Therapeutic agent for metabolic diseases comprising delivery system based on metal nanoparticle-nucleic acid conjugate

Abstract

The present invention relates to: a use of a gene delivery system as a drug carrier, the gene delivery system comprising metal nanoparticles and a double-helical nucleic acid molecule bound to the surface of the nanoparticles, in particular, a use of the delivery system for treating metabolic diseases; or a pharmaceutical composition for preventing or treating metabolic diseases, the pharmaceutical composition comprising the delivery system.

Description

Metabolic disease therapeutic agent comprising a carrier based on a metal nanoparticle-nucleic acid conjugate

[0001] The present invention relates to the use of a carrier comprising a metal nanoparticle and a double-helical nucleic acid molecule bound to the surface of the nanoparticle as a drug delivery vehicle, particularly to a therapeutic agent for metabolic diseases comprising the carrier or a pharmaceutical composition comprising the same.

[0002] Nanoparticles are particles with nanometer-sized dimensions. Their small size and high surface area allow them to possess diverse physical and chemical properties. Gold nanoparticles, the most widely used nanoparticles, exhibit surface electromagnetic resonance (SPR) in the visible light range, which occurs due to light absorption and scattering depending on their size and shape. This allows them to be utilized for detection and imaging based on fluorescent labels. Furthermore, their ease of introducing surface functional groups, coupled with their high biocompatibility and stability, make them ideal for the delivery of biological substances such as DNA, RNA, proteins, and antibodies, as well as various drugs.

[0003] Technologies for delivering genetic material into cells, such as cell therapy, to produce antigens or proteins for treatment or prevention are being continuously researched, and in particular, vaccine development technology has grown significantly due to the recent pandemic, leading to the development of various genetic vaccines such as DNA vaccines, mRNA vaccines, and viral vector vaccines.

[0004] DNA is the simplest genetic material, making it easily genetically modified, potentially shortening the development period for vaccines and other therapeutics. Furthermore, it offers significant advantages over other vaccine candidates, such as viruses, proteins, and RNA, in terms of production facility construction and production costs. Furthermore, its superior stability facilitates easy storage and distribution. However, DNA vaccines require delivery to the nucleus of the cell, where mRNA is directly produced. While DNA injected into the nucleus can continuously produce mRNA and antigen proteins, the introduction of a different genetic trait into the cell nucleus raises concerns about adverse effects, such as innate immune responses. Furthermore, when delivered via plasmids, DNA can carry bacterial genes in addition to antigens, potentially leading to adverse effects such as mutations in the body. Therefore, research into carriers and delivery technologies for the safe delivery of DNA into cells is necessary.

[0005] Accordingly, the present inventors have made extensive research efforts to develop a nucleic acid delivery technology to efficiently deliver nucleic acid molecules, particularly double-stranded DNA (dsDNA), that can be delivered into cells and expressed independently to the nucleus of cells. As a result, they have developed a delivery system capable of delivering a nucleic acid molecule containing a gene of interest into cells by directly covalently attaching it to the surface of metal nanoparticles, and have completed the present invention for a pharmaceutical composition for treating diabetes or a metabolic disease comprising the same using the same.

[0006] Accordingly, the object of the present invention is to provide a gene carrier for the treatment of metabolic diseases, comprising a gold nanoparticle; and a double-stranded DNA that binds to the gold nanoparticle via a moiety containing one or more functional groups and is delivered into a cell to express a substance that expresses insulin or promotes the secretion of insulin alone.

[0007] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating metabolic diseases comprising the gene carrier.

[0008] To achieve the above-described purpose, the present invention provides a gene carrier for the treatment of metabolic diseases, comprising: a gold nanoparticle; and a double-stranded DNA that binds to the gold nanoparticle via a moiety containing one or more functional groups and is delivered into a cell to express a substance that expresses insulin or promotes the secretion of insulin on its own.

[0009] In order to achieve another object of the present invention, the present invention provides a pharmaceutical composition for preventing or treating a metabolic disease, which comprises the gene carrier.

