x). Most of these systems require knocking out the expression of essential genes or enzymes to obtain response elements and growth regulators; however, the expression of control systems accompanied by heterologous pathways can increase stress on the microorganism. Summary of the Invention

[0006] In order to overcome the shortcomings of the prior art, the object of the present invention is to provide a co-cultivation system for synthesizing a target compound, the co-cultivation system comprising at least one feeder strain and at least one production strain, wherein the feeder strain provides a precursor compound, and the production strain utilizes the precursor compound to produce the target compound, the co-cultivation system further comprising an antibiotic, and wherein one of the production strain and the feeder strain is resistant to the antibiotic, and the other is not resistant to the antibiotic.

[0007] By means of the co-cultivation system according to the present invention, the ratio of the production strain to the feeder strain can be simply and accurately adjusted dynamically, thereby controlling the growth dynamics of the microorganisms while reducing the stress on the microorganisms expressing heterologous enzymes.

[0008] According to some advantageous embodiments of the present invention, in the co-cultivation system, one of the production strain and the feeder strain that grows faster is susceptible to antibiotics, and the other that grows slower is resistant to antibiotics. In some preferred embodiments, the faster growing strain is the feeder strain, and the slower growing strain is the production strain.

[0009] According to some embodiments of the invention, the feeder strain is susceptible to the antibiotic, and the production strain is resistant to the antibiotic.

[0010] According to some embodiments of the present invention, the target compound is a synthetic terpenoid compound.

[0011] According to some embodiments of the invention, the precursor compound is mevalonic acid.

[0012] According to some embodiments of the present invention, the feeder strain is used to provide mevalonic acid, and the production strain utilizes the mevalonic acid to synthesize terpenoids.

[0013] According to some embodiments of the invention, the feeder strain contains an overexpressed gene for synthesizing mevalonate and does not contain a gene for synthesizing farnesyl pyrophosphate.

[0014] According to some embodiments of the present invention, the production strain contains a first plasmid and a second plasmid, the first plasmid contains a gene for synthesizing farnesyl pyrophosphate and does not contain a gene for synthesizing mevalonic acid, and the second plasmid contains a gene for the terpenoid synthase.

[0015] According to some embodiments of the present invention, the target compound includes at least one of a monoterpenoid, a sesquiterpenoid, and a diterpenoid.

[0016] According to some embodiments of the present invention, the monoterpenoid compound includes at least one of linalool, geraniol and 2,6-dimethyloctane, the sesquiterpenes include at least one of bisabolene, cyclopentadiene, isobara, buniene, valencene, β-patchoulene, aristolochene, guaiacene, cedrene, buniene oxide and valencene oxide, and / or the diterpenoid compound is taxadiene.

[0017] According to some embodiments of the present invention, the terpenoid compound includes at least one of linalool, geraniol, 2,6-dimethyloctane, bisabolene, cycloterpenes, isomerene, taxadiene, bunene, valencene, β-patchoulene, and aristolochene.

[0018] According to some embodiments of the invention, the terpenoid comprises at least one of an oxidation product of bunene or valencene.

[0019] According to some embodiments of the present invention, the antibiotic acts externally by inhibiting cell wall synthesis and acts internally by inhibiting gene translation. In some embodiments, the antibiotic in the co-culture system includes at least one of chloramphenicol, streptomycin, kanamycin and tetracycline.

[0020] According to some preferred embodiments of the present invention, the antibiotic is an intracellular antibiotic, preferably streptomycin.

[0021] According to some embodiments of the present invention, the concentration of the antibiotic is set so that cells of the strain that are not resistant to the antibiotic, i.e., susceptible to the antibiotic, are not killed but only have their growth rate restricted, while cells of the strain that are resistant to the antibiotic are not affected by the antibiotic.

[0022] According to some embodiments of the present invention, the initial concentration of the antibiotic is set such that the growth rate of feeder cells that are not resistant to the antibiotic is inhibited by the antibiotic.

