Composition for detecting PIK3ca gene mutant tumor in companion animal and method for diagnosing PIK3ca gene mutant tumor in companion animal using same

Abstract

The present invention relates to a primer set for detecting a PIK3CA gene mutant tumor in a companion animal, the primer set comprising a forward primer selected from the group consisting of primers represented by SEQ ID NOs: 1 to 3 and a reverse primer selected from the group consisting of primers represented by SEQ ID NOs: 4 to 8.

Description

Composition for detecting PIK3CA gene mutation tumor in companion animals and method for diagnosing PIK3CA gene mutation tumor in companion animals using the same

[0001] The present invention relates to a composition for detecting a PIK3CA gene mutant tumor in a companion animal, comprising a primer set capable of amplifying a PIK3CA gene mutation in the companion animal, and a method for diagnosing a PIK3CA gene mutant tumor in the companion animal using the same. The present invention detects a PIK3CA gene mutation in a companion animal, diagnoses a PIK3CA gene mutant tumor, and provides information necessary for treatment.

[0002] As mutations in oncogenes and tumor suppressor genes become increasingly recognized as contributing to the development of cancer in humans and other animals, diverse research is being conducted to detect mutations in various oncogenes and tumor suppressor genes. These mutation detections contribute to cancer development and drug prognosis, providing essential information for the prevention, diagnosis, and treatment of cancer or tumors.

[0003] Mutations in the PIK3CA gene activate the PI3K (Phosphatidylinositol 3-kinase) protein, which in turn activates the tyrosine kinase receptor signaling pathway. Activated tyrosine kinases are involved in carcinogenesis by activating proteins that suppress cell survival and division, as well as proteins that promote metabolism and promote cell growth. PIK3CA mutations accelerate cancer progression and increase the frequency of metastasis, worsening the patient's prognosis. Furthermore, they are known to be involved in the downstream signaling pathway of the Human Epidermal Growth Factor (HER) family and are involved in resistance to HER family targeted therapies.

[0004] Unlike humans, diseases like tumors in animals lack supplementary diagnostic or detection tools, such as regular checkups and appropriate biomarker detection tests. Animals lack regular health checkups, and disease symptoms are often detected late, making disease prevention difficult. Furthermore, animals cannot routinely undergo precise tests like morphological examinations and tissue biopsies at general veterinary hospitals, limiting their access to routine diagnostic and therapeutic testing. In humans, biomarkers, which are indicators that can detect changes within the body using proteins, DNA, RNA (ribonucleic acid), and metabolites, can be used to objectively measure the normal or pathological state of an organism, as well as its response to drugs.

[0005] Against this backdrop, the present inventors have completed the present invention to detect PIK3CA gene mutations in companion animals, diagnose changes in the companion animal's body, and produce a primer set for detecting PIK3CA gene mutant tumors, thereby providing information necessary for diagnosing related diseases.

[0006] [Prior Art Literature]

[0007] [Patent Document]

[0008] Domestic Patent No. 10-1543215

[0009] The present invention aims to provide a method for detecting a tumor in a companion animal very simply and quickly using a composition for detecting a PIK3CA gene mutant tumor in a companion animal, and for performing a clinical diagnosis quickly and easily with high reliability.

[0010] The present invention provides a primer set for detecting a companion animal PIK3CA gene mutant tumor, comprising a forward primer selected from the group consisting of primers represented by SEQ ID NOs: 1 to 3 and a reverse primer selected from the group consisting of primers represented by SEQ ID NOs: 4 to 8, and a composition for detecting a companion animal PIK3CA gene mutant tumor, comprising the same. In addition, the present invention provides a method for diagnosing a companion animal PIK3CA gene mutant tumor and information necessary for treating a companion animal PIK3CA gene mutant tumor using the primer set.

[0011] When performing RT-qPCR using the composition and method according to the present invention, a companion animal PIK3CA gene mutant tumor can be detected with high accuracy and sensitivity, and a clinical diagnosis can be made quickly and easily with high reliability and information necessary for tumor treatment can be provided.

[0012] Figure 1 shows the results of PCR (RP-qPCR) performed using a composition for detecting a companion animal PIK3CA gene mutant tumor, including a primer set, according to one embodiment of the present invention. Figure 1(a) and Figure 1(b) show the results of confirming PCR amplification and evaluating analytical sensitivity by setting the ratio of mutant DNA to 0.001%, 0.01%, 0.1%, 1%, 10%, 50%, and 100% for template DNA of Accession Number: NC_051838. This is the result of performing PCR amplification using a composition for detecting a companion animal PIK3CA gene mutant tumor, including a primer set including at least one selected from the group consisting of a forward primer represented by SEQ ID NO: 1 to 2 and a reverse primer represented by SEQ ID NO: 4. Figures 1(c) and 1(d) show the results of analyzing gene amplification of RT-qPCR using the melting curve analysis method in the step of detecting PIK3CA mutations in companion animals by analyzing gene amplification of RT-qPCR.

[0013] FIG. 2 shows the results of PCR (RP-qPCR) performed using a composition for detecting a companion animal PIK3CA gene mutant tumor, including a primer set, according to one embodiment of the present invention. With respect to the template DNA of Accession Number: NC_051838, the ratio of mutant DNA was set to 0.001%, 0.01%, 0.1%, 1%, 10%, 50%, and 100%, and the results of evaluating the analytical sensitivity are shown. This shows the results of confirming by agarose gel electrophoresis in the step of detecting a companion animal PIK3CA mutation by analyzing the gene amplification of RT-qPCR. This shows the results of PCR amplification performed using a composition for detecting a companion animal PIK3CA gene mutant tumor, including a primer set including at least one selected from the group consisting of the forward primers represented by SEQ ID NOs: 1 to 2 and the reverse primer represented by SEQ ID NO: 4.