[0010] Hereinafter, the present invention will be described in detail.

[0011] In one aspect, the present invention relates to a gene carrier for the treatment of metabolic diseases, comprising: a gold nanoparticle; and a double-stranded DNA that binds to the gold nanoparticle via a moiety comprising one or more functional groups and is delivered into a cell to express a substance that expresses insulin or promotes the secretion of insulin on its own.

[0012] The gene carrier of the present invention comprises a metal nanoparticle. The metal nanoparticle has a diameter in the nanometer unit, and although the size is not limited thereto, it preferably has a diameter of 5 to 500 nm, more preferably 10 to 200 nm. Nanoparticles of this size are easy to manufacture in the form of stable particles, and their size can be easily controlled during the manufacturing process. In addition, in the case of the metal nanoparticles for use as a gene carrier as in the present invention, if the diameter increases to more than 500 nm, not only are the characteristics as nanoparticles lost, but also the bonding between the metal surface and the functional group becomes weak, making it difficult to manufacture a carrier using the nanoparticles.

[0013] In addition, the metal nanoparticles may preferably be gold nanoparticles, and the gold nanoparticles are harmless to the human body and have high biocompatibility, unlike heavy metals such as manganese, aluminum, cadmium, lead, mercury, cobalt, nickel, and beryllium.

[0014] As an example, the gold nanoparticles used in the present invention can be manufactured as follows: HAuCl4 is used as a gold source, and HAuCl4 is reduced using sodium citrate as a reducing agent to manufacture gold nanoparticles. In this case, the size of the gold nanoparticles can be controlled by varying the amount of citrate added. That is, as the amount of citrate added increases, nucleation increases, and thus the size of the gold nanoparticles decreases.

[0015] The metal nanoparticles of the present invention have a nucleic acid molecule containing a gene of interest bound to their surface. The nucleic acid molecule is bound to the surface of the metal nanoparticles for the purpose of transporting the gene of interest into cells and allowing it to be expressed independently.

[0016] The nucleic acid molecule is not limited in type. In the present invention, the nucleic acid molecule means a compound having a structure in which a base, a sugar, and a phosphoric acid are linked by a phosphodiester bond, and includes naturally occurring oligonucleotides such as 2'-deoxyribonucleic acid (hereinafter, "DNA") and ribonucleic acid (hereinafter, "RNA"), and nucleic acids containing a modified sugar moiety, a modified phosphate moiety, or a modified nucleobase. Modifications to the sugar moiety include replacement of a ribose ring with a hexose, cyclopentyl, or cyclohexyl ring. Alternatively, the D-ribose ring of a naturally occurring nucleic acid may be replaced by an L-ribose ring, or the β-anomer of a naturally occurring nucleic acid may be replaced by an α-anomer. The nucleic acid molecule may also contain one or more abasic moieties. Modified phosphate moieties may also include phosphorothioates, phosphorodithioates, methylphosphonates, and methyl phosphates. Such nucleic acid analogs are known to those skilled in the art.Nucleic acid molecules comprising a mixture of two or more of the above mixtures can be produced, for example, from a mixture of deoxyribo- or ribonucleosides, particularly from a mixture of a deoxyribonucleoside and a 2'-O-substituted ribonucleoside, such as 2'-O-methylribonucleoside or 2'-O-methoxyethyl ribonucleoside.

[0017] More specifically, the nucleic acid molecule may be selected from DNA, RNA, or DNA / RNA molecules, and more specifically, may be double-stranded DNA. The double-stranded DNA may include cDNA, gDNA, plasmid DNA, and PCR DNA that can be expressed independently. In one embodiment, the double-stranded DNA is bound to gold nanoparticles in a double-stranded state, and is used to transport the double-stranded DNA into cells. This is different from single-stranded DNA, which is bound to gold nanoparticles, then enters cells and hybridizes with a complementary strand.

