Car-t cells comprising a CDKN1b gene knockout and methods of use thereof
By introducing a CDKN1B gene knockout in CAR-T cells using CRISPR, the exhaustion and reduced efficacy of CAR-T cells are addressed, resulting in enhanced persistence and therapeutic effects against multiple myeloma.
Patent Information
- Application Number
- PCT/US2024/057041
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-07
- Filing Date
- 2024-11-22
- Publication Date
- 2025-05-30
AI Technical Summary
CAR-T cells used in cancer therapy often become exhausted, reducing their therapeutic efficacy and persistence in vivo.
Introduction of a loss of function mutation in the CDKN1B gene in CAR-T cells, specifically through CRISPR-mediated gene knockout, which enhances their persistence and efficacy against multiple myeloma.
The CDKN1B knockout in CAR-T cells leads to increased persistence and enhanced therapeutic efficacy against multiple myeloma, with improved cytotoxicity and reduced exhaustion markers.
Smart Images

Figure US2024057041_30052025_PF_FP_ABST
Abstract
Description
[0001] CAR-T CELLS COMPRISING A CDKN1B GENE KNOCKOUT AND METHODS OF USE THEREOF
[0002] RELATED APPLICATIONS
[0003] This application claims benefit under 35 U.S.C. § 119(e) to U.S. Provisional Application No. 63 / 602,032, filed November 22, 2023, entitled “CAR-T Cells Comprising a CDKN1B Gene Knockout and Methods of Use Thereof’, and U.S. Provisional Application No. 63 / 717,562, filed November 7, 2024, entitled “CAR-T Cells Comprising a CDKN1B Gene Knockout and Methods of Use Thereof’, the entire contents of each of which are incorporated herein by reference.
[0004] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0005] The contents of the electronic sequence listing (M105370052WO00-SEQ-ARM.xml; Size: 97,387 bytes; and Date of Creation: November 20, 2024) is herein incorporated by reference in its entirety.
[0006] BACKGROUND
[0007] Chimeric antigen receptor (CAR)-T cell therapy has proven effective at treating some types of cancer (e.g., liquid cancers) in some patients. CAR-T cells are generally made by extracting T cells from a patient having cancer and modifying the T cells to comprise a CAR which binds to an antigen expressed by the tumor. Thus, the CAR-T cells are capable of targeting tumor cells expressing the antigen. However, CAR-T cells can become exhausted when administered to a patient, which reduces CAR-T cell therapeutic efficacy.
[0008] SUMMARY
[0009] This disclosure describes, in part, the surprising discovery that CAR-T cells with a loss of function mutation in the cyclin dependent kinase inhibitor IB (CD KN IB) gene have increased persistence in vivo. Specifically, the inventors used CRISPR to test the effects of different B Cell Maturation Protein (BCMA) binding CAR-T cell (BCMA CAR-T cell) gene knockouts in vivo. Genes selected for gene knockout were genes known to be involved in CAR- T cell activity. Some of the gene knockouts increased BCMA CAR-T cell persistence in vivo, including CDKN1B. Additionally, the CDKN1B knockout also greatly increased BCMA CAR- T cell efficacy against multiple myeloma in vivo. In some aspects, this disclosure provides a chimeric antigen receptor (CAR)-T cell comprising a loss of function mutation in a cyclin dependent kinase inhibitor IB (CDKN1B) gene. In some embodiments, the loss of function mutation is an early stop codon, a truncation, a frameshift mutation, a deletion, or an insertion in the CDKN1B gene.
[0010] In some embodiments, the loss of function mutation is a deletion or an insertion in the CDKN1B gene. In some embodiments, the loss of function mutation is a deletion or an insertion in exon one of the CDKN1B gene. In some embodiments, the loss of function mutation is a deletion or an insertion in SEQ ID NO: 3 or 4 of exon one of the CDKN1B gene.
[0011] In some embodiments, the CAR-T cell comprises a polynucleotide encoding a clustered regularly interspaced short palindromic repeats (CRISPR) guide RNA polynucleotide comprising a homology region that is complementary to CDKN1B gene. In some embodiments, the CAR-T cell comprises a polynucleotide encoding CRISPR guide RNA polynucleotide comprising a homology region that is complementary to a CDKN1B gene.
[0012] In some embodiments, the homology region comprises a polynucleotide sequence of any one of SEQ ID NOs: 1-2 or 65-70. In some embodiments, the homology region comprises a polynucleotide sequence of any one of SEQ ID NOs: 1-2. In some embodiments, the CAR-T cell further comprises a CRISPR protein. In some embodiments, the CRISPR protein is a Cas9 protein. In some embodiments, the CAR comprises: (i) an antigen binding domain; (ii) a transmembrane domain; and (iii) an intracellular signaling domain.