[0014] FIG. 3 shows the results of PCR (RP-qPCR) performed using a composition for detecting a companion animal PIK3CA gene mutation tumor, including a primer set, according to one embodiment of the present invention. FIG. 3(a) and FIG. 3(b) show the results of PCR amplification performed using a composition for detecting a companion animal PIK3CA gene mutation tumor, including a primer set including at least one selected from the group consisting of the forward primers represented by SEQ ID NOs: 1 to 2 and the reverse primer represented by SEQ ID NO: 4, for template DNA of Accession Number: NC_006616. FIG. 3(c) and FIG. 3(d) show the results of analyzing the gene amplification of RT-qPCR using a melting curve analysis method in the step of detecting a companion animal PIK3CA mutation by analyzing the gene amplification of the RT-qPCR.

[0015] FIG. 4 shows the results of PCR (RP-qPCR) performed using a composition for detecting a companion animal PIK3CA gene mutant tumor, including a primer set, according to one embodiment of the present invention. FIG. 4(a) and FIG. 4(b) show the results of confirming PCR amplification and evaluating analytical sensitivity by setting the ratio of mutant DNA to 0.001%, 0.01%, 0.1%, 1%, 10%, 50%, and 100% for template DNA of Accession Number: NC_051838. This is the result of performing PCR amplification using a composition for detecting a companion animal PIK3CA gene mutant tumor, including a primer set including at least one primer selected from the group consisting of a forward primer represented by SEQ ID NO: 3 and a reverse primer represented by SEQ ID NOs: 5 to 8. Figures 4(c) and 4(d) are the results of analyzing gene amplification of RT-qPCR using the melting curve analysis method in the step of detecting companion animal PIK3CA mutations by analyzing gene amplification of RT-qPCR.

[0016] FIG. 5 shows the results of PCR (RP-qPCR) performed using a composition for detecting a companion animal PIK3CA gene mutant tumor, including a primer set, according to one embodiment of the present invention. With respect to the template DNA of Accession Number: NC_051838, the ratio of mutant DNA was set to 0.001%, 0.01%, 0.1%, 1%, 10%, 50%, and 100%, and the results of evaluating the analytical sensitivity are shown. This shows the results of confirming the agarose gel electrophoresis in the step of detecting a companion animal PIK3CA mutation by analyzing the gene amplification of RT-qPCR. This shows the results of PCR amplification performed using a composition for detecting a companion animal PIK3CA gene mutant tumor, including a primer set including at least one primer selected from the group consisting of the forward primer represented by SEQ ID NO: 3 and the reverse primers represented by SEQ ID NOs: 5 to 8.

[0017] FIG. 6 shows the results of PCR (RP-qPCR) performed using a composition for detecting a companion animal PIK3CA gene mutation tumor, including a primer set, according to one embodiment of the present invention. FIG. 6(a) and FIG. 6(b) show the results of PCR amplification performed using a composition for detecting a companion animal PIK3CA gene mutation tumor, including a primer set including at least one primer selected from the group consisting of a forward primer represented by SEQ ID NO: 3 and a reverse primer represented by SEQ ID NO: 5 to 8, for template DNA of Accession Number: NC_006616. FIG. 6(c) and FIG. 6(d) show the results of analyzing the gene amplification of RT-qPCR using a melting curve analysis method in the step of detecting a companion animal PIK3CA mutation by analyzing the gene amplification of the RT-qPCR.

[0018] Hereinafter, various embodiments of the present invention will be described with reference to the accompanying drawings. It should be understood that the present invention is not limited to specific embodiments, but rather encompasses various modifications, equivalents, and / or alternatives of the embodiments of the present invention. In the description of the drawings, similar reference numerals may be used for similar components.

[0019] In this specification, expressions such as “has”, “may have”, “includes”, or “may include” indicate the presence of a feature (e.g., a number, function, operation, or component such as a part), and do not exclude the presence of additional features.

[0020] In this specification, expressions such as "A or B," "at least one of A and / or B," or "one or more of A or / and B" can include all possible combinations of the listed items. For example, "A or B," "at least one of A and B," or "at least one of A or B" can all refer to (1) including at least one A, (2) including at least one B, or (3) including both at least one A and at least one B.

[0021] The expression "configured to" as used herein can be used interchangeably with, for example, "suitable for", "having the capacity to", "designed to", "adapted to", "made to", or "capable of", depending on the context. The term "configured to" does not necessarily mean "specifically designed to".

[0022] The terms used in this specification are used only to describe specific embodiments and may not be intended to limit the scope of other embodiments. The singular expression may include plural expressions unless the context clearly indicates otherwise. Terms used herein, including technical or scientific terms, may have the same meaning as commonly understood by those of ordinary skill in the art described in this specification. Terms used in this specification that are defined in general dictionaries may be interpreted as having the same or similar meaning in the context of the relevant technology, and shall not be interpreted in an idealized or overly formal sense unless explicitly defined in this specification. In some cases, even if a term is defined in this specification, it cannot be interpreted to exclude the embodiments of this specification.

