Rodent models obtained by knock-in of the human her2 gene

Abstract

The present invention is comprised within the field of biotechnology. Particularly, the present invention relates to a a novel HER2 transgenic rodent and to its use to develop a tumor model to test HER2-directed cancer therapies. Further, the invention also relates to a method for producing a rodent cell lacking the Erbb2 gene and to a method for obtaining the transgenic rodent.

Description

[0001] RODENT MODELS OBTAINED BY KNOCK-IN OF THE HUMAN HER2 GENE

[0002] FIELD OF THE INVENTION

[0003] The present invention is comprised within the field of biotechnology. Particularly, the present invention relates to a novel HER2 transgenic rodent and to its use to develop a tumor model to test HER2-directed cancer therapies. Further, the invention also relates to a method for producing a rodent cell lacking the Erbb2 gene and to a method for obtaining the transgenic rodent.

[0004] BACKGROUND OF THE INVENTION

[0005] Members of the ErbB family of receptor tyrosine kinases are important mediators of cell growth, differentiation and survival. The receptor family includes four distinct members, including epidermal growth factor receptor (EGFR or ErbB1), HER2 (ErbB2 or p185<neu>), HER3 (ErbB3) and HER4 (ErbB4 or tyro2).

[0006] HER 2 or p185<neu>, was originally identified as the product of the transforming gene from neuroblastomas of chemically treated rats. Amplification and overexpression of HER2 (ErbB2) is found in 30% of human breast cancers and is associated with refractory responsiveness to chemotherapy and overall poor prognosis. HER2 overexpression is thought to lead to ligand-independent association / dimerization of ERBB receptors, resulting in constitutive activation and signaling through the potent ErbB2 tyrosine kinase pathway. Overexpression of ErbB2 (frequently but not uniformly due to gene amplification) has also been observed in other carcinomas including carcinomas of the stomach, endometrium, salivary gland, lung, kidney, colon, thyroid, pancreas and bladder.

[0007] Experimental animal models are an indispensable research tool for studying the effects of anti-HER2 agents (e.g., anti-HER2 antibodies). Common experimental animals include mice, rats, guinea pigs, hamsters, rabbits, dogs, monkeys, pigs, fish and so on. However, there are many differences between human and animal genes and protein sequences, and many human agents targeting human proteins cannot bind to the animal’s homologous proteins to produce biological activity, leading to that the results of many clinical trials do not match the results obtained from animal experiments, specially regarding the safety of the therapies. A large number of clinical studies are in urgent need of better animal models. With the continuous development and maturation of genetic engineering technologies, the use of human cells or genes to replace or substitute an animal’s endogenous similar cells or genes to establish a biological system or disease model closer to human, and establish the humanized experimental animal models (humanized animal model) has provided an important tool for new clinical approaches or means.

[0008] There are some transgenic mice that express the human protein HER2 under a strong promoter, like the murine mammary tumor virus (MMTV) promoter (David Finkle et al., 2004, Clinical Cancer Research, vol 10: 2499-2511) or the whey acidic protein (WAP) promoter (Marie P. Piechocki et al., J Immunol 2003; 171 :5787-5794). While they show evidence of HER2 expression, it is only in some locations (brain and mammary gland in one case, breast in the other) and at higher levels that the normal protein. Because of the inherent limitations of the rodent neu-transgenic models, which, although useful for the study of basic HER2 biology and of nonspecific therapies, are not suitable for examining therapeutics specifically targeted to the human form of HER2.

[0009] The fact that these mice are not widely used to test the safety of antiHER2 therapies evidences that they are not good models to test it. Expression of HER2 in lungs or stomach from mice is desired, as most of the adverse effects observed in patients are directed to these two organs.

[0010] Thus, the generation of valid experimental models to test the toxicity or to test the safety profile of anti-HER2 therapies represents an unmet medical need.

[0011] SUMMARY OF THE INVENTION

[0012] The authors of the present invention have generated a transgenic mouse for the expression of the human protein HER2 under the promoter of the homologous murine protein Erbb2. This allows the expression of HER2 under controlled, physiological levels in the normal tissues where Erbb2 would be expressed.

[0013] Thus, in a first aspect, the present invention relates to a transgenic rodent, hereinafter the transgenic rodent of the invention, characterized in that a region of at least one copy of the endogenous Erbb2 gene is modified so that a region within the gene which encodes at least part of the rodent ERBB2 protein is replaced with a polynucleotide that encodes the human HER2 protein, wherein said polynucleotide is operably linked to the promoter of the endogenous Erbb2 gene.

[0014] In another aspect, the present invention relates to a method, hereinafter the first method of the invention, for determining the safety profile of an anti-HER2 therapeutic agent which targets the human HER protein, wherein the method comprises: (i) contacting the transgenic rodent of the invention with said therapeutic agent and

[0015] (ii) determining in the transgenic rodent one or more parameters indicative of the presence of adverse effects as a result of the treatment with the anti-HER2 therapeutic agent.

[0016] In another aspect, the present invention relates to a polynucleotide, hereinafter the polynucleotide of the invention, which comprises in the 5’ to 3’ direction:

[0017] (i) a first region which comprises a region of the genome of a non-human animal which is located 5’ with respect of the 5’-UTR of the HER2 gene in said non-human animal,

[0018] (ii) a second region which encodes the human HER2 protein and

[0019] (iii) a third region which comprises a region of the genome of said non-human animal which is located 3’ end with respect to the 3’-UTR of the HER2 gene in said non-human animal.

[0020] In another aspect, the present invention relates to a vector, hereinafter the vector of the invention, comprising the polynucleotide of the invention.

[0021] In another aspect, the present invention relates to a host cell comprising the polynucleotide of the invention or the vector of the invention.

[0022] In another aspect, the invention relates to a method, hereinafter the second method of the invention, for producing a rodent cell lacking the Erbb2 gene that comprises contacting said cell with the polynucleotide of the invention under conditions adequate for the polynucleotide to enter the cell and for recombination to occur between the first and third regions of the polynucleotide and the homologous regions in the genome of the rodent cell.

[0023] In another aspect, the present invention relates to a method, hereinafter the third method of the invention, for obtaining the transgenic rodent of the invention which comprises generating an animal from an embryonic stem cell obtained by the second method of the invention.

[0024] BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Description of the strategy followed for the generation of HER2 knock in mice. mErbb2 gene is targeted with a vector encoding the human HER2 exons and a neomycin resistance cassette. After correct insertion in the locus of interest, the resistance cassette is removed by electroporation of zygotes with flippase mRNA. The final construct is transcribed from the mErbb2 promoter leading to the expression of human HER2 in mice tissues.

[0026] Figure 2. Southern blot analysis of ES cell clones. 11 clones of ES cells modified to express the human HER2 construct were assayed by Southern Blot. DNA was extracted and digested with Sacl restriction enzyme (A). Following electrophoresis and blotting, filters were hybridized with a 5’ probe (Sacl digests) for visualization (B). The upper band corresponds to HER2 (16770 bp) and the lower band to mErbb2 (8669 bp). Clones 1 B12 (heterozygous) and 1G10 (homozygous for the insertion) were selected for further analysis.

[0027] Figure 3. Generation and Characterization of the expression of HER2 in tissues from HER2 knock in mice. (A) Lungs and Kidneys from HER2 knock in mice were extracted, mechanically disaggregated and analysed by RT-qPCR with primers specific for the mouse (mErbb2) or the human (HER2) transcripts. 1 B12 and 1G10 are HER2 knock in mice from two different ES cell clones. WT stands for control littermates negative for the insertion. (B, C) HER2 protein expression was assessed in kidney tissues by indirect immunofluorescence (B) and in lung tissues by Western blot (C) using anti-HER2 antibodies. Two-sided Student t test analyses compare to WT in each organ. *** P < 0.001 , **** P < 0.0001.

[0028] Figure 4. Characterization of the expression of HER2 in tissues from HER2 knock in mice. RT-qPCR analyses were conducted on the specified organs using HER2-specific primers to assess expression levels. n>3. 1 B12 and 1G10 are HER2 knock in mice from two different ES cell clones. WT stands for wild-type control littermates negative for the insertion. Two-sided Student t test analyses compare to WT in each organ. * P < 0.05, ** P < 0.01 , *** P < 0.001 , **** P < 0.0001.

[0029] Figure 5. Evaluation of HER2 knock-in mice progeny in heterozygous crossings. (A) Recapitulation of offspring from heterozygous x heterozygous matings, detailing both expected Mendelian ratios and observed percentages. (B) PCR analysis of a representative sample from five offspring, categorizing each as homozygous (in orange), heterozygous (in green), or wild type (in black) using specific primers targeting the murine Erbb2 gene or the HER2 insertion. (C, D) Comparative assessment of body weight across different genetic profiles within the colony, differentiated by sex. n>4. Data are represented as averages ± SD. Two-way ANOVA analyses compare as indicated, ns non-significant, significant p value is shown in graph. Figure 6. Analysis of offspring in homozygous HER2 knock-in mouse crossings. Upper, PCR analysis of a representative homozygous x homozygous mating, highlighting the homozygous (in orange). Lower, PCR analysis of the offspring, highlighting the homozygous (in orange). Specific primers targeting the murine Erbb2 gene or the HER2 insertion were used.

[0030] DETAILED DESCRIPTION OF THE INVENTION

[0031] Human HER2 gene Knock-in rodent models

[0032] In a first aspect, the present invention relates to a transgenic rodent, hereinafter the transgenic rodent of the invention, characterized in that a region of at least one copy of the endogenous Erbb2 gene is modified so that a region within the gene which encodes at least part of the rodent ERBB2 protein is replaced with a polynucleotide that encodes the human HER2 protein, wherein said polynucleotide is operably linked to the promoter of the endogenous Erbb2 gene.

[0033] The term "transgenic rodent" is defined as a rodent at least some of whose germ cells contain genetic material, originally derived from another animal, other than an ancestor of said animal, as a result of human intervention. So defined, it includes progeny of a transgenic animal which retain the transgenic genotype. It is not necessary that all cells of the animal contain the transgene.

[0034] As used in the present invention, the transgenic rodent of the invention refers to a knock- in rodent. The term “knock-in technology” refers to a genetic engineering method that involves the one-for-one substitution of DNA sequence information in a genetic locus or the insertion of sequence information not found within the locus. The difference between knock-in technology and traditional transgenic techniques is that a knock-in involves a gene inserted into a specific locus, and is thus a "targeted" insertion. Thus, the HER2 knock-in rodent of the invention contains at least one Erbb2 modified gene, which is a substitution of the native Erbb2 gene by the human orthologue.

[0035] In a particular embodiment, the knock-in rodent has a mixed F1 genetic background of crossbreeding of C57BL / 6 and 129, particularly C57BL / 6Ncr x 129S6 / SvEvTac.

[0036] An F1 background means that the mice are first generation hybrids of a cross between two different strains, in the present invention C57BL / 6Ncr and 129S6 / SvEvTac.

[0037] The reference to human intervention is intended to exclude genetic modification as a result of unintentional infection with a virus. The terms "progeny" and "progeny of the transgenic rodent" refer to any and all offspring of every generation subsequent to the originally transformed rodents.

[0038] The term "transgene", in accordance with the present invention, refers to a nucleic acid sequence that is introduced into the genome of the cell. In non-limiting examples, the transgene can consist of an exogenous gene not normally present in the target sequence, such as for example a gene from one species that is introduced into a cell derived from another species. In the present invention a polynucleotide encoding the human HER2 protein is introduced into a cell derived from a rodent.

[0039] Construction of transgenes can be accomplished using any suitable genetic engineering techniques well known in the art, including, without limitation, the standard techniques of restriction endonuclease digestion, ligation, transformation, plasmid purification, DNA sequencing etc., as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, N.Y., (1989)).

[0040] The methods for evaluating the presence of the introduced transgene as well as its expression are readily available and well-known in the art. Such methods include, but are not limited to, DNA (Southern) hybridization to detect the exogenous DNA, polymerase chain reaction (PCR), polyacrylamide gel electrophoresis (PAGE) and blots to detect DNA, RNA or protein.

[0041] The term “rodent” as used herein refers to mammals of the order Rodentia, which are characterized by a single pair of continuously growing incisors in each of the upper and lower jaws. In a particular embodiment, the rodent is selected from the group consisting of: mice, rats, squirrels, prairie dogs, porcupines, beavers and hamsters.

[0042] In a more particular embodiment, the rodent is a mouse or a rat. In a still more particular embodiment, the rodent is a mouse.

[0043] As an expert may know, a number of different strategies for the modification of the genome, and in particular the mouse genome, are used so far. Most of the methods involve the introduction of transgenes into the genome as well as the use of homologous recombination (HR) techniques for targeted gene modifications or the use of nontargeted gene trapping.

[0044] Gene modification via HR is based on the targeted insertion of a selectable marker (often the neomycin phosphotransferase gene, neo) into an exon of the target gene, the replacement of one or more exons or, alternatively, the insertion of additional nucleic acid sequences into a target locus. The mutant allele is initially assembled in a specifically designed gene targeting vector such that the sequence to be inserted is flanked at both sides with genomic segments of the target gene that serve as homology regions to initiate homologous recombination. Upon the isolation of recombinant embryonic stem (ES) cell clones, modified ES cells are injected into blastocysts to transmit the mutant allele through the germ line of chimeras and to establish a mutant strain. (Hasty P, Abuin A, Bradley A., 2000, In Gene Targeting: a practical approach, ed. AL Joyner, pp. 1-35. Oxford: Oxford University Press; Nagy A, Gertsenstein M, Vintersten K, Behringer R., 2003. Manipulating the Mouse Embryo. Cold Spring Harbour, New York: Cold Spring Harbour Laboratory Press).

