New inducible systems for the production of recombinant proteins in plants

The UV-C light-inducible promoter system addresses the challenges of recombinant protein production in plants by providing a cost-effective, safe, and efficient method for inducing protein expression in plants.

WO2025109213A1PCT designated stage expired Publication Date: 2025-05-30FREE UNIV OF BERLIN
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2024/083428
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-24
Filing Date
2024-11-25
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

Current systems for recombinant protein production in plants face challenges such as high costs, contamination risks, and the need for expensive chemicals or energy-intensive methods to induce protein expression.

Method used

Development of an inducible promoter system in plants that uses UV-C light for induction, allowing for quick, strong, and cost-effective production of recombinant proteins without toxicity to plants or humans.

Benefits of technology

The UV-C light-inducible promoter system enables rapid and efficient production of recombinant proteins in plants, reducing costs and minimizing environmental impact while ensuring safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000028_0000
    Figure 00000028_0000
  • Figure 00000028_0001
    Figure 00000028_0001
  • Figure 00000029_0000
    Figure 00000029_0000
Patent Text Reader

Abstract

The present invention relates generally to plant genetic engineering. More particularly, it concerns to improved gene expression systems for transgenic plants using nucleic acid molecules comprising an inducible promoter. The present invention also relates to a recombinant gene and to microorganisms, plant cells and plants transformed with the recombinant gene.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] New inducible systems for the production of recombinant proteins in plants:

[0002] FIELD OF THE INVENTION

[0003] The present invention relates generally to plant genetic engineering. More particularly, it concerns to improved gene expression systems for transgenic plants using nucleic acid molecules comprising an inducible promoter. The present invention also relates to a recombinant gene and to microorganisms, plant cells and plants transformed with the recombinant gene.

[0004] BACKGROUND OF THE INVENTION

[0005] Recombinant protein expression in plants can be achieved by generating stable transformed lines or transient expression, in both whole plants and cell cultures. The yield of protein production is critical to commercial viability of the expression platform.

[0006] Once a protein-of-interest (POI) is identified, it is possible to integrate the gene coding for this POI (i.e. gene-of-interest, GOI) into an expression vector, which can then be introduced into another organism to produce the POI, making the protein productions easier and scalable to industry levels. This process is termed as “recombinant technology” and proteins produced in these heterologous biological systems are named “recombinant proteins”. The biological systems used for recombinant protein production are used as living factories. Over the last decades, bacteria, yeast, insect and mammal cell suspension cultures have been extensively used as heterologous systems to produce recombinant proteins because they offer technical benefits.

[0007] However, cell suspensions also have limitations. Their cultivation in bioreactors must be sterile, tightly controlled and sometimes requires expensive media, making the costs of the cell growth and the equipment high. Bioreactors also restrict the biomass growth and consequently the amount of produced POI. Moreover, the risk of contamination of sterile cultures represents an important bottle neck. In addition, human pathogens proliferation in animal cell is a challenging sanitary risk. On the other hand, contaminations may be constrained using drugs in bacterial or yeast cultures, but these simple organisms do not achieve certain protein modifications (so- called “post-translational modifications) that are sometimes essential for the function of the proteins.

[0008] The production of recombinant proteins in plants offers several advantages: whole plants instead of cell suspensions can be used which makes biomass growth inexpensive, the absence of human pathogens makes plant systems inherently safe, the production is easy to scale up, and there is the possibility to couple the recombinant protein production with secondary metabolite extraction, similar to protein post-translational modifications to animals. Promoters that are permanently active (so-called “constitutive promoters”) have been of prime interest to produce recombinant proteins. However, these constitutive promoters show their limits when the recombinant proteins have a detrimental effect on the host cells, for example enzymes that impair an important cell component or proteins that are toxic for the cells. Furthermore, independently on whether they directly harm the host cells, the permanent production of recombinant proteins can impinge on growth and development of the host organism, which often affect the biomass and the protein yield.

[0009] Promoters that can be deliberately turned ON or OFF (so called “inducible promoters”), are easy to control in their activation and are able to produce the POI in all the vegetative tissues by systemic expression. However, most inducible promoters used in plant heterologous systems are activated by chemicals such as ethanol or estradiol, which leads to several problems. For example, the chemicals might be toxic for the plants, thus have a negative impact on the POI production or the chemicals might be toxic for humans, making the application of the chemicals or the collection of plant biomass hazardous. On the other side the chemicals must be applied all over the plants or at least the tissues, making the induction of the promoter impractical. In addition, the chemicals might be expensive. Alternatively, promoters activated by heat can be used for recombinant protein production, but heating up facilities like greenhouses can be energetically costly, reaching a certain temperature may require some and is not convenient to reverse.

[0010] It was an object of the present invention to provide promoters which can be used for heterologous expression of recombinant proteins, and which are quickly and strongly inducible by environmental conditions that are cheap and easy to apply on the whole plant, not proteotoxic nor toxic for plants, and not toxic for humans.

[0011] SUMMARY OF THE INVENTION

[0012] The invention is defined by the appended claims.

[0013] The present invention disclosed herein provides an isolated nucleic acid comprising a promoter proSPPiDDRI (SEQ OD NO: 1) which is capable of being induced by UV-C light, wherein preferably the wavelength of the UV-C light is selected from the range of 100nm > A < 280nm; in accordance with ISO standard 21348) and which can be cloned into a plant expression vector containing the polynucleotide of interest. The recombinant vector can then be introduced, for example transiently or stably, into plants. These plants can be irradiated with UV-C light to induce the production of the polynucleotide of interest.

[0014] The essential advantage of the inducible promotor according to the present invention is that the induction is very fast and strong, so that high production of recombinant proteins can be easily realized in time. Since the light emitted by tubular lamps spreads in all directions, when plant growth chambers or greenhouses are equipped with several distributed IIV-C lamps, the cells around the plants are reached by the IIV-C light. The installation of IIV-C lamps in plant growth chambers or greenhouses requires only minor adjustments. In addition, treatment with IIV-C light is cost-effective, as only small amounts of light (1 to 6 kJ / m2) are sufficient to induce POI production. Moreover, IIV-C light does not affect plants when used at low doses, at least not quickly enough to interfere with protein extraction a few days later.

[0015] In a first aspect, the invention pertains to an isolated nucleic acid molecule comprising an inducible promoter, wherein the promoter is selected from the group consisting of:

[0016] - a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or a functional fragment thereof; and

[0017] - a nucleic acid comprising a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2, or a functional fragment thereof. In some embodiments, the promoter is capable of being induced by IIV-C light.

[0018] In a preferred embodiment, the dosage of IIV-C light is between 1 to 10 kJ / m2, preferably between 2 to 6 kJ / m2, more preferred between 3 to 5 kJ / m2. Particular preferred is the use of a 3 kJ / m2dose of IIV-C light.

[0019] A second aspect provided herein is a chimeric gene comprising the isolated nucleic acid comprising the promoter according to the first aspect. In some embodiments said chimeric gene further comprises at least one polynucleotide of interest operably linked to the isolated nucleic acid comprising the promoter according to the first aspect.

[0020] In some embodiments, the polynucleotide of interest is heterologous with respect to isolated nucleic acid molecule comprising the promoter.

[0021] A third aspect provided herein is a recombinant vector comprising the chimeric gene of the second aspect. In some embodiments, the vector is a plant expression vector.

[0022] A fourth aspect provided herein is a transgenic host cell comprising the chimeric gene of the second aspect.

[0023] A further aspect provided herein is a transgenic plant comprising the transgenic host cell of the fourth aspect.

[0024] Other objects, features, advantages and aspects of the present invention will become apparent to those skilled in the art from the following description and appended Claims. It should be understood, however, that the following description, appended Claims, and specific examples, which indicate preferred embodiments of the application, are given by way of Illustration only. Various changes and modifications within the spirit and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following.