[0023] The embodiments disclosed herein are presented for the purpose of explaining and understanding the disclosed technical content and are not intended to limit the scope of the present invention. Therefore, the scope of this specification should be interpreted to include all modifications and various other embodiments based on the technical concept of the present invention.

[0024] Hereinafter, preferred embodiments of the present invention will be described in detail. Prior to this, it should be noted that the terms and words used in this specification and claims should not be construed as limited to their conventional or dictionary meanings. Based on the principle that the inventor can appropriately define the concepts of terms to best explain his or her invention, they should be interpreted in a way that aligns with the technical spirit of the present invention.

[0025] Accordingly, the configurations of the embodiments described in this specification are only some of the most preferred embodiments of the present invention and do not represent all of the technical ideas of the present invention, so it should be understood that there may be various equivalents and modified examples that can replace them at the time of filing this application.

[0026] Throughout the specification, whenever a part is said to "include" a component, this does not mean that it excludes other components, but rather that it may include other components, unless otherwise stated.

[0027] Hereinafter, the present invention will be described in detail.

[0028]

[0029] According to one embodiment of the present invention, the present invention relates to a primer set for detecting a companion animal PIK3CA gene mutant tumor, comprising a forward primer selected from the group consisting of primers represented by SEQ ID NOs: 1 to 3 and a reverse primer selected from the group consisting of primers represented by SEQ ID NOs: 4 to 8.

[0030] The term "primer" as used in the present invention refers to a short nucleic acid sequence having a short free 3-terminal hydroxyl group, which can form base pairs with a complementary template and serves as a starting point for template strand copying. The "template" refers to a "template nucleic acid" and refers to a nucleic acid used as a template for amplification in a PCR reaction. The "template" may include any that exists naturally, is naturally produced, or is synthetic. For example, in the present invention, the "template" may refer to the PIK3CA gene of a companion animal.

[0031] The above primer can initiate DNA synthesis in the presence of a polymerization reagent (DNA polymerase, reverse transcriptase, etc.) and four different nucleoside triphosphates in an appropriate buffer solution and temperature. The primer is also called a primer, and can be formed in various forms such as DNA, RNA, PNA (Peptide Nucleic Acid), LNA (Locked Nucleic Acid), or a mixture thereof, and can be used for gene amplification.

[0032] The primer can be prepared by chemical synthesis, for example, using the phosphoramidite method, the phosphodiester method, or the diethylphosphoramidite method. Furthermore, the primer base sequence can be modified by methods known in the art. Primers are typically single-stranded oligonucleotides (e.g., oligodeoxyribonucleotides). The length of the primer varies depending on the intended use, ranging from 10 to 50 consecutive nucleotides, preferably from 15 to 35 nucleotides. Shorter primer molecules generally require lower temperatures to form sufficiently stable hybridization complexes with the template. The primer does not need to reflect the exact sequence of the template, but must be sufficiently complementary to hybridize with the template for primer extension. The primer may, if desired, contain a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Examples of markers include enzymes (e.g., horseradish peroxidase, alkaline phosphatase), radioactive isotopes (e.g., 32 P), fluorescent molecules, chemical groups (e.g., biotin), etc.

[0033] The term "primer set" used in the present invention refers to a plurality of primers. The primer set may further include a container for accommodating the primers. The plurality of primers of the primer set may include a forward primer and a reverse primer, which refer to general primers commonly used in the amplification of a genetic sample containing a genetic mutation to be detected. This is something that can be easily determined by a person of ordinary skill in the art related to such primer sets, depending on the genetic mutation to be detected and the gene containing the mutation.

[0034] The primer set of the present invention is carefully designed to maximize the sensitivity and specificity of detecting PIK3CA gene mutations in companion animals by sufficiently considering the size of the primer, the Tm value, the GC content of the primer, prevention of formation of a complex (dimer) of the primer by self-complementary sequences within the primer, prohibition of repetition of the same base sequence three or more times, etc.

[0035] The term "mutation" used in the present invention refers to a phenomenon in which a qualitative or quantitative change occurs in a gene due to an abnormality in the gene or chromosome, thereby causing a change in the genetic trait. The mutation may be a mutation at the gene level, and preferably may be a point mutation or multiple mutation selected from substitutions, insertions, and deletions. The mutation may be a silent mutation, a neutral mutation, a missense mutation, a nonsense mutation, a frame shift mutation, etc., and the type thereof is not limited.

[0036] The term 'tumor' used in the present invention may mean a solid tumor. The solid tumor is derived from mesothelioma, cervical cancer, pancreatic cancer, ovarian cancer, squamous cell carcinoma (e.g., epithelial squamous cell carcinoma), small cell lung cancer, non-small cell lung cancer, lung cancer including adenocarcinoma of the lung and squamous carcinoma of the lung, peritoneal cancer, hepatocellular cancer, gastric cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial cancer or uterine carcinoma, salivary gland carcinoma, kidney cancer or renal cancer, prostate cancer, vulvar cancer, thyroid cancer, liver carcinoma, anal carcinoma, penile carcinoma, head and neck cancer, or any combination thereof.

