Isothermal-based oligonucleotides for nucleic acid amplification and real-time measurement method using reporter dye and quencher probe for nucleic acid amplification detection
By combining loop-mediated isothermal nucleic acid amplification with real-time PCR using specific oligonucleotides and a reporter dye/quencher probe, the method achieves rapid and sensitive detection of nucleic acids, addressing the limitations of existing technologies.
Patent Information
- Application Number
- PCT/KR2024/009952
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-01-04
- Filing Date
- 2024-07-11
- Publication Date
- 2025-05-30
AI Technical Summary
Current nucleic acid amplification methods, such as PCR, are time-consuming and have low sensitivity, making them inadequate for rapid diagnosis in settings like airports and hospital emergency rooms.
The method involves performing loop-mediated isothermal nucleic acid amplification (LAMP) or reverse transcription-LAMP (RT-LAMP) using six specific oligonucleotides, followed by a real-time PCR secondary reaction with a reporter dye and quencher probe to enhance sensitivity and speed.
This approach allows for the amplification and detection of a single or multiplex gene with a sensitivity of 10 copies/reaction within 25 minutes, significantly improving the speed and sensitivity of nucleic acid amplification.
Smart Images

Figure KR2024009952_30052025_PF_FP_ABST
Abstract
Description
Isothermal-based oligonucleotide for nucleic acid amplification and real-time measurement method including reporter dye and quencher probe for nucleic acid amplification measurement
[0001] The present invention relates to a real-time measurement method including an isothermal-based oligonucleotide for nucleic acid amplification and a reporter dye and a quencher probe for nucleic acid amplification measurement, and more particularly, to a method for measuring amplified nucleic acids in real time by performing a loop-mediated reverse transcription-isothermal nucleic acid amplification reaction (RT-LAMP) or a loop-mediated isothermal nucleic acid amplification reaction (LAMP) using an oligonucleotide performing a primer function, and then performing real-time fluorescence monitoring using a probe to which a fluorescent dye and a quencher are attached.
[0002] Nucleic acid amplification technology is a molecular biology technique that enables nucleotide amplification for various analytical purposes, and various amplification methods have been developed. Among them, the nucleic acid amplification method using polymerase chain reaction (PCR) developed by Mullis et al. (U.S. Patent Nos. 4,683,195, 4,800,159) and Saiki et al. (Science 230, 1350-1354, 1985) denatures double-stranded DNA, and then synthesizes DNA opposite to the DNA template through annealing of an oligonucleotide primer, which is the opposite base sequence of the DNA template, and primer extension by DNA polymerase. This process is repeated to amplify the target gene.
[0003] Real-time PCR using fluorescent substances is a method for detecting nucleic acids based on the intensity of fluorescence generated during the PCR process. A reporter dye is attached to the 5' end of an oligonucleotide with a complementary sequence corresponding to the middle position of the PCR reaction product, and a single-stranded probe with a quencher attached to the 3' end is added, and the PCR reaction proceeds by the 5' -> 3 exonuclease activity of Taq polymerase. The single-stranded probe binds to the complementary sequence, and during the sequence extension reaction of Taq polymerase, the probe is sequentially hydrolyzed starting from the 5' end, increasing the distance between the reporter dye and the quencher, resulting in fluorescence. The fluorescence detector of the real-time PCR device measures and analyzes the intensity of fluorescence generated during the PCR reaction in real time. Since it can detect up to five different fluorescences depending on the wavelength range, simultaneous multiplexing is possible by attaching reporter dyes with different wavelengths to the 5' end of the probe and proceeding with the PCR reaction, detecting up to five targets simultaneously.
[0004] This method has high sensitivity and is widely used in molecular diagnostics such as pathogen detection and mutation detection, but it has the disadvantage of taking more than 90 minutes to obtain test results, making it difficult to obtain results quickly.
[0005] To solve these problems, various isothermal amplification methods for detecting nucleic acids (DNA, RNA) in a short time are being developed, and one of these is Loop-mediated isothermal amplification (LAMP). This is a technology (Patent. No. PCT / JP2000 / 001919) that rapidly amplifies nucleic acids at an isotherm using six specific primers and Bst I DNA polymerase with strand displacement activity. In addition to DNA targets, the reverse transcription loop-mediated isothermal amplification (RT-LAMP) technology can also be applied to identify RNA target nucleotides, which can be used to diagnose infection with RNA virus pathogens.
[0006] Real-time nucleic acid detection using RT-LAMP and LAMP reactions significantly reduces the risk of spatial contamination by measuring the amount of fluorescence generated inside the PCR reaction tube without opening the tube. In addition, since the reaction time is approximately 20 to 30 minutes, results can be obtained in a short period of time, making it a technology that can be applied to sites where rapid diagnosis is required, such as airports, ports, and hospital emergency rooms. However, it has the disadvantage of lower sensitivity compared to the PCR / RT-PCR method.
[0007] The present invention solves the above problems and was derived from the above necessity, and the purpose of the present invention is to provide a method for amplifying and detecting a single or multiplex gene with a sensitivity of 10 copies / reaction level within a total reaction time of 25 minutes.
[0008] In order to achieve the above object, the present invention provides a method for amplifying and detecting a single or multiplex gene, which comprises performing gene isothermal amplification using six kinds of oligonucleotides for nucleic acid amplification of a loop-mediated isothermal nucleic acid amplification reaction or a reverse transcription loop-mediated isothermal nucleic acid amplification reaction (LAMP or RT-LAMP), and then continuously performing a secondary reaction for measuring the amount of fluorescence emission in real time using a forward primer, a reverse primer, and a probe for real-time PCR complementary to the amplified target gene sequence.
[0009] In one embodiment of the present invention, the six oligonucleotides for nucleic acid amplification of the loop-mediated isothermal nucleic acid amplification reaction (LAMP) or reverse transcription (RT)-LAMP reaction are selected from the group consisting of SEQ ID NOs: 1 to 6; SEQ ID NOs: 7 to 12; SEQ ID NOs: 13 to 18; and SEQ ID NOs: 19 to 24 in the case of the SARS coronavirus gene.
[0010] In the case of a gene of Chlamydia trachomatis, it is selected from the group consisting of SEQ ID NOs: 32 to 37; SEQ ID NOs: 38 to 43; SEQ ID NOs: 44 to 49; and SEQ ID NOs: 50 to 55.
[0011] For the influenza virus A gene, sequence numbers 63 to 68 are selected,
[0012] For the influenza virus B gene, sequence numbers 69 to 74 are selected,
[0013] In the case of respiratory syncytial virus (RSV) genes, sequence numbers 75 to 80 are selected,
[0014] In the case of the MS2 Phage virus gene, it is preferable to select sequence numbers 81 to 86, but is not limited thereto.
[0015] More preferably, the six oligonucleotides are oligonucleotides described in SEQ ID NOs: 1 to 6 in the case of the SARS coronavirus gene,
[0016] In the case of the gene of Chlamydia trachomatis, it is an oligonucleotide described in SEQ ID NO: 32 to 37,
[0017] In the case of the influenza virus A gene, it is an oligonucleotide described in sequence numbers 63 to 68,
[0018] In the case of the influenza virus B gene, it is an oligonucleotide described in sequence numbers 69 to 74,
[0019] In the case of respiratory syncytial virus (RSV) genes, it is an oligonucleotide described in sequence numbers 75 to 80,
[0020] In the case of the MS2 Phage virus gene, it is preferable to use an oligonucleotide described in sequence numbers 81 to 86, but is not limited thereto.
[0021] In one embodiment of the present invention, the six oligonucleotides of each target gene for nucleic acid amplification of loop-mediated reverse transcription isothermal nucleic acid amplification reaction (RT)-LAMP using multiplex genes are preferably, but not limited to, oligonucleotides set forth in SEQ ID NOs: 1 to 6 for the SARS coronavirus gene, oligonucleotides set forth in SEQ ID NOs: 63 to 68 for the influenza virus A gene, oligonucleotides set forth in SEQ ID NOs: 69 to 74 for the influenza virus B gene, oligonucleotides set forth in SEQ ID NOs: 75 to 80 for the respiratory syncytial virus (RSV) gene, and oligonucleotides set forth in SEQ ID NOs: 81 to 86 for the MS2 Phage virus gene.
[0022] In another embodiment of the present invention, for the detection of the loop-mediated (reverse transcription) isothermal nucleic acid amplification reaction of the single or multiplex gene, in the case of the SARS coronavirus gene, the forward primer is a primer described in SEQ ID NO: 29, the reverse primer is a primer described in SEQ ID NO: 30, and the probe is a probe described in SEQ ID NO: 25 to 26 or SEQ ID NO: 31.
[0023] In the case of the gene of Chlamydia trachomatis, the forward primer is the primer described in SEQ ID NO: 60, the reverse primer is the primer described in SEQ ID NO: 61, and the probe is the probe described in SEQ ID NO: 56 to 57 or SEQ ID NO: 62.
[0024] For the influenza virus A gene, the forward primer is the primer described in SEQ ID NO: 87, the reverse primer is the primer described in SEQ ID NO: 88, and the probe is the probe described in SEQ ID NO: 89.
[0025] For the influenza virus B gene, the forward primer is the primer described in SEQ ID NO: 90, the reverse primer is the primer described in SEQ ID NO: 91, and the probe is the probe described in SEQ ID NO: 92.
[0026] For the respiratory syncytial virus (RSV) gene, the forward primer is the primer described in SEQ ID NO: 93, the reverse primer is the primer described in SEQ ID NO: 94, and the probe is the probe described in SEQ ID NO: 95.
[0027] In the case of the MS2 Phage virus gene, the forward primer is the primer described in SEQ ID NO: 96, the reverse primer is the primer described in SEQ ID NO: 97, and the probe is preferably, but not limited to, the probe described in SEQ ID NO: 98.
[0028] In another embodiment of the present invention, the fluorescent dye used for measuring the amplified nucleic acid is preferably one or more of FAM, TET, HEX, TAMRA, ROX, TEXAS RED, CY3, CY5, SFC-V, SFC647, SFC610, and CY5.5, but is not limited thereto.
[0029] In one embodiment of the present invention, the method preferably comprises performing a loop-mediated isothermal nucleic acid amplification reaction or a reverse transcription loop-mediated isothermal nucleic acid amplification reaction at 62°C for 1 minute each 16 times, then performing a real-time PCR reaction at 95°C for 1 minute, 95°C for 10 seconds, and 62°C for 10 seconds, and then repeating fluorescence measurement. It is more preferable to repeat this process 5 times, but the present invention is not limited thereto.
[0030] In addition, the present invention provides a composition for gene amplification and detection comprising, as active ingredients, six kinds of oligonucleotides for single or multiplex gene amplification and detection in loop-mediated isothermal nucleic acid amplification reaction or reverse transcription loop-mediated isothermal nucleic acid amplification reaction (LAMP or RT-LAMP), a forward primer for real-time PCR, a reverse primer, and a probe including a fluorescent dye.