[0023] According to some embodiments of the present invention, since the bacterial strains resistant to antibiotics in the co-cultivation system degrade the antibiotics, the bacterial strains susceptible to antibiotics are gradually protected from the effects of the antibiotics. For example, the production strain can gradually degrade the antibiotics during incubation to reduce the effects of the antibiotics on the rearing strains. In this case, the growth rate of the rearing strain depends on the initial concentration of the antibiotic and the degradation rate of the antibiotic, and the degradation rate of the antibiotic depends on the growth rate of the production strain. Thus, the growth rate of the production strain indirectly controls the growth rate of the rearing strain.

[0024] According to some embodiments of the invention, based on the co-cultivation system, the concentration of the antibiotic is not less than 5 μg / ml, and / or not more than 20 μg / ml.

[0025] According to some embodiments of the invention, based on the co-culture system, the antibiotic concentration is 5 μg / ml to 20 μg / ml, for example, 5 μg / ml, 6 μg / ml, 7 μg / ml, 8 μg / ml, 9 μg / ml, 10 μg / ml, 11 μg / ml, 12 μg / ml, 13 μg / ml, 14 μg / ml, 15 μg / ml, 16 μg / ml, 17 μg / ml, 18 μg / ml, 19 μg / ml, 20 μg / ml or any interval therebetween.

[0026] According to some embodiments of the invention, based on the co-cultivation system, the antibiotic concentration is 5 μg / ml to 12.5 μg / ml.

[0027] According to some embodiments of the invention, based on the co-cultivation system, the antibiotic concentration is 5 μg / ml to 10 μg / ml.

[0028] According to some embodiments of the present invention, the production strain is transformed with pMBIS and pTRC-BS plasmids, thereby enabling the production strain to produce bunene.

[0029] According to some embodiments of the present invention, the production strain is transformed with at least one of the plasmids pCDF-FIAMAV and pCDF-FIAMAV-V1. Thus, the production strain is resistant to antibiotics in the co-cultivation system and oxidizes bulnesene to bulnesene-15-ol and bulnesene-15-al.

[0030] According to some embodiments of the present invention, antibiotic resistance plasmids are removed from the feeder strain, making the feeder strain more susceptible to antibiotics, thereby reducing the initial concentration of antibiotics in the co-culture system and thereby reducing the biological pressure exerted on both strains.

[0031] Another object of the present invention is to provide a method for synthesizing a target compound, wherein the method synthesizes the target compound by using the co-cultivation system according to the present invention.

[0032] According to some embodiments of the present invention, the concentration of the antibiotic is set so that the ratio of the number of the feeder strain to the number of the production strain matches the concentration of the antibiotic. For example, an appropriate initial antibiotic concentration is set to achieve a desired ratio of the number of feeder strains to the number of production strains during incubation.

[0033] According to some embodiments of the present invention, when the inoculum ratio of the feeder strain to the production strain exceeds 25%:75%, the antibiotic concentration can be gradually increased, for example, to 5 μg / ml to 20 μg / ml, or any value therebetween. The total terpene production level can be used to determine the antibiotic concentration required for a specific ratio of feeder strain to production strain. This allows for appropriate control of the growth of the feeder strain.

[0034] According to some embodiments of the present invention, the feeder strain and / or the production strain is selected from one or more of bacteria, fungi or yeast. According to some specific embodiments of the present invention, the feeder strain and / or the production strain is Escherichia coli.

[0035] According to some embodiments of the present invention, the ratio of the feeder strain to the production strain is (10-90):(90-10). According to some preferred embodiments of the present invention, the ratio of the feeder strain to the production strain is (12.5-75):(87.5-25). In the present invention, the ratio of the production strain to the feeder strain can be controlled by changing the inoculation ratio, thereby further improving the yield of terpenoid compounds.