[0037] The term 'PCR (polymerase chain reaction)' used in the present invention is a method of confirming whether a gene is amplified using a fluorescent substance, and is a gene amplification method that can simultaneously amplify and detect genes. The PCR reaction can be performed through (i) an initial denaturation step; (ii) a step of repeating one cycle of denaturation, annealing, and extension several to several dozen times; and (iii) a final heat treatment step; or a thermal cycle program that is a suitable modification of these steps. Specifically, the gene amplification may be performed using one amplification method selected from the group consisting of reverse transcription polymerase chain reaction (RT-PCR), real-time reverse transcriptase polymerase reaction (Real time RT-PCR), quantitative polymerase chain reaction (qPCR), competitive reverse transcription polymerase chain reaction (Competitive RT-PCR), real-time quantitative polymerase chain reaction (RT-qPCR), inverse polymerase chain reaction (Inverse PCR), and long and accurate polymerase chain reaction (Long and Accurate PCR). In the present invention, the gene amplification using the primer set may preferably be performed using one amplification method selected from the group consisting of RT-PCR, RT-qPCR, and Real time PCR. More preferably, RT-qPCR may be used. 'RT-qPCR' is a combined technology of 'RT-PCR' and 'qPCR', which allows quantification of gene expression and enables rapid and accurate detection.

[0038] PCR, RT-PCR, RT-qPCR, or Real-time PCR amplification results can be confirmed using methods such as agarose gel electrophoresis. The electrophoresis results can be analyzed using ethidium bromide staining after electrophoresis. In the present invention, RT-qPCR amplification results can be analyzed using agarose gel electrophoresis or melting curve analysis.

[0039] The 'PIK3CA' of the present invention is a gene for phosphoinositide 3-kinase (PI3K). PI3K is a lipid kinase that catalyzes the phosphorylation of phosphatidylinositol 4,5-bisphosphate (PIP2), which is involved in cell signaling, into phosphatidylinositol 3,4,5-trisphosphate (PIP3). PI3K is classified into classes I, II, and III based on structure, mechanism of action, and substrate specificity. Among them, class IB PI3K contains p110γ, which is activated by G protein-coupled receptors. Cell signaling pathways through p110α are overactivated in human cancer cells. And when the PI3K cell signaling pathway is abnormally regulated, the level of PIP3 increases, activating the downstream enzyme Akt, which ultimately affects cancer, immune disorders, and cardiovascular disorders. The PIK3CA gene, which encodes p110α, is mutated and overexpressed in various primary cancers. Mutations in the PIK3CA gene lead to the activation of the PI3K (Phosphatidylinositol 3-kinase) protein, and PI3K activates the signal transduction system of the tyrosine kinase receptor. The activated tyrosine kinase is involved in the carcinogenesis process by activating the functions of proteins that suppress cell survival and division, interfere with the promotion of metabolism, and activate the functions of proteins that promote cell growth. PIK3CA gene mutations accelerate the rate of cancer progression and increase the frequency of metastasis, worsening the prognosis of cancer development. It is also known to belong to the downstream signaling system of the Human Epidermal Growth Factor (HER) family and to be involved in resistance to HER family targeted therapeutics.These PIK3CA gene mutations can cause tumors, and the tumors can be mammary tumors. The mammary tumors can be one or more types selected from the group consisting of fibroadenoma, adenocarcinoma, and spindle cell neoplasm.

[0040] The companion animal of the present invention may be at least one species selected from the group consisting of a companion dog, a cat, a mouse, a rabbit, a horse, a sheep, a hamster, a hedgehog, a ferret, and a guinea pig. Preferably, the companion animal of the present invention may be a companion dog.

[0041] In the present invention, the primer set for detecting a PIK3CA gene mutant tumor in a companion animal detects at least one mutation selected from the group consisting of PIK3CA_E545K, PIK3CA_E542K, PIK3CA_H1047R, PIK3CA_H1047L, and PIK3CA_H1047Y. The primer set of the present invention can amplify any one of PIK3CA_E545K, PIK3CA_E542K, PIK3CA_H1047R, PIK3CA_H1047L, or PIK3CA_H1047Y, or simultaneously amplify one or more mutations selected from the group consisting of PIK3CA_E545K, PIK3CA_E542K, PIK3CA_H1047R, PIK3CA_H1047L, and PIK3CA_H1047Y.

[0042] The 'primer set for detecting PIK3CA gene mutant tumor' of the present invention refers to a set of primer pairs that can specifically bind to one or more mutation sites selected from the group consisting of PIK3CA_E545K, PIK3CA_E542K, PIK3CA_H1047R, PIK3CA_H1047L, and PIK3CA_H1047Y in the PIK3CA gene and induce an extension reaction. Each of the primer pairs generates a PCR product for a PIK3CA gene mutation, but hardly generates one for a wild-type PIK3CA gene.

[0043] The primers represented by the above sequence numbers 1 to 8 are as follows:

[0044] cPIK3CA-E545-WT-fwd-1: 5'- gatcctctctctgaaatcactg-3' (SEQ ID NO: 1)

[0045] cPIK3CA-E545K-fwd-1: 5'- gatcctctctctgaaatcacta -3' (SEQ ID NO: 2)

[0046] cfPIK3CA-H1047-fwd-2: 5'- catacattcgaaagaccctagc-3' (SEQ ID NO: 3)

[0047] cfPIK3CA-E545-rve-1: 5'- aggttagtaccaatgcagcgt-3' (SEQ ID NO: 4)

[0048] cPIK3CA-H1047-WT-rve-2: 5'- tgttgtccagccaccatgatg-3' (SEQ ID NO: 5)

[0049] cPIK3CA-H1047R-rve-2: 5'- ttgttgtccagccaccatgag-3' (SEQ ID NO: 6)

[0050] cPIK3CA-H1047L-rve-2: 5'- ttgttgtccagccaccatgaa-3' (SEQ ID NO: 7)

[0051] cPIK3CA-H1047Y-rve-2: 5'- tgttgtccagccaccatgata-3' (SEQ ID NO: 8)

[0052] The 1 base at the 3' end of the forward primer of the above sequence number 2 may be used for mutation detection corresponding to a position with a high possibility of mutation in the target DNA sequence.

