Prime editing system with enhanced correction precision and use thereof

Abstract

The present invention relates to a prime editing system with enhanced correction precision and a use thereof. More specifically, the present invention relates to a recombinant vector for prime editing with improved precision, comprising: a prime editor expression cassette including a mutant Cas9 (R221K, N394K, D840A), a nucleocapsid protein, and an RNaseH domain-deleted mutant MMLV reverse transcriptase (D200N, T306K, W313F, T330P, L603W); and a pegRNA (prime editing guide RNA) expression cassette transcriptionally regulated by a U6 composite promoter.

Description

Prime editing system with improved correction precision and its use

[0001] The present invention relates to a prime editing system with improved correction precision and its use.

[0002] Prime editing, a CRISPR-Cas9 tool first described by Anzalone et al. in 2019 (Nature 2019, 576, 149-157), has been reported to have the potential to repair approximately 89% of human pathogenic genetic variations, as it can accurately correct all types of point mutations, insertions, and deletions without inducing double-strand breaks (DSBs).

[0003] Prime editing technology requires two main components: the prime editor (PE) protein, which consists of a reverse transcriptase fused to the nickase Cas9 (nCas9), and the prime editing guide RNA (pegRNA), which guides PE to the target site and serves as a template for the desired correction. The pegRNA consists of a primer binding site (PBS), which serves as a docking site for the reverse transcriptase, and a reverse transcription template (RTT), which contains the desired correction information.

[0004] Prime editing has been shown to be more effective than homology-directed repair (HDR) and has been shown to have advantages over base editing for larger target areas and targets at risk of bystander editing.

[0005] Meanwhile, Korean Patent Publication No. 2022-0112698 discloses a 'composition for prime editing with improved correction efficiency', and Korean Patent Publication No. 2023-0075420 discloses 'prime editing using HIV reverse transcriptase and Cas9 or a variant thereof', but there is no description of the 'prime editing system with improved correction precision and its use' of the present invention.

[0006] The present invention seeks to provide a prime editing system capable of improving the precision of desired editing through a combination of various prime editor component proteins or regulatory factors.

[0007] To solve the above problem, the present invention provides a recombinant vector for prime editing with improved editing precision, comprising a Prime Editor expression cassette comprising a mutant Cas9 (CRISPR associated protein 9) protein, a nucleocapsid protein, and a mutant MMLV (Moloney murine leukemia virus) reverse transcriptase protein lacking an RNase H domain; and a prime editing guide RNA (pegRNA) expression cassette.

[0008] The present invention also provides a method for editing a gene of a target organism, comprising the step of introducing the recombinant vector into an isolated eukaryotic cell or a eukaryotic organism other than a human.

[0009] In addition, the present invention provides a composition for prime editing with improved editing precision, comprising as active ingredients a prime editor comprising a mutant Cas9 protein, a nucleocapsid protein, and a mutant MMLV reverse transcriptase protein lacking an RNase H domain, or a nucleic acid sequence encoding the same; and a prime editing guide RNA or a nucleic acid sequence encoding the same.

[0010] The use of a recombinant vector for prime editing according to the present invention can improve the precision of correction of an intended site, and thus can be usefully utilized in the fields of gene therapy and precision gene editing.

[0011] Figure 1 is a schematic diagram of the prime editor (PE) expression cassette used in the present invention. p35S: CaMV 35S promoter, nCas9max: mutant SpCas9 (R221K, N394K, D840A), nCas9: mutant SpCas9 (D840A), MMLV-RT: mutant MMLV reverse transcriptase (D200N, T306K, W313F, T330P, L603W), MMLV-RT-△RnaseH: RNaseH domain truncated mutant MMLV reverse transcriptase (D200N, T306K, W313F, T330P, L603W), MHL1dn: truncated MLH1 D754-756 lacking endonuclease domain, NC; viral nucleocapsid protein, EURb7: EU + Rb7 dual terminator, MCP-MMLV-RT: MS2 coat protein fused MMLV-RT (MCP was cloned from pREDIT_MCP-RecT, MMLV RT is a tobacco codon-optimized MMLV RT from the PE2).