[0045] The transgenic rodent of the invention is characterized in that at least one copy of the endogenous Erbb2 gene is modified so that a region within the gene which encodes at least part of the rodent ERBB2 protein is replaced with a polynucleotide that encodes the human HER2 protein.

[0046] "Encoding" or “encodes” includes the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if, for example, transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.

[0047] The term “polynucleotide”, as used in the present invention, relates to a polymer formed by a variable number of monomers wherein the monomers are nucleotides, including ribonucleotides as well as deoxyribonucleotides. The polynucleotides include monomers modified by methylation as well as unmodified forms. The terms “polynucleotide” and “nucleic acid” are used indiscriminately in the present invention and include mRNA, cDNA and recombinant polynucleotides.

[0048] The term Erbb2 gene refers to the gene encoding the ERBB2 protein and is provided in the GenelD database under accession number 13866 (release of 2-Aug-2023). “ERBB2”, as used herein refers to the receptor tyrosine-protein kinase erbB-2 protein that is encoded by the Erbb2 gene. ERBB2 refers to the rodent protein. In a particular embodiment, the ERRB2 rodent protein comprises or consists of the mouse ERBB2 protein identified by the Uniprot accession number P70424 (Entry version 222, sequence version 3, 28 June 2023). In another particular embodiment, the ERRB2 rodent protein comprises or consists of the rat ERBB2 protein identified by the Uniprot accession number P06494 (Entry version 211 , sequence version 3, 3 May 2023).

[0049] In mice, Erbb2 gene locus has twenty-seven exons. The mouse ERBB2 protein has, from N-terminus to C-terminus, a signal peptide, an extracellular region, a transmembrane region, and a cytoplasmic region. The nucleotide sequence for mouse Erbb2 mRNA comprises or consists of the sequence identified by the NCBI Reference Sequence NM_001003817.1 and the amino acid sequence for mouse ERBB2 comprises or consists of the sequence identified by the NCBI Reference Sequence NP_001003817.1.

[0050] The mouse Erbb2 gene is located in Chromosome 11 of the mouse genome. The location within chromosome 11 of the region encoding the 5’ UTR and of the 27 exons is as defined in the NCBI database under accession number Gene ID: 13866 or NM_001003817.1 (version of 2 August 2023).

[0051] The transgenic rodent according to the invention is characterized in that at least one copy of the endogenous Erbb2 gene is modified so that a region within the gene which encodes at least part of the rodent ERBB2 protein is replaced with a polynucleotide that encodes the human HER2 protein, wherein said polynucleotide is operably linked to the promoter of the endogenous Erbb2 gene.

[0052] Accordingly, in some embodiments, only one copy of the endogenous Erbb2 gene is modified. In another embodiment, both copies of the endogenous Erbb2 gene are modified. In a particular embodiment, both copies of the endogenous Erbb2 gene are modified so that a region within the gene which encodes at least part of the rodent ERBB2 protein is replaced with a polynucleotide that encodes the human HER2 protein, wherein said polynucleotide is operably linked to the promoter of the endogenous Erbb2 gene. The modification of the endogenous Erbb2 gene is such that a region within the gene which encodes at least part of the rodent ERBB2 protein is replaced with a polynucleotide that encodes the human HER2 protein. Accordingly, in some embodiments, the endogenous Erbb2 gene is modified in a manner that the complete region encoding the rodent ERBB2 protein is replaced with a polynucleotide that encodes the human HER2 protein. In another embodiment, the endogenous Erbb2 gene is modified in a manner that only a part of the region encoding the rodent ERBB2 protein is replaced with a polynucleotide that encodes the human HER2 protein, provided that the polynucleotide that encodes the human HER2 protein is operably linked to the promoter of the endogenous Erbb2 gene. "HER2" as used herein refers to human HER2 protein described, for example, in Semba et al., PNAS (USA), 82:6497-6501 (1985) and Yamamoto et al., Nature, 319:230-234 (1986) (NCBI accession number M117730, Genbank accession number M11730.1 of the corresponding mRNA). HER2 is a member of the human epidermal growth factor receptor (HER / EGFR / ERBB) family. In human genomes, HER2 gene (Gene ID: 2064) locus has twenty-seven exons which are separated by twenty-six intronic regions. The HER2 protein also has, from N-terminus to C-terminus, a signal peptide, an extracellular region, a transmembrane region, and a cytoplasmic region. The nucleotide sequence for human HER2 mRNA comprises or consists of the sequence identified by the NCBI Reference Sequence M117730, and the amino acid sequence for human HER2 comprises or consists of the sequence identified by the NCBI Reference Sequence M 117730.

[0053] The human HER2 gene is defined on the NCBI database with Gene ID: 2064. It will be understood that the invention requires that a region within the endogenous Erbb2 gene is replaced with a polynucleotide that encodes the human HER2 protein. Accordingly, the polynucleotide which encodes the human HER2 protein can be a cDNA or a genomic DNA which contains all elements which encode the HER2 protein. In some embodiments, the polynucleotide which encodes the human HER2 protein does not contain any region of human origin involved in the regulation of the expression of the gene, including promoter or enhancer regions.

[0054] In some embodiments, the human HER2 protein is the native sequence of the human HER2 (Uniprot accession number P04626, entry version 269, sequence version 1 , 28 June 2023). In a particular embodiment, the HER2 human protein comprises or consists of the protein identified by the Uniprot accession number P04626 (Entry version 269, sequence version 1 , 28 June 2023). In another particular embodiment, the human HER2 protein in a functionally equivalent variant of the protein identified by the Uniprot accession number P04626 (Entry version 269, sequence version 1 , 28 June 2023).

[0055] The terms "native sequence" or "native" in this context refer to a polypeptide having the sequence of a naturally occurring polypeptide, regardless its mode of preparation. Such native sequence polypeptides can be isolated from nature or can be produced by recombinant or synthetic means, or by any combination of these or similar methods. Accordingly, "native" or "native sequence" HER2 polypeptides or proteins may be isolated from nature, produced by techniques of recombinant DNA technology, chemically synthesized, or produced by any combinations of these or similar methods. The terms "polypeptide" and "peptide" are used interchangeably herein to refer to polymers of amino acids of any length. The polymer can be linear or branched, it can comprise modified amino acids, and it can be interrupted by non-amino acids.

[0056] "Functionally equivalent variant" of the HER2 protein is understood as any sequence having additions, substitutions, deletions or combinations thereof in its amino acid sequence and / or which has been chemically modified with respect to said sequence and which substantially maintains the function of said protein. Preferably, the functional equivalent variants of the HER2 show the aforementioned activity at least by 60%, preferably by 70%, advantageously by 80%, more preferably by 90%, more preferably by 95%, even more preferably by 97% and even more preferably by 98%, advantageously by 99%.

[0057] The “functionally equivalent variant” of the HER2 proteins preferably have a sequence identity with this protein of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%. The degree of identity between the variants and the natural proteins is determined by using computer algorithms and methods that are widely known for the persons skilled in the art. For example, the identity between two amino acid sequences is determined by using the BLASTP algorithm (BLASTManual, Altschul, S., et al, NCBI NLM NIH Bethesda, Md. 20894, Altschul, S., et al., J. Mol. Biol. 21 5: 403-410 (1990), though other similar algorithms can also be used.

[0058] In a particular embodiment, the functionally equivalent variant of the HER2 protein preferably have a sequence identity of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% with the protein identified by the Uniprot accession number P04626 (Entry version 269, sequence version 1 , 28 June 2023).

[0059] In a particular embodiment, the functionally equivalent variant of the HER2 protein has a sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% with the sequence of HER2 protein (the protein identified by the Uniprot accession number P04626) and maintains at least 60%, preferably by 70%, advantageously by 80%, more preferably by 90%, more preferably by 95%, even more preferably by 97% and even more preferably by 98%, advantageously by 99% of the function of HER2. In the present invention, the polynucleotide encoding the HER2 protein is operably linked to the promoter of the endogenous Erbb2 gene.

[0060] "Operably linked" means that a gene and a regulatory sequence(s) are connected in such a way as to permit gene expression when the appropriate molecules are bound to the regulatory sequence(s). In the present invention, this means that the promoter of the endogenous Erbb2 gene at the adequate distance and orientation with respect to the polynucleotide sequence encoding the human HER2 protein (or an equivalent functional variant thereof) so that both are arranged so that the expression of the nucleotide sequence encoding the HER2 protein occurs under the control of the promoter of the endogenous Erbb2 gene. Thus, the HER2 protein is under the control of the promoter of the endogenous (rodent) Erbb2 gene.

[0061] "Promoter" means a minimal sequence sufficient to direct transcription. Also included in the invention are those promoter elements which are sufficient to render promoterdependent gene expression controllable for cell-type specific or tissue-specific regulators; or inducible by external signals or agents; such elements may be located in the 5' or 3' regions of the native gene. A promoter element may be positioned for expression if it is positioned adjacent to a DNA sequence so it can direct transcription of the sequence. In the present invention, the promoter is the promoter of the endogenous Erbb2 gene.

[0062] In the transgenic rodent of the invention, a region of at least one copy of the endogenous Erbb2 gene is modified so that a region within the gene which encodes at least part of the rodent ERBB2 protein is replaced with a polynucleotide that encodes the human HER2 protein.

[0063] In this particular embodiment, the transgenic rodent expresses a decreased level of the protein encoded by endogenous Erbb2 gene, i.e. the transgenic rodent expresses the rodent ERBB2 protein.

[0064] Thus, in some embodiments, the transgenic rodent is heterozygous with respect to the replacement at the endogenous Erbb2 gene locus. In other embodiments, the rodent is homozygous with respect to the replacement at the endogenous HER2 gene locus, which means that both Erbb2 gene loci are modified so that a region within the both loci which encodes at least part of the rodent ERBB2 protein is replaced with a polynucleotide that encodes the human HER2 protein, wherein said polynucleotide is operably linked to the promoter of the endogenous Erbb2 gene. The term “homozygous” describes a genotype consisting of two identical alleles at a given locus. If the transgenic rodent is homozygous with respect to the replacement at the endogenous Erbb2 gene locus, the transgenic rodent does not express the protein encoded by the endogenous Erbb2 gene.

[0065] The term “heterozygous” describes a genotype consisting of two different alleles at a locus. If the transgenic rodent is heterozygous with respect to the replacement at the endogenous HER2 gene locus, the transgenic rodent express the protein encoded by the endogenous Erbb2 gene, i.e. the rodent ERBB2 protein.

[0066] In some embodiments, at least one copy of the entire sequence of exon 1 , exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11 , exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21 , exon 22, exon 23, exon 24, exon 25, exon 26, exon 27 or the region encoding the signal peptide, the region encoding the extracellular region, the region encoding the transmembrane region and / or the region encoding the cytoplasmic region of the endogenous Erbb2 mouse gene is / are replaced by the corresponding human sequence.

[0067] In other embodiments, both copies of the entire sequence of exon 1 , exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11 , exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21 , exon 22, exon 23, exon 24, exon 25, exon 26, exon 27 or the region encoding the signal peptide, the region encoding the extracellular region, the region encoding the transmembrane region and / or the region encoding the cytoplasmic region of the endogenous Erbb2 mouse gene are replaced by the corresponding human sequence, entire sequence of mouse exon 1 , exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11 , exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21 , exon 22, exon 23, exon 24, exon 25, exon 26, exon 27, signal peptide, extracellular region, transmembrane region, and / or cytoplasmic region is / are replaced by the corresponding human sequences.

[0068] In some embodiments, only a “region” or a “portion” of mouse exon 1 , exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11 , exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21 , exon 22, exon 23, exon 24, exon 25, exon 26, exon 27 or of the region encoding the signal peptide, the region encoding the extracellular region, the region encoding the transmembrane region and / or the region encoding the cytoplasmic region of the endogenous Erbb2 mouse gene is / are replaced by the corresponding human sequence. Said region or portion can comprise or consists of at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of exon 1 , exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11 , exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21 , exon 22, exon 23, exon 24, exon 25, exon 26, exon 27 or the region encoding the signal peptide, the region encoding the extracellular region, the region encoding the transmembrane region and / or the region encoding the cytoplasmic region of the endogenous.

[0069] In some embodiments, only a “region” or a “portion” of mouse exon 1 , exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11 , exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21 , exon 22, exon 23, exon 24, exon 25, exon 26, exon 27 or of the region encoding the signal peptide, the region encoding the extracellular region, the region encoding the transmembrane region and / or the region encoding the cytoplasmic region of the endogenous Erbb2 mouse gene is / are replaced by the corresponding human sequence in both mouse Erbb2 gene loci. Said region or portion can comprise or consists of at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of exon 1 , exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11 , exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21 , exon 22, exon 23, exon 24, exon 25, exon

[0070] 26, exon 27 or the region encoding the signal peptide, the region encoding the extracellular region, the region encoding the transmembrane region and / or the region encoding the cytoplasmic region of the endogenous.

[0071] In some embodiments, the sequence encoding the corresponding region of human HER2 comprises exon 1 , exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11 , exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21 , exon 22, exon 23, exon 24, exon 25, exon 26, and / or exon

[0072] 27, or a part thereof, of a human HER2 gene.

[0073] In a particular embodiment, the sequence encoding the corresponding region of human HER2 comprises all the intronic regions of the human HER2 gene, i.e., intron 1 , intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11 , intron 12, intron 13, intron 14, intron 15, intron 16, intron 17, intron 18, intron 19, intron 20, intron 21 , intron 22, intron 23, intron 24, intron 25, intron 26, and intron 27.

[0074] In another embodiment, the sequence within the transgenic rodent of the invention that encodes the human HER2 protein comprises, consists or essentially consists, from the 5’ to 3’ direction, in the human exon 1 , an intronic region and the human exons 2 to 27, being introns 2 to 26 absent from the polynucleotide. Suitable intronic regions that can be used in the present invention include, without limitation, the human HER2 gene intron I , intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron

[0075] I I , intron 12, intron 13, intron 14, intron 15, intron 16, intron 17, intron 18, intron 19, intron 20, intron 21 , intron 22, intron 23, intron 24, intron 25, intron 26, and intron 27.