[0053] The 1 base at the 3' end of the reverse primer of the above sequence number 6 may be used for mutation detection corresponding to a position with a high possibility of mutation in the target DNA sequence.

[0054] The 1 base at the 3' end of the reverse primer of the above sequence number 7 may be used for mutation detection corresponding to a position with a high possibility of mutation in the target DNA sequence.

[0055] The 3' end of the reverse primer of the above sequence number 8 may be used for mutation detection corresponding to a position with a high possibility of mutation in the target DNA sequence.

[0056] According to one embodiment of the present invention, the present invention relates to a composition for detecting a PIK3CA gene mutant tumor in a companion animal, comprising at least one primer set selected from the group consisting of: a) a primer set comprising a forward primer represented by SEQ ID NO: 1 and a reverse primer represented by SEQ ID NO: 4; b) a primer set comprising a forward primer represented by SEQ ID NO: 2 and a reverse primer represented by SEQ ID NO: 4; c) a primer set comprising a forward primer represented by SEQ ID NO: 3 and a reverse primer represented by SEQ ID NO: 5; d) a primer set comprising a forward primer represented by SEQ ID NO: 3 and a reverse primer represented by SEQ ID NO: 6; e) a primer set comprising a forward primer represented by SEQ ID NO: 3 and a reverse primer represented by SEQ ID NO: 7; and f) a primer set comprising a forward primer represented by SEQ ID NO: 3 and a reverse primer represented by SEQ ID NO: 8.

[0057] According to one embodiment of the present invention, the present invention relates to a composition for detecting a companion animal PIK3CA gene mutant tumor, comprising at least one primer set selected from the group consisting of a) a primer set comprising a forward primer represented by SEQ ID NO: 1 and a reverse primer represented by SEQ ID NO: 4; and b) a primer set comprising a forward primer represented by SEQ ID NO: 2 and a reverse primer represented by SEQ ID NO: 4, wherein the primer set detects a PIK3CA_E545K mutation.

[0058] According to one embodiment of the present invention, the present invention relates to a composition for detecting a PIK3CA gene mutant tumor in a companion animal, comprising at least one primer set selected from the group consisting of: c) a primer set comprising a forward primer represented by SEQ ID NO: 3 and a reverse primer represented by SEQ ID NO: 5; d) a primer set comprising a forward primer represented by SEQ ID NO: 3 and a reverse primer represented by SEQ ID NO: 6; e) a primer set comprising a forward primer represented by SEQ ID NO: 3 and a reverse primer represented by SEQ ID NO: 7; and f) a primer set comprising a forward primer represented by SEQ ID NO: 3 and a reverse primer represented by SEQ ID NO: 8, wherein the primer set detects at least one mutation selected from the group consisting of PIK3CA_H1047R, PIK3CA_H1047L, and PIK3CA_H1047Y.

[0059] Using a composition for detecting a companion animal PIK3CA gene mutant tumor comprising the primer set of the present invention, any one of PIK3CA_E545K, PIK3CA_E542K, PIK3CA_H1047R, PIK3CA_H1047L, or PIK3CA_H1047Y can be amplified, or at least one mutation selected from the group consisting of PIK3CA_E545K, PIK3CA_E542K, PIK3CA_H1047R, PIK3CA_H1047L, and PIK3CA_H1047Y can be simultaneously amplified.

[0060] According to one embodiment of the present invention, the present invention relates to a method for diagnosing a PIK3CA gene mutant tumor in a companion animal, comprising the steps of performing RT-qPCR on a PIK3CA gene in a companion animal using a primer set for detecting a PIK3CA gene mutant tumor in a companion animal, the primer set comprising a forward primer selected from the group consisting of primers represented by SEQ ID NOs: 1 to 3 and a reverse primer selected from the group consisting of primers represented by SEQ ID NOs: 4 to 8; and analyzing gene amplification of the RT-qPCR to detect a PIK3CA mutation in the companion animal.

[0061] The above companion animal PIK3CA gene mutant tumor may be a mammary tumor. The mammary tumor may be one or more selected from the group consisting of fibroadenoma, adenocarcinoma, and spindle cell neoplasm.

[0062] The step of performing RT-qPCR on the PIK3CA gene of a companion animal using a primer set for detecting a companion animal PIK3CA gene mutant tumor, which comprises a forward primer selected from the group consisting of primers represented by SEQ ID NOs: 1 to 3 and a reverse primer selected from the group consisting of primers represented by SEQ ID NOs: 4 to 8, refers to a process of amplifying the target DNA by repeating the processes of denaturation, annealing, and extension reaction using a target DNA as a template and a primer specific for the target DNA. The target DNA can be used using the canine PIK3CA gene information registered in the NCBI genebank of [Table 1] below as a template.