[0036] According to some embodiments of the present invention, the feeder strain is present in an amount of 10% to 90% by volume of the total inoculum volume of the feeder strain and the production strain. According to a preferred embodiment of the present invention, the feeder strain is present in an amount of 12.5% ​​to 75% by volume of the inoculum volume of the feeder strain and the production strain, for example, 12.5%, 25%, 37.5%, 50%, 62.5%, 75% and any value therebetween.

[0037] The co-cultivation system according to the present invention can increase the total production of terpenoid compounds. When the co-cultivation system according to the present invention is carried out in a shake flask, it can produce about 500 mg / L to 2500 mg / L of terpenoid compounds, and when the co-cultivation system is transferred to a fermenter, the production will be significantly increased.

[0038] By means of the co-cultivation system according to the present invention, any terpenoid compounds can be produced by expressing the corresponding terpene synthase, including but not limited to monoterpenoids (linalool, geraniol and 2,6-dimethyloctane) and other sesquiterpenes (bisabolene, terpenes and isostearene) for the production of biofuels, and diterpenes (taxadiene) for pharmaceutical and other applications.

[0039] According to some embodiments of the present invention, the feeder strains can be further modified to express hydrolases to degrade polymers such as cellulose, lignin, hemicellulose, etc.; in some embodiments, a variety of feeder strains can be developed and controlled by utilizing or degrading antibiotic systems for the production of terpenoids from complex biomaterials; in some embodiments, the antibiotic-controlled co-culture principle can be combined with other approaches to enhance the interaction, flux and product formation of microbial communities; in some embodiments, different microorganisms such as yeast, fungi and bacteria can be used to create a co-culture of multiple strains, and their numbers can be controlled by antibiotics during growth and expression. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] FIG1 schematically shows the productivity of single strains and co-culture systems for the biosynthesis of bunienes and their oxidation products using pCDF-FIAMAV.

[0041] FIG2 schematically shows the yields of single strains and co-culture systems for the biosynthesis of buniene and its oxidation products using pCDF-FIAMAV-V1.

[0042] FIG3 schematically shows the productivity of the co-cultivation system of Example 1.

[0043] FIG4 schematically shows the productivity of the co-cultivation system of Example 2.

[0044] FIG5 schematically shows the productivity of the co-cultivation system of Example 3.

[0045] FIG6 schematically shows the productivity of the co-cultivation system of Example 4. DETAILED DESCRIPTION

[0046] The present application will be further described below in conjunction with specific embodiments. It should be understood that these specific embodiments are only used to illustrate the present application and are not used to limit the scope of the present application.

[0047] For the sake of clarity, only some numerical ranges are specifically disclosed herein. However, any lower limit may be combined with any upper limit to form an unspecified range; and any lower limit may be combined with other lower limits to form an unspecified range, and similarly, any upper limit may be combined with any other upper limit to form an unspecified range. In addition, each individually disclosed point or single value may itself serve as a lower limit or upper limit and be combined with any other point or single value, or with other lower limits or upper limits, to form an unspecified range.

[0048] Unless otherwise specified, the terms used in this application have the commonly understood meanings commonly understood by those skilled in the art. Unless otherwise specified, the numerical values ​​of the various parameters mentioned in this application can be measured using various measurement methods commonly used in the art (for example, they can be tested according to the methods given in the examples of this application).

[0049] A list of items connected by the terms "at least one of," "at least one of," or other similar terms can mean any combination of the listed items. For example, if items A and B are listed, the phrase "at least one of A and B" means only A; only B; or A and B. In another example, if items A, B, and C are listed, the phrase "at least one of A, B, and C" means only A; or only B; only C; A and B (excluding C); A and C (excluding B); B and C (excluding A); or all of A, B, and C. Item A can contain a single component or multiple components. Item B can contain a single component or multiple components. Item C can contain a single component or multiple components.

[0050] The pMVA, pMBIS, and pMeVT plasmids are resistant to chloramphenicol and were generated by a method similar to that disclosed in Chinese patent application 2022105905014 (international application number PCT / CN2023 / 096509).