[0012] FIG. 2 and FIG. 3 are schematic diagrams of recombinant vectors for prime editing used in embodiments of the present invention. FIG. 2 is a vector in which the expression of pegRNA is controlled by the U6-26 core promoter, and FIG. 3 is a vector in which the expression of pegRNA is controlled by the U6 composite promoter. Supp. gRNA refers to a gRNA that binds to a position close to pegRNA for ALS1 prime editing and assists the prime editing reaction, and is composed of the base sequence of SEQ ID NO: 45. In FIG. 2 and FIG. 3, pegR1.6-MS2 is composed of the base sequence of SEQ ID NO: 46, and pegR1.8 is composed of the base sequence of SEQ ID NO: 11 and SEQ ID NO: 12 in Table 1 linked to both ends of the Cas9 gRNA scaffold sequence (corresponding to bases 92 to 177 in the base sequence of SEQ ID NO: 45).

[0013] Figure 4 shows the results of the correction efficiency analysis of prime editing using the recombinant vectors of Figures 2 and 3. *: p < 0.05, ***: p < 0.0002, ****: p < 0.0001.

[0014] Figure 5 is the result of the analysis of the correction precision of prime editing according to the prime editor system based on the results of Figure 4. **: p < 0.0021, ****: p < 0.0001.

[0015] Figure 6 shows the results of analyzing the frequency and efficiency of intended prime editing in regenerated plants. The y-axis numbers in the graph represent the frequency (%) of prime editing analyzed by Sanger sequencing of the target locus in transformants (plants regenerated from cotyledon explants transformed with the vectors of Figure 2 or Figure 3, i.e., PE0 events), and the numbers displayed at the top of each plot represent the efficiency of intended prime editing at the plant stage, which was calculated by dividing the number of transformants with intended prime editing by the total number of transformants analyzed.

[0016] Figure 7 shows the PCR results confirming the presence of replicon and T-DNA in some PE0 event plants.

[0017] In order to achieve the object of the present invention, the present invention provides a recombinant vector for prime editing with improved editing precision, comprising a Prime Editor expression cassette comprising a mutant Cas9 (CRISPR associated protein 9) protein, a nucleocapsid protein, and a mutant MMLV (Moloney murine leukemia virus) reverse transcriptase protein lacking an RNase H domain; and a prime editing guide RNA (pegRNA) expression cassette.

[0018] A prime editor is a type of CRISPR / Cas9-based gene-editing system that can introduce genetic changes by cutting only a single strand of DNA without double-stranded DNA cleavage. The prime editor may comprise a Cas nickase-reverse transcriptase (RT) fusion protein and a prime editing guide RNA (pegRNA), and additional domains or proteins may be additionally included in the fusion protein to enhance the efficiency of the prime editing.

[0019] The term "pegRNA" as used herein includes a guide sequence (or spacer sequence) that recognizes a target sequence, a trans-activating crispr RNA (tracrRNA) scaffold sequence, a primer binding site (PBS) required for initiating reverse transcription, and a reverse transcription template (RTT) containing a desired genetic change. In addition, the pegRNA may also include a modified form, such as a tevopreQ1 fusion, which can enhance the stability of the pegRNA.

[0020] In the above pegRNA, the guide sequence refers to a sequence within the guide RNA that designates a target site and includes a sequence that is fully or partially complementary to the target sequence. The guide sequence is any polynucleotide sequence that hybridizes with the target DNA sequence and has sufficient complementarity with the target polynucleotide sequence to induce sequence-specific binding of the gene editing complex to the target DNA sequence.

[0021] In the recombinant vector according to the present invention, the mutant Cas9 protein may be SpCas9 (Streptococcus pyogenesCas9) having R221K, N394K, and D840A mutations, but is not limited thereto.

[0022] In addition, in the recombinant vector according to the present invention, the mutant MMLV reverse transcriptase protein lacking the RNase H domain may additionally have D200N, T306K, W313F, T330P, and L603W mutations in addition to the RNase H domain deletion, but is not limited thereto.

[0023] In a recombinant vector according to one embodiment of the present invention, the prime editor may be encoded by the base sequence of SEQ ID NO: 6, but is not limited thereto.

[0024] The term "recombinant" as used herein refers to a cell that replicates a heterologous nucleic acid, expresses said nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. A recombinant cell may express a gene or gene fragment not found in the cell's native form, either in sense or antisense form. Furthermore, a recombinant cell may express a gene found in the cell's native form, but in a modified form that has been reintroduced into the cell by artificial means.