[0063] In the step of performing RT-qPCR on the PIK3CA gene of a companion animal using a primer set for detecting a companion animal PIK3CA gene mutant tumor, the primer set comprising a forward primer selected from the group consisting of primers represented by SEQ ID NOS: 1 to 3 and a reverse primer selected from the group consisting of primers represented by SEQ ID NOS: 4 to 8, specific PCR conditions include initial denaturation by heat treatment at 90 to 95°C for 1 to 20 minutes, followed by a denaturation step at 90 to 95°C for 10 seconds to 2 minutes; an annealing step at 58 to 70°C for 10 seconds to 2 minutes; and a synthesis step at 70 to 75°C for 10 seconds to 2 minutes, repeating the above-described conditions 10 to 40 times in total, and the reaction temperature and reaction time conditions can be appropriately modified and performed by those skilled in the art. More preferably, initial denaturation is performed at 95°C for 3 minutes, followed by a denaturation step at 95°C for 10 seconds; An annealing step of 10 seconds at 66°C and a synthesis step of 30 seconds at 72°C can be performed.

[0064] In the step of detecting companion animal PIK3CA mutations by analyzing the gene amplification of the above RT-qPCR, the analysis can be performed by analyzing the size of the PCR amplification product using any method known in the art. Preferably, the size of the amplification product can be confirmed by comparison with a target size marker through agarose or polyacrylamide gel electrophoresis, or the PIK3CA mutation can be detected using a melting curve analysis method.

[0065] The above melting curve analysis method means specifically detecting companion animal PIK3CA gene mutations by confirming the temperature at which double-stranded DNA dissociates into single-stranded DNA. In the step of detecting companion animal PIK3CA mutations by analyzing the gene amplification of the RT-qPCR, the melting curve analysis method was used to analyze the gene amplification of the RT-qPCR. The ratio of PIK3CA mutant DNA to the target PIK3CA wild-type (WT) DNA was set to 0.001%, 0.01%, 0.1%, 1%, 10%, 50%, and 100%, and the analytical sensitivity of the primer kit of the present invention was evaluated. As a result, mutations were detected starting from a mutation ratio of 0.001% (see Figs. 1 and 4). Preferably, mutations were detected starting from a mutation ratio of 0.01%. More preferably, it can be confirmed that mutations were detected starting from a mutation ratio of 1% (see Figs. 1 to 2 and Figs. 4 to 5). In this regard, previous research results have reported that mutations can be discovered as a result of base sequence analysis only when the concentration of mutant DNA is 10% or higher. However, compared to such previous reports, the present invention can detect mutations even at a mutant DNA ratio of 0.001%, which is much lower than 10%, demonstrating that the sensitivity of the kit of the present invention is very high.

[0066] In the step of detecting companion animal PIK3CA mutations by analyzing the gene amplification of the above RT-qPCR, the composition for detecting companion animal PIK3CA gene mutant tumors was used to confirm the detection of PIK3CA_E545K mutations, and a single Melt Peak was confirmed (see Figs. 1 and 3), and the section where the fluorescence sensitivity rapidly decreased occurred within the range of 81 to 84°C, and when the Melt Curve was confirmed, it could be confirmed that it had a single specific melting temperature (see Figs. 1 and 3). It could be confirmed that the composition for detecting companion animal PIK3CA gene mutant tumors had very excellent PIK3CA_E545K mutation specificity.

[0067] In the step of detecting a companion animal PIK3CA mutation by analyzing the gene amplification of the above RT-qPCR, when a composition for detecting a companion animal PIK3CA gene mutant tumor was used to confirm the detection of PIK3CA_H1047R, PIK3CA_H1047L, or PIK3CA_H1047Y mutation, a single Melt Peak was confirmed (see Figs. 4 and 6), and the section where the fluorescence sensitivity rapidly decreased occurred within the range of 81 to 84°C, and when the Melt Curve was confirmed, it could be confirmed that it had a single specific melting temperature (see Figs. 4 and 6). It could be confirmed that the composition for detecting a companion animal PIK3CA gene mutant tumor had very excellent specificity for PIK3CA_H1047R, PIK3CA_H1047L, or PIK3CA_H1047Y mutation.

[0068] According to one embodiment of the present invention, the present invention relates to a method for providing information necessary for treating a companion animal PIK3CA gene mutant tumor, comprising the steps of: isolating a PIK3CA gene from a cancer sample or a sample suspected of having a cancer mutation; performing RT-qPCR using a primer set for detecting a companion animal PIK3CA gene mutant tumor, the primer set comprising a forward primer selected from the group consisting of primers represented by SEQ ID NOs: 1 to 3 and a reverse primer selected from the group consisting of primers represented by SEQ ID NOs: 4 to 8, using the isolated PIK3CA gene as a template; and identifying a specific region of the PIK3CA gene in a product amplified by the RT-qPCR.

[0069] The term "sample" used in the present invention refers to a genetic sample containing a genetic mutation site to be detected. Specifically, it refers to any biological sample capable of genetic analysis, including nuclei and / or mitochondria, such as cells, tissues, organs, body fluids, etc., or endogenous or exogenous genes extracted from these.

[0070] In the step of isolating the PIK3CA gene from the cancer sample or suspected cancer mutation sample, the cancer sample or suspected cancer mutation sample may be collected from a blood sample of a companion animal. The companion animal may be a dog.

[0071] In the step of isolating the PIK3CA gene from the above cancer sample or a sample suspected of having a cancer mutation, the PIK3CA gene can be isolated from the sample by a conventional method known in the art.