[0031] In one embodiment of the present invention, the six oligonucleotides for single or multiplex gene amplification and detection of the loop-mediated isothermal nucleic acid amplification reaction (LAMP) or reverse transcription (RT)-LAMP reaction are selected from the group consisting of SEQ ID NOs: 1 to 6; SEQ ID NOs: 7 to 12; SEQ ID NOs: 13 to 18; and SEQ ID NOs: 19 to 24 in the case of the SARS coronavirus gene.
[0032] In the case of the gene of Chlamydia trachomatis, it is preferably selected from the group consisting of SEQ ID NOs: 32 to 37; SEQ ID NOs: 38 to 43; SEQ ID NOs: 44 to 49; and SEQ ID NOs: 50 to 55.
[0033] More preferably, the six oligonucleotides are oligonucleotides described in SEQ ID NOs: 1 to 6 in the case of the SARS coronavirus gene,
[0034] In the case of the gene of Chlamydia trachomatis, it is preferably an oligonucleotide described in SEQ ID NO: 32 to 37, but is not limited thereto.
[0035] In the case of the influenza virus A gene, it is preferably an oligonucleotide described in SEQ ID NOs: 63 to 68, in the case of the influenza virus B gene, it is preferably an oligonucleotide described in SEQ ID NOs: 69 to 74, in the case of the respiratory syncytial virus (RSV) gene, it is preferably an oligonucleotide described in SEQ ID NOs: 75 to 80, and in the case of the MS2 Phage virus gene, it is preferably an oligonucleotide described in SEQ ID NOs: 81 to 86, but is not limited thereto.
[0036] In another embodiment of the present invention, for the detection of a single or multiplex gene amplification reaction, in the case of the SARS coronavirus gene, the forward primer is a primer described in SEQ ID NO: 29, the reverse primer is a primer described in SEQ ID NO: 30, and the probe is a probe described in SEQ ID NO: 25 to 26 or SEQ ID NO: 31.
[0037] In the case of the gene of Chlamydia trachomatis, the forward primer is a primer described in SEQ ID NO: 60, the reverse primer is a primer described in SEQ ID NO: 61, and the probe is a probe described in SEQ ID NO: 56 to 57 or SEQ ID NO: 62.
[0038] For the influenza virus A gene, the forward primer is the primer described in SEQ ID NO: 87, the reverse primer is the primer described in SEQ ID NO: 88, and the probe is the probe described in SEQ ID NO: 89.
[0039] For the influenza virus B gene, the forward primer is the primer described in SEQ ID NO: 90, the reverse primer is the primer described in SEQ ID NO: 91, and the probe is the probe described in SEQ ID NO: 92.
[0040] For the respiratory syncytial virus (RSV) gene, the forward primer is the primer described in SEQ ID NO: 93, the reverse primer is the primer described in SEQ ID NO: 94, and the probe is the probe described in SEQ ID NO: 95.
[0041] In the case of the MS2 Phage virus gene, the forward primer is preferably a primer described in SEQ ID NO: 96, the reverse primer is preferably a primer described in SEQ ID NO: 97, and the probe is preferably a probe described in SEQ ID NO: 98, but is not limited thereto.
[0042] In another embodiment of the present invention, the fluorescent dye used for measuring the amplified nucleic acid is preferably one or more of FAM, TET, HEX, TAMRA, ROX, TEXAS RED, CY3, CY5, SFC-V, SFC647, SFC610, and CY5.5, but is not limited thereto.
[0043] In addition, the present invention comprises as active ingredients a probe including six kinds of oligonucleotides, a forward primer for real-time PCR, a reverse primer and a fluorescent dye for amplification and detection of single or multiplex genes in loop-mediated isothermal nucleic acid amplification reaction or reverse transcription loop-mediated isothermal nucleic acid amplification reaction (LAMP or RT-LAMP),
[0044] Here, six oligonucleotides for amplification and detection of single or multiplex genes of the loop-mediated isothermal nucleic acid amplification reaction (LAMP) or reverse transcription (RT)-LAMP reaction are selected from the group consisting of SEQ ID NOs: 1 to 6; SEQ ID NOs: 7 to 12; SEQ ID NOs: 13 to 18; and SEQ ID NOs: 19 to 24 in the case of the SARS coronavirus gene.
[0045] In the case of a gene of Chlamydia trachomatis, it is selected from the group consisting of SEQ ID NOs: 32 to 37; SEQ ID NOs: 38 to 43; SEQ ID NOs: 44 to 49; and SEQ ID NOs: 50 to 55; in the case of an influenza virus A gene, it is selected from the group consisting of SEQ ID NOs: 63 to 68; and in the case of an influenza virus B gene, it is selected from the group consisting of SEQ ID NOs: 69 to 74.
[0046] In the case of respiratory syncytial virus (RSV) genes, sequence numbers 75 to 80 are selected, and in the case of MS2 Phage virus genes, sequence numbers 81 to 86 are selected.
[0047] In the case of the above oligonucleotide, the forward primer is a primer described in SEQ ID NO: 29, the reverse primer is a primer described in SEQ ID NO: 30, and the probe is a probe described in SEQ ID NO: 25 to 26 or SEQ ID NO: 31,
[0048] In the case of the gene of Chlamydia trachomatis, the forward primer is a primer described in SEQ ID NO: 60, the reverse primer is a primer described in SEQ ID NO: 61, and the probe is a probe described in SEQ ID NO: 56 to 57 or SEQ ID NO: 62.
[0049] For the influenza virus A gene, the forward primer is the primer described in SEQ ID NO: 87, the reverse primer is the primer described in SEQ ID NO: 88, and the probe is the probe described in SEQ ID NO: 89.
[0050] For the influenza virus B gene, the forward primer is the primer described in SEQ ID NO: 90, the reverse primer is the primer described in SEQ ID NO: 91, and the probe is the probe described in SEQ ID NO: 92.
[0051] For the respiratory syncytial virus (RSV) gene, the forward primer is the primer described in SEQ ID NO: 93, the reverse primer is the primer described in SEQ ID NO: 94, and the probe is the probe described in SEQ ID NO: 95.
[0052] In the case of the MS2 Phage virus gene, a single or multiplex gene amplification and detection kit is provided, characterized in that the forward primer is a primer described in SEQ ID NO: 96, the reverse primer is a primer described in SEQ ID NO: 97, and the probe is a probe described in SEQ ID NO: 98.
[0053] The present invention is described below.
[0054] The present invention provides a method for amplifying and detecting a single or multiplex gene with a sensitivity of 10 copies / reaction within a total reaction time of 25 minutes by first performing gene amplification in a short period of time using six kinds of oligonucleotides for nucleic acid amplification of RT-LAMP reaction or LAMP reaction, and then continuously performing a secondary reaction of measuring the amount of fluorescence in real time using two kinds of oligonucleotides sequence-specific to the amplified target gene and a TaqMan probe (a single-stranded probe having a reporter dye attached to the 5' end of the oligonucleotide and a quencher attached to the 3' end) using a Real-Time PCR method.
[0055] Among the six oligonucleotides used in the Loop-mediated isothermal amplification (LAMP or RT-LAMP) method of the present invention, FIP (Forward Inner Primer) and RIP (Reverse Inner Primer) are designed by linking two primers (F1c and F2 or B1c and B2) for a target gene region into a single oligonucleotide, and together with F3, B3, Loop F, and Loop B primers designed to be sequence-specific for a target gene region, a method for performing a loop-mediated reverse transcription isothermal nucleic acid amplification reaction (RT-LAMP) or a loop-mediated isothermal nucleic acid amplification reaction (LAMP) is provided.
[0056] In addition, a method is provided to confirm amplification and detection of a single or multiplex gene in real time by designing oligonucleotides such as forward primer, reverse primer, and TaqMan probe specific to the target gene sequence to detect amplified genes in real time through loop-mediated reverse transcription-isothermal nucleic acid amplification (RT-LAMP) or loop-mediated isothermal nucleic acid amplification (LAMP) and performing continuous reactions using a real-time PCR method.
[0057] The oligonucleotide of the present invention comprises at least one isothermal-based oligonucleotide complementary to a specific gene sequence of a target RNA or DNA for a loop-mediated (reverse transcription) isothermal nucleic acid amplification reaction of a single or multiplex gene, and includes a forward primer, a reverse primer, and a TaqMan probe for real-time detection and measurement of the amount of amplified DNA.
[0058] The composition of the reaction mixture of the present invention includes Tris-HCl, KCl, (NH4)2SO4, MgCl2, Tween-20, dNTPs, Bovine serum albumin (BSA), Trehalose, etc., and includes Bst I DNA polymerase having 5'→3'→ activity, RNase inhibitor, reverse transcriptase such as Avian Myeloblastosis Virus (AMV) Reverse Transcriptase, Molony Murine Leukemia Virus (MMLV) Reverse Transcriptase, thermostable reverse transcriptase, and Taq polymerase having heat resistance that can stably endure thermocycling process at high temperature even when DNA denaturation process of 90℃ or higher is repeated for real-time PCR reaction, but is not limited thereto.
[0059] In addition, the present invention provides a composition for RT-LAMP or LAMP and Real-Time PCR nucleic acid amplification reaction, comprising six kinds of isothermal oligonucleotides complementary to a specific gene sequence of a target RNA or DNA of a single or multiplex gene for a loop-mediated (reverse transcription) isothermal nucleic acid amplification reaction, and a forward primer, a reverse primer, and a TaqMan probe (a single-stranded probe having a reporter dye attached to the 5' end and a quencher attached to the 3' end) for real-time detection and measurement of the amount of amplified DNA.
[0060] The present invention provides a test method for continuously performing RT-LAMP or LAMP for loop-mediated (reverse transcription) isothermal nucleic acid amplification using the oligonucleotide of the present invention and a Real-Time PCR method for real-time measurement of fluorescence values according to amplification of nucleic acids.
[0061] The present invention provides a method in which the isothermal temperature conditions of the RT-LAMP or LAMP reaction using the oligonucleotide of the present invention are in the range of 60 to 70°C, but is not limited thereto, and the present invention provides a method in which the thermocycling conditions of the real-time PCR reaction are in the range of 60 to 95°C, but is not limited thereto.
[0062] The oligonucleotide of the present invention provides an oligonucleotide characterized by a temperature of 60 to 95°C at which it unwinds from a double strand to a single strand, but is not limited thereto.
[0063] The present invention provides sequences of SEQ ID NOS: 1 to 24 for oligonucleotides specific for SARS-Corona Virus-2 used as primers in the RT-LAMP reaction of a single or multiplex gene, SEQ ID NOS: 63 to 68 for oligonucleotides specific for Influenza A virus, SEQ ID NOS: 69 to 74 for oligonucleotides specific for Influenza B virus, SEQ ID NOS: 75 to 80 for oligonucleotides specific for Respiratory Syncytial Virus (RSV) genes, SEQ ID NOS: 81 to 86 for oligonucleotides specific for MS2 Phage virus genes, and SEQ ID NOS: 32 to 55 for oligonucleotides specific for Chlamydia trachomatis used as primers in the LAMP reaction.