[0076] In another embodiment, the sequence within the transgenic rodent of the invention that encodes the human HER2 protein comprises, consists or essentially consists, from the 5’ to 3’ direction, in the human exon 1 , the human intron 1 and the humans exons 2 to 27, being introns 2 to 26 absent from the polynucleotide.

[0077] In a preferred embodiment, the polynucleotide that encodes the human HER2 protein replaces the complete ERBB2 protein coding region of the endogenous Erbb2 gene. The coding region of a gene, also known as the coding sequence (CDS), is the portion of a gene's DNA or RNA that codes for protein. Although this term is also sometimes used interchangeably with exon, it is not the exact same thing: the exon is composed of the coding region as well as the 3' and 5' untranslated regions of the RNA, and so therefore, an exon would be partially made up of coding regions. The 3' and 5' untranslated regions of the RNA, which do not code for protein, are termed non-coding regions.

[0078] In a particular embodiment, the transgenic rodent has one or more cells expressing human HER2.

[0079] Cells expressing human HER2 can be located in different mouse tissues, such as in mammary tissue or breast tissue, in the stomach, in the kidney, in gastric tissue, in ovarian tissue, in endometrial tissue, in pancreatic tissue, in the lung, in the brain or in uterine tissue.

[0080] Method for determining the safety profile of an anti-HER2 therapeutic agent

[0081] Genetically modified animals that express human or humanized HER2 protein, e.g., in a physiologically appropriate manner, provide a variety of uses that include, but are not limited to, developing therapeutics for human diseases and disorders, and assessing the toxicity and / or the efficacy of these human therapeutics in the animal models.

[0082] Thus, in another aspect, the present invention relates to a method, hereinafter the first method of the invention, for determining the safety profile of an anti-HER2 therapeutic agent which targets the human HER protein, wherein the method comprises:

[0083] (i) contacting the transgenic rodent of the invention with said therapeutic agent and (ii) determining in the transgenic rodent one or more parameters indicative of the presence of adverse effects as a result of the treatment with the anti-HER2 therapeutic agent.

[0084] The term “safety profile” refers to the frequency of side effects. The safety profile is usually determined using pharmacokinetics by studying the movement of the therapeutic agent in the body including in the processes of absorption, distribution, metabolism, and excretion of therapeutic agents. Therapeutic agents with a strong safety profile have fewer side effects. Therapeutic agents with a weak safety profile have adverse side effects. Therapeutic agents can produce physiological effects by initiating, inhibiting, modulating, or enhancing the basal biological activity in cells. Laboratory techniques routinely used in the evaluation of the safety profiles of therapeutic agents include enzyme assays, cell culture, translocation, immunoblotting, and phosphoprotein immunoassay on cell lines, among others.

[0085] In a first step, the first method of the invention comprises the administration of an antiFI ER2 therapeutic agent to the transgenic rodent of the invention. The anti-HER2 therapeutic agent can be administered in any manner desired and / or appropriate for delivery of the agent in order to examine its safety profile.

[0086] For example, the anti-HER2 therapeutic agent can be administered topically, by injection (e.g., by injection intravenously, intramuscularly, subcutaneously, and the like), orally, or by any other desirable means. Moreover, the first method of the invention can involve administering varying amounts of the therapeutic agent (from no agent to an amount of agent that approaches an upper limit of the amount that can be delivered successfully to the animal), and may include delivery of the agent in different formulations and routes. The therapeutic agents can be administered singly or can be combined in combinations of two or more.

[0087] The term “anti-HER2 therapeutic agent” as used herein refers to substances or treatments that are used to treat all stages of HER2-positive cancer and which act by neutralizing the HER2 activity.

[0088] In a particular embodiment, the transgenic rodent has a murine tumor expressing a human HER2 protein or expressing a truncated HER2 fragment. In another particular embodiment, the transgenic rodent has a HER2-positive human tumor.

[0089] The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia or lymphoid malignancies. More particular examples of such cancers include squamous cell cancer (e.g. epithelial squamous cell cancer), lung cancer including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung and squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, vulvar cancer, thyroid cancer, hepatic carcinoma, anal carcinoma, penile carcinoma, as well as head and neck cancer.

[0090] In a particular embodiment, the transgenic rodent comprises a HER2-positive human tumor xenograft of breast cancer, gastric cancer, endometrial cancer or pancreatic cancer origin. In a more particular embodiment, the transgenic rodent comprises a HER2-positive human tumor xenograft of breast cancer.

[0091] “Xenotransplantation”, or heterologous transplant, is the transplantation of living cells, tissues or organs from one species to another. Such cells, tissues or organs are called “xenografts” or “xenotransplants”.

[0092] “Gastric cancer” or “stomach cancer” is a cancer that develops from the lining of the stomach. Most cases of stomach cancers are gastric carcinomas, which can be divided into a number of subtypes, including gastric adenocarcinomas. Lymphomas and mesenchymal tumors may also develop in the stomach. The cancer may spread from the stomach to other parts of the body, particularly the liver, lungs, bones, lining of the abdomen, and lymph nodes. In some stomach cancers, the cancer cells have too much of a growth-promoting protein called HER2 on their surface. Cancers with increased levels of HER2 are called HER2-positive.

[0093] “Endometrial cancer” is a cancer that arises from the endometrium (the lining of the uterus or womb). Endometrial cancer is sometimes loosely referred to as "uterine cancer", although it is distinct from other forms of uterine cancer such as cervical cancer, uterine sarcoma, and trophoblastic disease. The most frequent type of endometrial cancer is endometrioid carcinoma, which accounts for more than 80% of cases. HER2 protein overexpression and / or gene amplification is present in approximately 25% to 30% of endometrial serous carcinomas.

[0094] “Pancreatic cancer” arises when cells in the pancreas, a glandular organ behind the stomach, begin to multiply out of control and form a mass. A number of types of pancreatic cancer are known. The most common, pancreatic adenocarcinoma, accounts for about 90% of cases, and the term "pancreatic cancer" is sometimes used to refer only to that type. HER2 protein expression was detected in 40% of pancreatic ductal adenocarcinoma (PDAs).

[0095] “Breast cancer” is cancer that develops from breast tissue. Breast cancer cells with higher than normal levels of HER2 are called HER2-positive, and tend to grow and spread faster than breast cancers that are HER2-negative. About 15% to 20% of breast tumors have higher levels of HER2. Breast cancers that overexpress HER2 are aggressive and associated with poor prognosis.

[0096] As an expert may know, different assays can be done to determine if a breast cancer is HER2 positive, such as immunohistochemistry (ICH) or in situ hybridization.

[0097] If the IHC result is 0, the cancer is considered HER2-negative. These cancers do not respond to treatment with drugs that target HER2.

[0098] If the IHC result is 1+, the cancer is considered HER2-negative. These cancers do not usually respond to treatment with drugs that target HER2, but some researchers show that certain HER2 drugs might help in some cases.

[0099] If the IHC result is 2+, the HER2 status of the tumor is not clear and is called "equivocal." This means that the HER2 status needs to be tested with ISH to clarify the result.

[0100] If the IHC result is 3+, the cancer is HER2-positive. These cancers are usually treated with drugs that target HER2.

[0101] Breast cancers with HER2 immunohistochemistry (IHC) score of 1+, or HER2 IHC score of 2+ with a negative in situ hybridization (ISH) result, are known as “HER2-low breast cancer”.

[0102] In a particular embodiment, the anti-HER2 therapeutic agent is selected from the group consisting of an anti-HER2 antibody, an anti-HER2 antibody drug conjugate, a T-cell bispecific antibody targeting HER2 or a variant thereof and CD3, a CAR-T cell specific for HER2 or a variant thereof and a tyrosine kinase inhibitor.

[0103] As used herein, the term “antibody” refers to a protein including at least one immunoglobulin variable region, for example, an amino acid sequence providing an immunoglobulin variable domain or a sequence of the immunoglobulin variable domain. An antibody can include, for example, a variable heavy chain (H) region (herein abbreviated as VH) and a variable light chain (L) region (herein abbreviated as VL). Typically, an antibody includes two variable heavy chain regions and two variable light chain regions. The term “antibody” encompasses antigen-binding antibody fragments (for example, single-chain antibodies, Fab fragments, F(ab’)2 fragments, Fd fragments, Fv fragments and dAb fragments) as well as whole antibodies, for example, intact and / or full length immunoglobulins of the IgA, IgG types (for example, lgG1 , lgG2, lgG3, lgG4), IgE, I g D, IgM (as well as subtypes thereof).

[0104] In a particular embodiment, the anti-HER2 therapeutic agent is an anti-HER2 antibody. In a more particular embodiment, the anti-HER2 antibody is selected from the group consisting of: trastuzumab, pertuzumab and margetuximab.

[0105] In another particular embodiment, the anti-HER2 agent is a trastuzumab biosimilar. Trastuzumab biosimilars are biologic agents created from living cells and have similar pharmacokinetic and pharmacodynamic properties to the original product. They may have minor differences in clinically inactive components from the original biologic medication, but there are no clinically meaningful differences between the two with respect to safety, purity and potency. In a more particular embodiment, the trastuzumab biosimilar is selected from the group consisting of: trastuzumab-dkst (MYL1401O), trastuzumab-pkrb (CT-P6), trastuzumab-dttb (SB3), trastuzumab-qyyp and trastuzumab- anns (ABP980).

[0106] In a particular embodiment, the anti-HER2 therapeutic agent is an anti-HER2 antibody drug conjugate. The HER2 antibody drug comprises an anti-HER2 antibody and a drug. Some examples of HER antibody drugs include, ado-trastuzumab emtansine (T-DM1), which is composed of trastuzumab connected via a stable linker to DM1 , a maytansine derivative with a drug-to antibody ratio (DAR) of ~3.5. T-DXd is a HER2 ADC comprising a humanized HER2 antibody with the same sequence as trastuzumab conjugated to deruxtecan (DXd); T-DXd has a DAR of 8 and exhibits the enhanced features of DXd. SYD985 (Byondis), which is comprised of the monoclonal antibody trastuzumab and a cleavable linker-drug called valine-citrulline-seco-DUocarmycin-hydroxyBenzamide- Azaindole (vc-seco-DUBA). The antibody part of [vic-]trastuzumab duocarmazine binds to HER2 on the surface of the cancer cell and the ADC is then internalized.

[0107] Antibody-drug conjugates or ADCs were designed to channel the cytotoxic effects of chemotherapy to specific tumour cells. ADCs contain a tumour-targeting antibody covalently bound to a cytotoxic drug (payload) via a synthetic linker. The ADC is directed to cancer cells expressing the target (for example, HER2) on the cell surface, followed by internalization of the ADC and release of the cytotoxic payload, resulting in tumour cell death. Cleavable linkers in ADCs enable release of the cytotoxic payload from the target cell to the extracellular space, leading to destruction of surrounding cancer cells that may not have high target protein expression. This bystander effect further enhances the efficacy of ADCs against tumour cells. In a particular embodiment, the anti-HER2 antibody drug conjugate is directed against a truncated HER2 fragment, particularly against p95HER2.

[0108] “p95HER2” is an NH (2)-terminally truncated form of HER2 that lacks the trastuzumab binding.

[0109] In a particular embodiment, the anti-HER2 therapeutic agent is a T-cell bispecific antibody targeting HER2 or a variant thereof and CD3.

[0110] A bispecific antibody is an artificial antibody that can simultaneously bind to two different types of antigen or two different epitopes on the same antigen. Naturally occurring antibodies typically only target one antigen. Bispecific antibodies can be manufactured in several structural formats. Bispecific antibodies can be designed to recruit and activate immune cells, to interfere with receptor signalling and inactivate signalling ligands, and to force association of protein complexes.

[0111] According to the invention, the T-cell bispecific antibody can simultaneously bind to the HER2 protein and to a specific T-cell antigen, particularly CD3.

[0112] According to the invention, the T-cell bispecific antibody can target a variant of HER2. In a particular embodiment, the variant is a truncated form of HER2, particularly p95HER2.

[0113] Thus, the T-cell bispecific antibody can simultaneously bind to the p95HER2 and to a specific T-cell antigen, particularly CD3.

[0114] Examples of bispecific antibodies include but are not limited to: zanidatamab (ZW25), a humanized, bispecific, I gG 1 antibody directed against the ECD IV and the dimerization domain (ECD II) of HER2, the same domains as are targeted by trastuzumab and pertuzumab, respectively; zenocutuzumab (MCLA-128), a humanized lgG1 antibody that is under investigation is zenocutuzumab (MCLA-128), which acts via two independent mechanisms of action: inhibition of HER2-HER3 signalling and elimination of tumour cells via ADCC; and KN026, which is a bispecific antibody that targets two distinct epitopes on HER2 (domains II and IV) leading to dual HER2 signal blockade, presumably by causing HER2 to aggregate on the cell surface and endocytose.

[0115] In a particular embodiment, the anti-HER2 therapeutic agent is a CART cell directed against HER2 or a variant thereof.

[0116] Chimeric antigen receptors (CARs), also known as chimeric immunoreceptors, chimeric T cell receptors or artificial T cell receptors, are receptor proteins that have been engineered to give T cells the new ability to target a specific antigen. CAR T cell therapy uses T cells engineered with CARs to treat cancer. CAR T cells can be derived either from T cells in a patient's own blood (autologously) or from the T cells of another, healthy, donor (allogeneically). Once isolated from a person, these T cells are genetically engineered to express a specific CAR, which programs them to target an antigen that is present on the surface of tumors.

[0117] In another particular embodiment, the anti-HER2 therapeutic agent is a CART cell directed against an HER2 variant, particularly p95HER2.