[0051] In the present example, a codon-optimized bulnesene synthase gene (NCBI-KF800046) was cloned into pTRC-HisA to generate plasmid pTRC-BS, which confers resistance to clobbercillin.

[0052] In this embodiment, wild-type P450BM3 (nucleotide sequence: SEQ ID No. 1, amino acid sequence: SEQ ID No. 2) was provided. The gene encoding the P450BM3 variant F87I / A82M / A330V was then cloned into the pCDF-duet vector to create pCDF-FIAMAV. In this embodiment, the T7 promoter (TAATACGACTCACTATAGGGGAA) of pCDF-FIAMAV was mutated (TAATACGACTCACTATCAAGGAA) to generate pCDF-FIAMAV-V1. pCDF-duet confers resistance to streptomycin.

[0053] Comparative Example 1 Single Strain System

[0054] The production strain is obtained by transforming pMVA, pTRC-BS and pCDF-FIAMAV or pCDF-FIAMAV-V1 plasmids into E. coli BL21 (DE3). The single strain is resistant to ampicillin, chloramphenicol and streptomycin. The production strain is inoculated into a separate 5ml LB (Luria-Bertani) medium, 100 μg / ml ampicillin, 36 μg / ml chloramphenicol and 100 μg / ml streptomycin are added and incubated at 37°C for 12 hours to obtain an overnight seed culture. The overnight seed culture is inoculated with a medium containing 100 μg / ml ampicillin, 36 μg / ml chloramphenicol and 100 μg / ml streptomycin added to 25ml TB (Terrific Broth) and incubated at 37°C and 200 rpm. Once the OD at 600nm reaches 0.6, the culture is induced using 0.1mM IPTG and incubated at 30°C. 2% w / v glucose was added as a carbon source, and 15% v / v decane was added as a second organic phase to extract terpenoids. The culture was induced twice with 0.1 mM IPTG at 24-hour intervals and supplemented with 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, and 100 μg / ml streptomycin, 2% glucose, and 2% tryptone. The decane phase was cleared by centrifugation after 72 hours and analyzed by GC.

[0055] The single-strain system using pCDF-FIAMAV produced 1400 mg / L of total terpenes and 53% oxidized bunieses (bunyene-15-ol and buniese-15-al) ( Figure 1 ). The single-strain system using pCDF-FIAMAV-V1 produced 885 mg / L of total terpenes and 36% oxidized bunieses ( Figure 2 ).

[0056] Comparative Example 2 Co-culture System

[0057] Feeder strains were generated by transforming pMevt, pUC-19, and pCDF-binary plasmids into E. coli BL21(DE3). Production strains were obtained by transforming pMBIS, pTRC-BS, and pCDF-FIAMAV or pCDF-FIAMAV-V1 plasmids into E. coli BL21(DE3). Both feeder and production strains were resistant to ampicillin, chloramphenicol, and streptomycin. Colonies of the feeder and production strains were inoculated into separate 5 ml LB (Luria-Bertani) medium, supplemented with 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, and 100 μg / ml streptomycin, and incubated at 37°C for 12 hours to obtain overnight seed cultures. Overnight cultures of the feeder and production strains at different ratios (25%:75% to 50%:50%) were inoculated into 25 ml of TB (Terrific Broth) medium supplemented with 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, and 100 μg / ml streptomycin and incubated at 37°C and 200 rpm. Once the OD at 600 nm reached 0.6, the culture was induced with 0.1 mM IPTG and incubated at 30°C. 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, 100 μg / ml streptomycin, and 2% w / v glucose were added as a carbon source, and 15% v / v decane was added as a second organic phase to extract terpenoids.

[0058] The co-cultivation system with pCDF-FIAMAV and 37.5% of the feeder strain produced 2234 mg / L of total terpenes and 59% oxidized bunenes (Figure 1). The co-cultivation system with pCDF-FIAMAV and 25% of the feeder strain produced 1667 mg / L of total terpenes and 66% oxidized bunenes (Figure 1). The co-cultivation system with pCDF-FIAMAV-V1 and 37.5% of the feeder strain produced 1600 mg / L of total terpenes and 60% oxidized bunenes (Figure 2).