[0064] The present invention provides two types of oligonucleotides (SEQ ID NOs: 25 and 27) having a reporter dye attached to the 5' end and two types of oligonucleotides (SEQ ID NOs: 26 and 28) having a quencher attached to the 3' end, which are characterized by being used together for fluorescence measurement in the RT-LAMP reaction of the present invention, and two types of oligonucleotides (SEQ ID NOs: 56 and 58) having a reporter dye attached to the 5' end and two types of oligonucleotides (SEQ ID NOs: 57 and 59) having a quencher attached to the 3' end, which are characterized by being used together for fluorescence measurement in the LAMP reaction.
[0065] The present invention provides an oligonucleotide for SARS coronavirus of SEQ ID NOs. 29 to 31, an oligonucleotide for Chlamydia trachomatis of SEQ ID NOs. 60 to 62, an oligonucleotide for influenza virus A of SEQ ID NOs. 87 to 89, an oligonucleotide for influenza virus B of SEQ ID NOs. 90 to 92, an oligonucleotide for respiratory syncytial virus of SEQ ID NOs. 93 to 95, and an oligonucleotide for MS2 phage of SEQ ID NOs. 96 to 98, characterized in that the oligonucleotides and TaqMan Probes (Probes having a reporter dye attached to the 5' end and a quencher attached to the 3' end) used as primers in the real-time PCR reaction are used individually or together.
[0066] The reporter dye of the oligonucleotide of the present invention provides an oligonucleotide including, but not limited to, FAM, TET, HEX, TAMRA, ROX, TEXAS RED, CY3, CY5, SFC647, SFC610, CY5.5 and other dyes having an emission wavelength of 450 to 685 nm.
[0067] The quencher of the oligonucleotide of the present invention provides, but is not limited to, TAMRA, DABCYL, Black Hole Quencher 1, Hole Quencher 2, SFCQ1, SFCQ3 and other oligonucleotides having an absorption wavelength range of 500 to 705 nm.
[0068] The present invention relates to a method for amplifying and detecting a single or multiplex gene with a sensitivity of 10 copies / reaction within a total reaction time of 25 minutes by continuously performing a secondary reaction in which the amount of fluorescence is measured in real time using a Real-Time PCR method using sequence-specific primers and a Taqman probe (a single-stranded probe in which a reporter dye is attached to the 5' end of the oligonucleotide and a quencher is attached to the 3' end) of the amplified target gene after a short period of time using six types of oligonucleotides, thereby achieving a sensitivity of 10 copies / reaction within a total reaction time of 25 minutes.
[0069] Figures 1 and 2 are the results of a performance comparison test of a total of 24 oligonucleotides specifically designed for the SARS Corona virus-2 gene sequence and a total of 24 oligonucleotides specifically designed for the Chlamydia Trachomatis gene sequence for the loop-mediated (reverse transcription) isothermal nucleic acid amplification reaction (RT-LAMP or LAMP) of the present invention, respectively, to select 6 oligonucleotides that show the optimal results for each target gene.
[0070] Figures 3 and 4 show the results of testing the fluorescence detection performance of the RT-LAMP or LAMP reaction by adding an oligonucleotide having a reporter dye attached to the 5' end and an oligonucleotide having a quencher attached to the 3' end, which were designed to be sequence complementary to the oligonucleotide that showed the optimal result in the loop-mediated (reverse transcription) isothermal nucleic acid amplification reaction (LAMP or RT-LAMP) of the present invention.
[0071] Figure 5 shows the results of a comparative test of performance according to the concentration of RTase used in RNA reverse transcription reaction and Bst I polymerase used in isothermal amplification reaction for optimization of the RT-LAMP reaction of the present invention.
[0072] Figures 6 and 7 are the performance test results of a forward primer, reverse primer, and TaqMan probe specific to the final product gene sequence of the RT-LAMP reaction of SARS-CoV-2 and the final product gene sequence of the LAMP reaction of Chlamydia Trachomatis, respectively, for the real-time polymerase chain reaction (Real-Time PCR) of the present invention.
[0073] Figure 8 is a test result to confirm whether the addition of Taq polymerase to the buffer composition for RT-LAMP reaction and oligonucleotide for continuous progress of RT-LAMP or LAMP reaction and Real-Time PCR reaction of the present invention affects the amplification result of the RT-LAMP reaction.
[0074] Figure 9 shows the results of a comparative test of performance when Taq polymerase was added at different concentrations using a buffer composition for RT-LAMP reaction and oligonucleotides and a forward primer, reverse primer, and TaqMan Probe for detecting Real-Time PCR fluorescence for continuous progress of RT-LAMP or LAMP reaction and Real-Time PCR reaction of the present invention.
[0075] Figures 10 and 11 show the results of testing protocol optimization within 25 minutes by changing the number of cycles of the isothermal amplification process or PCR amplification process for continuous progress of RT-LAMP or LAMP and Real-Time PCR of the present invention.
[0076] Figures 12 and 13 are the results of confirming the analytical sensitivity (Limit of Detection) values of SARS coronavirus or Chlamydia trachomatis genes when tested with the RT-LAMP protocol using the final buffer composition and oligonucleotide of the RT-LAMP or LAMP reaction of the present invention, respectively.
[0077] Figures 14 and 15 are the results of confirming the analytical sensitivity (Limit of Detection) values of SARS coronavirus or Chlamydia trachomatis genes when tested with a Real-Time PCR protocol using the final buffer composition and oligonucleotide of the Real-Time PCR reaction of the present invention, respectively.
[0078] Figures 16 and 17 show the results of confirming the analytical sensitivity (Limit of Detection) value of the SARS coronavirus or Chlamydia trachomatis gene when tested with a Real-Time PCR continuous protocol after RT-LAMP reaction using the final buffer composition and oligonucleotides of the RT-LAMP or LAMP and Real-Time PCR continuous reaction of the present invention.
[0079] Figures 18 to 22 show the final buffer composition of the RT-LAMP and Real-time PCR continuous reaction of the present invention and the results of confirming the single gene amplification and detection performance when tested with the Real-Time PCR continuous progress protocol after the RT-LAMP reaction using 6 types of oligonucleotides and Forward primer, Reverse primer, and TaqMan Probe specific to each gene of influenza virus A or influenza virus B or SARS coronavirus or respiratory syncytial virus or MS2 phage virus.
[0080] Figures 23 to 25 show the results of confirming the multiplex gene amplification and detection performance when tested with a Real-Time PCR continuous progress protocol after RT-LAMP reaction using the final buffer composition of the RT-LAMP and Real-time PCR continuous reaction of the present invention and all six types of oligonucleotides and forward primers, reverse primers, and TaqMan Probes specific to each gene of influenza virus A, influenza virus B, SARS coronavirus, respiratory syncytial virus, and MS2 phage virus.
[0081] Hereinafter, the present invention will be described in detail through examples. However, the following examples are provided solely to illustrate the present invention, and the content of the present invention is not limited by the following examples.
[0082] Example 1: Performance test of a total of 28 oligonucleotides specifically designed for the SARS Corona virus-2 gene sequence and a total of 28 oligonucleotides specifically designed for the Chlamydia Trachomatis gene sequence for the loop-mediated (reverse transcription) isothermal nucleic acid amplification reaction (LAMP or RT-LAMP) of the invention, and performance comparison test of buffer compositions according to enzyme concentration
[0083] In order to proceed with the loop-mediated (reverse transcription) isothermal nucleic acid amplification reaction (LAMP or RT-LAMP) of the present invention, LAMP test primers were designed using the LAMP Designer v1.16 program for the SARS-Corona Virsu-2 RdRp Gene target gene sequence and the Chlamydia Trachomatis OmpA Gene target gene sequence. The primers designed for SARS-Corona Virsu-2 are a total of 4 sets of oligonucleotides, mCR-1 (SEQ ID NOs: 1-6), mCR-2 (SEQ ID NOs: 7-12), mCR-3 (SEQ ID NOs: 13-18), and mCR-4 (SEQ ID NOs: 19-24).
[0084] The primers designed for Chlamydia trachomatis are mCHT-1 (SEQ ID NO: 32-37), mCHT-2 (SEQ ID NO: 38-43), mCHT-3 (SEQ ID NO: 44-49), and mCHT-4 (SEQ ID NO: 50-55), a total of four sets of oligonucleotides, and performance tests were performed on each of them. The six sequences of each set are listed in the following order: 1-F3 primer, 2-B3 primer, 3-FIP primer, 4-BIP primer, 5-Loop F primer, and 6-Loop B primer.
[0085] The isothermal nucleic acid amplification reaction for the oligonucleotides of the above RT-LAMP or LAMP used a buffer composition of 50 mM Tris-HCl (pH 9.0), 50 mM KCl, 5 mM MgCl2, 20 mM (NH4)2SO4, 0.1% Tween-20, 2.5 mM dNTP, 180 mM Trehalose, 100 ng BSA, 3.5 μg Bst I polymerase (Elpis Biotech, Korea), 0.2 μg RTase (Elpis Biotech, Korea), and 0.5 ng RNase Inhibitor (Elpis Biotech, Korea).
[0086] Here, 4 sets of 6 types of oligonucleotides each of mCR-1, mCR-2, mCR-3, mCR-4 or mCHT-1, mCHT-2, mCHT-3, mCHT-4 were added at a concentration of 10 pmoles / reaction and a performance test was conducted. For fluorescence detection of loop-mediated (reverse transcription) isothermal nucleic acid amplification reaction (RT-LAMP or LAMP), Cybergreen dye (SyBr) was added to the final 1X and used, and fluorescence was measured at 1-minute intervals for a total of 30 minutes at 62℃ using a CFX-96 (Bio-Rad, CA, USA) real-time fluorescence measurement device. For loop-mediated (reverse transcription) isothermal nucleic acid amplification reaction, SARS-Cov-2 standard sample stock (ZeptoMetrix, USA) or Chlamydia Trachomatis standard sample (AACC, USA) was used as a control gene and the test was conducted by diluting to a final reaction concentration of 1000 copies / reaction.
[0087] Figure 1 shows the test results for each set in which 6 sequences of mCR-1 (SEQ ID NOs: 1-6), mCR-2 (SEQ ID NOs: 7-12), mCR-3 (SEQ ID NOs: 13-18), and mCR-4 (SEQ ID NOs: 19-24) were mixed at 10 pmoles / reaction, and Figure 2 shows the test results for each set in which 6 sequences of oligonucleotides of mCHT-1 (SEQ ID NOs: 32-37), mCHT-2 (SEQ ID NOs: 38-43), mCHT-3 (SEQ ID NOs: 44-49), and mCHT-4 (SEQ ID NOs: 50-55) were mixed at 10 pmoles / reaction.