[0118] In another particular embodiment, the anti-HER2 therapeutic agent is a tyrosine kinase inhibitor. In a more particular embodiment, the tyrosine kinase inhibitor is selected from the group consisting of: lapatinib, neratinib, pyrotinib and tucatinib.

[0119] Tyrosine kinase inhibitor refers to small molecules that target the intracellular catalytic kinase domain of HER2, competing with ATP, blocking phosphorylation and activating downstream signalling cascades.

[0120] In another particular embodiment, the first method of the invention further comprises contacting the transgenic rodent of the invention with at least another suitable compound for the treatment of cancer, preferably for the treatment of an HER2 positive cancer.

[0121] “An HER2 positive cancer” refers to a cancer that has an extra HER2 proteins on the surface of the cancer cells.

[0122] Thus, in some embodiments, in a first step, the first method of the invention comprises the administration of an anti-HER2 therapeutic agent and at least another suitable compound for the treatment of cancer, preferably for the treatment of an HER2 positive cancer, to the transgenic rodent of the invention. The at least another suitable compound can be administered in any manner desired and / or appropriate for delivery of the agent in order to examine its safety profile.

[0123] For example, the at least another suitable compound for the treatment of cancer, preferably an HER2 positive cancer, can be administered topically, by injection (e.g., by injection intravenously, intramuscularly, subcutaneously, and the like), orally, or by any other desirable means.

[0124] In a particular embodiment, the at least another suitable compound is administered simultaneously, sequentially or separately from the anti-HER2 therapeutic agent.

[0125] “Simultaneous administration” encompasses coadministration of the two therapeutic agents, regardless of the relative frequencies or timing of the administration of the respective agents. Thus, simultaneous administration encompasses the coadministration of the two therapeutic agents at the same time and at the same frequencies of administration. In addition, simultaneous administration refers to the coadministration of the two therapeutic agents, in which one agent is administered more frequently than the other(s). In addition, simultaneous administration refers to the coadministration of the two therapeutic agents, in which an agent is administered only once during the administration of the other agent(s).

[0126] “Sequentially” administration occurs when the administration of the first component is discontinued before starting with the administration of the second component.

[0127] If administered separately, the therapeutic agents can be administered within a period of time from one another, for example, within 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, or 24 hours from one another. In some embodiments, can be administered within 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, or 24 days from one another.

[0128] In a particular embodiment, the at least another suitable compound for the treatment of cancer, preferably an HER2 positive cancer, is selected from the group consisting of: an anti-PD1 antibody, an anti-PD-L1 antibody, a chemotherapy agent and a CDK inhibitor.

[0129] In a particular embodiment, the at least another suitable compound is an anti-PD1 antibody. In a more particular embodiment, the anti-PD1 antibody is selected from the group consisting of: nivolumab, pidilizumab, pembrolizumab and toripalimab.

[0130] Programmed cell death protein 1 , also known as PD-1 and CD279 (cluster of differentiation 279), is a protein on the surface of T and B cells that has a role in regulating the immune system's response to the cells of the human body by down-regulating the immune system and promoting self-tolerance by suppressing T cell inflammatory activity. This prevents autoimmune diseases, but it can also prevent the immune system from killing cancer cells.

[0131] In another particular embodiment, the at least another suitable compound is an anti-PD- L1 antibody. In a more particular embodiment, the anti-PD-L1 antibody is selected from the group consisting of atezolizumab and avelumab.

[0132] PD-L1 , also known as programmed cell death 1 ligand 1 is an immune inhibitory receptor ligand that is expressed by hematopoietic and non-hematopoietic cells, such as T cells and B cells and various types of tumor cells. This protein is a type I transmembrane protein that has immunoglobulin V-like and C-like domains. Interaction of this ligand with its receptor inhibits T-cell activation and cytokine production. During infection or inflammation of normal tissue, this interaction is important for preventing autoimmunity by maintaining homeostasis of the immune response. In tumor microenvironments, this interaction provides an immune escape for tumor cells through cytotoxic T-cell inactivation.

[0133] In another particular embodiment, the at least another suitable compound is a chemotherapy agent.

[0134] Chemotherapy agents, also known as cytotoxic agents or cytostatic drugs, are known to be of use in chemotherapy for cancer. Chemotherapy is a type of cancer treatment that uses one or more anti-cancer drugs (chemotherapeutic agents or alkylating agents) as part of a standardized chemotherapy regimen. A "chemotherapeutic agent" is a chemical compound useful in the treatment of cancer. Examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclosphosphamide (CYTOXAN(TM)); alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethylenethiophosphaoramide and trinmethylolomelamine; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, ranimustine; antibiotics such as aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, calicheamicin, carabicin, carminomycin, carzinophilin, chromomycins, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin, epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5-fluorouracil (5-Fll); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine, 5-Fll; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elfomithine; elliptinium acetate; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidamine; mitoguazone; mitoxantrone; mopidamol; nitracrine; pentostatin; phenamet; pirarubicin; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK7; razoxane; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2, 2',2'=-trichlorotriethylamine; urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; thiotepa; taxanes, e.g. paclitaxel (TAXOL<7>, Bristol-Myers Squibb Oncology, Princeton, NJ) and doxetaxel (TAXOTERE7, Rhone- Poulenc Rorer, Antony, France); chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitomycin C; mitoxantrone; vincristine; vinorelbine; navelbine; novantrone; teniposide; daunomycin; aminopterin; xeloda; ibandronate; CPT-11 ; topoisomerase inhibitor RFS 2000; difluoromethylomithine (DMFO); retinoic acid; esperamicins; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above. Also included in this definition are anti- hormonal agents that act to regulate or inhibit hormone action on tumors such as antiestrogens including for example tamoxifen, raloxifene, aromatase inhibiting 4(5)- imidazoles, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone, and toremifene (Fareston); and anti-androgens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; and pharmaceutically acceptable salts, acids or derivatives of any of the above.

[0135] In another particular embodiment, the at least another suitable compound is a CDK inhibitor.

[0136] A CDK (cyclin-dependent kinase) inhibitor is any chemical that inhibits the function of CDKs. They are used to treat cancers by preventing over proliferation of cancer cells.

[0137] In a more particular embodiment, the CDK inhibitor is a CDK4 / 6 inhibitor. Cyclin- dependent kinase 4 (CDK4) and CDK6 are critical mediators of cellular transition into S phase and are important for the initiation, growth and survival of many cancer types. In a still more particular embodiment, the CDK4 / 6 inhibitor is selected from the group consisting of: palbociclib, ribociclib and abemaciclib.

[0138] In another particular embodiment, HER-2 inhibitors can be classified as inhibitors of HER-2 mRNA. Inhibitors of HER-2 mRNA include a HER-2 antisense nucleic acid, a ribozyme against HER-2 nucleic acid, a triple helix against HER-2 nucleic acid, a siRNA against HER-2, or any compound that specifically inhibits the HER-2 nucleic acid.

[0139] In a second step, the first method of the invention comprises determining in the transgenic rodent of the invention the appearance of one or more parameters indicative of the presence of adverse effects as a result of the treatment with the anti-HER2 therapeutic agent. In some embodiments, when the transgenic rodent of the invention is contacted with at least another suitable compound for the treatment of cancer, preferably an HER2 positive cancer, the first method of the invention comprises determining in the transgenic rodent of the invention the appearance of one or more parameters indicative of the presence of adverse effects as a result of the treatment with the anti-HER2 therapeutic agent and the at least another suitable compound for the treatment of cancer.

[0140] The safety of a therapeutic agent refers to the potential for adverse effects related to the administration of this agent. In particular, anti-HER2 therapeutic agent safety refers to the potential for adverse effects related to the administration of this agent. The term “adverse effects” or “side effects” refer to any unwanted effects of the therapeutic agent.

[0141] As an expert may know, different parameters can be used to determine the presence of adverse effects. In a particular embodiment, the parameters indicative of the presence of adverse effects of the anti-HER2 therapeutic agent, alone or in combination with at least another suitable compound for the treatment of cancer, preferably an HER2 positive cancer, to the rodent are selected from the group consisting of body weight (loss of 5- 20% of body weight), physical appearance (rash, dry eye, conjunctivitis, hyperkeratosis, dermatitis, alopecia), animal behaviour (stereotypic behaviours such as limping, hunched posture, dull movements, lack of movement lack of response to external stimuli), red blood cell count (less than 7.3 x106 / pL in males, less than 7.2x106 / pL in females), haematocrit (less than 39% in males, less than 38% in females), and / or haemoglobin (less than 11.9 g / dL in males, less than 11 .2 g / dL in females), of the animal and histological analyses of selected organs.

[0142] As mentioned above, the transgenic rodent has a HER2-positive human tumor xenograft of breast cancer, gastric cancer, endometrial cancer or pancreatic cancer origin.

[0143] In another particular embodiment, additionally one or more parameters indicative of the response of the tumor are determined.

[0144] In a more particular embodiment, the parameter indicative of the response of the tumor is selected from the group consisting of tumor mass (grams), tumor volume (measured by callipers in mm3until 1500 mm3), survival time (in weeks / months) and tumor infiltration of immune cells (determined by flow cytometry or immunohistochemistry).

[0145] Polynucleotides for the generation of the human HER2 gene knock-in rodent models

[0146] In another aspect, the present invention relates to a polynucleotide, hereinafter the polynucleotide of the invention, which comprises in the 5’ to 3’ direction: (i) a first region which comprises a region of the genome of a non-human animal which is located 5’ with respect of the 5’-UTR of the HER2 gene in said non- human animal,

[0147] (ii) a second region which encodes the human HER2 protein and

[0148] (iii) a third region which comprises a region of the genome of said non-human animal which is located 3’ end with respect to the 3’-UTR of the HER2 gene in said non- human animal.

[0149] The term polynucleotide has been defined or explained in the first method of the invention and this definition is applicable to the polynucleotide of the invention.

[0150] The first region of the polynucleotide of the invention comprises a region of the genome of a non-human animal which is located 5’ with respect of the 5’-UTR of the HER2 gene in said non-human animal.

[0151] The 5' untranslated region (also known as 5' UTR, leader sequence, transcript leader, or leader RNA) is the region of a messenger RNA (mRNA) that is directly upstream from the initiation codon. While called untranslated, the 5' UTR or a portion of it is sometimes translated into a protein product. This product can then regulate the translation of the main coding sequence of the mRNA. In many organisms, however, the 5' UTR is completely untranslated, instead forming a complex secondary structure to regulate translation. In mice, the 5’ UTR of Erbb2 gene is from 98303310 to 98303488 based on transcript NM_001003817.1. In human, the 5’ UTR of HER2 gene is from 39700064 to 39700236 based on transcript NM_004448.4.

[0152] The third region of the polynucleotide of the invention comprises a region of the genome of said non-human animal which is located 3’ end with respect to the 3’-UTR of the HER2 gene in said non-human animal.

[0153] The three prime untranslated region (3 -UTR) is the section of messenger RNA (mRNA) that immediately follows the translation termination codon. The 3 -UTR often contains regulatory regions that post-transcriptionally influence gene expression. Regulatory regions within the 3'-untranslated region can influence polyadenylation, translation efficiency, localization, and stability of the mRNA. In mice, the 3'-UTR of the Erbb2 gene is from 98327496 to 98328542, based on transcript NM_001003817.1. In human, the 3'-UTR of HER2 gene is from 39728045 to 39728658, based on transcript NM_004448.4.

[0154] The term “non-human animal” is used herein to include all vertebrate animals, except humans. In one embodiment, the non-human animal is a mammal. Such non-human animals include, for example, pigs, rats, rabbits, cattle, goats, and other animal species, particularly mammalian species. Additionally, other members of the rodent family, e.g., rats, and guinea pigs, and nonhuman primates, such as chimpanzees, may be used to practice the embodiments described herein. In a particular embodiment, the non-human animal is a rodent or a monkey.

[0155] Thus, in a particular embodiment, the first and third regions are from a mammal, preferably a monkey or a rodent, more preferably from a mouse.

[0156] The second region of the polynucleotide encodes the human HER2 protein.

[0157] In a particular embodiment, the second region is a polynucleotide comprising all the exonic regions of the human HER2 gene (exons 1 to 27) and wherein at least two contiguous exonic regions are separated by an intermediate region, wherein said intermediate region comprises an intron.

[0158] In other embodiments, the second region is a polynucleotide comprising all the exonic regions of the human HER2 gene (exons 1 to 27) but lacking intronic regions within any of the two neighbouring exonic regions.

[0159] The terms “HER2 gene” and “HER2 protein” have been defined or explained in the transgenic rodent of the invention and these definitions are applicable to the polynucleotide of the invention.

[0160] In a more particular embodiment, the second region of the polynucleotide of the invention comprises, in this order, exon 1 of the human HER2 gene, the intermediate region and exons 2 to 27 of the human HER2 gene.

[0161] In the human HER2 gene (Gene ID: 2064), exon 1 is from 39700064 to 39700311 based on transcript NM_004448.4. Exon 2 is from 39706990 to 39707141 , exon 3 is from 39708321 to 39708534, exon 4 is from 39709318 to 39709452, exon 5 is from 39709813 to 39709881 , exon 6 is from 39710086 to 39710201 , exon 7 is from 39710340 to

[0162] 39710481 , exon 8 is from 39711928 to 39712047, exon 9 is from 39712322 to 39712448, exon 10 is from 39715286 to 39715359, exon 11 is from 39715446 to 39715536, exon 12 is from 39715740 to 39715939, exon 13 is from 39716301 to 39716433, exon 14 is from 39716515 to 39716605, exon 15 is from 39717320 to 39717480, exon 16 is from 39719787 to 39719834, exon 17 is from 39723319 to 39723457, exon 18 is from

[0163] 39723538 to 39723660, exon 19 is from 39723912 to 39724010, exon 20 is from

[0164] 39724726 to 39724911 , exon 21 is from 39725049 to 39725204, exon 22 is from

[0165] 39725327 to 39725402, exon 23 is from 39725707 to 39725853, exon 24 is from

[0166] 39726562 to 39726659, exon 25 is from 39726815 to 39727003, exon 26 is from 39727295 to 39727547 and exon 27 is from 39727689 to 39728658 based on transcript NM_004448.4.