[0072] In the step of performing RT-qPCR using a primer set for detecting a companion animal PIK3CA gene mutant tumor, which comprises a forward primer selected from the group consisting of primers represented by SEQ ID NOS: 1 to 3 and a reverse primer selected from the group consisting of primers represented by SEQ ID NOS: 4 to 8 using the above-described separated PIK3CA gene as a template, the RT-qPCR refers to a process of amplifying target DNA by repeating the processes of denaturation, annealing, and extension reaction using target DNA as a template and primers specific to the target DNA.

[0073] In the step of confirming a specific region of the PIK3CA gene in the product amplified by the above RT-qPCR, the specific region of the PIK3CA gene means detecting at least one mutation selected from the group consisting of PIK3CA_E545K, PIK3CA_E542K, PIK3CA_H1047R, PIK3CA_H1047L, and PIK3CA_H1047Y.

[0074] According to one embodiment of the present invention, the present invention relates to a kit for use in detecting a companion animal PIK3CA gene mutant tumor, the kit comprising one or more primers selected from the group consisting of base sequences of SEQ ID NOs: 1 to 8.

[0075] RT-qPCR performed using one or more primers selected from the group consisting of the base sequences of the above sequence numbers 1 to 8 can reliably and quickly identify a companion animal PIK3CA gene mutation, thereby quickly diagnosing a companion animal PIK3CA gene mutation tumor and quickly providing information necessary for treating a companion animal PIK3CA gene mutation tumor.

[0076] The term "kit" as used in the present invention may include DNA polymerase, dNTPs, buffer, etc. to perform PCR amplification reaction. The kit may further include a user guide describing optimal reaction performance conditions. The guide is a printed matter explaining how to use the kit, for example, a method for preparing reverse transcription buffer and PCR buffer, suggested reaction conditions, etc. The guide includes instructions in the form of a pamphlet or leaflet, a label attached to the kit, and on the surface of the package containing the kit. The guide also includes information disclosed or provided through electronic media such as the Internet. The kit may take the form of a bottle, tub, sachet, envelope, tube, ampoule, etc., which may be formed partially or wholly from plastic, glass, paper, foil, wax, etc. The container may be equipped with a completely or partially detachable stopper, which is initially a part of the container or may be attached to the container by mechanical, adhesive, or other means. The container may also be fitted with a stopper, allowing access to the contents by means of a syringe needle.

[0077] The detection of the above companion animal PIK3CA gene mutation tumor may be used to evaluate the prognosis of cancer or predict the risk of developing cancer mutations.

[0078] The detection of the above companion animal PIK3CA gene mutation tumor may provide information necessary for targeted treatment of cancer.

[0079]

[0080] Hereinafter, to aid understanding of the present invention, examples will be given in detail. However, the following examples are intended only to illustrate the scope of the present invention and are not intended to limit its scope. These examples are provided to more fully explain the present invention to those of average skill in the art.

[0081]

[0082] Example 1

[0083] 1. Template DNA

[0084] [Table 1] below shows the PIK3CA gene information of dogs registered in NCBI genebank to be used as a template for gene amplification in the present invention.

[0085] NoSourceSize(bp)Acession Number1Canis lupus familiaris (dog)42263871 bpNC_0518382Canis lupus familiaris (dog)51113282 bpNC_006616

[0086] 2. Making a primer set

[0087] To design primers that generate PCR products for PIK3CA gene mutations but not for wild-type PIK3CA genes, eight primers were designed using the SnapGene program by checking primer size, Tm value, GC content of the primer, and whether self-complementary sequences were present within the primer. The base sequences of the designed primers are shown in [Table 2].

[0088] No.Name of PrimerSequence (5'-3')LengthTm%GC1cPIK3CA-E545-WT-fwd-1gatcctctctctgaaatcactg2254452cPIK3CA-E545K-fwd-1gatcctctctctg aaatcactA2253413cfPIK3CA-H1047-fwd-2catacattcgaaagaccctagc2255454cfPIK3CA-E545-rve-1aggttagtaccaatgcag cgt2159485cPIK3CA-H1047-WT-rve-2tgttgtccagccaccatgatg2160526cPIK3CA-H1047R-rve-2ttgttgtccagccaccatgaG 2159527cPIK3CA-H1047L-rve-2ttgttgtccagccaccatgaA2159488cPIK3CA-H1047Y-rve-2tgttgtccagccaccatgatA216048

[0089]

[0090] Example 2

[0091] PCR was performed on template DNA (Accession Numbers: NC_051838, NC_006616) using the primers prepared in Example 1. Each 10 μL reaction contained 5 μL of master mix, 1 μL of primers (each at a final concentration of 0.1 μM), 2 μL of nuclease-free water, and 1 μL of template DNA (0.1 ng / μL). PCR runs were analyzed using Bio-Rad CFX Maestro software version 2.3. In all analyses, automatic thresholding was used to determine the threshold cycle (Ct). PCR conditions are shown in [Table 3].

[0092] Temperature ℃ Time Cycle Initial Denaturation 953 sec Denaturation 9510 sec 40 Annealing 6610 sec Extension 7230 sec Hold 4 Hold

[0093] Through the above experiments, we confirmed that primers targeting PIK3CA gene mutations can selectively detect only DNA harboring mutations, without detecting normal DNA. Therefore, these primers can specifically detect tumor-causing PIK3CA gene mutations and can be useful in the diagnosis of PIK3CA gene mutation-induced tumors in companion animals.