[0018] Furthermore, the nucleic acid molecule may be introduced into a cell and expressed independently after containing one or more genes of interest. The term "gene of interest" as used herein includes any nucleic acid that has therapeutic, diagnostic, and / or prophylactic effects and / or induces a desired biological and / or pharmacological effect, or a nucleic acid encoding a functional peptide or polypeptide (protein) of interest (either native or modified).

[0019] In particular, in the present invention, the gene of interest is a substance that expresses insulin or a substance that promotes the secretion of insulin, and is a substance that can have a preventive or therapeutic effect on metabolic diseases through effects such as blood sugar control and appetite suppression. The substance is not limited thereto, but may be an insulin gene (INS (Insulin gene)) or a substance that promotes the secretion of insulin, selected from among GLP-1 (Glucagon-Like Peptide-1), GLP-1 Receptor Agonists, GIP (Gastric Inhibitory Polypeptide), Oxyntomodulin, PYY (Peptide YY), CCK (Cholecystokinin), DPP-4 inhibitors (Dipeptidyl Peptidase-4 Inhibitors), and PDX1 (Pancreatic and Duodenal Homeobox 1).

[0020] In the present invention, the term "expressed alone" means that the gene of interest contained in the nucleic acid molecule is transcribed and / or translated alone without being integrated into the genome of the injected cell. As an example, but not limited thereto, in order to be expressed alone, the nucleic acid molecule may include one or more promoters, open reading frames, or terminators, and more preferably, may include one or more promoters operably linked to the gene of interest. The promoter sequence is often a eukaryotic promoter derived from or truncated by a virus, and thus the promoter may be a pro-opiomelanocortin promoter (POMC), an adenovirus promoter, a baculovirus promoter, a CMV promoter, a parvovirus promoter, a herpesvirus promoter, a poxvirus promoter, an adeno-associated virus promoter, a Semliki Forest virus promoter, an SV40 promoter, a vaccinia virus promoter, or a retrovirus promoter. Examples of promoters include the human simplex virus thymidine kinase (HSV TK or miniTK) promoter, the cauliflower mosaic virus (CaMV) 35S promoter, the human cytomegalovirus CMV promoter (miniCMV), CMV53 (minCMV with an upstream GC box added), the simian virus 40 promoter (minSV40), MLP (the -38 to +6 region of the adenovirus major late promoter), minP (a synthetic promoter consisting of a TATA box and a transcription start site - Promega), pJB42CAT5 (a promoter derived from the human junB gene), YB_TATA, and the super core promoter 1 (SCP1) promoter. Several promoters (sometimes called "core promoters") have been described in the literature (Ede et al., ACS Synth Biol 2016 May 20; 5(5): 395-404).

[0021] The terms "operably positioned," "operably linked," and "operably linked" mean that a promoter (and / or enhancer) is in the correct functional location and orientation relative to a nucleic acid sequence to control the initiation and expression of transcription of that nucleic acid. An enhancer is "operably linked" to a promoter if it is in the correct functional location and orientation to increase the transcriptional activity of the promoter.

[0022] In one embodiment, the nucleic acid molecule further comprises a polyadenylation (poly(A)) sequence. The poly(A) sequence causes appropriate polyadenylation of the nucleic acid (transcript) of interest. Representative examples of poly(A) sequences include SV40 poly(A) and / or bovine growth hormone poly(A), which are known to be convenient and / or functional in various target cells.

[0023] In one embodiment, the nucleic acid molecule further comprises a transcription termination sequence. A "termination signal" or "terminator" is a DNA sequence that is involved in the specific termination of an RNA transcript by an RNA polymerase.

[0024] Additionally, but not limited to, the nucleic acid molecule may produce transcription and / or translation products through expression processes that involve transcription and / or translation. The transcription and / or translation products may include, but are not limited to, mRNA, noncoding RNA, proteins, antigens, or antibodies.