[0088] In the amplification curve of the SARS coronavirus gene in Fig. 1, among the four oligonucleotide sets, the results of mCR-1 (SEQ ID NOs. 1-6) and mCR-2 (SEQ ID NOs. 7-12) showed the highest superiority, and in the amplification curve of the Chlamydia trachomatis gene in Fig. 2, among the four oligonucleotide sets, the results of mCHT-1 (SEQ ID NOs. 32-37) and mCHT-2 (SEQ ID NOs. 38-43) showed the highest superiority in the numerical values of the amplification measurement time (Cycle) and the fluorescence amplification amount (Rn). Cybergreen dye (SyBr) was used for fluorescence measurement, which is one of the dyes that attaches between the two amplified strands of genes and fluoresces, but is not a substance that reacts sequence-specifically.
[0089] Figure 3 shows the results of testing the fluorescence detection performance of the RT-LAMP reaction by adding oligonucleotides having a reporter dye attached to the 5' end and an oligonucleotide having a quencher attached to the 3' end, designed to be complementary to the sequences of mCR-1 (SEQ ID NOs: 1-6) and mCR-2 (SEQ ID NOs: 7-12). Figure 4 shows the results of testing the fluorescence detection performance of the LAMP reaction by adding oligonucleotides having a reporter dye attached to the 5' end and an oligonucleotide having a quencher attached to the 3' end, designed to be complementary to the sequences of mCHT-1 (SEQ ID NOs: 32-37) and mCHT-2 (SEQ ID NOs: 38-43). Finally, mCR-1 (SEQ ID NOs: 1-6) and SEQ ID NOs: 25-26; The results using a mixture of oligonucleotides of mCHT-1 (SEQ ID NO: 32-37) and SEQ ID NO: 56-57 were the best.
[0090] Figure 5 shows the results of a performance test conducted by widening the concentration range of Bst I polymerase and RTase enzymes, which are mainly used in isothermal nucleic acid amplification, to increase the efficiency of loop-mediated (reverse transcription) isothermal nucleic acid amplification reaction using the final selected RT-LAMP and LAMP oligonucleotides and a mixture of oligonucleotides with reporter dyes attached to the 5' end and oligonucleotides with quenchers attached to the 3' end. The buffer composition and oligonucleotide concentration were the same, and among the added enzymes, RTase was cross-tested in the range of 0.2 to 0.4 μg / reaction and Bst I polymerase was 3 to 5 μg.
[0091] Among the amplification curve results in Fig. 5, the red curve showed the most optimal performance. This is the result of using RTase at a concentration of 0.4 μg and Bst I polymerase at a concentration of 5.0 μg, and the same enzyme concentration was applied in subsequent tests.
[0092] Example 2: Performance test of forward primer, reverse primer, and TaqMan probe specifically designed for SARS Corona virus-2 gene sequence or Chlamydia Trachomatis gene sequence for real-time polymerase chain reaction (Real-Time PCR) of the invention
[0093] In order to proceed with the real-time polymerase chain reaction (Real-Time PCR) of the present invention, forward primer, reverse primer, and TaqMan Probe were designed for the target gene sequence of the SARS-Corona Virsu-2 RdRp Gene and the target gene sequence of the Chlamydia Trachomatis OmpA Gene, respectively. For the SARS-Corona Virsu-2, the design was carried out within the gene sequence synthesized through a loop-mediated isothermal amplification reaction using a mixture of oligonucleotides having sequence numbers 1-6, and for the Chlamydia trachomatis, the design was carried out within the gene sequence synthesized through a loop-mediated isothermal amplification reaction using a mixture of oligonucleotides having sequence numbers 32-37. The design qPCR assay service provided on the IDT website was used, and the designed sequences are described as SARS coronavirus forward primer sequence number 29, reverse primer sequence number 30, and TaqMan probe sequence number 31, and the probe has FAM attached to the 5' end and SFCQ1 attached to the 3' end, respectively. Chlamydia trachomatis forward primer sequence number 60, reverse primer sequence number 61, and TaqMan probe sequence number 62, and the probe has SFC-V attached to the 5' end and SFCQ1 attached to the 3' end, respectively.
[0094] The real-time nucleic acid amplification reaction for the above Real-Time PCR oligonucleotides was performed using a buffer composition of 60 mM Tris-HCl (pH 9.0), 10 mM KCl, 3 mM MgCl2, 25 mM (NH4)2SO4, 0.1% Tween-20, 1.5 mM dNTP, 100 mM Trehalose, 60 ng BSA, 5 U anti-Taq polymerase (Elpis Biotech, Korea), 4 U RTase (Elpis Biotech, Korea), and 5 U RNase Inhibitor (Elpis Biotech, Korea). The performance test was performed by adding oligonucleotides of SARS coronavirus sequence numbers 29 to 31 and Chlamydia trachomatis sequence numbers 60 to 62 at a concentration of 10 pmoles / reaction, respectively.
[0095] The temperature conditions of the test were 50℃ for 15 minutes, 95℃ for 5 minutes, then 95℃ for 20 seconds, 62℃ for 30 seconds, and then fluorescence measurement once, repeated 45 times in total, for a reaction time of approximately 70 minutes. The fluorescence value was measured using a real-time fluorescence measurement device (CFX-96) and the SARS-Cov-2 standard sample stock (ZeptoMetrix, USA) and Chlamydia Trachomatis standard sample (ATCC, USA) used in the isothermal amplification test were used, respectively. The final reaction concentration of SARS-Cov-2 was 10 to 10 million copies / reaction and the final reaction concentration of Chlamydia Trachomatis was 10 to 100 million copies / reaction, and the performance test was conducted at each concentration.
[0096] Figures 6 and 7 are graphs showing the results of testing the performance at each concentration by diluting the SARS-Cov-2 standard sample (ZeptoMetrix, USA) or Chlamydia Trachomatis standard sample (AACC, USA) stock material by 1 / 10 times using 1X TE buffer, and the results of gene amplification at the highest concentration are listed from the front. Normal amplification was confirmed at regular intervals without loss of fluorescence value up to the last 10 copies / reaction concentration according to each dilution ratio, and oligonucleotides of SARS coronavirus sequence numbers 29-31 and Chlamydia trachomatis sequence numbers 60-62 were finally selected and used for subsequent experiments.
[0097] Example 3: Optimization test of buffer composition using a mixture of selected oligonucleotides from each reaction for continuous progress of loop-mediated (reverse transcription) isothermal nucleic acid amplification reaction (RT-LAMP or LAMP) and real-time gene amplification reaction (Real-Time PCR) of the invention.
[0098] The RT-LAMP reaction test results were confirmed using the optimized 50 mM Tris-HCl (pH 9.0), 50 mM KCl, 5 mM MgCl2, 20 mM (NH4)2SO4, 0.1% Tween-20, 2.5 mM dNTP, 180 mM Trehalose, 100 ng BSA, 5.0 μg Bst DNA polymerase (Elpis Biotech, Korea), 0.4 μg RTase (Elpis Biotech, Korea), 0.5 ng RNase Inhibitor (Elpis Biotech, Korea) buffer composition for the above RT-LAMP oligonucleotide as a reference, and the same composition with 5 U anti-Taq polymerase, which is essential for the Real-Time PCR reaction, added as a control group. Oligonucleotide sequence numbers 1-6 and 25-26 were added at a concentration of 10 pmoles / reaction, respectively, and fluorescence was measured at 1-minute intervals for a total of 30 minutes at 62°C using a CFX-96 (Bio-Rad, CA, USA) real-time fluorescence measurement device. The gene for the loop-mediated isothermal amplification reaction test was used as a SARS-Cov-2 standard sample (ZeptoMetrix, USA), and comparative tests were performed at two concentrations: 100 copies / reaction and 1000 copies / reaction.
[0099] The green amplification curve in Figure 8 represents the results obtained using the optimal composition for the RT-LAMP reaction, while the yellow amplification curve represents the test results for a composition in which anti-Taq polymerase was added to the RT-LAMP reaction composition. Similar levels of amplification results were observed in both compositions without any inhibition of the RT-LAMP reaction results due to the addition of anti-Taq polymerase.
[0100] Figure 9 shows a test in which oligonucleotides for SARS coronavirus LAMP reaction (SEQ ID NOs: 1 to 6) and oligonucleotides for Real-Time PCR (SEQ ID NOs: 29 to 31) were added at a concentration of 10 pmoles / reaction to each buffer composition containing 4U, 5U, and 6U anti-Taq polymerase to determine whether a method of continuously performing Real-Time PCR after RT-LAMP reaction and measuring fluorescence is feasible.
[0101] Using a CFX-96 (Bio-Rad, CA, USA) real-time fluorescence measurement device, RT-LAMP reaction was performed at 62°C for a total of 20 minutes in 1-minute increments, followed by Bst I polymerase inactivation at 95°C for 1 minute, followed by fluorescence measurement at 95°C for 20 seconds and 62°C for 30 seconds. This process was repeated 10 times in total and the results were confirmed. Real-Time PCR reaction was performed continuously after RT-LAMP reaction using a SARS-Cov2 standard sample (ZeptoMetrix, USA) diluted to a concentration of 100 copies / reaction. Through this, it was confirmed that the method of measuring gene amplification and fluorescence value was continuous, and the optimal result was confirmed in the composition in which anti-Taq Polymerase was added at a concentration of 5U, as shown in the green curve result in Fig. 9.
[0102] Example 4: Optimization test for temperature and time conditions of each reaction for continuous progress of loop-mediated (reverse transcription) isothermal nucleic acid amplification reaction (RT-LAMP or LAMP) and real-time polymerase chain reaction (Real-Time PCR) of the invention.
[0103] In order to perform the continuous process of the loop-mediated (reverse transcription) isothermal nucleic acid amplification reaction (RT-LAMP or LAMP) and real-time gene amplification reaction (Real-Time PCR) of the present invention within a total of 25 minutes, an optimization test was conducted by variously adjusting conditions such as the reaction time of the RT-LAMP or LAMP reaction, the reaction time of the Real-Time PCR performed continuously thereto, and the number of cycle repetitions.