[0167] In some embodiments, the intermediate region which is flanked by two HER2 gene exons, preferably exons 1 and 2, comprises an intron. An “intron” is any nucleotide sequence within a gene that is not expressed or operative in the final RNA product. The term intron refers to both the DNA sequence within a gene and the corresponding RNA sequence in RNA transcripts. It will be understood that the term intron, as used herein, refers to a sequence that contains an intron donor splice site and a compatible intron acceptor site and that these two regions may be located next to each other or may contain between then one or more sequences that have to be excised during splicing and removal of the region which is flanked by the intronic donor and acceptor sites.

[0168] In particular embodiments, the intron is a rabbit globin intron sequence, a chicken P-actin intron sequence, a synthetic intron sequence, or an EF1-a intron sequence.

[0169] In a particular embodiment, the intron is an artificial intron. In a more particular embodiment, the artificial intron is the beta-actin intron.

[0170] In certain embodiments, the polynucleotide of the invention comprises a polyA sequence. In particular embodiments, the polyA sequence is a rabbit globin polyA sequence, a human growth hormone polyA sequence, a bovine growth hormone polyA sequence, a PGK polyA sequence, an SV40 polyA sequence, or a TK polyA sequence. In some embodiments, the poly-A signal may be a bovine growth hormone polyadenylation signal (bGHpA).

[0171] In another particular embodiment, the intermediate region further comprises a selection marker.

[0172] Reporter or selection marker genes encode proteins necessary for the survival and / or growth of transfected cells under selective culture conditions and comprise the region encoding the protein which is necessary for survival and growth as well as those regions needed for the proper expression of the selection marker in the cells of interest. Typical selection marker genes encode proteins that, for example: (i) confer resistance to antibiotics or other toxins, e.g., ampicillin, tetracycline or kanomycin for prokaryotic host cells, and neomycin, hygromycin or methotrexate for mammalian cells; or (ii) complement auxotrophic deficiencies of the cell. Useful reporter genes in the context of the present invention include lacZ, luciferase, thymidine kinase, GFP and on the like. Useful marker genes in the context of this invention include, for example, the neomycin resistance gene, conferring resistance to the aminoglycoside G418; the hygromycin phosphotransferase gene, conferring resistance to hygromycin; the ODC gene, conferring resistance to the inhibitor of the ornithine decarboxylase (2-(difluoromethyl)- DL-ornithine (DFMO); the dihydrofolatereductase gene, conferring resistance to methotrexate; the puromycin-N-acetyl transferase gene, conferring resistance to puromycin; the ble gene, conferring resistance to zeocin; the adenosine deaminase gene, conferring resistance to 9-beta-D-xylofuranose adenine; the cytosine deaminase gene, allowing the cells to grow in the presence of N-(phosphonacetyl)-L-aspartate; thymidine kinase, allowing the cells to grow in the presence of aminopterin; the xanthine- guanine phosphoribosyltransferase gene, allowing the cells to grow in the presence of xanthine and the absence of guanine; the trpB gene of E. coli, allowing the cells to grow in the presence of indol instead of tryptophan; the hisD gene of E. coli, allowing the cells to use histidinol instead of histidine.

[0173] In a preferred particular embodiment, the selection marker is a gene that confers resistance neomycin.

[0174] In a particular embodiment, the selection marker is flanked by recombinase target sites.

[0175] The term "recombinase target site" or "recombinase recognition site (RRS)" is used according to the definitions provided in the art. Thus, it refers to a short nucleic acid site or sequence, that is recognized by a site-specific recombinase and which becomes the crossover region during a site-specific recombination event. Non-limiting examples of recombinase recognition site include lox sites, att sites and frt sites. The term "lox site" as used herein refers to a nucleotide sequence at which the product of the ere gene of bacteriophage P1, the Cre recombinase, can catalyze a site-specific recombination event. A variety of lox sites are known in the art, including the naturally occurring loxP, loxB, loxL and loxR, as well as a number of mutant, or variant, lox sites, such as loxP511 , Iox5171 , loxP514, loxA86, loxA117, loxC2, loxP2, loxP3 and lox P23. The term "frt site" as used herein refers to a nucleotide sequence at which the product of the flp gene of the yeast 2 micron plasmid, FLP recombinase, can catalyze site-specific recombination. Frt sites include the naturally occurring "FRT" as well as the "F3" and "F5" site. The orientation of the recombinase recognition sites dictates one of three types of site specific recombination reactions: (i) excision, if two identical recombinase recognition sites are present in the same direction; (ii) inversion, if two identical recombinase recognition site are present in opposite direction and (iii) exchange, if two different (heterotypic) recombinase recognition sites are present in opposite or identical direction. In a particular embodiment, the recombinase target sites are Frt sites. Also the term "recombinase" is used in accordance with the definitions provided in the art. Thus, it refers to a genetic recombination enzyme that mediates site-specific recombination in cells. Site specific recombinases are naturally occurring only in prokaryotes and lower eukaryotes. There are two classes of site-specific recombinases, tyrosine recombinases (integrases) and serine recombinases (invertases / resolvases). Non-limiting examples of tyrosine recombinases include Cre recombinase from E.coli phage P1 , FLP recombinase from yeast 2m episome, I integrase from E.coli I phage and XerC / XerD recombinase from E.coli. Non-limiting examples include Hin recombinase from Salmonella flagella antigen switch, gamma-delta resolvase from the Tn 1000 transposon and <t>C31 integrase from Streptomyces phage (large serine subclass).

[0176] The requirement that a recombinase recognition site is specifically recognised by a particular recombinase means that said recombinase recognition site is only recognised by said particular recombinase. For example, a loxP site is only recognised by Cre recombinase but not by FLP recombinase. Thus, a loxP recombinase recognition site is specifically recognised by Cre recombinase. While one recombinase recognition site can only be recognised by one recombinase it is nonetheless possible that one recombinase can recognise multiple recombinase recognition sites. For example, Cre recombinase not only recognises loxP, but also the above recited recombinase recognition sites loxB, loxL, loxR, loxP511 , loxP514, loxA86, loxA117, loxC2, loxP2, loxP3 and lox P23. As sitespecific recombination only occurs between matching recombinase recognition sites, the use of different recombinase recognition sites within the transgene cassette ensures that recombination only occurs between the genome and the cassette but not within the cassette.

[0177] In a particular embodiment, the recombinase is a Flp recombinase. Flp recombinase originates from Saccharomyces cerevisiae and recognizes FRT sites in the genome. It catalyzes recombination between two FRT sites, thereby excising the intervening DNA sequence.

[0178] Thus, in an embodiment, the selection cassette, (resistance to neomycine, which is flanked by Frt sites), is removed using the Flp recombinase.

[0179] In some embodiments, in those cases in which the human HER2 contains at least one intermediate region separating two exons (preferably exons 1 and 2), the region within said intermediate region which contains the selection marker flanked by recombinase target sites is in turned flanked by intron donor and acceptor sites. In this manner, once the selection maker has been excised by the activity of the recombinase, the resulting single recombinase target site resulting from the recombinase-mediated excision will end up flanked by splice donor and acceptor sites. This allows the excision of this target site when the gene is expressed and the transcript is spliced.

[0180] In one embodiment, the polynucleotide according to the invention shows the following order of elements within the intermediate region from 5’ to 3’: intron splice donor site - recombinase target site - selection marker - recombinase target site - intron splice acceptor site.

[0181] For the generation of the transgenic rodent, it is first required to produce a cell comprising a transgene in its genome, thus, a targeting vector needs to be inserted into genome of the cell.

[0182] Thus, in another aspect, the present invention relates to a vector, hereinafter the vector of the invention, comprising the polynucleotide of the invention.

[0183] The term “vector” as used herein, refers to a nucleic acid molecule, preferably a DNA molecule derived, for example, from a plasmid, bacteriophage or virus, into which a nucleic acid sequence may be inserted or cloned.

[0184] The term "expression vector" includes plasmids, cosmids or phages capable of synthesizing the subject HER2 protein encoded by the respective recombinant gene carried by the polynucleotide of the invention.

[0185] A person skilled in the art will understand that there is no limitation as regards the type of vector which can be used. Vectors suitable for the insertion of this polynucleotide are vectors derived from expression vectors in prokaryotes such as pUC18, pUC19, Bluescript and the derivatives thereof, mp18, mp19, pBR322, pMB9, Co1 E1 , pCR1 , RP4, phages and “shuttle” vectors such as pSA3 and pAT28; expression vectors in yeasts such as vectors of the type of 2 micron plasmids, integration plasmids, YEP vectors, centromere plasmids and the like; expression vectors in insect cells such as vectors of the pAC series and of the pVL; expression vectors in plants such as pl Bl, pEarleyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, pORE series and the like; and expression vectors in eukaryotic cells, including baculovirus suitable for transfecting insect cells using any commercially available baculovirus system. The vectors for eukaryotic cells include preferably viral vectors (adenoviruses, viruses associated to adenoviruses such as retroviruses and, particularly, lentiviruses) as well as non-viral vectors such as pSilencer 4.1-CMV (Ambion), pcDNA3, pcDNA3.1 / hyg, pHMCV / Zeo, pCR3.1 , pEFI / His, pIND / GS, pRc / HCMV2, pSV40 / Zeo2, pTRACER-HCMV, pUB6 / V5-His, pVAX1, pZeoSV2, pCI, pSVL and PKSV-10, pBPV-1 , pML2d and pTDT1. A vector preferably contains one or more restriction sites and may be capable of autonomous replication in a defined host cell including a target cell or tissue or a progenitor cell or tissue thereof, or be partially or entirely integrable with the genome of the defined host such that the cloned sequence is reproducible. Accordingly, the vector may be an autonomously replicating vector, i.e. a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a linear or closed circular plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome / s into which it has been integrated. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.

[0186] The vector may further comprise one or more nucleic acid sequences encoding selectable marker such as auxotrophic markers (e.g., LELI2 , LIRA3, TRP 1 or HIS3) , detectable labels such as fluorescent or luminescent proteins (e.g., GFP, eGFP, DsRed, CFP) , or protein conferring resistance to a chemical / toxic compound (e.g., MGMT gene conferring resistance to temozolomide) . These markers can be used to select or detect host cells comprising the vector and can be easily chosen by the skilled person according to the host cell.

[0187] The selection gene is incorporated into a plasmid that can additionally include a promoter suitable for the expression of said gene in eukaryotic cells (for example, the CMV or SV40 promoters), an optimized translation initiation site (for example, a site following the so-called Kozak’s rules or an IRES), a polyadenylation site such as, for example, the SV40 polyadenylation or phosphoglycerate kinase site, introns such as, for example, the beta-globulin gene intron. Alternatively, it is possible to use a combination of both the reporter gene and the marker gene simultaneously in the same vector.

[0188] The disclosure also relates to a cell comprising the targeting vectors or polynucleotides as described above. In another aspect, the present invention relates to a host cell comprising the polynucleotide of the invention or the vector of the invention. The cells can be obtained by conventional methods known by persons skilled in the art [see e.g. Sambrook et al., cited ad supra] as explained before.

[0189] As used herein, a "host cell" includes any cultivatable cell that can be modified by the introduction of heterologous DNA. Preferably, a host cell is one in which the polynucleotide of the invention can be stably expressed, post-translationally modified, localized to the appropriate subcellular compartment, and made to engage the appropriate transcription machinery. The choice of an appropriate host cell will also be influenced by the choice of detection signal. For example, reporter constructs, as described above, can provide a selectable or screenable trait upon activation or inhibition of gene transcription in response to a transcriptional regulatory protein; in order to achieve optimal selection or screening, the host cell phenotype will be considered. A host cell of the present invention includes prokaryotic cells and eukaryotic cells. Prokaryotes include gram negative or gram positive organisms, for example, E. coli or Bacilli. It is to be understood that prokaryotic cells will be used, preferably, for the propagation of the transcription control sequence comprising polynucleotides or the vector of the present invention. Suitable prokaryotic host cells for transformation include, for example, E. coli, Bacillus subtilis, Salmonella typhimurium, and various other species within the genera Pseudomonas, Streptomyces, and Staphylococcus. Eukaryotic cells include, but are not limited to, yeast cells, plant cells, fungal cells, insect cells (e.g., baculovirus), mammalian cells, and the cells of parasitic organisms, e.g., trypanosomes. As used herein, yeast includes not only yeast in a strict taxonomic sense, i.e. , unicellular organisms, but also yeast-like multicellular fungi of filamentous fungi. Exemplary species include Kluyverei lactis, Schizosaccharomyces pombe, and Ustilaqo maydis, with Saccharomyces cerevisiae being preferred. Other yeasts which can be used in practicing the present invention are Neurospora crassa, Aspergillus niger, Aspergillus nidulans, Pichia pastoris, Candida tropicalis, and Hansenula polymorpha. Mammalian host cell culture systems include established cell lines such as COS cells, L cells, 3T3 cells, Chinese hamster ovary (CHO) cells, embryonic stem cells, with BHK, HeK or HeLa cells being preferred. Eukaryotic cells are, preferably, used to gene expression by applying the expression vector of the present invention.