[0025] Additionally, the term "vector" is used to refer to a DNA fragment(s) or nucleic acid molecule that is delivered into a cell. A vector replicates DNA and can reproduce independently in a host cell. The term "vector" is often used interchangeably with "vector."

[0026] The above vector may be, but is not limited to, a virus, cosmid, or plasmid vector. The type of the vector is not particularly limited as long as it can express a desired gene and produce a desired protein in various target cells, such as prokaryotic cells and eukaryotic cells. However, a vector that can produce a large amount of a foreign protein in a form similar to that in the natural state while possessing a promoter that exhibits strong activity and a strong expression ability can be used.

[0027] The term "expression cassette" as used herein refers to a nucleic acid sequence comprising one or more genes and sequences that regulate their expression, for example, any combination of various cis-acting transcriptional regulatory elements. The expression cassette of the present invention comprises three main elements: i) a promoter; ii) a second polynucleotide, which may be referred to as a "coding polynucleotide" or "coding sequence" (also referred to as a coding gene), which is operably linked to the promoter and whose transcription is directed by the promoter when the expression cassette is introduced into a cell; and iii) a terminator polynucleotide (also referred to as a transcription terminator) that directs the termination of transcription and is located immediately downstream of the second polynucleotide.

[0028] The above promoter may be a general promoter, which may be constitutive or inducible, and in the case of prokaryotes, the lac, tac, T3 and T7 promoters, and in the case of eukaryotes, the cauliflower mosaic virus (CaMV) promoter, the simian virus 40 (SV40) promoter, the mouse mammary tumor virus (MMTV) promoter, the human immunodeficiency virus (HIV), for example, the long terminal repeat (LTR) promoter of HIV, the moloney virus promoter, the cytomegalovirus (CMV) promoter, the Epstein-Barr virus (EBV) promoter, the Rous sarcoma virus (RSV) promoter, as well as the β-actin promoter, the human hemoglobin promoter, the human muscle creatine promoter, the human metallothionein promoter, and the like, but are not limited thereto.

[0029] The prime editor expression cassette according to one embodiment of the present invention may be one whose expression is regulated by a CaMV 35S promoter and an EURb7 terminator (EU + Rb7 dual terminator), and the pegRNA expression cassette may be one whose transcription is regulated by a U6 composite promoter, but is not limited thereto.

[0030] In addition, in the present invention, the CaMV 35S promoter may be composed of a base sequence of SEQ ID NO: 7, the EURb7 terminator may be composed of a base sequence of SEQ ID NO: 8, and the U6 composite promoter may be composed of a base sequence of SEQ ID NO: 10, but is not limited thereto.

[0031] In addition, the recombinant vector for prime editing according to the present invention may additionally include a selection marker expression cassette, but is not limited thereto.

[0032] The above selection marker is used to select cells transformed with the vector. Markers that confer selectable phenotypes, such as drug resistance, nutrient requirements, cytotoxic agent resistance, or surface protein expression, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive, allowing the transformed cells to be selected.

[0033] The present invention also provides a method for editing a gene of a target organism, comprising the step of introducing the recombinant vector into an isolated eukaryotic cell or a eukaryotic organism other than a human.

[0034] In the gene editing method of the target organism according to the present invention, the recombinant vector is as described above. In addition, in the gene editing method according to the present invention, the introduction of the recombinant vector means transformation into the target organism. When the host cell is a prokaryotic cell, the transformation method can be performed by the CaCl2 method, the Hanahan method (Hanahan, D., J Mol Biol, (1983) 166:557-580), and the electroporation method. In addition, when the host cell is a eukaryotic cell, the vector can be injected into the host cell by the microinjection method, the calcium phosphate precipitation method, the electroporation method, the liposome-mediated transfection method, the DEAE-dextran treatment method, and the gene bombardment method.

[0035] The present invention also provides a composition for prime editing with improved precision, comprising as active ingredients a prime editor comprising a mutant Cas9 (CRISPR associated protein 9) protein, a nucleocapsid protein, and a mutant MMLV (Moloney murine leukemia virus) reverse transcriptase protein lacking an RNase H domain, or a nucleic acid sequence encoding the same; and a prime editing guide RNA (pegRNA) or a nucleic acid sequence encoding the same.

[0036] The composition for prime editing according to the present invention may be a composition for editing target DNA or genes in vivo or ex vivo.

[0037] The composition according to the present invention is characterized by improving the precision of the desired correction at the target site.