[0104] 50mM Tris-HCl (pH9.0), 50mM KCl, 5mM MgCl2, 20mM (NH4)2SO4, 0.1% Tween-20, 2.5mM dNTP, 180mM Trehalose, 100ng BSA, 5.0μg, Bst I polymerase (Elpis Biotech, Korea), 0.4μg A buffer composition of RTase (Elpis Biotech, Korea), 0.5ng RNase Inhibitor (Elpis Biotech, Korea), and 5U anti-Taq polymerase (Elpis Biotech, Korea) was used. At this time, the oligonucleotides for SARS coronavirus were used by adding sequence numbers 1-6 and 29-31 at a concentration of 10 pmoles / reaction, and the oligonucleotides for Chlamydia trachomatis were added sequence numbers 32-37 and 60-62 at a concentration of 10 pmoles / reaction. The genes for the test used were SARS-Cov-2 standard sample stock (ZeptoMetrix, USA) or Chlamydia Trachomatis standard sample (AACC, USA), and the final reaction concentration was 100 copies / reaction. After the RT-LAMP reaction, a real-time PCR reaction was performed continuously to measure the fluorescence value, and a CFX-96 (Bio-Rad, CA, USA) real-time fluorescence measurement device was used.
[0105] Figure 10 shows the results of a test condition in which the RT-LAMP reaction was repeated 16 times for 1 minute each at 62°C, followed by 1 minute at 95°C, followed by a real-time PCR reaction at 95°C for 10 seconds, 62°C for 10 seconds, and then fluorescence measurement, for a total of 5 repetitions. When the test was conducted using this method, the total reaction time was within 25 minutes, and when real-time PCR was performed after the RT-LAMP reaction using the SARS coronavirus gene, the gene amplification results at a concentration of 100 copies / reaction were all confirmed to be valid.
[0106] Figure 11 shows the results of a test condition in which a LAMP reaction was repeated 16 times for 1 minute each at 62°C, followed by a real-time PCR reaction at 95°C for 10 seconds, 62°C for 10 seconds, and then fluorescence measurement, for a total of 5 repetitions. When the test was conducted using this method, the total reaction time was within 25 minutes, and when real-time PCR was performed after the LAMP reaction using the Chlamydia trachomatis gene, the gene amplification results at a concentration of 100 copies / reaction were all confirmed to be valid.
[0107] The RT-LAMP and LAMP conditions, which were 30 reactions at 62℃ for 1 minute each, were tested by reducing the conditions to 62℃, 1 minute, 25 times, 20 times, 15 times, and 10 times. The Real-Time PCR conditions were also tested in various temperature and time ranges, such as 95℃ for 1 minute, 95℃ for 5 to 20 seconds, and 62℃ for 5 to 30 seconds, followed by fluorescence measurement for a total of 5 to 20 times. Through this, the test conditions that showed the optimal results within 25 minutes were finally confirmed.
[0108] Example 5: Final sensitivity testing of individual and sequential reactions for the loop-mediated (reverse transcription) isothermal nucleic acid amplification reaction (RT-LAMP or LAMP) and real-time gene amplification reaction (Real-Time PCR) of the invention.
[0109] The buffer composition of the loop-mediated (reverse transcription) isothermal nucleic acid amplification reaction (RT-LAMP or LAMP) and real-time gene amplification reaction (Real-Time PCR) of the present invention was 50 mM Tris-HCl (pH9.0), 50 mM KCl, 5 mM MgCl2, 20 mM (NH4)2SO4, 0.1% Tween-20, 2.5 mM dNTP, 180 mM Trehalose, 100 ng BSA, 5.0 μg, Bst I polymerase (Elpis Biotech, Korea), 0.4 μg RTase (Elpis Biotech, Korea), 0.5 ng RNase Inhibitor (Elpis Biotech, Korea), and 5 U anti-Taq polymerase (Elpis Biotech, Korea). Oligonucleotides sequence numbers 1-6, 29-31 selected for SARS coronavirus or oligonucleotides sequence numbers 32-37, 60-62 selected for Chlamydia trachomatis were added at 10 pmoles / reaction, and the RT-LAMP reaction was performed at 62°C for 1 minute each for 16 cycles. Then, the Real-Time PCR reaction was performed at 95°C for 1 minute, 95°C for 10 seconds, and 62°C for 10 seconds, followed by fluorescence measurement, which was repeated 5 times in total. The final conditions were applied to confirm that the detection limit was 10 copies / reaction within the total reaction time of 25 minutes. The genes for the test were SARS-Cov-2 standard sample stock (ZeptoMetrix, USA) or Chlamydia Trachomatis standard sample (AACC, USA), and the final reaction concentrations were 10, 50, and 100 copies / reaction, respectively, and the tests were repeated 24 times for each concentration, and the results were analyzed using a CFX-96 (Bio-Rad, CA, USA) real-time fluorescence measurement device.
[0110] The detection sensitivity of the case in which only the RT-LAMP reaction was performed using the SARS coronavirus gene (using sequence numbers 1 to 6, 25 to 26) and the detection sensitivity of the case in which only the Real-Time PCR reaction was performed (using sequence numbers 29 to 31) were tested, and compared with the detection sensitivity of the case in which RT-LAMP and Real-Time PCR reactions were performed continuously (using sequence numbers 1 to 6, 29 to 31).
[0111] The detection sensitivity of the case in which only the LAMP reaction was performed using the Chlamydia trachomatis gene (using SEQ ID NOs. 32-37, 56-57) and the detection sensitivity of the case in which only the Real-Time PCR reaction was performed (using SEQ ID NOs. 60-62) were tested and compared with the detection sensitivity of the case in which LAMP and Real-Time PCR reactions were performed continuously (using SEQ ID NOs. 32-37, 60-62).
[0112] Figure 12 shows the detection sensitivity results of a test that performed RT-LAMP reaction (62℃, 20 times for 1 minute each, fluorescence measurement after each 1-minute test). The graph on the left is a Negative Control with only DW added without adding a gene, which means that no unintended abnormal amplification occurred. The graph on the right shows the fluorescence detection results according to the concentration of the added gene, with green indicating 100 copies / reaction, blue indicating 50 copies / reaction, and yellow indicating 10 copies / reaction. In the case of SARS coronavirus, it was confirmed that some of the 10 copies / reaction genes were not amplified, and the final detection limit that could be amplified by 100% was confirmed to be 50 copies / reaction.
[0113] Figure 13 shows the detection sensitivity results of a test in which a LAMP reaction (62℃, 20 times for 1 minute each, fluorescence measurement for each 1-minute test) was performed. The graph on the left is a Negative Control in which only DW was added without adding a gene, which means that no unintended abnormal amplification occurred. The graph on the right shows the fluorescence detection results according to the concentration of the added gene, with green indicating 100 copies / reaction, blue indicating 50 copies / reaction, and yellow indicating 10 copies / reaction. In the case of Chlamydia trachomatis, it was confirmed that some of the 10 copies / reaction genes were not amplified, and the final detection limit for 100% amplification was confirmed to be 50 copies / reaction.
[0114] Figure 14 is the detection sensitivity result of a test in which a real-time PCR reaction was performed (50℃ for 15 minutes, 95℃ for 5 minutes, then 95℃ for 20 seconds, 62℃ for 30 seconds, and then fluorescence was measured once, a total of 45 times). The graph on the left is a negative control in which only DW was added without adding a gene, which means that no unintended abnormal amplification occurred. The graph on the right is the fluorescence detection result according to the concentration of the added gene, with green representing 100 copies / reaction, blue representing 50 copies / reaction, and yellow representing 10 copies / reaction. In the case of SARS-CoV-2, the final detection limit that could amplify 100% was confirmed to be 10 copies / reaction.
[0115] Figure 15 shows the detection sensitivity results of a test in which a Real-Time PCR reaction was performed (50℃ for 15 minutes, 95℃ for 5 minutes, then 95℃ for 20 seconds, 62℃ for 30 seconds, and then fluorescence was measured once, a total of 45 times). The graph on the left is a Negative Control in which only DW was added without adding a gene, indicating that no unintended abnormal amplification occurred. The graph on the right is the fluorescence detection result according to the concentration of the added gene, with green representing 100 copies / reaction, blue representing 50 copies / reaction, and yellow representing 10 copies / reaction. In the case of Chlamydia trachomatis, the final detection limit for 100% amplification was confirmed to be 10 copies / reaction.
[0116] Figure 16 shows the detection sensitivity results of the final condition test, which repeats the process of performing RT-LAMP reaction 16 times for 1 minute each at 62℃, Real-Time PCR reaction at 95℃ for 1 minute, 95℃ for 10 seconds, and 62℃ for 10 seconds, and then measuring fluorescence a total of 5 times. The graph on the left is the Negative Control where only DW was added without adding the gene, which means that no unintended abnormal amplification occurred. The graph on the right is the fluorescence detection result according to the concentration of the added gene, with green representing 100 copies / reaction, blue representing 50 copies / reaction, and yellow representing 10 copies / reaction. In the case of SARS-CoV-2, the final detection limit that can amplify 100% was confirmed to be 10 copies / reaction.
[0117] Figure 17 shows the detection sensitivity results of the final condition test, which repeats the process of performing the LAMP reaction at 62℃ for 1 minute each 16 times, the Real-Time PCR reaction at 95℃ for 1 minute, 95℃ for 10 seconds, and 62℃ for 10 seconds, and then measuring fluorescence a total of 5 times. The graph on the left is the Negative Control where only DW was added without adding the gene, which means that no unintended abnormal amplification occurred. The graph on the right is the fluorescence detection result according to the concentration of the added gene, with green representing 100 copies / reaction, blue representing 50 copies / reaction, and yellow representing 10 copies / reaction. In the case of Chlamydia trachomatis, the final detection limit that can amplify 100% was confirmed to be 10 copies / reaction.
[0118] Example 6: Performance testing of continuous reactions for loop-mediated reverse transcription isothermal nucleic acid amplification (RT-LAMP) and real-time gene amplification (Real-Time PCR) using single or multiplex genes of the invention.
[0119] For the loop-mediated reverse transcription isothermal nucleic acid amplification reaction (RT-LAMP) and real-time gene amplification reaction (Real-Time PCR) using a single or multiplex gene of the present invention, a buffer composition of 50 mM Tris-HCl (pH 9.0), 50 mM KCl, 5 mM MgCl2, 20 mM (NH4)2SO4, 0.1% Tween-20, 2.5 mM dNTP, 180 mM Trehalose, 100 ng BSA, 5.0 μg, Bst I polymerase (Elpis Biotech, Korea), 0.4 μg RTase (Elpis Biotech, Korea), 0.5 ng RNase Inhibitor (Elpis Biotech, Korea), and 5 U anti-Taq polymerase (Elpis Biotech, Korea) was used. Oligonucleotides selected for SARS coronavirus (SEQ ID NO: 1-6, 29-31) or oligonucleotides selected for influenza virus A (SEQ ID NO: 63-68, 87-89) or oligonucleotides selected for influenza virus B (SEQ ID NO: 69-74, 90-92) or oligonucleotides selected for respiratory syncytial virus (RSV) (SEQ ID NO: 75-80, 93-95) or oligonucleotides selected for MS2 Phage virus (SEQ ID NO: 81-86, 96-98) were added at 10 pmoles / reaction, and the RT-LAMP reaction was performed at 62°C for 1 minute each for 16 cycles. Then, the Real-Time PCR reaction was performed at 95°C for 1 minute, followed by fluorescence measurement 5 times, applying the final conditions for a total reaction time of 25 minutes, 10 It was confirmed that the detection limit of copies / reaction was observed.The genes for the test were SARS-Cov-2 Standard Sample Stock (ZeptoMetrix, USA), Influenza A Standard Sample Stock (KBPV, KOREA), Influenza B Standard Sample Stock (KBPV, KOREA), Respiratory Syncytial Virus (RSV) Standard Sample Stock (ATCC, USA), or MS2 Phage Standard Sample Stock (ATCC, USA). The final reaction concentrations were 10, 100, and 1000 copies / reaction, and the results were analyzed using a CFX-96 (Bio-Rad, CA, USA) real-time fluorescence measurement device.