[0059] Example 1 Antibiotic control of 25% of the breeding strains and 75% of the production strains

[0060] Feeder strains were generated by transforming pMevt, pUC-19, and plasmids into E. coli BL21 (DE3). Compared to the control, the feeder strains did not include the pCDF-duet plasmid and were therefore sensitive to streptomycin. Production strains were generated by transforming pMBIS, pTRC-BS, and pCDF-FIAMAV plasmids into E. coli BL21 (DE3). The feeder strains were sensitive to streptomycin, but the production strains were resistant to it due to the presence of pCDF-FIAMAV. Colonies of the feeder and production strains were inoculated into 5 ml LB (Luria-Bertani) medium supplemented with 100 μg / ml ampicillin and 36 μg / ml chloramphenicol, and colonies of the production strain were inoculated into 5 ml LB (Luria-Bertani) medium supplemented with 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, and 100 μg / ml streptomycin. The feeder and production strains were incubated at 37°C for 12 hours to obtain overnight seed cultures. The feeder strain and the production strain with a volume ratio of 25%:75% were inoculated into 25 ml TB (Terrific Broth) culture medium supplemented with 100 μg / ml ampicillin and 36 μg / ml chloramphenicol, and incubated at 37°C and 200 rpm with a streptomycin concentration of 10 μg / ml or 12.5 μg / ml. Once the OD at 600 nm reached 0.6, the culture was induced with 0.1 mM IPTG and incubated at 30°C. 2% w / v glucose was added as a carbon source, and 15% v / v decane was added as a second organic phase to extract terpenoids. Cultures were induced twice every 24 hours with 0.1 mM IPTG, and supplemented with streptomycin (10 μg / ml or 12.5 μg / ml), 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, 2% glucose, and 2% tryptone. The decane phase was centrifuged and analyzed by GC after 72 hours.

[0061] The antibiotic-controlled co-cultivation system with 12.5 μg / ml streptomycin produced 2224 mg / L of total terpenes and 70% oxidized bunene ( FIG3 ). This represents a 33% increase in total terpene production compared to the co-cultivation system with the same inoculum ratio ( FIG3 ).

[0062] Example 2: Antibiotic control of 37.5% of the breeding strains and 62.5% of the production strains

[0063] The feeder strain was generated by transforming pMevt, pUC-19 and plasmids into E. coli BL21 (DE3). Compared to the control example, the feeder strain does not contain the pCDF-duet plasmid, so it is sensitive to streptomycin. The production strain was generated by transforming the pMBIS, pTRC-BS and pCDF-FIAMAV plasmids into E. coli BL21 (DE3). The feeder strain is sensitive to streptomycin, but due to the presence of pCDF-FIAMAV, the production strain is resistant to it. The colony of the feeder strain was inoculated into 5 ml LB (Luria Bertani) medium containing 100 μg / ml ampicillin and 36 μg / ml chloramphenicol. The colony of the production strain was inoculated into 5 ml LB (Luria Bertani) medium containing 100 μg / ml ampicillin, 36 μg / ml chloramphenicol and 100 μg / ml streptomycin. The feeder strain and the production strain were incubated at 37°C for 12 hours to obtain overnight seed cultures. The feeder strain and the production strain were inoculated into 25 ml of TB medium at a volume ratio of 37.5%:62.5% and incubated at 37°C and 200 rpm, with the streptomycin concentration maintained at 10 μg / ml to 15 μg / ml. Once the OD at 600 nm reached 0.6, the culture was induced with 0.1 mM IPTG and incubated at 30°C. 2% w / v glucose was added as a carbon source and 15% v / v decane was added as a second organic phase to extract terpenoids. The culture was induced twice with 0.1 mM IPTG every 24 hours and supplemented with 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, streptomycin (10 μg / ml to 15 μg / ml), 2% glucose and 2% tryptone. The decane phase was collected by centrifugation after 72 hours and analyzed by GC.