[0190] The polynucleotide of the invention can be introduced into the host cell in vivo as naked DNA plasmids, but also using vectors by methods known in the art, including but not limited to transfection, electroporation (e.g. transcutaneous electroporation), microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter. See Wu C, et al., J. Biol. Chem. 1992; 267:963-967, Wu C and Wu G, Biol. Chem. 1988; 263:14621-14624, and Williams R, et al., Proc. Natl. Acad. Sci. USA 1991 ; 88:2726-2730. Other molecules are also useful for facilitating transfection of a nucleic acid in vivo, such as cationic oligopeptides, peptides derived from DNA binding proteins, or cationic polymers. See Bazile D, et al., WO1995021931 , and Byk G, et al., WO1996025508. Another well-known method that can be used to introduce polynucleotides into host cells is particle bombardment (aka biolistic transformation). Biolistic transformation is commonly accomplished in one of several ways. One common method involves propelling inert or biologically active particles at cells. See Sanford J, et al., US 4,945,050, US 5,036,006, and US 5,100,792.

[0191] Alternatively, the vector can be introduced in vivo by lipofection. The use of cationic lipids can promote encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes. See Feigner P, Ringold G, Science 1989; 337:387-388. Particularly useful lipid compounds and compositions for transfer of nucleic acids have been described. See Feigner P, et al., US 5,459,127, Behr J, et al., WO1995018863, and Byk G, WO1996017823.

[0192] Method for producing a rodent cell lacking the Erbb2 gene

[0193] For the generation of the genetically engineered animal, it is first required to produce a cell comprising a transgene in its genome, thus, a targeting vector needs to be inserted into genome of the cell.

[0194] Thus, in another aspect, the invention relates to a method, hereinafter the second method of the invention, for producing a rodent cell lacking the Erbb2 gene that comprises contacting said cell with the polynucleotide of the invention under conditions adequate for the polynucleotide to enter the cell and for recombination to occur between the first and third regions of the polynucleotide and the homologous regions in the genome of the rodent cell.

[0195] In a particular embodiment, the contacting step is carried out in the presence of a CRISP / Cas9 system that contains guide RNAs which are capable of specifically hybridizing to a region within the Erbb2 gene.

[0196] To use Cas 9 to modify genomic sequences, the protein can be delivered directly to a cell. Alternatively, an mRNA that encodes Cas 9 can be delivered to a cell, or a gene that provides for expression of an mRNA that encodes Cas 9 can be delivered to a cell. In addition, either target specific crRNA and a tracrRNA or target specific gRNA(s) can be delivered to the cell (these RNAs can alternatively be produced by a gene constructed to express these RNAs). Selection of target sites and designed of crRNA / gRNA are well known in the art.

[0197] In a particular embodiment, the rodent cell is a mouse cell.

[0198] In a more particular embodiment, the rodent cell is an embryonic stem (ES) cell. The transgenic rodents of the present invention are preferably generated by introduction of the targeting polynucleotides into embryonic stem (ES) cells. The term "embryonic stem cells", as used throughout the present invention, refers to stem cells derived from the inner cell mass of an early stage embryo known as a blastocyst. ES cells are pluripotent, i.e. they are able to differentiate into all derivatives of the three primary germ layers: ectoderm, endoderm, and mesoderm. Recent advances in embryonic stem cell research have led to the possibility of creating new embryonic stem cell lines without destroying embryos, for example by using a single-cell biopsy similar to that used in preimplantation genetic diagnosis, which does not interfere with the embryo's developmental potential (Klimanskaya et al. (2006)). Furthermore, a large number of established embryonic stem cell lines are available in the art (according to the U.S. National Institutes of Health, 21 lines are currently available for distribution to researchers), thus making it possible to work with embryonic stem cells without the necessity to destroy an embryo.

[0199] Embryonic stem (ES) cell are typically obtained from pre-implantation embryos cultured in vitro. Transgenes can be efficiently introduced into the ES cells by DNA transfection using a variety of methods known to the art including electroporation, calcium phosphate co-precipitation, protoplast or spheroplast fusion, lipofection and DEAE-dextran- mediated transfection. Transgenes may also be introduced into ES cells by retrovirus- mediated transduction or by microinjection. Such transfected ES cells can thereafter colonise an embryo following their introduction into the blastocoel of a blastocyst-stage embryo and contribute to the germ line of the resulting chimeric animal. Prior to the introduction of transfected ES cells into the blastocoel, the transfected ES cells may be subjected to various selection protocols to enrich for ES cells which have integrated the transgene assuming that the transgene provides a means for such selection. Alternatively, the polymerase chain reaction may be used to screen for ES cells which have integrated the transgene. This technique obviates the need for growth of the transfected ES cells under appropriate selective conditions prior to transfer into the blastocoel.

[0200] The polynucleotide of the invention can be transfected by any transgenesis method known by the person skilled in the art, including, but not limiting to, microinjection, electroporation, particle bombardment, cell transformation followed by cloning (the nuclei of the successfully transformed cells are transferred to enucleated ova and are implanted in receptor females), gamete transformation (introducing genes in oocytes or spermatocytes and using the transformed gametes for fertilization, generating a complete animal) and / or intracytoplasmic sperm microinjection (ICSI). The term "transfection" refers to the introduction of a nucleic acid, e.g., an expression vector, into a recipient cell by nucleic acid-mediated gene transfer. "Transformation", as used herein, refers to a process in which a cell's genotype is changed as a result of the cellular uptake of exogenous DNA or RNA, and, for example, the transformed cell expresses HER2 protein.

[0201] Preferably, the polynucleotide of the invention is transfected into said ES cell by electroporation. The ES cells are cultured and prepared for transfection using methods known in the related art. The ES cells that will be transfected with the polynucleotide of the invention are derived from embryo or blastocyst of the same species as the developing embryo or blastocyst into which they are to be introduced. ES cells are typically selected for their ability to integrate into the inner cell mass and contribute to the germ line of an individual when introduced into the animal in an embryo at the blastocyst stage of development. In one embodiment, the ES cells are isolated from the mouse blastocysts.

[0202] After transfection, the ES cells are cultured under suitable condition to detect transfected cells. For example, when the cassette or vector comprises a marker gene, e.g. an antibiotic resistant marker, e.g. neomycin resistant gene, the cells are cultured in that antibiotic. The DNA of the surviving ES cells may be analyzed using Southern Blot technology in order to verify the proper integration of the polynucleotide.

[0203] The selected ES cells can be injected into a blastocyst of a non-human animal to form chimeras. Chimeras are crossed with wild-type animals to generate heterozygous animals.

[0204] In particular, the ES cells may be inserted into an early embryo using microinjection. The injected blastocysts are re-implanted into a foster mother. When the progenies are born, they are screened for the presence of the polynucleotide, or vector of the invention, e.g. using Southern Blot and / or PCR technique. The heterozygotes are identified and are then crossed with each other to generate homozygous animals.

[0205] In a preferred embodiment, the ES cell is a G4 ES cell. G4 ES cells are derived from a mixed F1 background of crossbreeding of C57BL / 6 and 129.

[0206] Alternative methods for the generation of transgenic animals are known to those skilled in the art. For example, embryonic cells at various developmental stages can be used to introduce transgenes for the production of transgenic animals. Different methods are used depending on the stage of development of the embryonic cell. The zygote, particularly at the pronuclear stage (i.e. prior to fusion of the male and female pronuclei), is a preferred target for micro-injection. In the mouse, the male pronucleus reaches the size of approximately 20 micrometers in diameter, which allows reproducible injection of 1-2 picoliters (p1) of DNA solutions.

[0207] The age of the mammals that are used to obtain embryos and to serve as surrogate hosts is a function of the species used. When mice are used, for example, pre-puberal females are preferred as they yield more embryos and respond better to hormone injections.

[0208] Administration of hormones or other chemical compounds may be necessary to prepare the female for egg production, mating and / or implantation of embryos. Usually, a primed female (i. e. one that is producing eggs that may fertilised) is mated with a stud male and the resulting fertilised embryos are removed for introduction of the transgene(s). Alternatively, eggs and sperm may be obtained from suitable females and males and used for in vitro fertilisation to produce an embryo suitable for introduction of the transgene.

[0209] Normally, fertilised embryos are incubated in suitable media until the pronuclei appear. At about this time, the exogenous nucleic acid sequence comprising the transgene of interest is introduced into the male orfemale pronucleus. In some species, such as mice, the male pronuclease is preferred.

[0210] Following introduction of the nucleic acid into the embryo, the embryo may be incubated in vitro for varied amounts of time prior to reimplantation into the surrogate host. One common method is to incubate the embryos in vitro for 1 to 7 days and then reimplant them into the surrogate host.

[0211] Reimplantation is accomplished using standard methods. Usually the surrogate host is anaesthetised and the embryos are inserted into the oviduct. The number of embryos implanted into a particular host will vary, and will usually be comparable to or higher than the number of offspring the species naturally produces. Transgenic offspring of the surrogate host may be screened for the presence of the transgene by any suitable method. Screening may be accomplished by Southern or northern analysis using a probe that is complimentary to at least a portion of the transgene (and / or a region flanking the transgene) or by PCR using primers complementary to portions of the transgene (and / or a region flanking the transgene). Western blot analysis using an antibody against the protein encoded by the transgene may be employed as an alternative or additional method for screening. Alternative or additional methods for evaluating the presence of the transgene include without limitation suitable biochemical assays such as enzyme and / or immunological assays, histological stains for particular markers or enzyme activities and the like.

[0212] Progeny of the transgenic mammals may be obtained by mating the transgenic mammal with a suitable partner or by in vitro fertilisation using eggs and / or sperm obtained from the transgenic mammal. Where in vitro fertilisation is used, the fertilised embryo is implanted into a surrogate host or incubated in vitro or both. Where mating is used to produce transgenic progeny, the transgenic mammal may be back-crossed to a parental line, otherwise inbred or cross-bred with mammals possessing other desirable genetic characteristics. The progeny may be evaluated for the presence of the transgene using methods described above, or other appropriate methods.

[0213] Method for obtaining a transgenic rodent

[0214] In another aspect, the present invention relates to a method, hereinafter the third method of the invention, for obtaining the transgenic rodent of the invention which comprises generating an animal from an embryonic stem cell obtained by the second method of the invention.

[0215] In a particular embodiment, the third method of the invention further comprising crossing the rodents in order to obtain a zygote and contacting the zygote with a recombinase or with a recombinase-coding polynucleotide which is specific for the recombinase target sites which flank the selection marker under conditions adequate for the recombinase to enter the zygote or for the recombinase-coding polynucleotide to enter the zygote and produce the recombinase and for the recombinase to excise said selection marker.

[0216] In a first step, the rodents are crossed to obtain a zygote. The zygote refers to the eukaryotic cell formed by a fertilization event between two gametes. The heterozygotes animals are identified and are then crossed with each other to generate homozygous animals.

[0217] In a second step, the zygote is contacted with a recombinase or with a recombinasecoding polynucleotide in order to eliminate the selection marker, i.e. in order to eliminate the neomycin cassette. The recombinase or the recombinase-coding polynucleotide is specific for the recombinase target sites which flank the selection marker. In a particular embodiment, the selection marker is a gene that confers resistance to neomycin and this gene is flanked by Frt sites. The terms “recombinase”, “selection marker” and “recombinase target sites” have been defined or explained above, and these definitions are applicable to the third method of the invention.

[0218] In a particular embodiment, the recombinase is a Flp recombinase. In another particular embodiment, the recombinase-coding polynucleotide is a Flp recombinase-encoding polynucleotide.

[0219] The zygote is contacted with the recombinase or with the recombinase-coding polynucleotide under conditions adequate for the recombinase to enter the zygote or for the recombinase-coding polynucleotide to enter the zygote and produce the recombinase and for the recombinase to excise said selection marker.

[0220] In a particular embodiment, the recombinase is introduced in the zygote or the recombinase-coding polynucleotide in introduced in the zygote by electroporation. Following electroporation, embryos were transferred to pseudo-pregnant foster mice.

[0221] In another particular embodiment, the third method of the invention further comprising allowing the zygote to develop into an animal.

[0222] EXAMPLES

[0223] The following examples illustrate the invention and must not be considered as limiting the scope thereof.

[0224] A gene targeting construct consisting of 5’ homology-human exon 1 -synthetic intron- cDNA of human exons 2-27-3’ homology, was used to replace the entire mouse gene between the 5’ and the 3’ mouse UTRs. An Frt flanked b-actin-neo selection cassette was placed into the synthetic intron to allow for selection in ES cells.

[0225] Material and methods

[0226] Cloning

[0227] 1. A synthetic construct containing the human exon 1 -intron-human exon 2 to 27 flanked by Avril sites, and containing appropriate restriction sites for insertion of targeting homologies was designed and ordered from Twist Biosciences (ERBB2 AF HC-amp).

[0228] 2. ERBB2 AF HC-amp was digested with Avril, the backbone was gel purified and religated to give ERBB2-lnt1. 3. The 5’ homologous region was amplified from mouse (C57B6 / j) genomic DNA using primers:

[0229] ERBB2 5HR-F (SEQ ID NO: 1)

[0230] ACCTAGGCGATCGCGTAGTTTGGGACACCCCTCAGC

[0231] ERBB2 5HR-R (SEQ ID NO: 2)

[0232] AGTCGACAGGAGGGCGAGGAGGAAC

[0233] The resulting PCR fragment was isolated by gel electrophoresis, purified and cloned into the PCR cloning vector pCR-blunt. The 5’ targeting arm was then isolated from this cloning plasmid by Avrll / Sall digestion

[0234] 4. The 3’ homologous region was amplified from mouse (C57B6 / j) genomic DNA using primers:

[0235] ERBB2 3HR-F (SEQ ID NO: 3)

[0236] AGTCGACTCTGGCCACATGACATCCAGG

[0237] ERBB2 3HR-R (SEQ ID NO: 4)

[0238] AGCGGCCGCTAAATTTAACTAATGGCACCGTCACAAT

[0239] The resulting PCR fragment was isolated by gel electrophoresis, purified and cloned into the PCR cloning vector pCR-blunt. The 3’ targeting arm was then isolated from this cloning plasmid by Notl / Sall digestion.