[0120] For the continuous reaction performance test of reverse transcription-isothermal nucleic acid amplification reaction (RT-LAMP) and real-time gene amplification reaction (Real-Time PCR) using a single gene, the final buffer composition and 6 types of oligonucleotides selected for each virus, 2 types of primers, 1 type of probe, and standard samples for each gene were selectively added according to the gene to be tested, and for the continuous reaction performance test of reverse transcription-isothermal nucleic acid amplification reaction (RT-LAMP) and real-time gene amplification reaction (Real-Time PCR) using multiplex genes, the final buffer composition and 6 types of oligonucleotides selected for 5 types of viruses, 2 types of primers, 1 type of probe, and standard samples for 5 types of genes were all mixed at once, and the performance test was conducted.
[0121] Figure 18 shows the results of a test under the final conditions of performing a LAMP reaction at 62℃ for 1 minute each for 16 cycles using oligonucleotide sequence numbers 63-68, 87-89 selected for influenza virus A and Influenza A standard sample stock (KBPV, KOREA) diluted to concentrations of 10, 100, and 1000 copies / reaction, and then continuously performing a Real-Time PCR reaction at 95℃ for 1 minute, 95℃ for 10 seconds, and 62℃ for 10 seconds, followed by fluorescence measurement, repeated 5 times. It was confirmed that influenza virus A gene amplification and detection at concentrations of 10, 100, and 1000 copies / reaction were all normal, and it was confirmed that no abnormal amplification occurred in the Negative Control with only DW added.
[0122] Figure 19 shows the results of a test under the final conditions of performing a LAMP reaction at 62℃ for 1 minute each for 16 cycles using oligonucleotide sequence numbers 69-74, 90-92 selected for influenza virus B and Influenza B standard sample stock (KBPV, KOREA) diluted to concentrations of 10, 100, and 1000 copies / reaction, and then continuously performing a Real-Time PCR reaction at 95℃ for 1 minute, 95℃ for 10 seconds, and 62℃ for 10 seconds, followed by fluorescence measurement, repeated 5 times. It was confirmed that influenza virus B gene amplification and detection at concentrations of 10, 100, and 1000 copies / reaction were all normal, and it was confirmed that no abnormal amplification occurred in the Negative Control with only DW added.
[0123] Figure 20 shows the results of a test under the final conditions of performing a LAMP reaction at 62°C for 1 minute each for 16 cycles using oligonucleotide sequence numbers 1-6, 29-31 selected for SARS coronavirus and SARS-Cov-2 standard sample stock (ZeptoMetrix, USA) diluted to concentrations of 10, 100, and 1000 copies / reaction, and then continuously performing a Real-Time PCR reaction at 95°C for 1 minute, 95°C for 10 seconds, and 62°C for 10 seconds, followed by fluorescence measurement, repeated 5 times. It was confirmed that the amplification and detection of the SARS coronavirus gene at concentrations of 10, 100, and 1000 copies / reaction were all normal, and it was confirmed that no abnormal amplification occurred in the Negative Control with only DW added.
[0124] Figure 21 shows the results of a test under the final conditions of performing a LAMP reaction at 62℃ for 1 minute each for 16 cycles using oligonucleotide sequence numbers 75-80, 93-95 selected for respiratory syncytial virus (RSV) and respiratory syncytial virus (RSV) standard sample stock (ATCC, USA) diluted to concentrations of 10, 100, and 1000 copies / reaction, and then continuously performing a Real-Time PCR reaction at 95℃ for 1 minute, 95℃ for 10 seconds, and 62℃ for 10 seconds, followed by fluorescence measurement, repeated 5 times. It was confirmed that RSV gene amplification and detection at concentrations of 10, 100, and 1000 copies / reaction were all normal, and it was confirmed that no abnormal amplification occurred in the Negative Control with only DW added.
[0125] Figure 22 shows the results of a test under the final conditions of performing a LAMP reaction at 62℃ for 1 minute each for 16 cycles using oligonucleotide sequence numbers 81-86, 96-98 selected for MS2 Phage virus and MS2 Phage standard sample stock (ATCC, USA) diluted to concentrations of 10, 100, and 1000 copies / reaction, and then continuously performing a Real-Time PCR reaction at 95℃ for 1 minute, 95℃ for 10 seconds, and 62℃ for 10 seconds, followed by fluorescence measurement, repeated 5 times. It was confirmed that the MS2 Phage virus gene amplification and detection at concentrations of 10, 100, and 1000 copies / reaction were all normal, and it was confirmed that no abnormal amplification occurred in the Negative Control with only DW added.
[0126] Figure 23 shows that oligonucleotides having sequence numbers 1 to 6 and 29 to 31 selected for SARS coronavirus, oligonucleotides having sequence numbers 63 to 68 and 87 to 89 selected for influenza virus A, oligonucleotides having sequence numbers 69 to 74 and 90 to 92 selected for influenza virus B, oligonucleotides having sequence numbers 75 to 80 and 93 to 95 selected for respiratory syncytial virus (RSV), and oligonucleotides having sequence numbers 81 to 86 and 96 to 98 selected for MS2 Phage virus were added at 10 pmoles / reaction, respectively, and SARS-Cov-2 standard sample Stock (ZeptoMetrix, USA), Influenza A standard sample Stock (KBPV, KOREA), Influenza B standard sample Stock (KBPV, KOREA), and respiratory syncytial virus (RSV) standard sample were added. This is the result of testing the performance of loop-mediated reverse transcription isothermal nucleic acid amplification reaction (RT-LAMP) and real-time gene amplification reaction (Real-Time PCR) using multiplex genes by applying the final conditions of diluting Stock (ATCC, USA) and MS2 Phage standard sample Stock (ATCC, USA) to a concentration of 1000 copies / reaction and adding them all, performing RT-LAMP reaction at 62℃ for 1 minute each for 16 cycles, and then performing Real-Time PCR reaction at 95℃ for 1 minute, 95℃ for 10 seconds, and 62℃ for 10 seconds, and then measuring fluorescence for a total of 5 cycles. Nucleic acid amplification and detection at a concentration of 1000 copies / reaction were all confirmed to be normal in 5 genes, and it was confirmed that no abnormal amplification occurred in the Negative Control with only DW added.
[0127] Figure 24 shows that oligonucleotides having sequence numbers 1 to 6 and 29 to 31 selected for SARS coronavirus, oligonucleotides having sequence numbers 63 to 68 and 87 to 89 selected for influenza virus A, oligonucleotides having sequence numbers 69 to 74 and 90 to 92 selected for influenza virus B, oligonucleotides having sequence numbers 75 to 80 and 93 to 95 selected for respiratory syncytial virus (RSV), and oligonucleotides having sequence numbers 81 to 86 and 96 to 98 selected for MS2 Phage virus were all added at 10 pmoles / reaction, and SARS-Cov-2 standard sample Stock (ZeptoMetrix, USA), Influenza A standard sample Stock (KBPV, KOREA), Influenza B standard sample Stock (KBPV, KOREA), and respiratory syncytial virus (RSV) standard sample were added. This is the result of testing the performance of loop-mediated reverse transcription isothermal nucleic acid amplification reaction (RT-LAMP) and real-time gene amplification reaction (Real-Time PCR) using multiplex genes by applying the final conditions of diluting Stock (ATCC, USA) and MS2 Phage standard sample Stock (ATCC, USA) to a concentration of 100 copies / reaction, adding them all, and performing RT-LAMP reaction at 62℃ for 1 minute each for 16 cycles, followed by Real-Time PCR reaction at 95℃ for 1 minute, 95℃ for 10 seconds, and 62℃ for 10 seconds, and then measuring fluorescence for a total of 5 cycles. Nucleic acid amplification and detection at a concentration of 100 copies / reaction were all confirmed to be normal in 5 genes, and it was confirmed that no abnormal amplification occurred in the Negative Control with only DW added.
[0128] Figure 25 shows the oligonucleotides selected for SARS coronavirus, oligonucleotides selected for influenza virus A, oligonucleotides selected for influenza virus B, oligonucleotides selected for respiratory syncytial virus (RSV), oligonucleotides selected for MS2 Phage virus, oligonucleotides selected for SARS-Cov-2 standard sample Stock (ZeptoMetrix, USA), Influenza A standard sample Stock (KBPV, KOREA), Influenza B standard sample Stock (KBPV, KOREA), and respiratory syncytial virus (RSV) standard sample, all added at 10 pmoles / reaction. This is the result of testing the performance of loop-mediated reverse transcription isothermal nucleic acid amplification reaction (RT-LAMP) and real-time gene amplification reaction (Real-Time PCR) using multiplex genes by applying the final conditions of diluting Stock (ATCC, USA) and MS2 Phage standard sample Stock (ATCC, USA) to a concentration of 10 copies / reaction and adding them all, performing RT-LAMP reaction at 62℃ for 1 minute each for 16 cycles, and then performing Real-Time PCR reaction at 95℃ for 1 minute, 95℃ for 10 seconds, and 62℃ for 10 seconds, and then measuring fluorescence for a total of 5 cycles. As a result of the test, in loop-mediated reverse transcription isothermal nucleic acid amplification reaction (RT-LAMP) and real-time gene amplification reaction (Real-Time PCR) using up to 5 types of multiplex genes, nucleic acid amplification and detection at a concentration of 10 copies / reaction were confirmed within a total reaction time of 25 minutes, and it was confirmed that no abnormal amplification occurred in the Negative Control with only DW added.