[0025] DRAWINGS

[0026] Features will become apparent to those of ordinary skill in the art by describing in detail exemplary embodiments with reference to the attached drawings in which:

[0027] Fig. 1 illustrates the function of an inducible promotor.

[0028] Fig. 2 illustrates qPCR analysis data of SPPiDDRI, (SEQ ID NO: 8).

[0029] Fig. 3 illustrates a plant expression vector used for Agrobacterium-mediated stable transformation of Arabidopsis thaliana plants.

[0030] Fig. 4 illustrates a plant expression vector used for tobacco leaf transient transformation.

[0031] Fig. 5 illustrates the fold-change after IIV-C irradiation.

[0032] Fig. 6 illustrates the relative expression of SPPiDDRI (SEQ ID NO: 8) in Col-0, HY5, and SOG1 mutants two hours after IIV-C exposure compared to the corresponding untreated genotypes.

[0033] Fig. 7a illustrates the SOG1 binding motif (round) (SEQ ID NO: 6) and HY5 binding motifs (square) (SEQ ID NO: 7) which are found in the proximal part of proSPPiDDRI (SEQ ID NO: 1).

[0034] Fig. 7b shows the green fluorescent protein (GFP) signals after tobacco leaf transient transformation with truncated proSPPiDDRI, 326 bp (SEQ ID NO: 2).

[0035] Fig. 8 shows a screenshot from the encyclopedia of plant genome online server.

[0036] DETAILED DESCRIPTION OF THE INVENTION

[0037] The present invention provides an isolated nucleic acid molecule comprising a promoter which is capable of being induced by UV-C light and a chimeric gene comprising said isolated nucleic acid that directs expression of an operably linked polynucleotide of interest in a plant cell, plant, or plant part or seed.

[0038] It was found that the model plant Arabidopsis thaliana contains a plant specific gene (SPPiDDRI , SEQ ID NO: 8) which can be induced by light. SPPiDDRI can be found in many dicot plant genomes, for example tobacco, a plant commonly used for heterologous expression of recombinant proteins. Thus, it was found that the promoter of SPPiDDRI (proSPPiDDRI , SEQ ID NO: 1) may therefore be used for heterologous expression of recombinant proteins in plants. The annotation ID in the Arabidopsis thaliana genome is AT4G09215 (SEQ ID NO: 9, https: / / www.arabidopsis.org / servlets / TairObject7icM501167540&type=locus).

[0039] The present invention is based on the discovery that the nucleic acid molecule comprising the nucleic acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 or a functional fragment thereof has inducible promoter activity in plants a provides a moderate expression level of a polynucleotide of interest. Such moderate expression allows proteins to be expressed at a level such that the protein works effectively without adverse effects to the plant. The promoter may be capable of being induced by IIV-C light.

[0040] According to one aspect of the present invention, a chimeric gene for regulating expression of a polynucleotide of interest, comprises an isolated nucleic acid molecule comprising the promotor which is at least 80%, preferably at least 90%, 95%, 98% or at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 or a functional fragment thereof. In some embodiments, the isolated nucleic acid molecule comprising the promoter comprises the nucleic acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.

[0041] The term “functional fragment thereof” as used herein refers to a nucleic acid sequence that is shorter in length than the nucleic acid molecule comprising the promoter set forth in SEQ ID NO: 1 or SEQ ID NO: 2, yet retains the activity of the nucleic acid molecule comprising the promoter set forth in SEQ ID NO: 1 or SEQ ID NO: 2. Nucleic acid molecules that are fragments of a promoter sequence may comprise at least about 20, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900 contiguous nucleotides, or up to the number of nucleotides present in a full- length promoter sequence disclosed herein depending upon the intended use. By “contiguous” nucleotides is intended nucleic acid residues that are immediately adjacent to one another. Biologically active fragments of the promoters of the present invention will retain promoter activity (i.e., initiating transcription). By “retains promoter activity” is intended that the fragment will have at least about 30%, at least about 50%, at least about 70%, or at least about 80% of the promoter activity of the full-length promoter. For example, in some embodiments, the functional fragment of the nucleic acid molecule comprising the promoter comprises a nucleotide sequence at least 680 bp (SEQ ID NO: 3), 643 bp (SEQ ID NO: 4), 480 bp (SEQ ID NO: 5) or 326 bp (SEQ ID NO: 2) in length and retains the activity of the nucleic acid having inducible promoter activity.

[0042] For example, in some embodiments, the functional fragment of the nucleic acid having inducible promotor activities comprises a nucleotide sequence of 680 bp (SEQ ID NO: 3), 643 bp (SEQ ID NO: 4) or 480 bp (SEQ ID NO: 5).

[0043] In one embodiment the isolated nucleic acid molecule comprising the promoter has one or more binding motifs of SOG1 (AT1G25580) and of HY5 (AT5G11260). In another embodiment, the isolated nucleic acid molecule comprising the promoter comprises in its sequence one or more of the binding motifs CTT(N)7AAG (SEQ ID NO: 6) and / or ACGT (SEQ ID NO: 7). In a preferred embodiment the isolated nucleic acid molecule comprising the promoter comprises in its sequence one binding motif CTT(N)?AAG (SEQ ID NO: 6) and two binding motifs ACGT (SEQ ID NO: 7).

[0044] A biologically active portion of a promoter can be prepared by isolating a portion of one of the promoter nucleotide sequences of the invention and assessing the activity of that portion of the promoter.

[0045] Expression vectors

[0046] Another aspect of the present invention refers to a recombinant vector comprising the chimeric gene of the present invention.

[0047] The term “vector", encompasses phage, plasmid, viral or retroviral vectors as well as artificial chromosomes, such as bacterial or yeast artificial chromosomes. Moreover, the term also relates to targeting constructs which allow for random or site-directed integration of the targeting construct into genomic DNA. Such target constructs comprise DNA of sufficient length for either homologous or heterologous recombination as described in detail below. The vector encompassing the polynucleotides of the present invention may comprise selectable markers for propagation and / or selection in a host. The vector may be incorporated into a host cell by various techniques well known in the art. If introduced into a host cell, the vector may reside in the cytoplasm or may be incorporated into the genome. In the latter case, it is to be understood that the vector may further comprise nucleic acid sequences which allow for homologous recombination or heterologous insertion. Vectors can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques, the terms “ transformation" and “transfection", conjugation and transduction, as used in the present context, are intended to comprise a multiplicity of well known in the art processes for introducing foreign nucleic acid (for example DNA) into a host cell, including calcium phosphate, rubidium chloride or calcium chloride co- precipitation, DEAE-dextran-mediated transfection, lipofection, natural competence, carbon-based clusters, chemically mediated transfer, electroporation or particle bombardment (e.g., “gene-gun”). Alternatively, a plasmid vector may be introduced by heat shock or electroporation techniques. Should the vector be a virus, it may be packaged in vitro using an appropriate packaging cell line prior to application to host cells. Retroviral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in complementing host / cells.

[0048] The vector referred to herein may be suitable as a cloning vector, i.e. replicable in microbial systems. Such vectors ensure efficient cloning in bacteria, yeasts or fungi and make possible the stable transformation of plants. Those which must be mentioned are, in particular, various binary and co-integrated vector systems which are suitable for the T-DNA-mediated transformation. Such vector systems are, as a rule, characterized in that they contain at least the vir genes, which are required for the Agrobacterium-mediated transformation, and the sequences which delimit the T-DNA (T-DNA border). These vector systems may also comprise further cis- regulatory regions such as promoters and terminators and / or selection markers with which suitable transformed host cells or organisms can be identified. While co-integrated vector systems have vir genes and T-DNA sequences arranged on the same vector, binary systems are based on at least two vectors, one of which bears vir genes, but no T-DNA, while a second one bears T-DNA, but no vir gene. As a consequence, the last-mentioned vectors are relatively small, easy to manipulate and can be replicated both in E. coli and in Agrobacterium. Furthermore, by using appropriate cloning vectors, the recombinant gene of the invention can be introduced into host cells or organisms such as plants or animals and, thus, be used in the transformation of plants.