[0240] 5. The 5’ homologous arm was then cloned into ERBB2-lnt1 at the Avrll / Sall sites to give ERBB2-lnt1-5HR.

[0241] 6. The 3’ homologous arm was then cloned into ERBB2-lnt1-5HR at the Notl / Sall sites to give ERBB2-lnt1-5HR+ 3HR.

[0242] 7. ERBB2-lnt1-5HR+ 3HR was then digested with Ncol and PspOMI. The Ncol-Aarl fragment of ERBB2 AF HC-amp was inserted into the same sites to give ERBB2- Int2.

[0243] 8. A PCR product containing an Frt flanked b-actin-neomycin / pA drug resistance cassette was the generated using the primers below, and a template containing the cassette. Frt-neo F (SEQ ID NO: 5)

[0244] ACCTCGAGGCTGGATCCGGAGTCGAGAAGTTCC

[0245] Frt-neo R (SEQ ID NO: 6)

[0246] AACGCGTACGAAGTTATCTCGACGAAGTTCCTA

[0247] The PCR product was purified and cloned into pCR-blunt, and then digested out using the restriction sites Absl and Mlul.

[0248] 9. The Absl -Mlul fragment from (8) was cloned into the same sites to give the final targeting vector ERBB2-FTV.

[0249] Mouse ES cell work

[0250] 1-. B6C2 ES cells (approx. 1 X 107) were transfected with 40pg of linearized ERBB2- FTV vector by electroporation. Transfected cells were then plated out in VGB6 conditioned medium (VGB6-CM) onto 10 X 10cm plates seeded with DR4 mouse- embryonic feeders (MEF’s). Selection with neomycin (final concentration 200pg / ml) was started 24 hours after transfection, and continued for 6 days, with medium changes every day. After selection was complete, individual colonies were picked into wells of a 96 well plate, trypsinised, and plated into a 96 well plated seeded with MEF’s. 4 X 96 well plates were picked. Clones were cultured for a further 2-3 days, after which the expanded clones were harvested by trypsinization and plated onto a gelatinised 96 well plate, and a duplicate plate containing 2X ES cell freezing medium. The former plate was cultured for an additional 3 days, to provide genomic DNA for analysis, whilst the latter plate was stored at -80°C. DNA was prepared from the gelatinised plate by carefully removing medium, washing the cells 3 X with PBS and then lysing / fixing them by the addition of lysis buffer and overnight incubation, followed by the addition of ice-cold / NaCI solution the following morning. The plates were then washed 3X with 70% EtOH, dried, and the DNA taken up in 150pl Tris / EDTA pH 8.0.

[0251] Genomic DNA was then analysed by long range PCR using Sequaprep (Invitrogen) and primer pairs consisting of a single primer binding outside of the homologous targeting arms, combined with a primer binding within the gene-targeting vector. Screening was carried out across both the 5’ and 3’ homologous targeting regions.

[0252] Screening primers

[0253] 5’ screen (5.5kb) 3’ screen (6.0kb) n this initial attempt, no positive clones were identified.

[0254] 2-. A second targeting attempt was made using the same ES cells and vector, but, in this attempt, authors used a CRISPR / Cas9 guide RNA to facilitate the targeting of the vector. The following guides were used:

[0255] ERBB2 5 G2 (SEQ ID NO: 11) AGACCCACCTTGGGTACCCG

[0256] ERBB2 3 G2 (SEQ ID NO: 12) GACCAGAACTCATCGGAGCA

[0257] 2 X 106cells were transfected with Cas9 protein, guide RNA and tracrRNA, along with the gene targeting vector. 2 separate systems were used in this experiment: transfection with a NEPA 21 electroporator and transfection with the Amaxa nucleofector system: i) NEPA 21 electroporation

[0258] A ribonuclear protein (RNP) mix was made as follows:

[0259] 3pl of ERBB2 5 G2 (200pM), 3pl of ERBB2 3 G2 (200pM) and 6pl of tracr RNA (200pM) were combined in a microtube and heated to 95°C for 5 minutes, followed by gradual cooling to room temperature. 60pl of Cas9 (20pM) was then added to the RNA mix and the resulting mix was incubated at room temp for 10 minutes. The RNP was then combined with 10pl (20pg) of gene targeting vector immediately prior to transfection using the NEPA 21 electroporator.

[0260] After electroporation, cells were harvested from the cuvette, and placed onto 8 X 10cm DR4 MEF plates in VGB6 CM.

[0261] 2 X 96 well plates were picked ii) AMAXA nucleofection

[0262] An RNP / targeting vector mix was made, as above. Cells were harvested, pelleted and taken up in 75pl of nucleofection solution from the Amaxa mouse ES nucleofector kit. The cell suspension was combined with the RNP / targeting vector mix and transfected using the Amaxa Nucleofector II and programme A32. After nucleofection, cells were harvested from the cuvette, and placed onto 8 X 10cm DR4 MEF plates in VGB6 CM. Selection with neomycin at a concentration of 200 pg / ml was started 24 hours after nucleofection and continued for 6 days.

[0263] 2 X 96 well plates were picked.

[0264] DNA was prepared from these clones and screened by long-range PCR, as previously described.

[0265] 18 putative positives were identified from this screen (plates 3 and 4, Amaxa) expanded and rescreened.

[0266] 8 clones analysed by Southern (3B11 , 4B1 , 4B6, 4C1 , 4D2, 4D7, 4F8, 4H1).

[0267] Based on the results of the Southern blots, 5 clones chromosome counted (4B6, 4C1 , 4F8, 4D7, 3B11).

[0268] Expression analysis

[0269] Expression of hHER2 was checked in 2 independent clones by RT-PCR. Heart and kidney were isolated from adult mice, and 3 primer pairs were tested for cross-reactivity with mouse HER2 cDNA. One primer pair, ERBB2-RT-PCR F1 and ERBB2 RT-PCR R1 (243bp) was found to produce no signal from mouse tissue. RNA was isolated from targeted ES cell clones, and cDNA generated from the RNA by reverse transcription. PCR was then carried out on these cDNA, followed by gel electrophoresis. Bands corresponding to the correct size were seen in both clones, whilst no corresponding band was seen in wt controls.

[0270] Blastocyst injection

[0271] Clones 4C1 , 4B6 were injected into 3.5 dpc blastocysts generated from CD1 mice.

[0272] Offspring born; 16 from clone 4C1 (3 chimeras) and 21 from clone 4B6 (3 chimeras). All chimeras from this experiment were mated.

[0273] No germline transmission was obtained in this experiment. Authors then decided to switch to a more amenable genetic background for further targeting experiments.

[0274] Gene targeting in G4 ES cells

[0275] Because of the failure of gene targeting in the B6C2 cell line (C57B6 / N background) inventors decided to switch to an ES cell line with an F1 genetic background. Thus, subsequent targeting experiments were carried out with the G4 cell line. (C57BL / 6Ncr x 129S6 / SvEvTac). 1-. The first attempt with G4 cells was undertaken with circular, supercoiled plasmid DNA. 2 different methods were used to transfect DNA. i) Approx 2 X 106G4 cells were electroporated along with 30pg of targeting vector alone. Cells were plated to 8 X 10cm DR4 MEF plates after electroporation ii) Approx 2 X 106G4 cells were nucleofected with the Amaxa nucleofection system, as detailed above. Cells were plated to 8 X 10cm DR4 MEF plates after nucleofection

[0276] In both cases, selection with 200pg / ml neomycin was started 24 hours after electroporation / nucleofection, and continued for 6 days. On completion of selection, clones were picked into 96 well plates, expanded, archived and analysed, as previously described. 4 X 96 clones were picked for the nucleofection experiment, and 2 x 96 well plates for the electroporation. DNA was screened by long-range PCR, as previously described.

[0277] Approximately 14% of clones from the Amaxa nucleofection were positive by the 3’ screen. However, none were positive by the 5’ screen. On further analysis, all tested clones had integrated the plasmid backbone at the 5’ end, and were therefore not suitable for use. No positive clones were obtained from electroporation experiment

[0278] 2. - An attempt was then made with a linearised vector. Amaxa nucleofection was used in this experiment, as described above. Cells were nucleofected and plated to 10 X DR4 MEF plates. Selection was applied for 6 days, after which clones were picked. 4 X 96 well plates were picked, expanded, and archived, with a duplicate plate used for DNA analysis.

[0279] 15 positives clones were identified from plate #1. These were expanded for archiving and further analysis. 10 clones were analysed by Southern blot, plus 1 control (non targeted) clone. Of these 5 were identified as correctly targeted and heterozygous, and an additional clone was identified as correctly targeted and homozygous.

[0280] Clones 1G10 and 1 B12 were chosen for blastocyst injection.

[0281] From these blastocyst injections:

[0282] Clones 1G10 and 1 B12 were injected into 3.5 dpc blastocysts generated from C57B6 mice.

[0283] Offspring born; 22 from clone 1G10 (21 chimeras) and 7 from clone 1 B12 (7 chimeras). Offspring were screened by PCR to test for the transmission of the modification. Positive offspring were bred to generate the HER2 mouse line, and to generate animals for the removal of the Frt flanked selection cassette. mRNA Production

[0284] FlpO mRNA was synthesized using mMESSAGE MACHINE T7 Ultra AM1345 (Thermofisher), according to manufacturers instructions.

[0285] Plasmid pCAG-FIpo (Addgene 60662), was used as a template for mRNA synthesis. Following IVT and polyA tailing, the mRNA was purified using the MEGAclear Transcription Clean-UP Kit AM1908 (Thermofisher), ethanol-precipitated, and finally resuspended in Opti-MEM.

[0286] Electroporation of isolated zygotes

[0287] Electroporator: Nepa 21. Chamber: CUY1 P1-1.5 (1 mm). Poring Pulse: Voltage 40V; Length 3,5mS; Interval 50mS; Pulse numbers, 4; D.Rate 10%; Polarity +

[0288] Transfer Pulse: Voltage 5V; Length 50mS; Interval 50mS; Pulse number, 5; D.Rate 40%; Polarity + / -

[0289] Following electroporation, embryos were transferred to pseudo-pregnant foster mice. Offspring were screened by PCR for the deletion of the Frt-flanked selection cassette.

[0290] Southern Blot

[0291] DNA was extracted from modified ES cell clones and digested with the restriction enzyme Sacl. Samples were then run in agarose gel electrophoresis and blotted onto a nitrocellulose membrane. Then, membranes were blocked to prevent non-specific binding and filters were hybridized with a 5’ probe for visualization of the DNA fragment of interest by chemiluminescent detection. The expected bands are 8.7 Kb (wt) and 16.8 Kb (Knock in) for 5’ probe. The banding pattern of the Sacl digests suggests heterozygous modification for the samples #1 , 2, 4, 6, 8 (1 B12 among them) and homozygous modification for sample #9 (1G10).

[0292] RT-qPCR

[0293] Kidneys and lungs from HER2 knock in mice were extracted and mechanically disaggregated. Total RNA was isolated from the tissue as recommended by the supplier (RNeasy Mini Kit, Qiagen). RNA was eluted in RNase-free water and quantified using NanoDropTM 2000 spectrophotometer. 1 pg of the total RNA was reverse-transcribed to cDNA by using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Quantitative reverse transcription-polymerase chain reaction (RT-qPCR) was performed with primers specific for the mouse (mErbb2) or the human (HER2) transcripts in 384- well plates using an ABI 7900HT Sequence Detection System (Applied Biosystems). Each sample was assayed in duplicates and normalized by using GAPDH expression as a reference. 1 B12 and 1G10 are heterozygous HER2 knock in mice from two different ES cell clones. C stands for control littermates negative for the insertion (negative control).

[0294] RT-qPCR for other tissues (small intestine, heart, stomach, pancreas, liver and breast).

[0295] Total RNA was isolated from mechanically disaggregated tissues from mice with DNase I. RNA was eluted in RNase-free water and quantified using NanoDropTM 2000 spectrophotometer (Thermo Fisher Scientific). 1 pg of the total RNA was reverse- transcribed to cDNA by using the High Capacity cDNA Reverse Transcription Kit (#4368813, Applied Biosystems). Quantitative reverse transcription-polymerase chain reaction (RT-qPCR) was performed with SYBR primers designed to target specifically murine Erbb2 mRNA or the human HER2 mRNA. Each sample was assayed in triplicate and normalized by using GAPDH or Actin expression as a reference. The Ct (Cycle Threshold) values of the real-time PCR were analyzed and normalized using the deltadelta Ct method.