[0038]

[0039] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

[0040]

[0041] Experimental method

[0042] 1. Combination of PE protein elements and plasmid construction

[0043] For the production of PE proteins used in the present invention, PE2max, PE4max, nCas9 (H840A) of ePEmax1, nCas9 of ePEmax2, ePEmax3, and eRT were cloned from the plasmid pCMV-PEmax-P2A-hMLH1dn (Addgene #174828). The nCas9 of PPE-NC-v1 was cloned from the nCas9-PPE plasmid (Addgene #140445), and NC and RT were cloned from the pH-ePPE plasmid (Addgene #183097). ePPE was cloned from the pH-ePPE plasmid, and the NC sequences used in ePEmax1, ePEmax2, ePEmax3, and PE2max-NC were cloned from the pH-ePPE plasmid.

[0044] For the basic PE expression cassette, transcription was controlled using the CaMV 35S promoter (p35S) (Addgene #50267) and the EU + Rb7 double terminator (EURB7) (Diamos and Mason, 2018, Plant Biotechnol J. 16:1971-1982). For experiments evaluating the influence of promoters, several promoters (p35S, dual CaMV 35S promoter (p2x35S) (Addgene #50269) and tomato EF1α (PSLEF1α) (Niu et al., 2023, Plant Biotechnol J. 21:5-7) were used together with the EU + 35S + Rb7 triple terminator (t3T). To evaluate the influence of terminators on PE efficiency, p35S was combined with several terminators (t35S, tNOS, EURB7, t3T).

[0045] Modified epegRNAs were designed by introducing basic modifications to the epegRNA scaffold in a modified SpCas9 scaffold (Nelson et al., 2022, Nat Biotechnol. 40:402-410). Transcription of pegRNA was driven by the U6-26 core promoter (pU6-26 core) or the U6 composite promoter (Jiang et al., 2020, Genome Biol. 21:257). The edited sites / loci, gRNA, and RTT information are detailed in Table 1. pegRNAs were amplified by PCR, cloned into expression cassettes, and then ligated into binary vectors by Golden Gate assembly.

[0046] For T-DNA-based PE tools, the expression cassettes of the selection marker (NPTⅡ, Addgene #51144), PE protein, and pegRNA were cloned into the pAGM4723 plasmid (Addgene #48015), and for geminivirus replication system, the expression cassettes were cloned into the pLSL.R.Ly vector as previously reported (Vu et al., 2020, Plant Biotechnol J. 18:2133-2143). All biocomponents [pNOS::NptⅡ::tOCS (from pICSL11024, Addgene Plasmid #51144), PE2max (SEQ ID NO: 1), PE4max (SEQ ID NO: 2), PPE-NC-v1 (SEQ ID NO: 3), ePPE (SEQ ID NO: 4), ePEmax1 (SEQ ID NO: 5), ePEmax2 (SEQ ID NO: 6), 35S promoter (SEQ ID NO: 7), EU + Rb7 double terminator (EURb7; SEQ ID NO: 8), U6-26 core promoter (SEQ ID NO: 9), U6 composite promoter (SEQ ID NO: 10)] were domesticated into Moclo (Weber et al., 2011, PLoS One. 6(2):e16765) level 0 plasmid and assembled into PE protein combination and binary vectors.

[0047] tomato ALS1 pegRNA sequence for gene prime editing Accession no. Solyc03g044330 Targeted change P186S: +1 C to T; +3 A to TgRNA (5'-3')CTATTACAGGTCAAGTGCCA (SEQ ID NO: 11)RTT + PBS * (5'-3')CAATCATCCTCCTaGaCACTTGACCT(SEQ ID NO: 12)PBS: Underlined sequence

[0048]

[0049]

[0050]

[0051] 2. Analysis of Agrobacterium-mediated tomato transformation and prime editing efficiency.