[0129]
[0130] Sequence number 1
[0131] 5'-CACCTTATGGGTTGGGAT -3'
[0132] Sequence number 2
[0133] 5'-ACCTGGTTTAACATATAGTGAACC-3'
[0134] Sequence number 3
[0135] 5'-TTGCGAGCAAGAACAAGTGAATCCTAAATGTGATAGAGCCA-3'
[0136] Sequence number 4
[0137] 5'-GTTGTAGCTTGTCACACCGTTTCTCACACATGACCATTTCACTCAATA-3'
[0138] Sequence number 5
[0139] 5'-GGCCATAATTCTAAGCATGTTAGG-3'
[0140] Sequence number 6
[0141] 5'-ATAGATTAGCTAATGAGTGTGCTCAAG -3'
[0142] Sequence number 7
[0143] 5'-TGTGATAGAGCCATGCCTA -3'
[0144] Sequence number 8
[0145] 5'-CGGACATACTTATCGGCAAT-3'
[0146] Sequence number 9
[0147] 5'-CGCCACACATGACCATTTCACTGTTGTAGCTTGTCACACC-3'
[0148] Sequence number 10
[0149] 5'-AGGTGGAACCTCATCAGGAGACCGTGACAGCTTGACAAA-3'
[0150] Sequence number 11
[0151] 5'-ACTTGAGCACACTCATTAGCTA -3'
[0152] Sequence number 12
[0153] 5'-TGCCACAACTGCTTATGCTA-3'
[0154] Sequence number 13
[0155] 5'-GAGCCATGCCTAACATGC -3'
[0156] Sequence number 14
[0157] 5'-CTCCTGATGAGGTTCCAC-3'
[0158] Sequence number 15
[0159] 5'-CGGTGTGACAAGCTACAACACGAATTATGGCCTCACTTGTTC-3'
[0160] Sequence number 16
[0161] 5'-GATTAGCTAATGAGTGTGCTCAAGTGGTTTAACATATAGTGAACCGCC-3'
[0162] Sequence number 17
[0163] 5'-GTTGTATGTTTGCGAGCAA-3'
[0164] Sequence number 18
[0165] 5'-ATTGAGTGAAATGGTCATGTGT-3'
[0166] Sequence number 19
[0167] 5'-CCATGCCTAACATGCTTAGA-3'
[0168] Sequence number 20
[0169] 5'-CGGACATACTTATCGGCAAT-3'
[0170] Sequence number 21
[0171] 5'-CGCCACACATGACCATTTCACTGTTGTAGCTTGTCACACC-3'
[0172] Sequence number 22
[0173] 5'-AGGTGGAACCTCATCAGGAGACCGTGACAGCTTGACAAA-3'
[0174] Sequence number 23
[0175] 5'-ACTTGAGCACACTCATTAGCTA-3'
[0176] Sequence number 24
[0177] 5'-TGCCACAACTGCTTATGCTAT-3'
[0178] Sequence number 25
[0179] 5'-SFC647-TTGCGAGCAAGAACAAGTGAATCCTAAATGTGATAGAGCCA-3'
[0180] Sequence number 26
[0181] 5'-TCACTTGTTCTTGCTCGCAA-SFCQ3-3'
[0182] Sequence number 27
[0183] SFC647-CGCCACACATGACCATTTCACTGTTGTAGCTTGTCACACC
[0184] Sequence number 28
[0185] GTGAAATGGTCATGTGTGGCG-SFCQ3
[0186] Sequence number 29
[0187] 5'-CCTCACTTGTTCTTGCTCGC-3'
[0188] Sequence number 30
[0189] 5'-AACCGCCACACATGACCATT-3'
[0190] Sequence number 31:
[0191] 5'-FAM-CAACGTGTTGTAGCTTGTCACACCG-3SFCQ1-3'
[0192] Sequence number 32:
[0193] 5'-GAACAGATGCTGCGACAG-3'
[0194] Sequence number 33:
[0195] 5'-CAGTTTTCACATCGCCAG-3'
[0196] Sequence number 34:
[0197] 5'-AGGGAGTGAACATATTCAGTCTGTAGGATGCCTCTATTGATTACCA-3'
[0198] Sequence number 35:
[0199] 5'-TGATGCCGATACGATTCGTATAGCGTTGGGTTAAGCGTGGTA-3'
[0200] Sequence number 36:
[0201] 5'-AGCTAAACTTGCTTGCCATTCA-3'
[0202] Sequence number 37:
[0203] 5'-CCAGCCAAAATCAGCTACAGCTAT-3'
[0204] Sequence number 38:
[0205] 5'-ACAGACTGAATATGTTCACTCC-3'
[0206] Sequence number 39:
[0207] 5'-TCCACAATAGTTGTTCCTACTG-3'
[0208] Sequence number 40:
[0209] 5'-CGCCAGCTCCAGCAATAGTATTCGTATAGCCCAGCCA-3'
[0210] Sequence number 41:
[0211] 5'-AAACTGGCGCAGAGGGTCTGTTCAATTGCAAGGAAACG-3'
[0212] Sequence number 42:
[0213] 5'-GGGTTAAGCGTGGTAGTATCAA-3'
[0214] Sequence number 43:
[0215] 5'-AGCTCGGAGACACAATGC-3'
[0216] Sequence number 44:
[0217] 5'-TGAACCAAGCCTTATGATCG-3'
[0218] Sequence number 45:
[0219] 5'-GCCGTAAGCAGGATTCTC-3'
[0220] Sequence number 46:
[0221] 5'-CTCCGTAGTAACCAACACGCATGAGATCCTTTGCGATCCTTG-3'
[0222] Sequence number 47:
[0223] 5'-TTCAGATGGGTGGCCAAGCCTGCTGTAAGAGTGGATGGA-3'
[0224] Sequence number 48:
[0225] 5'-ATAGCGTCACACCAAGTGG-3'
[0226] Sequence number 49:
[0227] 5'-CAACTGATACAGGCAATAGTGC-3'
[0228] Sequence number 50:
[0229] 5'-TGCAATGCAGCAGAGTTTA-3'
[0230] Sequence number 51:
[0231] 5'-CGAATCGTATCGGCATCAA-3'
[0232] Sequence number 52:
[0233] 5'-TTAGTTCCTGTCGCAGCATCTGAAAGGGTATTGTAGGTAAGGAGT-3'
[0234] Sequence number 53:
[0235] 5'-TGGCAAGCAAGTTTAGCTCTCTGCTTGCTCGAGACCATTT-3'
[0236] Sequence number 54:
[0237] 5'-CCTGCTGTAAGATCAAGAGGAA-3'
[0238] Sequence number 55:
[0239] 5'-ATGTTCACTCCCTACATTGGAG-3'
[0240] Sequence number 56:
[0241] FAM-AGGGAGTGAACATATTCAGTCTGTAGGATGCCTCTATTGATTACCA
[0242] Sequence number 57:
[0243] TACAGACTGAATATGTTCACTCCCT-SFCQ1
[0244] Sequence number 58:
[0245] FAM-CGCCAGCTCCAGCAATAGTATTCGTATAGCCCAGCCA
[0246] Sequence number 59:
[0247] ACTATTGCTGGAGCTGGCG-SFCQ1
[0248] Sequence number 60:
[0249] AGCAAGTTTAGCTCTCTCTTACA
[0250] Sequence number 61:
[0251] ACGAATCGTATCGGCATCAA
[0252] Sequence number 62:
[0253] SFCV-TGGAGTTAAAATGGTCTCGAGCAAGCT-SFCQ1
[0254] Sequence number 63:
[0255] CAAGGAGGTGTCACTAAGC
[0256] Sequence number 64:
[0257] CTAGTCTGATTGGCAACCTC
[0258] Sequence number 65:
[0259] TGTGAGACCGATGCTGTGAATCGGAACAGTGACCACAGAAG
[0260] Sequence number 66:
[0261] ACCACCAATCCACTAATCAGGCGCCATCTGTTCCATAGCC
[0262] Sequence number 67:
[0263] TCTGTTCACAAGTGGCACA
[0264] Sequence number 68:
[0265] ACAGAATGGTGCTGGCTAG
[0266] Sequence number 69:
[0267] CCCCAATGGATACAAGTCCT
[0268] Sequence number 70:
[0269] TCGGTGCTCTTGACCAAAT
[0270] Sequence number 71:
[0271] CGATGGCACATCTTCTTCATCCTACCAGAGTGGAAGGCTTG
[0272] Sequence number 72:
[0273] AACTCACTCTTCGAGCGTCTCAATAAGACTCCCACCGCAG
[0274] Sequence number 73:
[0275] TGTAAGATCATCAGTGGCAACAAGT
[0276] Sequence number 74:
[0277] CGCCAATTCGAGCAGCTGAA
[0278] Sequence number 75:
[0279] CAAACATCACAACTACACTGC
[0280] Sequence number 76:
[0281] TCTGTTTGAGTTGGTCATGG
[0282] Sequence number 77:
[0283] TAGATTGCCTTCGGAGGGAGGTTCACCAACAACACCACAG
[0284] Sequence number 78:
[0285] AAGTCTCCACAACATCCGAGCCTACTGGCGTTTTGTGTT
[0286] Sequence number 79:
[0287] TGAGTGGAAGGTTTCCATTTGA
[0288] Sequence number 80:
[0289] CACAACCCTCATCTCCACC
[0290] Sequence number 81:
[0291] GAGCTCTGCGCAGAATCG
[0292] Sequence number 82:
[0293] AGATGCCGGAGTTTGCTG
[0294] Sequence number 83:
[0295] TGCGGCTACAGGAAGCTCTACAAAGTCGAGGTGCCTAAAGTG
[0296] Sequence number 84:
[0297] CTACGAATTCCGACTGCGAGCTTGAGGGAATCGGGTTTCCA
[0298] Sequence number 85:
[0299] CACCAACAGTCTGGGTTGC
[0300] Sequence number 86:
[0301] TATTGTTAAGGCAATGCAAGGTCTC
[0302] Sequence number 87:
[0303] ACTTGTGAACAGATTGCTGATTC
[0304] Sequence number 88:
[0305] CCTGTTCACTCGATCCAGCC
[0306] Sequence number 89:
[0307] SFC610- CGGTCTCACAGACAAATGGCTACTAC-SFCQ3
[0308] Sequence number 90:
[0309] ATGCATATGACCAGAGTGGAAG
[0310] Sequence number 91:
[0311] GCTCGAATTGGCGTTGAATG
[0312] Sequence number 92:
[0313] CY5.5-TCCTCAACTCACTCTTCGAGCGTCT-SFCQ3
[0314] Sequence number 93:
[0315] GGAAACCTTCCACTCAACCT
[0316] Sequence number 94:
[0317] TTGTGTTGGGTGGAGATGAG
[0318] Sequence number 95:
[0319] SFC647-AAGTCTCCACAACATCCGAGCACC-SFCQ3
[0320] Sequence number 96:
[0321] TCAAAGTCGAGGTGCCTAAAG
[0322] Sequence number 97:
[0323] AATAAGCTCGCAGTCGGAAT
[0324] Sequence number 98:
[0325] SFCV-TAGCCGCATGGCGTTCGTACTTAA-SFCQ1
Claims
1. A single or multiplex gene amplification and detection method comprising: performing gene isothermal amplification using six kinds of oligonucleotides for nucleic acid amplification in a loop-mediated isothermal nucleic acid amplification reaction or a reverse transcription loop-mediated isothermal nucleic acid amplification reaction (LAMP or RT-LAMP), and then continuously performing a secondary reaction for measuring the amount of fluorescence emission in real time using a forward primer, a reverse primer, and a probe for real-time PCR complementary to the amplified target gene sequence.