[0025] The gene delivery vehicle of the present invention comprises a nucleic acid molecule bound to the surface of a gold nanoparticle. The nucleic acid molecule comprises one or more functionalities for binding to the surface of the gold nanoparticle. The functionalities are not limited in type and may be a thiol group or an amine group, and may be included in one or more residues of the nucleic acid molecule to be delivered. In one embodiment of the present invention, the nucleic acid molecule comprises one or more thiolated residues, thereby directly binding to the surface of the gold nanoparticle. The binding does not involve a separate spacer or linker. The thiolated residues may be one or more bases included at the 3' end, the 5' end, or within the base sequence of the nucleic acid molecule.

[0026] In addition, the nucleic acid molecule is bound to the surface of the gold nanoparticle at least once, and is not limited thereto, but 1 to 20 nucleic acid molecules may be bound to the surface of the gold nanoparticle for expression. In addition, the length of the nucleic acid molecule to be bound is at least 100 bp, 200 bp, or 300 bp or more, but is not limited thereto. In some cases, the nucleic acid molecule is more than 30 nucleotides.

[0027] In another embodiment, the nucleic acid molecule is greater than 35 nucleotides. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 55 nucleotides. In another embodiment, the length is at least 50 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides. In another embodiment, the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides. In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides. In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides.In another embodiment, the length is at least 1300 nucleotides. In another embodiment, the length is at least 1400 nucleotides. In another embodiment, the length is at least 1500 nucleotides. In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at least 3000 nucleotides. In another embodiment, the length is at least 4000 nucleotides. In another embodiment, the length is at least 5000 nucleotides, or more than 5000 nucleotides.

[0028] In another aspect, the present invention relates to a pharmaceutical composition comprising the above-described gold nanoparticles and a gene carrier comprising double-stranded DNA. The pharmaceutical composition is intended for the prevention, improvement, or treatment of a disease, and is not limited in its type. The use thereof may vary depending on the type of double-stranded DNA bound to the gold nanoparticles and the expression product.

[0029] In particular, the pharmaceutical composition of the present invention may be an agent for preventing or treating a metabolic disease, wherein the metabolic disease is a disease caused by a problem in the body's metabolic process, and may include diabetes, obesity, lipid metabolism disorder, fatty liver disease, metabolic syndrome, or cardiovascular disease such as hypertension, and may preferably be diabetes, but is not limited thereto.

[0030] The above pharmaceutical composition may be a cell gene therapy agent including a cell therapy agent, a genetically modified cell therapy agent, a gene therapy agent, or an RNA therapy agent.

[0031] The above cell therapy agent refers to a medicine used for the purpose of treatment, diagnosis, and prevention through a series of actions such as proliferating, selecting, or otherwise changing the biological characteristics of living autologous, allogenic, or xenogeneic cells in vitro to restore the tissue and function of cells. When the genes within the cells are modified, it is also classified as a genetically modified cell therapy agent. In addition, the gene therapy agent is a medicine manufactured for the purpose of treating or preventing genetic defects by correcting defective genes or adding new functions to cells by introducing normal genes and therapeutic genes into the patient's cells using genetic manipulation such as genetic recombination.

[0032] In addition, the RNA therapeutic agent exhibits drug efficacy by inhibiting the process of producing a protein that induces a disease from a target gene, and may include mRNA, RNAi, ASO (Antisense oligonucleotide), RNA aptamer, etc.

[0033] The pharmaceutical composition according to the present invention may further comprise suitable carriers, excipients, and diluents commonly used in the manufacture of pharmaceutical compositions. The excipients may be, for example, one or more selected from the group consisting of diluents, binders, disintegrants, lubricants, adsorbents, moisturizers, film-coating materials, and controlled-release additives.

[0034] The pharmaceutical composition according to the present invention may be formulated and used in the form of external preparations such as powders, granules, sustained-release granules, enteric-coated granules, liquids, eye drops, ellipsoids, emulsions, suspensions, alcohols, troches, aromatic waters, limonades, tablets, sustained-release tablets, enteric-coated tablets, sublingual tablets, hard capsules, soft capsules, sustained-release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, irrigation solutions, ointments, lotions, pastes, sprays, inhalants, patches, sterile injection solutions, or aerosols, according to a conventional method, and the external preparations may have formulations such as creams, gels, patches, sprays, ointments, ointments, lotions, liniments, pastes, or cataplasmas.