[0049] The vector of the present invention may be an expression vector. In such an expression vector, the chimeric gene comprises a nucleic acid molecule comprising the promoter as specified above allowing for expression in eukaryotic cells or isolated fractions thereof. An expression vector may, in addition to the chimeric gene of the invention, also comprise further regulatory elements including transcriptional as well as translational enhancers. The expression vector may also be a gene transfer or targeting vector. Expression vectors derived from viruses such as retroviruses, vaccinia virus, adeno-associated virus, herpes viruses, or bovine papilloma virus, may be used for delivery of the recombinant genes or vector of the invention into targeted cell population. Methods which are well known to those skilled in the art can be used to construct recombinant viral vectors.

[0050] In some embodiments, the vector (or vectors) described herein comprising the chimeric gene are propagated and amplified in a suitable organism, i.e. expression host. In some embodiments, one copy of the vector is propagated and amplified in a suitable organism. In some embodiments, two or more (e.g., 3, 4, 5, 6 7, 8 or more) copies of the vector are propagated and amplified in a suitable organism.

[0051] The term "chimeric gene" as used herein refers to a recombinant linear or circular nucleic acid molecule. It encompasses DNA as well as RNA sequences which are capable of directing expression of a particular nucleotide sequence in an appropriate host cell. In general, it comprises a promoter operably linked to a polynucleotide of interest, which is - optionally - operably linked to termination signals and / or other regulatory elements. The chimeric gene of the present invention is characterized in that it shall comprise a nucleic acid molecule comprising a promoter as defined herein. A chimeric gene may also comprise sequences which may be needed for proper translation of the nucleotide sequence. The coding region usually codes for a protein of interest but may also code for a functional RNA of interest, for example antisense RNA or a non-translated RNA, in the sense or antisense direction. The gene comprising the polynucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components. The chimeric gene may also be one which is naturally occurring but has been obtained in a recombinant form useful for heterologous expression. A chimeric gene may be assembled entirely extracellularly (e.g., by recombinant cloning techniques). However, a chimeric gene may also be assembled using in part endogenous components. For example, a chimeric gene may be obtained by placing (or inserting) a promoter sequence upstream of an endogenous sequence, which thereby becomes functionally linked and controlled by said promoter sequences. Likewise, a nucleic acid sequence to be expressed may be placed (or inserted) downstream of an endogenous promoter sequence thereby forming a chimeric gene. In another embodiment, such chimeric genes will comprise a transcriptional initiation region linked to a nucleotide sequence of interest. Such a chimeric gene may be provided with a plurality of restriction sites for insertion of the gene of interest to be under the transcriptional regulation of the regulatory regions. The chimeric gene may additionally contain selectable marker genes. The cassette will include in the 5'-3' direction of transcription, a transcriptional and translational initiation region, a DNA sequence of interest, and a transcriptional and translational termination region functional in plants. The termination region may be native with the transcriptional initiation region, may be native with the DNA sequence of interest, or may be derived from another source. Convenient termination regions are available from the Ti- plasmid of A. tumefaciens, such as the octopine synthase and nopalfne synthase termination regions. The chimeric gene may also comprise a multiple cloning site. In such a case, the multiple cloning site may be arranged in a manner as to allow for operative linkage of a polynucleotide to be introduced in the multiple cloning site with the transcription regulating sequence. In addition to the aforementioned components, the chimeric gene of the present invention may comprise components required for homologous recombination, i.e. flanking genomic sequences from a target locus. However, also contemplated is a chimeric gene which essentially consists of the nucleic acid molecule comprising the promotor, as defined hereinafter.

[0052] The terms “operably-linked" or “functionally linked" refer to the association of nucleic acid sequences on single nucleic acid fragment so that the function of one is affected by the other. For example, a regulatory DNA sequence is said to be "operably linked to" or "associated with" a DNA sequence that codes for an RNA or a polypeptide if the two sequences are situated such that the regulatory DNA sequence affects expression of the coding DNA sequence (i.e., that the coding sequence or functional RNA is under the transcriptional control of the promoter). Coding sequences can be operably-linked to regulatory sequences in sense or antisense orientation. The term "promoter" as used herein refers to a nucleotide sequence, usually upstream (5') to its coding sequence, which controls the expression of the coding sequence by providing the recognition for RNA polymerase and other factors required for proper transcription. "Promoter" includes a minimal promoter that is a short DNA sequence comprised, in some cases, of a TATA box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for enhancement of expression. "Promoter" also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements and that is capable of controlling the expression of a coding sequence or functional RNA. This type of promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. Accordingly, an "enhancer" is a DNA sequence, which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter. It is capable of operating in both orientations (normal or flipped) and is capable of functioning even when moved either upstream or downstream from the promoter. Both enhancers and other upstream promoter elements bind sequence-specific DNA-binding proteins that mediate their effects. Promoters may be derived in their entirety from a native gene, or be composed of different elements, derived from different promoters found in nature, or even be comprised of synthetic DNA segments.

[0053] A promoter may also contain DNA sequences that are involved in the binding of protein factors, which control the effectiveness of transcription initiation in response to physiological or developmental conditions. The "initiation site" is the position surrounding the first nucleotide that is part of the transcribed sequence, which is also defined as position +1. With respect to this site all other sequences of the gene and its controlling regions are numbered. Downstream sequences (i.e., further protein encoding sequences in the 3' direction) are denominated positive, while upstream sequences (mostly of the controlling regions in the 5* direction) are denominated negative. Promoter elements, such as a TATA element, that are inactive or have greatly reduced promoter activity in the absence of upstream activation are referred as "minimal" or “core" promoters. In the presence of a suitable transcription factor, the minimal promoter functions to permit transcription. A "minimal" or “core" promoter thus consists only of all basal elements needed for transcription initiation, e.g., a TATA box and / or an initiator.

[0054] The term "inducible promoter" as used herein refers to a promoter that is a regulated promoter which becomes on or active in the cell in response to specific stimuli. Therefore, these promoters are active only under certain circumstances. Unless it receives a stimulus, inducible promoter stays at inactive state. In the inactive state or off state, transcriptional factors or RNA polymerase cannot bind with the promoter. Once an inducer binds to the activator protein, activator protein binds with the promoter and makes it active to initiate transcription. Thus, inedible promotors can be deliberately turned ON or OFF. Figure 1 shows that an inducible promoter controls where, when, how and how much the chimeric gene according to the invention under its control is expressed.

[0055] In one embodiment, promoters inducing the production of the polynucleotide of interest in all the vegetative tissues, such as leaves, root, shoot, petiole, which is called “systemic expression” are preferred. In a further embodiment, promoters inducing the production of the polynucleotide of interest in specific plants tissues, such as flower, seed coat, may be used. Systemic promoters are preferred because they may offer a higher chimeric gene yield.

[0056] In a further embodiment the promotor is capable of being induced by light, preferably IIV-C light. In a preferred embodiment the IIV-C light is applied in a dose of 1 to 10 kJ / m2, preferably 2 to 6 kJ / m2, more preferred of 3 to 5 kJ / m2. Particular preferred is the use of a 3 kJ / m2dose of IIV-C light (see also Figure 5).