[0013] In some embodiments, the antigen binding domain binds to any one of BCMA, CD 19, CD79b, TACI, MUC1, MUC16, B7H3, mesothelin, CD70, PSMA, PSCA, EGFRvIII, claudin6, binds to any pair of CD19 / CD79b, BCMA / TACI, or is a TriPRIL antigen binding domain. In some embodiments, the antigen binding domain binds to BCMA. In some embodiments, the antigen binding domain that binds to BCMA comprises an amino acid sequence of SEQ ID NO: 5.
[0014] In some embodiments, the transmembrane domain comprises a alpha, beta or zeta chain of a T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, KIRDS2, 0X40, CD2, CD27, LFA-1 (CDlla, CD18), ICOS (CD278), 4-1BB (CD137), 4-1BBL, GITR, CD40, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRFI), CD160, CD19, IL2R beta, IL2R gamma, IL7R a, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CDlld, ITGAE, CD103, ITGAL, CDlla, LFA-1, ITGAM, CDllb, ITGAX, CDllc, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRT AM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), SLAMF6 (NTB-A, LylO8), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, PAG / Cbp, NKp44, NKp30, NKp46, NKG2D, or NKG2C transmembrane domain.
[0015] In some embodiments, the transmembrane domain comprises a CD8 transmembrane domain. In some embodiments, the CD8 transmembrane domain comprises an amino acid sequence of SEQ ID NO: 49. In some embodiments, the intracellular signaling domain comprises a CD3y, CD3s, CD35, or CD3(^ intracellular signaling domain. In some embodiments, the intracellular signaling domain comprises a CD3(^ intracellular signaling domain. In some embodiments, the CD3(^ intracellular signaling domain comprises an amino acid sequence of SEQ ID NO: 54.
[0016] In some embodiments, the CAR further comprises a costimulatory domain. In some embodiments, the costimulatory domain comprises a CD28, 4- IBB, CD27, TCR-zeta, FcR- gamma, FcR-beta, CD3-gamma, CD3-theta, CD3-sigma, CD3-eta, CD3-epsilon, CD3-zeta, CD22, CD79a, CD79b, or CD66d costimulatory domain. In some embodiments, the costimulatory domain comprises a 4- IBB costimulatory domain. In some embodiments, the CAR further comprises a truncated CD34 (CD34t) protein. In some embodiments, the CD34t protein comprises an amino acid sequence of SEQ ID NO: 71. In some embodiments, the CAR comprises a 2A peptide between the intracellular signaling domain and the CD34t protein.
[0017] In some embodiments, the CAR further comprises a signal peptide. In some embodiments, the signal peptide comprises a CD8 signal peptide or an IgK signal peptide. In some embodiments, the CD8 signal peptide comprises an amino acid sequence of SEQ ID NO: 55.
[0018] In some embodiments, the CAR comprises from N-terminal to C-terminal: (i) a CD8 leader sequence; (ii) antigen binding domain that binds to BCMA; (iii) a CD8 transmembrane domain; (iv) a 4- IBB costimulatory domain; and (v) a CD3(^ intracellular signaling domain.
[0019] In some embodiments, the CAR comprises an amino acid sequence of SEQ ID NO: 6 or 36. In some embodiments, the CAR comprises an amino acid sequence of any one of SEQ ID NOs: 6-47. In some embodiments, this disclosure provides a method of treating a BCMA expressing cancer in a subject, the method comprising administering the CAR-T cell to the subject. In some embodiments, the BCMA expressing cancer is a B cell cancer. In some embodiments, the BCMA expressing cancer is multiple myeloma. In some embodiments, the subject is a human subject. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0021] FIG. 1 is an experimental schematic showing generation of T cells expressing a B-cell maturation antigen (BCMA) chimeric antigen receptor (CAR) and subsequent transfer of CAR- T cells into mice injected with MM. Is (a B lymphoblast line) tumor cells.
[0022] FIGs. 2A-2B relate to persistence of control CAR-T cells or CAR-T cells with different gene knockouts (e.g., CRISPR included indels) in genes that are associated with T cell function, cultured in either interleukin-2 (IL-2) or IL-7 and IL- 15 (gene names shown in plots indicate the mutated gene). CAR-T cell persistence was assessed following the in vitro period (days -11 to 0 in culture; FIG. 2A) or the in vivo period (days 7 or 21 post-transfer into mice; FIG. 2B). RAS p21 protein activator 2 (RASA2) ko CAR-T cells were identified as the best performing knockout during the in vitro period, and cyclin dependent kinase inhibitor IB (CDKN1B) ko and protein tyrosine phosphatase non-receptor type 2 (PTPN2) ko CAR-T cells were identified as the best performing knockouts during the in vivo period.