[0094] cPIK3CA-E545-WT-fwd-1: 5'- gatcctctctctgaaatcactg-3' (SEQ ID NO: 1)

[0095] cPIK3CA-E545K-fwd-1: 5'- gatcctctctctgaaatcacta -3' (SEQ ID NO: 2)

[0096] cfPIK3CA-H1047-fwd-2: 5'- catacattcgaaagaccctagc-3' (SEQ ID NO: 3)

[0097] cfPIK3CA-E545-rve-1: 5'- aggttagtaccaatgcagcgt-3' (SEQ ID NO: 4)

[0098] cPIK3CA-H1047-WT-rve-2: 5'- tgttgtccagccaccatgatg-3' (SEQ ID NO: 5)

[0099] cPIK3CA-H1047R-rve-2: 5'- ttgttgtccagccaccatgag-3' (SEQ ID NO: 6)

[0100] cPIK3CA-H1047L-rve-2: 5'- ttgttgtccagccaccatgaa-3' (SEQ ID NO: 7)

[0101] cPIK3CA-H1047Y-rve-2: 5'- tgttgtccagccaccatgata-3' (SEQ ID NO: 8)

Claims

1. A primer set for detecting a companion animal PIK3CA gene mutant tumor, comprising a forward primer selected from the group consisting of primers represented by SEQ ID NOs: 1 to 3 and a reverse primer selected from the group consisting of primers represented by SEQ ID NOs: 4 to 8.

2. In claim 1, The primer set for detecting the companion animal PIK3CA gene mutant tumor is a primer set for detecting the companion animal PIK3CA gene mutant tumor, which detects at least one mutation selected from the group consisting of PIK3CA_E545K, PIK3CA_E542K, PIK3CA_H1047R, PIK3CA_H1047L, and PIK3CA_H1047Y. 3.a) A primer set comprising a forward primer represented by sequence number 1 and a reverse primer represented by sequence number 4; b) a primer set comprising a forward primer represented by sequence number 2 and a reverse primer represented by sequence number 4; c) a primer set comprising a forward primer represented by sequence number 3 and a reverse primer represented by sequence number 5; d) a primer set comprising a forward primer represented by sequence number 3 and a reverse primer represented by sequence number 6; e) a primer set comprising a forward primer represented by sequence number 3 and a reverse primer represented by sequence number 7; and f) A primer set consisting of a forward primer represented by sequence number 3 and a reverse primer represented by sequence number 8. A composition for detecting a companion animal PIK3CA gene mutant tumor, comprising at least one primer set selected from the group consisting of: 4.a) a primer set comprising a forward primer represented by sequence number 1 and a reverse primer represented by sequence number 4; and b) A primer set consisting of a forward primer represented by sequence number 2 and a reverse primer represented by sequence number 4. A composition for detecting a companion animal PIK3CA gene mutant tumor, comprising at least one primer set selected from the group consisting of: The above primer set is a composition for detecting a companion animal PIK3CA gene mutant tumor, which detects PIK3CA_E545K mutation. 5.c) A primer set comprising a forward primer represented by sequence number 3 and a reverse primer represented by sequence number 5; d) a primer set comprising a forward primer represented by sequence number 3 and a reverse primer represented by sequence number 6; e) a primer set comprising a forward primer represented by sequence number 3 and a reverse primer represented by sequence number 7; and f) A primer set consisting of a forward primer represented by sequence number 3 and a reverse primer represented by sequence number 8. A composition for detecting a companion animal PIK3CA gene mutant tumor, comprising at least one primer set selected from the group consisting of: A composition for detecting a companion animal PIK3CA gene mutant tumor, wherein the above primer set detects at least one mutation selected from the group consisting of PIK3CA_H1047R, PIK3CA_H1047L, and PIK3CA_H1047Y.

6. A step of performing RT-qPCR on the PIK3CA gene of a companion animal using a primer set for detecting a companion animal PIK3CA gene mutant tumor, the primer set comprising a forward primer selected from the group consisting of primers represented by SEQ ID NOS: 1 to 3 and a reverse primer selected from the group consisting of primers represented by SEQ ID NOS: 4 to 8; Step of detecting PIK3CA mutation in companion animals by analyzing gene amplification of the above RT-qPCR A method for diagnosing a companion animal PIK3CA gene mutant tumor comprising:

7. In claim 6, A method for diagnosing a PIK3CA gene mutant tumor, wherein the companion animal PIK3CA gene mutant tumor is a mammary tumor.

8. A step of isolating the PIK3CA gene from a cancer sample or a sample suspected of having a cancer mutation; A step of performing RT-qPCR using a primer set for detecting a companion animal PIK3CA gene mutant tumor, which comprises the separated PIK3CA gene as a template and a forward primer selected from a group consisting of primers represented by SEQ ID NOS: 1 to 3 and a reverse primer selected from a group consisting of primers represented by SEQ ID NOS: 4 to 8; and Step for confirming a specific region of the PIK3CA gene in the product amplified by the above RT-qPCR A method for providing information necessary for treating a companion animal PIK3CA gene mutant tumor comprising:

9. In claim 8, A method for providing information necessary for the treatment of a companion animal PIK3CA gene mutant tumor, wherein the cancer sample or suspected cancer mutation occurrence sample is collected from a blood sample of the companion animal.

10. A kit for detecting a companion animal PIK3CA gene mutant tumor, comprising at least one primer selected from the group consisting of base sequences of sequence numbers 1 to 8.

Images