[0057] The term "heterologous" with respect to a nucleic acid molecule or DNA refers to a nucleic acid molecule which is operably linked to, or is manipulated to become operably linked to, a second nucleic acid molecule to which it is not operably linked in nature, or to which it is operably linked at a different location in nature. For example, a promoter of the invention is in its natural environment functionally linked to its native coding sequence, whereas in the present invention it is linked to another coding sequence, which might be derived from the same organism, a different organism or a synthetic coding sequence. It is in addition to be understood that the coding sequence under the control of the promoter of the invention is heterologous to said promoter as its sequence has been manipulated by for example a mutation such as insertions, deletions and the forth so that the natural sequence of said coding sequence Is modified and therefore have become heterologous to a promoter of the invention

[0058] Expression in a Host Cell

[0059] The term "expression" as used herein refers to the transcription and / or translation of an endogenous gene, or portion thereof, a transgene or cisgene in plants. For example, in the case of antisense constructs, expression may refer to the transcription of the antisense DNA only. In addition, expression refers to the transcription and stable accumulation of sense (mRNA) or functional RNA. Expression may also refer to the production of protein.

[0060] The term "nucleic acid" as used herein refers to deoxyribonucleotides or ribonucleotides and their polymers thereof in either single- or double-stranded form, composed of monomers (nucleotides) containing a sugar, phosphate and a base, which is either a purine or pyrimidine. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides, which have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues. A "nucleic acid fragment" is a fraction of a given nucleic acid molecule, in higher plants, deoxyribonucleic acid (DNA) is the genetic material while ribonucleic acid (RNA) is involved in the transfer of information contained within DNA into proteins. The term "nucleotide sequence" refers to a polymer of DNA or RNA which can be single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers. The terms "nucleic acid" or "nucleic acid sequence" may also be used interchangeably with gene, cDNA, DNA and RNA encoded by a gene.

[0061] "Isolated nucleic acid molecule", used interchangeably with "isolated DNA" as used herein refers to a nucleic acid molecule not occurring in its natural genomic context, irrespective of its length and sequence. Isolated DNA can, for example, refer to DNA which is physically separated from the genomic context, such as a fragment of genomic DNA. Isolated DNA can also be an artificially produced DNA, such as a chemically synthesized DNA, or such as DNA produced via amplification reactions, such as polymerase chain reaction (PGR) well-known in the art. Isolated DNA can further refer to DNA present in a context of DNA in which it does not occur naturally. For example, Isolated DNA can refer to a piece of DNA present in a plasmid. Further, the Isolated DNA can refer to a piece of DNA present in another chromosomal context than the context in which it occurs naturally, such as for example at another position in the genome than the natural position, in the genome of another species than the species in which it occurs naturally, or in an artificial chromosome.

[0062] Nucleic acid variants of the nucleic acid molecule comprising the promoter that retain the activity of the wild-type nucleic acid molecule comprising the promoter are also contemplated. The term "variant" as used herein with respect to a sequence (e.g., a polypeptide or nucleic acid sequence such as - for example - a nucleic acid having inducible promoter activity of the invention) Is intended to mean substantially similar sequences. Naturally occurring allelic variants such as these can be identified with the use of well-known molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques.

[0063] Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis. Generally, nucleotide sequence variants of the invention will have at least 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, to 79%, generally at least 80%, e.g., 81 %-84%, at least 85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, to 98% and 99% nucleotide sequence identity to the native (wild type or endogenous) nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 or a functional fragment thereof. As used herein, the term “sequence identity" or "identity" in the context of two nucleic acid or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity." Means for making this adjustment are well known to those of skill in the art. Typically tills involves scoring a conservative substitution as a partial rather than a full mismatch, thereby Increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as Implemented in the program PC / GENE.

[0064] The term "substantial identity" of polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%. or 79%, at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, at least 90%, 91%, 92%, 93%, or 94%, and at least 95%, 96%, 97%, 98%, or 99% sequence identity, compared to a reference sequence using one of the alignment programs described using standard parameters. One of skill in the art will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning, and the like.

[0065] Polynucleotides of Interest

[0066] The term "polynucleotide of interest" as used herein refers to a nucleic acid which is expressed under the control of the nucleic acid molecule comprising the promoter referred to herein. A polynucleotide of interest may encode a polypeptide the presence of which is desired in a plant cell, a plant, or a plant part as referred to herein. Such a polypeptide may be an enzyme which is required for the synthesis of seed storage compounds or may be a seed storage protein. It is to be understood that if the polynucleotide of interest encodes a polypeptide, transcription of the nucleic acid in RNA and translation of the transcribed RNA into the polypeptide may be required. A polynucleotide of interest may also include biologically active RNA molecules and antisense RNAs, ribozymes, micro RNAs or siRNAs. For example, an undesired enzymatic activity in a seed can be reduced due to the seed specific expression of an antisense RNAs, ribozymes, micro RNAs or siRNAs. The underlying biological principles of action of the aforementioned biologically active RNA molecules are well known in the art. Moreover, the person skilled in the art is well aware of how to obtain nucleic acids which encode such biologically active RNA molecules. It is to be understood that the biologically active RNA molecules may be directly obtained by transcription of the nucleic acid of interest, i.e. without translation into a polypeptide. Preferably, at least one polynucleotide of interest to be expressed under the control of the nucleic acid molecule comprising the promoter of the present invention is heterologous in relation to said the nucleic acid molecule comprising the promoter, i.e. it is not naturally under the control thereof, but said control has been produced in a non-natural manner (for example by genetic engineering processes).

[0067] An operable linkage in relation to any chimeric gene described herein may be realized by various methods known in the art, comprising both in vitro and in vivo procedure. Thus, a chimeric gene of the invention or a vector comprising such chimeric gene may by realized using standard recombination and cloning techniques well known in the art.

[0068] An operable linkage may - for example - comprise a sequential arrangement of the nucleic acid molecule comprising the promoter described herein (for example, the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2, or functional fragment thereof) with a nucleic acid sequence to be expressed, and - optionally - additional regulatory elements such as for example polyadenylation or transcription termination elements, enhancers, introns, etc, in a way that the nucleic acid having constitutive promoter activity can fulfil its function in the process of expressing the nucleic acid sequence of Interest under the appropriate conditions. The term “appropriate conditions" may mean the presence of the chimeric gene in a plant cell. Preferred are arrangements, in which the nucleic acid sequence of interest to be expressed is placed down-stream (i.e., in 3'-direction) of the nucleic acid molecule comprising the promoter of the invention in a way, that both sequences are covalently linked. Optionally additional sequences may be inserted in-between the two sequences. Such sequences may be for example linker or multiple cloning sites. Furthermore, sequences can be inserted coding for parts of fusion proteins (in case a fusion protein of the protein encoded by the nucleic acid of interest is intended to be expressed). Preferably, the distance between the polynucleotide of interest to be expressed and the nucleic acid molecule comprising the promoter of the invention is not more than 200 base pairs, preferably not more than 100 base pairs, more preferably no more than 50 base pairs.

[0069] In some embodiments, a chimeric gene is assembled by inserting a nucleic acid molecule comprising the promoter described herein (for example a nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2, or functional fragment thereof) into the plant genome. Such insertion will result in an operable linkage to a nucleic acid sequence of interest, which as such already existed in the genome. By the insertion, the nucleic acid of interest is expressed in an inducible way due to the transcription regulating properties of the nucleic acid molecule comprising the promoter which is inducible. The insertion may be directed or by chance. When the insertion is directed, it may be realized by for example gene editing. By this procedure a natural promoter may be exchanged against the nucleic acid molecule comprising the promotor of the invention, thereby modifying the expression profile of an endogenous gene. The nucleic acid molecule comprising the promoter may also be Inserted in a way, that antisense mRNA of an endogenous gene is expressed, thereby inducing gene silencing.

[0070] Similarly, a polynucleotide of interest to be expressed may by inserted into a plant genome comprising the nucleic acid molecule comprising the promoter in its natural genomic environment (i.e. linked to its natural gene) in a way that the inserted sequence becomes operably linked to the nucleic acid molecule comprising the promoter, thereby forming a chimeric gene of the invention.

[0071] The chimeric gene may be employed for numerous expression purposes such as for example expression of a protein of interest, or expression of an antisense RNA, sense or doublestranded RNA.