[0296] Immunofluorescence

[0297] Mouse kidney tissues were collected, fixed in 10% neutral-buffered formalin, and embedded in paraffin (FFPE). Sections of 5 pm thickness were prepared using a cryostat and mounted on positively charged glass slides. Tissue sections were fixed in 4% paraformaldehyde (PFA) for 15 minutes at room temperature, followed by washes with PBS. Non-specific binding was blocked by incubating sections in blocking buffer (5% normal goat serum, 1 % bovine serum albumin in PBS) for 1 hour at room temperature. Sections were then incubated overnight at 4°C with DAKO anti-HER2 antibody. Following primary antibody incubation, sections were washed with PBS. Secondary antibody incubation involved anti-human IgG conjugated with Alexa Fluor 488 (AF488), diluted 1 :500 in blocking buffer, for 1 hour at room temperature in the dark. Finally, sections were washed three times in PBS to remove unbound secondary antibody, sections were treated with Vectoquencher according to the manufacturer's instructions to reduce background staining, and slides were mounted with a coverslip using an antifade mounting medium for fluorescence preservation. Slides were visualized in fluorescence Thunder Microscope. Western Blot

[0298] Tissues from mice were mechanically disaggregated and tissue lysates were sonicated at a frequency of 20 kHz for 10 seconds. Then, samples were centrifuged at 14,000 g for 20 min at4°C and protein content was measured using the Bio-Rad DC Protein Assay (Bio-Rad, USA). Equal amounts of protein (25 pg) were resolved by 10% SDS-PAGE gel (#4561084, Bio-Rad) and electro-transferred onto nitrocellulose membranes (#1704158, Bio-Rad). Membranes were stained with Ponceau, incubated in 5% BSA in TBS-T (1 * tris-buffered saline with 0.1 % tween 20 (#P7949, Sigma-Aldrich) for blocking and incubated overnight with primary antibodies. Primary antibody recognizing HER2 (CB11 , Biogenex, MU 134) was used at 1 :1000 concentration in 5% BSA. After washing, membranes were incubated with horseradish peroxidase-conjugates antibodies (GE Healthcare) for 1 h. Membranes were developed with Immobilon Western Chemiluminescent HRP Substrate (#WBKLS0500, Millipore) and protein bands were visualized in AmershamTM Imager 600 (GE Life Sciences). Authors used ECL mouse IgG, HRP-linked whole antibody (from sheep) (#NA931 , Amersham GE Healthcare) as secondary antibody.

[0299] Genotyping PCR

[0300] T ail fragments were collected from mice and DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen) according to the manufacturer’s protocol. Tail tissues were lysed overnight at 55°C with proteinase K, and DNA was subsequently purified and eluted. PCR reactions were performed in a 25 pL mixture containing 12.5 pL of 2X GoTaq Green Master Mix (Promega), 1 pL of each primer for HER2 and mErbb2 (10 pM), 3 pL of genomic DNA (approximately 50 ng / pL), and 7.5 pL of nuclease-free water. Authors used specific primer sequences for HER2 and mErbb2. After amplification, PCR products were resolved on a 2% agarose gel and visualized under UV light. The genotype was determined by the presence or absence of specific bands for HER2 and for mErbb2.

[0301] Results

[0302] In the development of the transgenic mice of the invention, authors used a targeted knock-in approach to insert the human HER2 gene within the murine Erbb2 locus. This strategy is aimed to ensure that the expression of HER2 is regulated by the endogenous murine Erbb2 promoter, maintaining physiological control within the genomic architecture of the murine Erbb2 gene. In the study, authors utilized the embryonic stem (ES) cell method, which involves the in vitro genetic modification of ES cells to include the human HER2 gene. For gene editing objectives, authors selected the G4 ES cell line, which has an F1 genetic background (C57BL / 6Ncr x 129S6 / SvEvTac), The G4 ES cells underwent modification via CRISPR / Cas9 technology. Specifically, authors employed CRISPR guides targeted to murine Erbb2 alongside a donor DNA construct carrying the human HER2 gene. This HER2 construct included all exons from the human gene, arranged as exon 1 , followed by an artificial intron that flanks the neomycin resistance gene, also flanked by FRT sites, and continuing through exons 2 to 31. Murine Erbb2 exon 27 was included at the end of the construct to enhance recombination due to size compatibility with the target locus (Fig. 1).

[0303] After effective transformation with the HER2 construct, G4 ES cells were selected using Neomycin, and fifteen positive clones were isolated. Detailed genetic analysis of 10 of these clones was conducted using Southern blotting (Fig. 2), identifying five clones as correctly targeted and heterozygous. Additionally, one clone, 1G10, was distinguished as homozygous. Clones 1 B12 and 1G10 were successfully integrated into blastocysts from donor mice, which were then implanted into pseudopregnant females to initiate gestation. Following the birth of the first offspring cohort, genetic screening was conducted to confirm the expression of the human HER2 gene by PCR techniques using primers specific to the human HER2 gene. The progeny expressing the human HER2 gene, subsequently termed chimeras, were selectively bred with wild-type C57BL / 6J mice to evaluate germline transmission of the gene by PCR. This initial cohort of genetically modified mice was crossbred with wild-type C57BL / 6J mice to harvest zygotes. These zygotes were subjected to electroporation with Flp mRNA to facilitate the excision of the Frt-flanked neomycin resistance cassette. Following the successful removal of this cassette, the treated embryos were implanted into pseudo-pregnant foster mice. The offspring from these implantations were subsequently screened to verify the successful deletion of the selection cassette. This screening confirmed the establishment of the first heterozygous HER2 knock-in founder mice.

[0304] Authors then initiated the characterization of four heterozygous founders from their newly developed HER2 knock-in mice, comprising two mice each from clones 1 B12 and 1G10, including both sexes. First, they quantified murine Erbb2 mRNA levels in major organs using RT-qPCR, comparing with those from a wild-type C57BL / 6 littermate. Notably, in both lungs and kidneys, the HER2 knock-in mice exhibited reduced levels of Erbb2 mRNA relative to the wild-type controls (Fig. 3A). This finding is in line with the assumption that the insertion of the human HER2 gene replaces one allele of the murine Erbb2 gene in our heterozygous knock-in models. To specifically detect the human HER2 mRNA, authors designed primers that do not anneal with the murine mRNA sequence and confirmed the expression of the human gene (Fig. 3A). They confirmed the active expression of the inserted human HER2 gene into HER2 protein in both kidneys by immunofluorescence (Fig. 3B) and lungs by Western blot (Fig. 3C), demonstrating not only successful gene insertion but also its functional expression.

[0305] The assessments of additional organs, including the small intestine, heart, stomach, pancreas, liver, and breast, confirmed HER2 mRNA expression across all organs tested, albeit at variable levels. Concordant with data from murine Erbb2 expression in mouse tissues from the web resources tissues.jensenlab.org (Palasca et al, 2018, Tissues 2.0: an integrative web resource on mammalian tissue expression, Database, Volume 2018), and in the Expression Atlas supported by EMBL-EBI, the stomach has more HER2 expression than the breast, while the heart has more expression than the liver, which shows little expression of the mErbb2 mRNA in databases (Fig. 4).

[0306] Following the confirmation of HER2 gene expression in heterozygous HER2 knock-in mice, authors performed breeding trials to assess the possibility of obtaining homozygous offspring. Remarkably, they successfully produced homozygous offspring from heterozygous pairings although at lower ratios than expected. Theoretically, breeding heterozygous mice should result in a Mendelian ratio of 25% wild type, 50% heterozygous, and 25% homozygous offspring. However, their results deviate from this expectation, with only 6.8% (4 out of 58) of the offspring being homozygous and a notably higher prevalence of wild-type individuals at 47% (Fig. 5A). Genotyping was conducted using PCR with specific primers for both murine Erbb2 and the inserted human HER2 gene. An illustrative genotyping example is shown in Fig. 5B. Notably, homozygous mice were viable and appeared healthy, although they exhibited a reduced body weight compared to their wild-type and heterozygous counterparts considering both male and female mice, although not yet statistically significant given the low number of mice included in the analysis (Fig. 5C, D).

[0307] Given their primary interest in homozygous mice for increased expression of HER2, authors next evaluated their fertility. As the number of mice available expanded, they proceeded with homozygous to homozygous matings. The results of these crossings were viable offspring and, predictably, all resulting offspring were homozygous (Fig. 6). The colony of homozygous mice is currently being expanded to enable further comparative studies on HER2 expression and additional functional assessments.

Claims

CLAIMS1. A transgenic rodent characterized in that a region of at least one copy of the endogenous Erbb2 gene is modified so that a region within the gene which encodes at least part of the rodent ERBB2 protein is replaced with a polynucleotide that encodes the human HER2 protein, wherein said polynucleotide is operably linked to the promoter of the endogenous Erbb2 gene.

2. The transgenic rodent according to claim 1 wherein the polynucleotide that encodes the human HER2 protein replaces the complete ERBB2 protein coding region of the endogenous Erbb2 gene.

3. The transgenic rodent according to claims 1 or 2 wherein the polynucleotide that encodes the human HER2 protein comprises, in the 5’ to 3’ direction, the human HER2 gene exon 1 , an intron and the human HER2 gene exons 2 to 27.

4. The transgenic rodent according to any one of claims 1 to 3, wherein the rodent is a mouse.

5. The transgenic rodent according to any one of claims 1 to 4, wherein both copies of the endogenous Erbb2 gene are modified so that a region within the gene which encodes at least part of the rodent ERBB2 protein is replaced with a polynucleotide that encodes the human HER2 protein, wherein said polynucleotide is operably linked to the promoter of the endogenous Erbb2 gene.

6. The transgenic rodent according to any one of claims 1 to 5, wherein the animal has one or more cells expressing human HER2.

7. A method for determining the safety profile of an anti-HER2 therapeutic agent which targets the human HER protein, wherein the method comprises:(i) contacting the transgenic rodent according to any one of claims 1 to 6 with said therapeutic agent and(ii) determining in the transgenic rodent one or more parameters indicative of the presence of adverse effects as a result of the treatment with the anti-HER2 therapeutic agent.

8. The method according to claim 7, wherein the anti-HER2 therapeutic agent is selected from the group consisting of an anti-HER2 antibody, an anti- HER2 antibody drug conjugate, a T-cell bispecific antibody targeting HER2 or a variant thereof and CD3, a CAR-T cell specific for HER2 or a variant thereof and a tyrosine kinase inhibitor.

9. The method according to claims 7 or 8, wherein the method further comprises contacting the transgenic rodent according to any one of claims 1 to 6 with at least another suitable compound for the treatment of cancer, preferably an HER2 positive cancer, and determining in the transgenic rodent one or more parameters indicative of the presence of adverse effects as a result of the treatment with the anti-HER2 therapeutic agent and the at least another suitable compound.

10. The method according to claim 9, wherein the at least another suitable compound for the treatment of cancer, preferably an HER2 positive cancer, is selected from the group consisting of: a chemotherapy agent, a CDK4 / 6 inhibitor, an anti-PD1 antibody and an anti-PD-L1 antibody.11 . The method according to any one of claims 7 to 10, wherein the parameters indicative of the presence of adverse effects of the anti-HER2 therapeutic agent, alone or in combination with at least another suitable compound for the treatment of cancer, to the rodent are selected from the group consisting on body weight, physical appearance, animal behaviour, red blood cell count, haematocrit, and / or haemoglobin of the animal and histological analyses of selected organs.

12. The method according to any one of claims 7 to 11 wherein the transgenic rodent comprises a HER2-positive human tumor xenograft of breast cancer, gastric cancer, endometrial cancer or pancreatic cancer origin.

13. The method according to claim 12 wherein additionally one or more parameters indicative of the response of the tumor are determined.

14. The method according to claim 13 wherein the parameter indicative of the response of the tumor is selected from the group consisting of tumor mass, tumor volume, survival time and tumor infiltration of immune cells.

15. A polynucleotide which comprises in the 5’ to 3’ direction:(i) a first region which comprises a region of the genome of a non-human animal which is located 5’ with respect of the 5’-UTR of the HER2 gene in said non-human animal,(ii) a second region which encodes the human HER2 protein and(iii) a third region which comprises a region of the genome of said non-human animal which is located 3’ end with respect to the 3’-UTR of the HER2 gene in said non-human animal.

16. The polynucleotide of claim 15 wherein the second region is a polynucleotide comprising all the exonic regions of the human HER2 gene and wherein at least two contiguous exonic regions are separated by an intermediate region, wherein said intermediate region comprises an intron.

17. The polynucleotide of claim 16 wherein the second region comprises, in this order, exon 1 of the human HER2 gene, the intermediate region and exons 2 to 27 of the human HER2 gene.

18. The polynucleotide according to claims 16 or 17 wherein the intron is an artificial intron.

19. The polynucleotide according to claim 18 wherein the artificial intron is the beta-actin intron.

20. The polynucleotide according to claim 19 wherein the intermediate region further comprises a selection marker.

21. The polynucleotide according to claim 20 wherein the selection marker is flanked by recombinase target sites.

22. The polynucleotide according to claim 21 wherein the recombinase target sites are Frt sites.

23. The polynucleotide according to any one of claims 20 to 22 wherein the order of elements within the intermediate region from 5’ to 3’ is intron splice donor site, recombinase target site, selection marker, recombinase target site and intron splice acceptor site.

24. The polynucleotide according to any one of claims 15 to 23 wherein the first and third regions are from a rodent, preferably a mouse.

25. A vector comprising the polynucleotide of any one of claims 15 to 24.

26. A host cell comprising the polynucleotide according to any one of claims 15 to 24 or the vector according to claim 25.

27. A method for producing a rodent cell lacking the Erbb2 gene that comprises contacting said cell with the polynucleotide according to any one of claims 15 to 24 under conditions adequate for the polynucleotide to enter the cell and for recombination to occur between the first and third regions of the polynucleotide and the homologous regions in the genome of the rodent cell.

28. The method according to claim 27 wherein the contacting step is carried out in the presence of a CRISP / Cas9 system that contains guide RNAs which are capable of specifically hybridizing to a region within the Erbb2 gene.

29. The method according to claims 27 or 28 wherein the rodent cell is a mouse cell.

30. The method according to any one of claims 27 to 29 wherein the rodent cell is an embryonic stem (ES) cell.31 . The method according to claim 30 wherein the ES cell is a G4 ES cell.

32. A method for obtaining a transgenic rodent as defined in any one of claims 1 to 6 which comprises generating an animal from an embryonic stem cell obtained by the method according to any of claims 27 to 31.

33. The method according to claim 32 further comprising crossing the rodents in order to obtain a zygote and contacting the zygote with a recombinase or with a recombinase-coding polynucleotide which is specific for the recombinase target sites which flank the selection marker under conditions adequate for the recombinase to enter the zygote or for the recombinase-coding polynucleotide to enter the zygote and produce the recombinase and for the recombinase to excise said selection marker.

34. The method according to claim 33 further comprising allowing the zygote to develop into an animal.

Images