[0035] Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

[0036] When formulating, it is usually prepared using diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants.

[0037] The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment. The effective dosage level can be determined based on factors including the type and severity of the patient's disease, the activity and sensitivity of the drug to the drug, the time of administration, the route of administration and the excretion rate, the duration of treatment, concurrently used drugs, and other factors well known in the medical field. The pharmaceutical composition according to the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, can be administered sequentially or simultaneously with conventional therapeutic agents, and can be administered singly or in multiple doses. It is important to take all of the above factors into consideration and administer an amount that can achieve the maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art to which the present invention pertains.

[0038] The pharmaceutical composition of the present invention can be administered to a subject via various routes. All modes of administration are conceivable, including oral ingestion, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, intrathecal injection, sublingual administration, buccal mucosal administration, rectal insertion, vaginal insertion, ocular administration, otic administration, nasal administration, inhalation, oral or nasal spraying, dermal administration, and transdermal administration.

[0039] The pharmaceutical composition of the present invention is determined based on the type of drug as the active ingredient, along with various related factors such as the disease to be treated, the route of administration, the patient's age, sex, weight, and the severity of the disease. As used herein, "subject" refers to a subject requiring treatment for a disease, and more specifically, mammals such as humans or non-human primates, mice, rats, dogs, cats, horses, and cows.

[0040] In the present invention, “administration” means providing a predetermined composition of the present invention to an individual by any appropriate method.

[0041] In the present invention, “prevention” means any action that suppresses or delays the onset of a target metabolic disease, “treatment” means any action that improves or beneficially changes a metabolic disease and its metabolic abnormality symptoms by administering a pharmaceutical composition according to the present invention, and “improvement” means any action that reduces a parameter related to a target disease, for example, the severity of a symptom, by administering a composition according to the present invention.

[0042] In another aspect of the present invention, the present invention relates to a method for producing a gene carrier, comprising the steps of: treating a metal nanoparticle with an acidic solution to modify the surface of the metal nanoparticle; and binding a nucleic acid molecule containing one or more genes of interest to be delivered into cells and expressed, to the surface of the metal nanoparticle.

[0043] In addition, as another aspect of the present invention, the present invention relates to a method for expressing a gene that expresses insulin or promotes the secretion of insulin through a nucleic acid molecule that is bound to the surface of a metal nanoparticle and expressed alone within a cell.

[0044] The present invention relates to a gene carrier comprising a metal nanoparticle and a nucleic acid molecule including a gene for a substance that expresses insulin or promotes secretion of insulin bound to the surface of the metal nanoparticle, a method for producing the same, and a use thereof. In particular, a nucleic acid molecule in the form of double-stranded DNA is directly bound to the surface of a gold nanoparticle through a covalent bond and is delivered into a cell and expressed, thereby enabling stable delivery and expression of a gene, and in particular, by expressing a substance that expresses insulin or promotes secretion of insulin, the gene carrier can be utilized as a pharmaceutical composition for preventing or treating a metabolic disease.

[0045] Figure 1 is a schematic diagram showing the structure of a nucleic acid molecule containing a gene of interest bound to a gold nanoparticle in one embodiment of the present invention.

[0046] Figure 2 is a schematic diagram of insulin and Bioactive (BA) insulin used in one embodiment of the present invention.

[0047] Figure 3 is an expression system for insulin and Bioactive (BA) insulin produced in one embodiment of the present invention.

[0048] Figure 4 shows the results of expression in cells using the expression system produced in the present invention.

[0049] Figure 5 shows the results of confirming the binding efficiency of a nucleic acid molecule bound to a gold nanoparticle of the present invention through a thiolated residue.