[0072] The protein of interest may be any coding sequence of interest. The protein of interest may be a gene from any other organisms with the same genetic code as the plant used for the heterologous expression, or any artificial / synthetic coding sequences (either a gene from another organism with a different genetic code, that has been edited so it codes for the same protein in the plants; or a gene fully created artificially). The protein of interest may be for example, an enzyme, a pharmaceutically active protein, a blood coagulation factor, an antibody, an antigen, a vaccine, a food supplement, a nutritional supplement, an industrial enzyme, or one or proteins that may form “virus like particle” within the plant.

[0073] Plants and host cells

[0074] Host cells or non-human, organisms comprising a chimeric gene described herein are also contemplated. They may be prokaryotic or eukaryotic organisms. Both microorganism and higher organisms are comprised. Examples of microorganisms are bacteria, yeast, algae, and fungi, Preferred bacteria are those of the genus Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Pseudomonas, Bacillus or Cyanobacterium such as - for example - Synechocystis. In some embodiments, the cells or non-human, organisms comprising a chimeric gene described herein is a plant cell or plant (as defined herein). In some embodiments, the plant is hemizygous for the chimeric gene. In some embodiments, the plant is homozygous for the chimeric gene.

[0075] In some embodiments, the host cell is a plant cell, a plant, a plant seed or other plant part.

[0076] The term “plant” encompasses whole plants, ancestors and progeny of the plants and plant parts including seeds, shoots, stems, leaves, roots, flowers, and tissues and organs, wherein each of the aforementioned comprise the gene / nucleic acid of Interest, The term “plant" also encompasses plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen, microspores and propagules, again wherein each of the aforementioned comprises the gene / nucleic acid of interest.

[0077] The term "transgenic plant" as used herein, refers to a plant which contains a foreign nucleotide sequence inserted into either its nuclear genome or organelle genome. It encompasses further the offspring generations i.e. the T1-, T2- and consecutively generations or BC1 -, BC2- and consecutively generation as well as crossbreeds thereof with non-transgenic or other transgenic plants.

[0078] The term “plant parts” as used herein encompasses all components of a plant including seeds, shoots, stems, leaves, roots, flowers, and plant tissues and plant organs, plant cells, Suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen, microspores and propagules. A "Propagule" is any kind of organ, tissue, or cell of a plant capable of developing into a complete plant. A propagule can be based on vegetative reproduction (also known as vegetative propagation, vegetative multiplication, or vegetative cloning) or sexual reproduction. A propagule can therefore be seeds or parts of the non-reproductive organs, like stem or leave. In particular, with respect to Poaceae, suitable propagules can also be sections of the stem, i.e., stem cuttings.

[0079] The nature of the plants, plant parts and seeds are not limited; for example, the plant, plant part or seed can be monocotyledonous or dicotyledonous. In some embodiments, the plant or plant part is from a dicotyledonous plant, which is preferred. Examples of plants or plant parts are selected from the group consisting of tomato, cucumber, squash, peas, alfalfa, melon, chickpea, chicory, clover, kale, lentil, soybean, beans, tobacco, potato, sweet potato, yams, cassava, radish, broccoli, spinach, cabbage, rape, apple trees, citrus, grape, cotton, sunflower, strawberry, lettuce, and hop. In a preferred embodiment the plant or plant part is from tobacco.

[0080] Methods for producing plants or plant parts, including plant tissue, plant organ, plant or seed comprising introducing a chimeric gene of recombinant vector described herein into a plant cell and regenerating the plant cell to form a plant tissue, plant organ, plant or seed are also contemplated.

[0081] Methods of providing IIV-C light response activity to a plant comprising introducing a chimeric gene or recombinant vector described herein comprising a nucleotide sequence that encodes a IIV-C light inducible protein into a plant cell: and regenerating the plant cell to form a plant or plant part, including plant tissue, plant organ, plant or seed, thereby providing pesticidal activity to the plant, are also contemplated.

[0082] As used herein an “expression cassette” refers to a component of the expression vector which contains the polynucleotide of interest under the control of the regulatory sequences for expression. An expression cassette as described herein comprises a promoter sequence proSPPiDDRI ::GFP-GUS (GFP: green fluorescent protein; GUS: beta-glucuronidase), flanked by left- and right borders of the t-DNA of the binary vector.

[0083] In a preferred embodiment the production of the protein of interest with plants may take place in growth chambers or greenhouses equipped with IIV-C lamps. First, the transformation of plants with the plant expression vector comprising the proSPPiDDRI ::GOI cassette may be carried out, the genotyping to obtain homozygous T2 plants and the collection of T3 seeds. In a second step the germination of T3 seeds and growth of vegetative tissues under white light may take place. In a third step the plants may be irradiated with IIV-C light of 3 kJ / m2to induce the expression of the GOI. After that, the plants may grow under white light for 3-4 days to wait for the accumulation of the polynucleotide of interest (step four). In a preferred embodiment step 3 and 4 may be repeated several times to boost the production of the polynucleotide of interest. The last step may be the isolation and purification of the polynucleotide of interest with classical biochemistry technics.

[0084] In one embodiment, the chimeric gene according to the invention together with one reporter gene and / or a tag enabling the purification of the POI are cloned into an expression cassette which is introduced into the organism via a vector or directly into the genome.

[0085] To follow the segregation and to select for homozygous plants, in order to obtain a stable line, reporter genes may be used. The reporter gene should allow easy detection via a growth, fluorescence, chemical, bioluminescence or tolerance assay or via a photometric measurement. Examples of reporter genes which may be mentioned are antibiotic- or herbicide-tolerance genes, hydrolase genes, fluorescence protein genes, bioluminescence genes, sugar or nucleotide metabolic genes or biosynthesis genes such as the Ura3 gene, the Ilv2 gene, the luciferase gene, the p-galactosidase gene, the gfp gene, the 2-desoxyglucose- 6-phosphate phosphatase gene, the p-glucuronidase gene, p-lactamase gene, the neomycin phosphotransferase gene, the hygromycin phosphotransferase gene, a mutated acetohydroxyacid synthase (AH AS) gene (also known as acetolactate synthase (ALS) gene), a gene for a D-amino acid metabolizing enzmye or the BASTA (= gluphosinate-tolerance) gene.

[0086] To increase the possibility of identification of transformants it is also desirable to use reporter genes such as p-galactosidase-, p -glucuronidase-(GUS), alkaline phosphatase- and / or green- fluorescent protein-genes (GFP).

[0087] The transgenic plants of the present invention are prepared using transformation methods known to those skilled in the art of plant biotechnology. Any method can be used to transform a recombinant expression vector into a plant cell to produce a transgenic plant of the invention. Transformation methods can include both direct and indirect transformation methods. Suitable direct methods include polyethylene glycol-induced DNA uptake, liposome-mediated transformation, use of gene gun introduction, electroporation, and microinjection, and the like. In a particular embodiment of the invention, the invention uses an Agrobacterium-mediated transformation technique. Agrobacterium strains, such as A. tumefaciens or A. rhizogenes, contain plasmids (Ti or Ri plasmids) and T-DNA elements that are transferred to plants after transfection with Agrobacterium and T-DNA is integrated into the genome of plant cells. The T-DNA can be located on the R-plasmid or Ti-plasmid, or independently in a so-called binary vector. Agrobacterium-mediated transformation is most suitable for dicotyledons but also for monocotyledons. Transformation can result in transient or stable transformation and expression.

[0088] A preferred method is Agrobacterium-mediated transformation with binary vectors.