2. In the first paragraph, the six oligonucleotides for nucleic acid amplification of the loop-mediated isothermal nucleic acid amplification reaction (LAMP) or reverse transcription (RT)-LAMP reaction are selected from the group consisting of SEQ ID NOs: 1 to 6; SEQ ID NOs: 7 to 12; SEQ ID NOs: 13 to 18; and SEQ ID NOs: 19 to 24 in the case of the SARS coronavirus gene. In the case of a gene of Chlamydia trachomatis, it is selected from the group consisting of SEQ ID NOs: 32 to 37; SEQ ID NOs: 38 to 43; SEQ ID NOs: 44 to 49; and SEQ ID NOs: 50 to 55, For the influenza virus A gene, sequence numbers 63 to 68 are selected, For the influenza virus B gene, sequence numbers 69 to 74 are selected, In the case of respiratory syncytial virus (RSV) genes, sequence numbers 75 to 80 are selected, A single or multiplex gene amplification and detection method characterized in that the MS2 Phage virus gene is selected from sequence numbers 81 to 86.
3. In the first or second paragraph, the six types of oligonucleotides are oligonucleotides described in sequence numbers 1 to 6 in the case of the SARS coronavirus gene, In the case of the gene of Chlamydia trachomatis, it is an oligonucleotide described in sequence numbers 32 to 37, In the case of the influenza virus A gene, it is an oligonucleotide described in sequence numbers 63 to 68, In the case of the influenza virus B gene, it is an oligonucleotide described in sequence numbers 69 to 74, In the case of respiratory syncytial virus (RSV) genes, it is an oligonucleotide described in sequence numbers 75 to 80, A single or multiple gene amplification and detection method characterized in that the oligonucleotides described in sequence numbers 81 to 86 are present in the case of MS2 Phage virus genes.
4. In the first paragraph, in the case of the SARS coronavirus gene, the forward primer is a primer described in SEQ ID NO: 29, the reverse primer is a primer described in SEQ ID NO: 30, and the probe is a probe described in SEQ ID NO: 25 to 26 or SEQ ID NO:
31. In the case of the gene of Chlamydia trachomatis, the forward primer is a primer described in SEQ ID NO: 60, the reverse primer is a primer described in SEQ ID NO: 61, and the probe is a probe described in SEQ ID NO: 56 to 57 or SEQ ID NO:
62. For the influenza virus A gene, the forward primer is the primer described in SEQ ID NO. 87, the reverse primer is the primer described in SEQ ID NO. 88, and the probe is the probe described in SEQ ID NO.
89. For the influenza virus B gene, the forward primer is the primer described in SEQ ID NO: 90, the reverse primer is the primer described in SEQ ID NO: 91, and the probe is the probe described in SEQ ID NO:
92. For the respiratory syncytial virus (RSV) gene, the forward primer is the primer described in SEQ ID NO: 93, the reverse primer is the primer described in SEQ ID NO: 94, and the probe is the probe described in SEQ ID NO:
95. A single or multiple gene amplification and detection method, characterized in that, for the MS2 Phage virus gene, the forward primer is a primer described in SEQ ID NO: 96, the reverse primer is a primer described in SEQ ID NO: 97, and the probe is a probe described in SEQ ID NO:
98.
5. A single or multiple gene amplification and detection method according to claim 1, characterized in that the fluorescent dye used for measuring the amplified nucleic acid is at least one of FAM, TET, HEX, TAMRA, ROX, TEXAS RED, CY3, CY5, SFC-V, SFC647, SFC610, and CY5.
5.
6. In the first paragraph, the method is a single or multiple gene amplification and detection method characterized in that the method comprises performing a loop-mediated isothermal nucleic acid amplification reaction or a reverse transcription loop-mediated isothermal nucleic acid amplification reaction at 62°C for 1 minute each 16 times, and then performing a real-time PCR reaction at 95°C for 1 minute, 95°C for 10 seconds, and 62°C for 10 seconds, and then measuring fluorescence.
7. A composition for amplification and detection of a single or multiple genes, comprising as active ingredients six kinds of oligonucleotides for nucleic acid amplification in loop-mediated isothermal nucleic acid amplification reaction or reverse transcription loop-mediated isothermal nucleic acid amplification reaction (LAMP or RT-LAMP), a forward primer for real-time PCR, a reverse primer, and a probe including a fluorescent dye.
8. In the 7th paragraph, the six oligonucleotides for nucleic acid amplification of the loop-mediated isothermal nucleic acid amplification reaction (LAMP) or reverse transcription (RT)-LAMP reaction are selected from the group consisting of SEQ ID NOs: 1 to 6; SEQ ID NOs: 7 to 12; SEQ ID NOs: 13 to 18; and SEQ ID NOs: 19 to 24 in the case of the SARS coronavirus gene. In the case of a gene of Chlamydia trachomatis, it is selected from the group consisting of SEQ ID NOs: 32 to 37; SEQ ID NOs: 38 to 43; SEQ ID NOs: 44 to 49; and SEQ ID NOs: 50 to 55, For the influenza virus A gene, sequence numbers 63 to 68 are selected, For the influenza virus B gene, sequence numbers 69 to 74 are selected, In the case of respiratory syncytial virus (RSV) genes, sequence numbers 75 to 80 are selected, A composition for amplifying and detecting a single or multiple genes, characterized in that the MS2 Phage virus gene is selected from sequence numbers 81 to 86.
9. In clause 7 or 8, the six oligonucleotides are oligonucleotides described in sequence numbers 1 to 6 in the case of the SARS coronavirus gene. In the case of the gene of Chlamydia trachomatis, it is an oligonucleotide described in sequence numbers 32 to 37, In the case of the influenza virus A gene, it is an oligonucleotide described in sequence numbers 63 to 68, In the case of the influenza virus B gene, it is an oligonucleotide described in sequence numbers 69 to 74, In the case of respiratory syncytial virus (RSV) genes, it is an oligonucleotide described in sequence numbers 75 to 80, A composition for amplifying and detecting a single or multiple genes, characterized in that the oligonucleotides are described in sequence numbers 81 to 86 for the MS2 Phage virus gene.
10. In the 7th paragraph, in the case of the SARS coronavirus gene, the forward primer is a primer described in SEQ ID NO: 29, the reverse primer is a primer described in SEQ ID NO: 30, and the probe is a probe described in SEQ ID NO: 25 to 26 or SEQ ID NO:
31. In the case of the gene of Chlamydia trachomatis, the forward primer is a primer described in SEQ ID NO: 60, the reverse primer is a primer described in SEQ ID NO: 61, and the probe is a probe described in SEQ ID NO: 56 to 57 or SEQ ID NO:
62. For the influenza virus A gene, the forward primer is the primer described in SEQ ID NO. 87, the reverse primer is the primer described in SEQ ID NO. 88, and the probe is the probe described in SEQ ID NO.
89. For the influenza virus B gene, the forward primer is the primer described in SEQ ID NO: 90, the reverse primer is the primer described in SEQ ID NO: 91, and the probe is the probe described in SEQ ID NO:
92. For the respiratory syncytial virus (RSV) gene, the forward primer is the primer described in SEQ ID NO: 93, the reverse primer is the primer described in SEQ ID NO: 94, and the probe is the probe described in SEQ ID NO:
95. A composition for amplifying and detecting a single or multiple genes, characterized in that, in the case of the MS2 Phage virus gene, the forward primer is a primer described in SEQ ID NO: 96, the reverse primer is a primer described in SEQ ID NO: 97, and the probe is a probe described in SEQ ID NO:
98.
11. A composition for gene amplification and detection, characterized in that in paragraph 7, the fluorescent dye of the probe is at least one of FAM, TET, HEX, TAMRA, ROX, TEXAS RED, CY3, CY5, SFC-V, SFC647, SFC610, and CY5.
5.
12. Contains as active ingredients six kinds of oligonucleotides for nucleic acid amplification in loop-mediated isothermal nucleic acid amplification reaction or reverse transcription loop-mediated isothermal nucleic acid amplification reaction (LAMP or RT-LAMP), a forward primer for real-time PCR, a reverse primer and a probe including a fluorescent dye, Here, six oligonucleotides for nucleic acid amplification of the loop-mediated isothermal nucleic acid amplification reaction (LAMP) or reverse transcription (RT)-LAMP reaction are selected from the group consisting of SEQ ID NOs: 1 to 6; SEQ ID NOs: 7 to 12; SEQ ID NOs: 13 to 18; and SEQ ID NOs: 19 to 24 in the case of the SARS coronavirus gene. In the case of a gene of Chlamydia trachomatis, it is selected from the group consisting of SEQ ID NOs: 32 to 37; SEQ ID NOs: 38 to 43; SEQ ID NOs: 44 to 49; and SEQ ID NOs: 50 to 55, For the influenza virus A gene, sequence numbers 63 to 68 are selected, For the influenza virus B gene, sequence numbers 69 to 74 are selected, In the case of respiratory syncytial virus (RSV) genes, sequence numbers 75 to 80 are selected, For the MS2 Phage virus gene, sequence numbers 81 to 86 are selected. In the case of the above SARS coronavirus gene, the forward primer is a primer described in SEQ ID NO: 29, the reverse primer is a primer described in SEQ ID NO: 30, and the probe is a probe described in SEQ ID NO: 25 to 26 or SEQ ID NO:
31. In the case of the gene of Chlamydia trachomatis, the forward primer is a primer described in SEQ ID NO: 60, the reverse primer is a primer described in SEQ ID NO: 61, and the probe is a probe described in SEQ ID NO: 56 to 57 or SEQ ID NO:
62. For the influenza virus A gene, the forward primer is the primer described in SEQ ID NO. 87, the reverse primer is the primer described in SEQ ID NO. 88, and the probe is the probe described in SEQ ID NO.
89. For the influenza virus B gene, the forward primer is the primer described in SEQ ID NO: 90, the reverse primer is the primer described in SEQ ID NO: 91, and the probe is the probe described in SEQ ID NO:
92. For the respiratory syncytial virus (RSV) gene, the forward primer is the primer described in SEQ ID NO: 93, the reverse primer is the primer described in SEQ ID NO: 94, and the probe is the probe described in SEQ ID NO:
95. A single or multiplex gene amplification and detection kit, characterized in that, for the MS2 Phage virus gene, the forward primer is a primer described in SEQ ID NO: 96, the reverse primer is a primer described in SEQ ID NO: 97, and the probe is a probe described in SEQ ID NO: 98.
Citation Information
Patent Citations
Primers used in nested RT-PCR for diagnosing variouscancers including stomach cancer and liver cancer,gastritis, hepatocirrhosis and hepatitis at the sametime
KR1020030031243A
PCR method
US20030017482A1