[0064] The antibiotic control co-cultivation system using 12.5 μg / ml streptomycin produced 2673 mg / L of total terpenes and 65% oxidized bunene ( FIG4 ). This represents a 15% increase in total terpene production compared to the co-cultivation system with the same inoculum ratio ( FIG4 ).

[0065] Example 3 Control of 50% of the breeding strains and 50% of the production strains by antibiotics

[0066] The feeder strain was generated by transforming pMevt, pUC-19 and plasmids into E. coli BL21 (DE3). Compared to the control example, the feeder strain does not contain the pCDF-duet plasmid, so it is sensitive to streptomycin. The production strain was generated by transforming the pMBIS, pTRC-BS and pCDF-FIAMAV plasmids into E. coli BL21 (DE3). The feeder strain is sensitive to streptomycin, but due to the presence of pCDF-FIAMAV, the production strain is resistant to it. The colony of the feeder strain was inoculated into 5 ml LB (Luria Bertani) medium containing 100 μg / ml ampicillin and 36 μg / ml chloramphenicol. The colony of the production strain was inoculated into 5 ml LB (Luria Bertani) medium containing 100 μg / ml ampicillin, 36 μg / ml chloramphenicol and 100 μg / ml streptomycin. The feeder strain and the production strain were incubated at 37°C for 12 hours to obtain overnight seed cultures. The feeder strain and the production strain were inoculated into 25 ml of TB medium at a volume ratio of 50%:50%, 100 μg / ml ampicillin, 36 μg / ml chloramphenicol were added and incubated at 37°C and 200 rpm. The streptomycin concentration was maintained at 10 μg / ml to 15 μg / ml. Once the OD at 600 nm reached 0.6, the culture was induced with 0.1 mM IPTG and incubated at 30°C. 2% w / v glucose was added as a carbon source and 15% v / v decane was added as a second organic phase to extract terpenoids. The culture was induced twice with 0.1 mM IPTG every 24 hours and supplemented with streptomycin (10 μg / ml to 15 μg / ml), 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, as well as 2% glucose and 2% tryptone. The decane phase was centrifuged after 72 hours and analyzed by GC.

[0067] The antibiotic control co-culture system using 15 μg / ml streptomycin produced 2627 mg / L of total terpenes and 59% oxidized bunene ( FIG5 ). This represents a 2.5-fold increase in total terpene production compared to the co-culture system strains with the same inoculum ratio ( FIG5 ).

[0068] Example 4: Increasing the antibiotic concentration for 25% of the rearing strains and 75% of the production strains

[0069] The rearing strain is produced by converting pMevt and pUC-19 plasmids into BL21 (DE3). Compared with the comparative example, the rearing strain does not contain the pCDF-duet plasmid, so it is sensitive to streptomycin. The production strain is produced by converting pMBIS, pTRC-BS and pCDF-FIAMAV-V1 plasmids into BL21 (DE3). The pCDF-FIAMAV-V1 plasmid is created by regulating FIAMAV expression by mutating the T7 promoter. The rearing strain is sensitive to streptomycin, but due to the presence of pCDF-FIAMAV-V1, the production strain is resistant to it. The colony of the rearing strain is inoculated into 5 ml LB (Luria Bertani) medium containing 100 μg / ml ampicillin and 36 μg / ml chloramphenicol. The colony of the production strain is inoculated into 5 ml LB (Luria Bertani) medium containing 100 μg / ml ampicillin, 36 μg / ml chloramphenicol and 100 μg / ml streptomycin. The feeder and production strains were incubated at 37°C for 12 hours to generate overnight seed cultures. A 25%:75% volume ratio of the feeder and production strains was inoculated into 25 ml of TB medium, supplemented with 100 μg / ml ampicillin and 36 μg / ml chloramphenicol, and incubated at 37°C and 200 rpm. Streptomycin concentrations were maintained at 5 μg / ml or 10 μg / ml. Once the OD at 600 nm reached 0.6, the cultures were induced with 0.1 mM IPTG and incubated at 30°C. 2% w / v glucose was added as a carbon source, and 15% v / v decane was added as a second organic phase to extract terpenoids. The cultures were induced twice with 0.1 mM IPTG at 24-hour intervals and supplemented with 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, 2% glucose, and 2% tryptone. After 24 hours, 10 μg / ml or 15 μg / ml streptomycin was added to the cultures. After 48 hours, 15 μg / ml to 25 μg / ml streptomycin was added to the culture. The decane phase was centrifuged and analyzed by GC after 72 hours.