[0089] Evaluation of Plant Transformation

[0090] To confirm the presence of the transferred polynucleotide of interest in transformed cells and plants, a variety of assays may be performed. Such assays include, for example, "molecular biological" assays well known to those of skill in the art, such as Southern and Northern blotting, in situ hybridization and nucleic acid-based amplification methods such as PCR or RT-PCR or TaqMan; "biochemical" assays, such as detecting the presence of a protein product, e.g., by immunological means (ELISAs and Western blots) or by enzymatic function; plant part assays, such as seed assays; and also, by analyzing the phenotype of the whole regenerated plant, e.g., for disease or pest resistance.

[0091] In some embodiments, the presence of nucleic acid elements introduced through the methods of this invention may be determined by polymerase chain reaction (PCR). Using these technique discreet fragments of nucleic acid are amplified and detected by gel electrophoresis. This type of analysis permits one to determine whether a preselected nucleic acid segment is present in a stable transformant, but does not prove integration of the Introduced preselected nucleic acid segment into the host cell genome. In addition, it is not possible using PCR techniques to determine whether transformants have exogenous genes introduced into different sites in the, genome, i.e., whether transformants are of independent origin. It is contemplated that using PCR techniques it would be possible to clone fragments of the host genomic DNA adjacent to an introduced preselected DNA segment.

[0092] Known methods of PCR include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially mismatched primers, and the like.

[0093] Positive proof of DNA integration into the host genome and the independent identities of transformants may be determined using the technique of Southern hybridization. Using this technique specific DNA sequences that were introduced into the host genome and flanking host DNA sequences can be identified. Hence the Southern hybridization pattern of a given transformant serves as an identifying characteristic of that transformant. In addition, it is possible through Southern hybridization to demonstrate the presence of introduced preselected DNA segments in high molecular weight DNA, i.e., confirm that the introduced preselected, DNA segment has been Integrated into the host cell genome. The technique of Southern hybridization provides information that is obtained using PCR, e. g., the presence of a preselected DNA segment, but also demonstrates integration into the genome and characterizes each individual transformant.

[0094] Whereas DNA analysis techniques may be conducted using DNA isolated from any part of a plant, RNA may only be expressed in particular cells or tissue types and hence it will be necessary to prepare RNA for analysis from these tissues. PGR techniques may also be used for detection and quantitation of RNA produced from introduced preselected DNA segments. In this application of PCR, it is first necessary to reverse transcribe RNA into DNA, using enzymes such as reverse transcriptase, and then through the use of conventional PCR techniques amplify the DNA. In most instances, PCR techniques, while useful, will not demonstrate integrity of the RNA product. Further information about the nature of the RNA product may be obtained by Northern blotting. This technique will demonstrate the presence of an RNA species and give information about the integrity of that RNA. The presence or absence of an RNA species can also be determined using dot or slot blot Northern hybridizations. These techniques are modifications of Northern blotting and will only demonstrate the presence or absence of an RNA species.

[0095] While Southern blotting and PCR may be used to detect the preselected DNA segment in question, they do not provide information as to whether the preselected DNA segment is being expressed. Expression may be evaluated by specifically identifying the protein products of the introduced preselected DNA segments or evaluating the phenotypic changes brought about by their expression.

[0096] Evaluation of Promoter Activity

[0097] Numerous methods are available to assess promoter activity in plants. Promoter function during expression of a gene of interest under its regulatory control may be tested at either the transcriptional or translational stage. At the transcriptional stage, RNA levels may be tested by DNA-RNA hybridization assays (i.e., Northern blot analysis), competitive reverse transcriptase PCR and RNAse protection assays. At the translational stage promoter activity may be determined by using specific functional assays for the protein synthesized (for example, by enzymatic activity or by immunoassay of the protein). For example, reporter gene activity, such as p-glucuronidase activity, luciferase activity or GFP fluorescence may be monitored at various times after transformation. Reporter gene activity may be monitored by enzymatic activity, by staining cells or tissue with Substrate for the enzyme encoded by the reporter gene or by direct visualization under an appropriate wavelength of light. Western blot may be carried out on the transgenic plants to confirm the presence of protein encoded by a gene of interest operably linked to the TripPro5 promoter by standard procedures using antibodies that bind to one or more epitopes present on the protein. Full-length promoter sequences, deletions and mutations of the promoter sequence may be assayed and their expression levels compared.

[0098] Use of the isolated nucleic acid comprising an inducible promoter described herein is provided to regulate expression of an operably linked nucleic acid in a plant or to identify other nucleic acid having inducible promoter activity.

[0099] A further aspect of the present invention is a method of producing food, feed, or an industrial product including a) obtaining the plant, plant part or seed, of the invention, and b) preparing the food, feed or industrial product from the plant, plant part or seed. The method may also include where a) the food or feed is oil, meal, grain, starch, flour, enzyme or protein, or b) the Industrial product is biofuel, fiber, biosensor, industrial chemicals, a pharmaceutical, cosmetics or a nutraceutical.

[0100] It is to be understood that this invention is not limited to the particular methodology, protocols, cell lines, plant species or genera, constructs, and reagents described as such. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention, which will be limited only by the appended claims. It must be noted that as used herein and in the appended claims, the singular forms "a, "and," and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to "a vector" is a reference to one or more vectors and includes equivalents thereof known to those skilled in the art, and so forth.

[0101] The present invention is further illustrated by the following examples, from which further features, embodiments, aspects and advantages of the present invention can be seen.

[0102] SEQUENCE LISTING

[0103] This application contains, as a separate part of the disclosure, a Sequence Listing in computer readable form.

[0104] SEQ ID NO: 1 (promotor 975 bp, full sequence):

[0105] GTCTGAAAAGTGGTAATTGAATTTTGTTTAGAATGATTCTACAGAGGTTGAATTTGGTAAA TGAATCAGAGGAATATTAAGCATTTGAGCATAATTTCCAATTTGGTCAGATTATGATATAT GTAAATATGTCCATGATTCATTTTCTGTTTTTGGGTTCTCTTTGTTCATTTATTAAGTCATG GGCTGAAGTTTTCATATTTTAAGTCATGGGCTGAGTTCTCAAGGACTAAAACTGGTATTG ATATTATGATCTGTTAAAAGCCAATTCATTTAAGGTGTTCAAAATCTAAACTGAATAATTG CGTTAAATTAAGCCGGACATGTTTCAATCAAAAGTCAATAGAATGTGTCAAAATACTCTG

[0106] GGTACTTGGGTAGTATTAGTAACATTAACTTACAAGGATTTTTCTCTATATAAAAATACAG

[0107] AGTACTAGTTTTGATTTTATCTGAGTGAGAACTTTCTAATAAAACTCTAATCGAAAACAAT

[0108] TAATATTTTGTATAAAATGGAGTGTAGAACCTAAATATTTTGTATTGCTTGGATATATAGTT

[0109] TTTTTTCTTCTTAACATGGATATATAAGTTCTATTTCGTACATATTTCCCCTAATTTTAATG

[0110] TTGAATTTTGGAAAACTTTTGTTGGATAGTGACATGAAGACCCTAATTTTAATCATAACAT

[0111] TTTGGAAAACTTGATTGGGTGAGTGATATGGAGGTGATGTTAACGTATGTTTGGTATCAA

[0112] TAGTTGGTCCAATTAGGCCCAAAGAGTCAAAAAAGGTGCCCAAGTGTTGTCAAAAGAGA

[0113] AAACAATTAAGAATAGGGCAAAGCTTGGCCAGCAAGATTTAGTGGTCATTTCCTAGAAAC

[0114] GTGTCCAAGAATTTATAAAGATGGGTTGTCTTATAAATACATATCGTTCACGTAATTACCT

[0115] GAGATCAAATCTTAATCATATCATTCATCGTATATAGACTCCAAACACGTTTTTCAAACTC CT

[0116] SEQ ID NO: 2 (truncated promoter 326 bp):