[0052] Agrobacterium-mediated transformation of tomato was performed as described by Vu et al. In the present invention, Agrobacterium tumefaciens strains GV3101::pMP90, EHA105, and EHA105-based SuperAgro version 2 (Nonaka et al., 2019, Front Plant Sci. 10:1204) were used. Seven-day-old cotyledons of tomato plants were excised and used for transformation. Agrobacterium containing PE plasmid were cultured, harvested by centrifugation, and resuspended in ABM-MS solution (Vu et al., 2020) supplemented with 100 μM acetosyringone, and OD 600nm This was prepared to be 0.8. Agrobacteria were activated by incubating at 28°C for 1 hour before transformation. Agrobacteria and cotyledons were mixed and incubated at room temperature for 20 minutes, and the transformed plants were cocultured for 2 days before being washed and transferred onto selection media. Samples were incubated at 31°C for 5 days, then at 28°C for 5 days, and then 25°C incubation conditions were applied for the remaining stages. Redifferentiated shoots were selected on media containing 80 mg / L kanamycin and rooting was induced before transferring to soil. Hardened plants were then used to evaluate PE efficiency. For temperature treatment experiments, after coculture, explants were incubated at different temperatures for 5 days, then at 28°C for 5 days, and then transferred to 25°C in the later stages.

[0053] To evaluate PE efficiency, samples were collected 16 days post-transformation (dpt) and subjected to targeted deep sequencing. Leaves of transformants were collected at all plant growth stages and screened for PE alleles using PCR and Sanger sequencing.

[0054]

[0055] 3. Targeted deep sequencing

[0056] Genomic DNA (gDNA) was extracted from cotyledons or plant leaves using the CTAB method. Analysis was performed using the MiniSeq sequencing service (MiniSeq™ System, Illumina, USA). MiniSeq samples were prepared through three PCRs using the primers listed in Table 4. The third PCR was performed using the primers provided by the manufacturer to assign sample IDs. Subsequently, the MiniSeq raw data FASTQ files were analyzed using Cas-Analyzer (Park et al., 2016, Bioinformatics 33:286-288) and CRISPResso2 (Clement et al., 2019, Nat Biotechnol. 37:224-226) tools with the parameters listed in Table 5.

[0057] Primer information for MiniSeq sample amplification Name Sequence (5'-3') Sequence number ALS-F1 CCTCACCATCTCCATGTTTCTC38 ALS-R1 GTCTCAGCTCCTCACTTGATTG39 ALS-F2 ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCTACAAATCTTGTTAGTGGTCTTG40 ALS-R2 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GCTTCGTAATAGATCTCGTTACCTC41

[0058] Parameters used in FASTQ file analysis Name Sequence (5'-3') Sequence number Reference sequence GCTACAATCTTGTTAGTGGTCTTGCGGATGCTTTGTTAGATAGTATTCCGATTGTTGCTATTACAGGTCAAGTGCCAAGGAGGATGATTGGTACTGATGCGTTCCAGGAAACGCCTATTGTTGAGGTAACGAGATCTATTACGAAGCA42 Donor (RGEN) AGGTCAAGTGtCtAGGAGGATGATTG43 CRISPResso2 3' extension CAATCATCCTCCTaGaCACTTGACCT44

[0059]

[0060] 4. Identification of transformants containing the PE allele

[0061] After the hardening step, PE allele screening was performed on surviving transformants. Three different leaf fragments from each plant were collected and combined, and gDNA was isolated using the CTAB method. PCR reactions were used to amplify DNA sequences flanking the target region, and the PCR products were sequenced by Sanger sequencing. The resulting sequencing chromatograms were analyzed by the ICE Synthgo tool to screen for potential events carrying the PE allele. Some representative PE events were subsequently verified by targeted deep sequencing.

[0062]

[0063] 5. Assessing the presence of T-DNA and replicon within PE events

[0064] To assess the presence of T-DNA and replicon, gDNA from PE plants was used as a template for PCR reactions using primer pairs designated for the right border (RB) of the T-DNA and the circularized form of the replicon. The replicon primers were designed to amplify only the circularized DNA configured to be released from the vector (Vu et al., 2020). PCR products were developed on a 1% agarose gel, and the presence of T-DNA and replicon was determined by identifying PCR bands of the sizes corresponding to the T-DNA and replicon, respectively.

[0065]

[0066] 6. Off-target analysis

[0067] The gRNA sequence of the pegRNA was searched for potential off-target sites within the tomato genome database Solanum lycopersicum (SL2.4) using the Cas-OFinder tool, which had fewer than four mismatches with the gRNA sequence. Cotyledon explants transformed with pegRNA at 16 days posttransformation (dpt) with identified potential off-target sites were analyzed by targeted deep sequencing using the primers listed in Table 4.

[0068]

[0069] 7. Data Analysis

[0070] All experiments were performed at least three times. Statistical analyses and scatter plots were processed using MS Excel and GraphPad Prism 9.0 software. Multiple comparisons were performed using the uncorrected Fisher's LSD test.