[0050] Figure 6 shows the results of confirming whether a gold nano carrier loaded with double-stranded DNA delivers and expresses genes in a small animal model.

[0051] Hereinafter, examples will be described in detail to specifically explain this specification. However, the embodiments according to this specification may be modified in various different forms, and the scope of this specification is not limited to the embodiments described below. The embodiments of this specification are provided to more fully explain this specification to those of average skill in the art.

[0052]

[0053] Example 1. Preparation of double-stranded DNA for insulin expression

[0054] 1-1. Preparation of plasmids for expressing insulin in cells

[0055] The INS gene was synthesized by PCR using primers 1 and 2 from cDNA of pancreatic beta cells, and then inserted between the CMV promoter and bGH terminator of pcDNA3.1 using the infusion method to produce pNES1-INS (SEQ ID NO: 12).

[0056] After inducing mutations in INS by PCR using primers of SEQ ID NOs: 3 and 4, 5 and 2, and 3 and 2 in the INS gene, pNES1-BA-INS (SEQ ID NO: 13) was constructed by inserting the INS gene between the CMV promoter and bGH terminator of pcDNA3.1 by the infusion method.

[0057] After PCR synthesis using primers of sequence numbers 6 and 7 from the CMV promoter to the beta blobin poly A signal of pAAV2-CMV, the above sequence was replaced with the sequence from the CMV promoter to the bGH terminator of pcDNA3.1 using the infusion method to produce pNES3.

[0058] In addition, pNES1-INS and BA-INS were synthesized by PCR using primers of sequence numbers 8 and 9, and then inserted between the beta globin intron and beta globin polyA of pNES3 using the infusion method to produce pNES3-INS (SEQ ID NO: 14) and pNES3-BA-INS (SEQ ID NO: 15). The primer sequences used at this time are as shown in Table 1 below.

[0059] SEQ ID NO NAME Sequence 1pNES1-INS-SP FAACTAGAGAACCCACTGCTTACTGGCGCGCGCCACCATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGC2pNES1-INS RCAGATGGCTGGCAACTAGAAGGCACAGTCGCTAGTTGCAGTAGTTCTCCAG3pNES1-INS FAACTAGAGAACCCACTGCTTACTGGCGCCGCCACCACCATGGCCCTGTGGATGCGCCTC4BA-INS RAGGGCCCCCGCCCAGCTCCACCTGCCCCACCTGCAGGTCCTCTGCCTCCCGcttGGTCcTGGGTGTGTAGAAGAAGCCTCG5BA-INS FGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCgGCAGAAGCGTGGCATTGTGGAA6CMV-FCAGATATACGCGTTGACATTGATTATTGACTAGTT7b-globin PA-RTTTCCGCCTCAGAAGAAAATACAGCATAGCAAAAC8pNES3-INS FGATCCACCGGTCGCCACCATGGCCCTGTGGATGCGC9pNES3-INS RTAAGCTTGGATCCTCTAGAGCGGCCGCTCTAGTTGCAGTAGTTCTCCAGCTG

[0060] The plasmid produced as a result of the above is shown in Fig. 3. 1-1. Confirmation of intracellular insulin and BA insulin expression using the plasmid

[0061] Expression of the plasmids containing the INS and BA-INS genes constructed above was performed using a cell line (HeLa cells). 1 μg of plasmid was transfected into a culture plate containing 3*10^5 cells using Lipofectamine 3000. Insulin expression was then observed by Western blotting. As a result, insulin expression was confirmed in all pNES1-INS, pNES1-BA-INS, pNES3-INS, and pNES3-BA-INS. (Figure 4)

[0062]

[0063] Example 2. Preparation of gold nanoparticles expressing insulin.

[0064] AuNP-dsDNA capable of intracellular delivery and expression was prepared by conjugating thiolated double-stranded DNA for intracellular expression to gold nanoparticles through the following steps, and a schematic diagram thereof is shown in Figure 1.