[0070] An antibiotic control co-culture system with increasing streptomycin concentrations (5 μg / ml at inoculation, 12.5 μg / ml at 24 hours, and 20 μg / ml at 48 hours) produced 1636 mg / L of total terpenes and 61% oxidized bunene (Figure 6). This represents a 70% increase in total terpene production compared to a co-culture system with the same inoculum ratio (Figure 6).

[0071] Although some exemplary embodiments of the present application have been illustrated and described, the present application is not limited to the disclosed embodiments. On the contrary, those skilled in the art will recognize that some modifications and changes may be made to the described embodiments without departing from the spirit and scope of the present application as described in the appended claims.

Claims

1. A co-cultivation system for synthesizing a target compound, characterized in that: The co-cultivation system comprises at least one feeder strain and at least one production strain, wherein the feeder strain provides a precursor compound and the production strain utilizes the precursor compound to produce the target compound, the co-cultivation system further comprises an antibiotic, and wherein one of the production strain and the feeder strain is resistant to the antibiotic and the other is not resistant to the antibiotic.

2. The co-cultivation system according to claim 1, characterized in that The target compound is a terpenoid compound, and preferably the precursor compound is mevalonic acid. The cultured bacteria are used to provide mevalonic acid, and the production strain is used to synthesize terpenoid compounds using the mevalonic acid.

3. The co-cultivation system according to claim 1, characterized in that The target compound includes at least one of monoterpenoid compounds, sesquiterpenoid compounds and diterpenoid compounds.

4. The co-cultivation system according to claim 3, characterized in that The monoterpene compound includes at least one of linalool, geraniol and 2,6-dimethyloctane, the sesquiterpene includes at least one of bisabolene, cyclopentene, isomerene, bunene, valencene, β-patchoulene, aristolochene, guaiacene, cedrene, bunene oxide and valencene oxide, and the diterpene compound is taxadiene.

5. The co-cultivation system according to claim 1 or 2, characterized in that: The antibiotic is an intracellular antibiotic, preferably streptomycin.

6. The co-cultivation system according to claim 1, characterized in that: Based on the co-cultivation system, the concentration of the antibiotic is not less than 5 μg / ml, and / or not more than 20 μg / ml.

7. The co-cultivation system according to claim 1, characterized in that: Based on the co-cultivation system, the antibiotic concentration is 5 μg / ml to 20 μg / ml, preferably 5 μg / ml to 12.5 μg / ml, particularly preferably 5 μg / ml to 10 μg / ml.

8. The co-cultivation system according to claim 1, characterized in that: An antibiotic resistance plasmid was removed from the rearing strain.

9. A method for synthesizing a target compound, characterized in that: The method synthesizes the target compound by using the co-cultivation system according to any one of claims 1 to 8.

10. The method according to claim 9, characterized in that The concentration of the antibiotic is set so that the ratio of the feeder strain to the production strain and the concentration of the antibiotic match.

11. The method according to claim 9, characterized in that When the inoculation ratio of the feeder strain to the production strain exceeds 25%:75%, the concentration of the antibiotic may also be gradually increased.

Images