[0117] GACCCTAATTTTAATCATAACATTTTGGAAAACTTGATTGGGTGAGTGATATGGAGGTGA

[0118] TGTTAACGTATGTTTGGTATCAATAGTTGGTCCAATTAGGCCCAAAGAGTCAAAAAAGGT

[0119] GCCCAAGTGTTGTCAAAAGAGAAAACAATTAAGAATAGGGCAAAGCTTGGCCAGCAAGA

[0120] TTTAGTGGTCATTTCCTAGAAACGTGTCCAAGAATTTATAAAGATGGGTTGTCTTATAAAT

[0121] ACATATCGTTCACGTAATTACCTGAGATCAAATCTTAATCATATCATTCATCGTATATAGA

[0122] CTCCAAACACGTTTTTCAAACTCCT

[0123] SEQ ID NO: 3 (truncated promoter 680 bp):

[0124] TGAATAATTGCGTTAAATTAAGCCGGACATGTTTCAATCAAAAGTCAATAGAATGTGTCA

[0125] AAATACTCTGGGTACTTGGGTAGTATTAGTAACATTAACTTACAAGGATTTTTCTCTATAT

[0126] AAAAATACAGAGTACTAGTTTTGATTTTATCTGAGTGAGAACTTTCTAATAAAACTCTAAT

[0127] CGAAAACAATTAATATTTTGTATAAAATGGAGTGTAGAACCTAAATATTTTGTATTGCTTG

[0128] GATATATAGTTTTTTTTCTTCTTAACATGGATATATAAGTTCTATTTCGTACATATTTCCCC

[0129] TAATTTTAATGTTGAATTTTGGAAAACTTTTGTTGGATAGTGACATGAAGACCCTAATTTT

[0130] AATCATAACATTTTGGAAAACTTGATTGGGTGAGTGATATGGAGGTGATGTTAACGTATG

[0131] TTTGGTATCAATAGTTGGTCCAATTAGGCCCAAAGAGTCAAAAAAGGTGCCCAAGTGTT

[0132] GTCAAAAGAGAAAACAATTAAGAATAGGGCAAAGCTTGGCCAGCAAGATTTAGTGGTCA

[0133] TTTCCTAGAAACGTGTCCAAGAATTTATAAAGATGGGTTGTCTTATAAATACATATCGTTC

[0134] ACGTAATTACCTGAGATCAAATCTTAATCATATCATTCATCGTATATAGACTCCAAACACG TTTTTCAAACTCCT

[0135] SEQ ID NO: 4 (truncated promoter 643 bp):

[0136] TCAAAAGTCAATAGAATGTGTCAAAATACTCTGGGTACTTGGGTAGTATTAGTAACATTA

[0137] ACTTACAAGGATTTTTCTCTATATAAAAATACAGAGTACTAGTTTTGATTTTATCTGAGTG AGAACTTTCTAATAAAACTCTAATCGAAAACAATTAATATTTTGTATAAAATGGAGTGTAG

[0138] AACCTAAATATTTTGTATTGCTTGGATATATAGTTTTTTTTCTTCTTAACATGGATATATAA

[0139] GTTCTATTTCGTACATATTTCCCCTAATTTTAATGTTGAATTTTGGAAAACTTTTGTTGGAT

[0140] AGTGACATGAAGACCCTAATTTTAATCATAACATTTTGGAAAACTTGATTGGGTGAGTGA

[0141] TATGGAGGTGATGTTAACGTATGTTTGGTATCAATAGTTGGTCCAATTAGGCCCAAAGAG

[0142] TCAAAAAAGGTGCCCAAGTGTTGTCAAAAGAGAAAACAATTAAGAATAGGGCAAAGCTT

[0143] GGCCAGCAAGATTTAGTGGTCATTTCCTAGAAACGTGTCCAAGAATTTATAAAGATGGGT

[0144] TGTCTTATAAATACATATCGTTCACGTAATTACCTGAGATCAAATCTTAATCATATCATTC

[0145] ATCGTATATAGACTCCAAACACGTTTTTCAAACTCCT

[0146] SEQ ID NO: 5 (truncated promoter 480 bp):

[0147] TGTATAAAATGGAGTGTAGAACCTAAATATTTTGTATTGCTTGGATATATAGTTTTTTTTCT

[0148] TCTTAACATGGATATATAAGTTCTATTTCGTACATATTTCCCCTAATTTTAATGTTGAATTT

[0149] TGGAAAACTTTTGTTGGATAGTGACATGAAGACCCTAATTTTAATCATAACATTTTGGAAA

[0150] ACTTGATTGGGTGAGTGATATGGAGGTGATGTTAACGTATGTTTGGTATCAATAGTTGGT

[0151] CCAATTAGGCCCAAAGAGTCAAAAAAGGTGCCCAAGTGTTGTCAAAAGAGAAAACAATT

[0152] AAGAATAGGGCAAAGCTTGGCCAGCAAGATTTAGTGGTCATTTCCTAGAAACGTGTCCA

[0153] AGAATTTATAAAGATGGGTTGTCTTATAAATACATATCGTTCACGTAATTACCTGAGATCA AATCTTAATCATATCATTCATCGTATATAGACTCCAAACACGTTTTTCAAACTCCT

[0154] SEQ ID NO: 6 (binding motif of SOG1):

[0155] CTT(N)7AAG

[0156] SEQ ID NO: 7 (binding motif of HY5):

[0157] ACGT

[0158] SEQ ID NO: 8 (coding sequences of SPPiDDRI : Chr4 : 16891790 - 16891605):

[0159] ATGATCATGTGTTCTCTCTTTGCCTCCGTCTTTGATTGCTTTGTTCCAAAATCAGACTCAA

[0160] AGATTAGCTCAACTGATGAGAGTGACTTGAAAGTCCTGTCCTCAAAGAAACCAAAAAGC

[0161] AAATCCCCGAGAGCTCCGATTATGGTGTCTTACTTTCCCGCCGGTTCAAACCTTTCGCG TCTATAA

[0162] SEQ ID NO: 9 (At4G09215):

[0163] AAATCTTAATCATATCATTCATCGTATATAGACTCCAAACACGTTTTTCAAACTCCTATGA

[0164] TCATGTGTTCTCTCTTTGCCTCCGTCTTTGATTGCTTTGTTCCAAAATCAGACTCAAAGAT

[0165] TAGCTCAACTGATGAGAGTGACTTGAAAGTCCTGTCCTCAAAGAAACCAAAAAGCAAAT

[0166] CCCCGAGAGCTCCGATTATGGTGTCTTACTTTCCCGCCGGTTCAAACCTTTCGCGTCTA TAAGTGCCAAATAGAAGAGAAGAGAAGATGAAGTATTGGGATGTTGATTTTGATATAAAC GAAAGAAGTTTTTGGTTGTAGACATGTTGTATGCGCAGGCTTTAATTTTATGTTTTATTTA ATTATGTACAAATAGACCATTTAGATTGATAGCATCATATATATGCTTTGTATTTAAGACC AAATAAAAGATTAATGTTTATATACA

[0167] EXAMPLES:

[0168] Example 1

[0169] Identification of inducible promoter

[0170] It was found that a plant specific gene “SPPiDDRT’ (SEQ ID NO: 8) can be induced by UV-C light. The induction is very fast (expressions starts less than 1 hour and peaks at 3 hours after a 3 kJ / m2UV-C dose), lasts over 72 hours and is very strong, for example 3 hours after UV-C irradiation, see Fig. 2). The promoter of SPPiDDRI (proSPPiDDRI, SEQ OD NO: 1) may therefore be used for heterologous expression of recombinant proteins in plants.