[0065] 2-1. Manufacturing of dsDNA capable of intracellular antigen expression

[0066] As the above-mentioned target genes, the INS and BA-INS genes were cloned by the infusion method using the above-mentioned method, and the 5'-terminal thiolation primer sequence of Table 1 below was used to thiolate the 5'-terminal residue, and the thiolated double-stranded DNA of INS and BA-INS was synthesized.

[0067] Sequence Number Name Sequence 10 pcDNA3.1 dsDNA F5' - (Thiolation) C*T*T*A*G*GGTTAGGCGTTTTGC 11 pcDNA3.1 dsDNA R5' - C*T*A*C*A*GGGCGCGTGGGGATAC

[0068] *Phosphorothiolated backbone 2-2. Pretreatment of thiolated double-stranded DNA

[0069] The synthesized thiolated double-stranded DNA was dissolved in water to a final concentration of 1 μM, and 20 μl of 3 M sodium acetate (pH 5.2) and 30 μl of 1 N dithiothreitol (DTT) were added to 150 μl of the thiolated double-stranded DNA, and the mixture was reacted at room temperature for 60 minutes. To remove DTT containing unwanted thiol molecules, 200 μl of ethyl acetate was added, mixed, and the supernatant was removed by centrifugation. This process was repeated three times. Then, the thiolated double-stranded DNA was precipitated using the EtOH precipitating method.

[0070] 2-3 Preparation of dsDNA-functionalized gold nanoparticles (AuNP-dsDNA)

[0071] The thiolated double-stranded DNA precipitated through the above 2-2 process was dissolved in water, added to gold nanoparticles, and then bound using the salt aging method. Specifically, thiolated double-stranded DNA was added to 7 nM of gold nanoparticles (AuNP: thiolated double-stranded DNA = 1:40) and mixed thoroughly. Then, NaCl was added to a concentration of 0.1 M and mixed for 4 hours. After 4 hours, NaCl was added to a concentration of 0.2 M and mixed for 4 hours. After 4 hours, NaCl was added to a concentration of 0.3 M and mixed for 12 hours.

[0072] After 12 hours, the thiolated double-stranded DNA and gold mixture was collected by centrifugation at ~10,000 xg for 20 minutes, and the unreacted double-stranded DNA in the supernatant was removed. This process was repeated three times.

[0073] The final AuNP-thiolated double-stranded DNA complexes (AuNP-thiolated dsDNA) were dispersed in 10 mM sodium phosphate buffer (pH 7.4) containing 0.1 M NaCl. The prepared AuNP-thiolated double-stranded DNA complexes were analyzed by electrophoresis on a 10% acrylamide 8 M urea gel, and it was confirmed that 1.98 to 9.27 thiolated double-stranded DNAs were bound per gold nanoparticle (Fig. 5).

[0074]

[0075] Example 3. Confirmation of gene delivery and expression by AuNP-dsDNA (insulin) in a small animal model.

[0076] The diabetic mouse model experiment utilized a type 1 diabetes model induced by streptozotocin (STZ). Eight-week-old BALB / c female mice (Central Lab Animal Inc., Korea) were treated with 50 mg / kg of STZ for 5 days to induce diabetes. AuNP-thiolated dsDNA (insulin) was injected once into the thigh muscle, and blood glucose levels were monitored for 50 days. As a result, NES-INS and NES-BA-INS were confirmed to reduce blood glucose levels in diabetic model mice to levels similar to those observed in mice receiving daily insulin injections. (Figure 6)

[0077]

[0078] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than restrictive. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

[0079] In one aspect, the present invention relates to a gene carrier comprising a gold nanoparticle; and a double-stranded DNA that binds to the gold nanoparticle via a moiety comprising one or more functional groups and is delivered into a cell to express a substance that alone expresses insulin or promotes the secretion of insulin.

[0080] In one embodiment, the double-stranded DNA comprises an insulin gene (INS).