[0071]

[0072] Example 1. Analysis of proofreading efficiency and precision according to the type of Prime Editor protein combination and pegRNA transcription control promoter.

[0073] The present inventors constructed various recombinant vectors (Figs. 2 and 3) targeting the tomato ALS1 gene and transformed cotyledons of the tomato Honggwang cultivar with each of these vectors via Agrobacterium. Subsequently, the target region was analyzed for base correction using next-generation sequencing (NGS) analysis.

[0074] As a result, as disclosed in Fig. 4, it was confirmed that the correction efficiency was significantly superior in the vector experimental group in which pegRNA transcription was controlled by the U6 composite promoter than in the vector in which pegRNA expression was controlled by the U6-26 core promoter, and among these, it was confirmed that the intended base correction occurred the most in the experimental groups using the prime editors of PE2max and ePEmax2. However, the rate of unintended editing in the experimental group using the PE2max prime editor was significantly higher than that in the experimental group using the ePEmax2 prime editor, and it was confirmed that the prime editing precision was the highest in the experimental group using the ePEmax2 prime editor.

[0075]

[0076] Example 2. Analysis of the frequency and efficiency of intended editing in prime-edited redifferentiated plants.

[0077] After regenerating plants from the callus in which the tomato ALS1 gene was corrected through the above Example 1, the intended prime editing was reconfirmed in the regenerated plants. As a result, as shown in Fig. 6, it was confirmed that even at the plant stage, when the pegRNA transcription control promoter was the U6 composite promoter, the intended prime editing efficiency was generally higher than that of the U6-26 core promoter, and it was confirmed that the intended prime editing efficiency was the best in the experimental group using the ePEmax2 prime editor.

[0078]

[0079] Example 3. Presence of T-DNA and replicon in prime editing event plants

[0080] The presence of T-DNA and replicon in the tomato ALS1 gene prime-edited plant obtained through Example 1 was confirmed through PCR. The primers used were identical to those disclosed in Korean Patent No. 2074744.

[0081] Analysis results showed that T-DNA and replicon were not detected in some PE0 event plants (Fig. 7), and these individuals were advanced through generations.

Claims

1. A recombinant vector for prime editing with improved precision, comprising: a prime editor expression cassette comprising a mutant Cas9 (CRISPR associated protein 9) protein, a nucleocapsid protein, and a mutant MMLV (Moloney murine leukemia virus) reverse transcriptase protein lacking the RNase H domain; and a prime editing guide RNA (pegRNA) expression cassette.

2. A recombinant vector for prime editing in claim 1, characterized in that the mutant Cas9 protein is SpCas9 (Streptococcus pyogenesCas9) having R221K, N394K, and D840A mutations.

3. A recombinant vector for prime editing, characterized in that the mutant MMLV reverse transcriptase protein lacking the RNase H domain in the first paragraph additionally has D200N, T306K, W313F, T330P, and L603W mutations in addition to the RNase H domain deletion.

4. A recombinant vector for prime editing, characterized in that in the first paragraph, the prime editor is encoded by a base sequence of sequence number 6.

5. A recombinant vector for prime editing, characterized in that in the first paragraph, the prime editor expression cassette is expressed by a CaMV 35S promoter and a EURb7 terminator.

6. A recombinant vector for prime editing, characterized in that the pegRNA expression cassette of paragraph 1 is regulated in expression by a U6 composite promoter.

7. A recombinant vector for prime editing, characterized in that in claim 1, the recombinant vector additionally comprises a selection marker expression cassette.

8. A method for editing a gene of a target organism, comprising the step of introducing a recombinant vector for prime editing of any one of claims 1 to 7 into an isolated eukaryotic cell or a eukaryotic organism other than a human.

9. A composition for prime editing with improved precision, comprising, as active ingredients, a prime editor comprising a mutant Cas9 (CRISPR associated protein 9) protein, a nucleocapsid protein, and a mutant MMLV (Moloney murine leukemia virus) reverse transcriptase protein lacking an RNase H domain, or a nucleic acid sequence encoding the same; and a prime editing guide RNA (pegRNA) or a nucleic acid sequence encoding the same.

10. A composition for prime editing, characterized in that the composition in claim 9 is for correcting target DNA or genes in vivo or ex vivo.

Images