[0171] Chromatine-lmmuno Precipitation (ChIP) data with transcription factors (TFs) were screened on the online server “encyclopedia of plant genomes”. In Fig. 8 the high-lighted part is the genomic DNA of SPPiDDRI (AT4G09215). Compared to respective input tracks (controls), the tracks with ChIP using SOG1 or HY5 show peaks in proSPPiDDRI. Among all TFs, two were found to bind onto the SPPiDDRI promoter: SOG1 (AT1G25580) and HY5 (AT5G11260). The consensus binding motif of SOG1 is CTT(N)7AAG (SEQ ID NO: 6) and the one of HY5 is ACGT (SEQ ID NO: 7). In line with this, one SOG1 (SEQ ID NO: 6) binding motif and two Hy5 (SEQ ID NO: 7) binding motifs were found in proSPPiDDRI (SEQ ID NO: 1). SOG1 (SEQ ID NO: 6) binding motif and the most distal HY5 (SEQ ID NO: 7) binding motif correspond to the peaks observed with ChIP. To confirm that these two TFs are important for SPPiDDRI promoter activity, the induction of SPPiDDRI after UV-C irradiation was checked in SOG1 and in HY5 mutants. In these mutants, the remaining inductions were only 62% and 32%, respectively, underlining their role in the activation of proSPPiDDRI (SEQ ID NO: 1).

[0172] Consequently, a shorter proSPPiDDRI referred as to “truncated proSPPiDDRI", which corresponds to the 328 first bases of proSPPiDDRI (SEQ ID NO: 2), was cloned into the expression vector. Although shorter, this truncated proSPPiDDRI (SEQ ID NO: 2) still contains SOG1 (SEQ ID NO: 6) and HY2 (SEQ ID NO: 7) consensus binding motifs. When used for tobacco transient expression, truncated proSPPiDDRI yielded a GFP fluorescence signal, indicating that the truncated proSPPiDDRI may be the core functional element of the promoter SPPiDDRI. However, the signal appeared less intense than with the full-length promoter, indicating that other important element may be located beyond the base #328 and that other TFs contribute to the activity of proSPPiDDRI (SEQ ID NO: 1). The use of the full-length promoter seems therefore more appropriate for a strong induction desired in heterologous expression of recombinant proteins.

[0173] In Figure 6 the relative expression of SPPiDDRI in Col-0, HY5, and SOG1 mutants two hours after IIV-C exposure compared to the corresponding untreated genotypes are shown. Figure 7a shows SOG1 binding motif (round) and HY5 binding motifs (square) which are found in the proximal part of proSPPiDDRI . The truncated proSPPiDDRI corresponds to the most proximal 328bp of proSPPiDDRI , which still contains SOG1 and HY5 binding motifs. Figure 7b relates to the situation after tobacco leaf transient transformation with truncated proSPPiDDRI and IIV-C exposure (3 kJ / m2), GFP was monitored on leave discs with epifluorescence microscopy.

[0174] Example 2

[0175] Plant Transformation proSPPiDDRI (SEQ ID. NO: 1) was cloned into a plant expression vector (plasmid pKGWFS7) that contains two reporter genes: Green Florescent Protein (GFP) and P-glucuronidase (GUS) (Fig. 3 and 4). The accumulation of both GFP and GUS proteins can easily be monitored with fluorescence microscopy for GFP and histochemical staining for GUS. These genes originate from Aequorea victoria and E. coli bacteria, respectively, so their expression in plants constitutes proof-of-concept (PoC) for recombinant proteins production in plants.

[0176] This expression vector was first used for Agrobacterium-mediated stable transformation of Arabidopsis thaliana plants (Fig. 3). Genotyping was carried out to select for T2 homozygous plants. Then a 3 kJ / m2UV-C dose was applied on the T2 plants and GFP and GUS were monitored 24 hours later. Plants displayed a strong signal for both GFP and GUS after the UV- C irradiation, while the control plants that were not exposed to UV-C showed no signal for GFP nor GUS. Moreover, GUS staining was present in all vegetative tissues (leaves, roots, vasculatures, petioles and part of the shoot) meaning that proSPPiDDRI (SEQ ID NO: 1) is systemically active, reinforcing the advantageous traits of promoter.

[0177] Figure 3 shows a plant expression vector carrying proSPPiDDRI (SEQ ID NO: 1) upstream of Green Fluorescent Protein (GFP) and p-glucuronidase (GUS) genes was introduced into Arabidopsis plants. T2 homozygous plants were then treated with UV-C (3 kJ / m2). 24 hours later, GFP and GUS were monitored with epifluorescence microscopy and GUS straining, respectively. Plants used for GFP monitoring were 4 weeks old (picture of leave discs) and plants used for GUS monitoring were 10 days old. To know whether this expression system can be implemented into other plant species that are more commonly used for recombinant protein production, the same plant expression vector was used for Agrobacterium- mediated transient transformation of tobacco leaves (Fig. 4). Transformed leaves were exposed to a 3kJ / m2IIV-C dose, which resulted in a strong GFP signal, while non-UV-C irradiated transformed leaves did not.

[0178] Figure 4: The same plant expression vector from Fig. 3 was used for tobacco leaf transient transformation. 24 hours after the infiltration of Agrobacteria containing the vector, the leaves were exposed to a 3 kJ / m2IIV-C dose. 24 hours after the IIV-C irradiation, GFP was monitored on leave discs with epifluorescence microscopy.

Claims

CLAIMS1. An isolated nucleic acid molecule comprising an inducible promoter, wherein the promoter is selected from the group consisting of:- a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or a functional fragment thereof; and- a nucleic acid comprising a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2, or a functional fragment thereof.

2. The isolated nucleic acid according to claim 1 , wherein the promoter is capable of being induced by UV-C light.

3. A chimeric gene comprising the isolated nucleic acid comprising the promoter according to claim 1 or 2.

4. The chimeric gene of claim 3, wherein said chimeric gene further comprises at least one polynucleotide of interest operably linked to the isolated nucleic acid comprising the promoter according to claim 1 or 2.

5. A recombinant vector comprising the chimeric gene of claim 4.

6. The recombinant vector of claim 4, wherein said vector is a plant expression vector.

7. A transgenic host cell comprising the chimeric gene of claim 3 or 4 or the vector of claim 5 or 6.

8. The transgenic host cell of claim 7, wherein the host cell is a plant cell.

9. A transgenic plant comprising the transgenic host cell of claim 7 or 8.

10. A transgenic seed from the transgenic plant of claim 9, wherein the seed comprises the chimeric gene according to claim 3 or 4.

11. A method for expressing a polynucleotide of interest in a transgenic host cell comprising(a) introducing the isolated nucleic acid comprising the chimeric gene of claim 3 or 4, the recombinant vector of claim 5 or 6 into a host cell, and(b) expressing at least one polynucleotide of interest in said host cell.

12. The method of claim 8, wherein said host cell is a plant cell.

13. A method for producing a plant or plant part comprising(a) introducing the isolated nucleic acid comprising the promoter according to claim 1 or 2, the chimeric gene of claim 3 or 4 or the recombinant vector of claim 5 or 6 into a plant cell; and(b) regenerating said plant cell to form a plant or plant part.

14. A method of providing IIV-C light response activity to a plant comprising(a) introducing the nucleic acid capable of being induced by IIV-C according to claim 2, the chimeric gene of claim 3 or the vector of claim 4 or 5 into a host cell of the plant, and(b) expressing a polynucleotide that encodes a plant protein in said host cell, thereby providing IIV-C light response activity in the plant, wherein said isolated nucleic acid comprising a promotor according to claims 1 or 2 is operably linked to said polynucleotide that encodes a protein so that expression of said polynucleotide is inducible by IIV-C light.

115. Use of the isolated nucleic acid comprising the promotor according to claim 1 or 2 to regulate expression of an operably linked nucleic acid in a plant.

Citation Information

Patent Citations

  • Ovule specific promoter and methods of use

    US20150121568A1

  • Pollen preferred promoters and methods of use

    WO2013103365A1

  • Somatic ovule specific promoter and methods of use

    WO2013103367A1

  • Methods and compositions for modulating expression or activity of a RKD polypeptide in a plant

    WO2013103370A1