[0081] In one embodiment, the substance that promotes the secretion of insulin includes one selected from among Glucagon-Like Peptide-1 (GLP-1), GLP-1 Receptor Agonists, Gastric Inhibitory Polypeptide (GIP), Oxyntomodulin, Peptide YY (PYY), Cholecystokinin (CCK), Dipeptidyl Peptidase-4 Inhibitors (DPP-4 inhibitors), and Pancreatic and Duodenal Homeobox 1 (PDX1).

[0082] As an example, the double-stranded DNA may be expressed independently without being integrated into the genome of the injected cell.

[0083] As an example, the residue comprising the functional group may include a thiol group or an amine group, and the residue comprising the functional group may be included at the 3' end, the 5' end, or within the base sequence of the double-stranded DNA.

[0084] As an example, the gold nanoparticles have a size of 5 to 500 nm.

[0085] In another aspect, the present invention relates to a pharmaceutical composition for preventing or treating a metabolic disease, comprising the gene carrier.

[0086] As an example, the metabolic disease may be a disease selected from the group including diabetes, obesity, lipid metabolism disorder, fatty liver disease, metabolic syndrome, or cardiovascular disease such as hypertension.

[0087] In another aspect, the present invention relates to a method for preventing or treating metabolic diseases using a gold nanoparticle carrier, comprising the steps of: binding a double-stranded DNA expressing a substance that expresses insulin or promotes the secretion of insulin to the surface of a gold nanoparticle and injecting the double-stranded DNA into a cell; and expressing the double-stranded DNA bound to the surface of the gold nanoparticle solely within the nucleus.

[0088] In another aspect, the present invention relates to the use of a gold nanoparticle carrier comprising a double-stranded DNA expressing insulin or a substance that promotes the secretion of insulin, which is bound to the surface through a moiety having one or more functional groups, for the prevention or treatment of metabolic diseases.

Claims

1. Gold nanoparticles; and A gene vector comprising a double-stranded DNA that binds to the gold nanoparticle via a moiety comprising one or more functional groups and is delivered into a cell to express a substance that alone expresses insulin or promotes the secretion of insulin.

2. In paragraph 1, A gene vector, wherein the double-stranded DNA comprises an insulin gene (INS).

3. In paragraph 1, A gene carrier comprising a substance that promotes the secretion of the above insulin is selected from among GLP-1 (Glucagon-Like Peptide-1), GLP-1 Receptor Agonists, GIP (Gastric Inhibitory Polypeptide), Oxyntomodulin, PYY (Peptide YY), CCK (Cholecystokinin), DPP-4 inhibitors (Dipeptidyl Peptidase-4 Inhibitors), and PDX1 (Pancreatic and Duodenal Homeobox 1).

4. In paragraph 1, A gene vector wherein the double-stranded DNA is expressed independently without being integrated into the genome of the injected cell.

5. In paragraph 1, A gene vector, wherein the residue comprising the above functional group comprises a thiol group or an amine group.

6. In paragraph 1, A gene vector, wherein the residue comprising the above functional group is one or more residues included at the 3' end, the 5' end or within the base sequence of the double-stranded DNA.

7. A gene carrier according to claim 1, wherein the gold nanoparticles have a size of 5 to 500 nm.

8. A pharmaceutical composition for preventing or treating a metabolic disease, comprising a gene carrier according to any one of claims 1 to 7.

9. In paragraph 8, A pharmaceutical composition, wherein the metabolic disease is selected from the group including diabetes, obesity, lipid metabolism disorders, fatty liver disease, metabolic syndrome, or cardiovascular diseases such as hypertension.

10. A step of binding double-stranded DNA expressing a substance that expresses insulin or promotes secretion of insulin to the surface of gold nanoparticles and injecting it into cells; A method for preventing or treating metabolic diseases using a gold nanoparticle carrier, comprising a step of expressing double-stranded DNA bound to the surface of the gold nanoparticles solely within the nucleus.

11. Use of a gold nanoparticle carrier comprising a double-stranded DNA expressing insulin or a substance that promotes secretion of insulin bound to the surface through a residue having one or more functional groups for the prevention or treatment of metabolic diseases.

Images