[0023] FIGs. 3A-3C show expansion (FIG. 3A) and phenotype (FIGs. 3B-3C) of CAR-T cells engineered to have gene knockouts in the genes RASA2 ko, PTPN2 ko, CDKN1B ko, CD160 (CD160 ko), and IL-2 receptor alpha (IL2Ra ko) (with or without culturing cells in IL-7 and IL- 15). FIG. 3B shows the percentage of cells with a CD4+ T helper phenotype versus a CD8+ cytotoxic T cell phenotype, and FIG. 3C shows the percentages of CD4+ and CD8+ cells that correspond to naive, effector, effector memory, and central memory phenotypes.
[0024] FIGs. 4A-4B show the quantification of tumor expansion (FIG. 4A) and CAR-T cell expansion (FIG. 4B) in mice treated with T cells comprising BCMA binding CARs, and IL2RA, CD160, CDKN1B, PTPN2 or RASA2 knockout.
[0025] FIGs. 5A-5D relate to repeated stimulations of CAR-T cells. FIG. 5A shows an experimental schematic in which CAR-T cells and cancer cells are co-cultured for 72 hours at a 1:1 ratio (1 stimulation). In vitro cytotoxicity against cancer cells was analyzed after the second (FIG. 5B), fourth (FIG. 5C), and sixth (FIG. 5D) CAR-T cell stimulations.
[0026] FIGs. 6A-6D relate to in vivo assays to measure cytotoxicity of CAR-T cells against tumor cells (“Flux”, y-axis). FIG. 6A shows an experimental schematic in which mice are injected with 1 x 106MM. Is tumor cells 3 weeks prior to engraftment with 2 x 106CAR-T cells. FIGs. 6B-6C show tumor size in mice treated with CAR-T cells with gene knockouts of IL2RA (IL2RA ko (IL2)), RASA2 (RASA2 ko), CD160 (CD160 ko), PTPN2 (PTPN2 ko), and CDKN1B (CDKN1B ko). The experiment was repeated for CDKN1B ko CAR-T cells using T cells derived from a second donor (FIG. 6D).
[0027] FIGs. 7A-7C show the percentage of circulating CAR-T cells expressing the exhaustion markers PD-1 (FIG. 7A), LAG3 (FIG. 7B), and Tim-3 (FIG. 7C) on CAR-T cells.
[0028] FIG. 8 shows cell cycle analysis in CAR-T cells that were either unstimulated or cocultured with BCMA-expressing cancer cells (“K562-BCMA co-culture”).
[0029] FIGs. 9A-9B show CD8+ T cells (primarily CAR-T cells) in the spines of mice engrafted with MMl.s cancer cells and treated with either control CAR-T cells (FIG. 9A) or CDKN1B ko CAR-T cells (FIG. 9B).
[0030] FIGs. 10A-10F demonstrate that an in vivo loss-of-function CRISPR screen is feasible but varies based on screening condition. FIG. 10A is a diagram of the genes targeted in the Mario library. FIG. 10B is an exemplary diagram of the screen workflow. T cells were activated, one day later transduced sequentially with the BCMA CAR and then with guide library lentivirus. A pre-electroporation sample was frozen down for analysis on day -11, after which Cas9 mRNA electroporation (day -7) and a CD3 negative selection (day -5) were performed. Transduction efficiencies were assessed on day -4 and on day 0 an injection input sample was frozen down. T cells containing Mario-CAR-T cells (2E6 double positive cells) were injected in NSG mice bearing MMl.s. At day 7 (early in vivo) or day 21 (late in vivo), mice were euthanized and a total marrow harvest was conducted (collecting femur, tibia, and spine). FIG. IOC shows volcano plots of gene hits displaying knockout genes that were enriched and depleted, based on the different periods analyzed: in vitro expanded vs. baseline (day -11 to day 0), early in vivo vs. in vitro expanded (day 0 to day 7), and early in vivo vs. in vitro expanded (day 0 to day 21). n = 3 healthy donor T cells (ND216, ND99, ND106). FIG. 10D shows frequency histograms of enrichment or depletion of sgRNAs for RASA2, PTPN2, and CDKN1B, grouped by respective period; n = 3 healthy donor T cells (ND216, ND99, ND106). FIG. 10E is an LFC comparison for gene knockout scoring between the IL2-cultured and IL7 / 15 cultured screen, sorted by investigated time frame; n = 3 healthy donor T cells for IL2 (ND216, ND99, ND106) and 2 of the 3 donors for IL7 / 15 (ND106, ND216). FIG. 10F shows the abundance of sgRNAs targeting individual genes across the entire screen workflow for Mario- CAR-T cells produced in IL-2. ND: normal donor. LFC: log fold change. FIGs. 11A-11G relate to in vivo Pertub-seq characterization of BCMA CAR-T cells. FIG.11A is an exemplary diagram of the perturb- seq workflow. Cells were prepared as described elsewhere herein. The perturb-seq library featured a selected fraction of the Mario library genes (intergenic controls, CD160, CDKN1B, IL2RA, PTPN2, RASA2, RC3H1, SOSC1, TGBR2, ZC3H12A). Modified CAR-T cells (2E6 double positive cells) were transferred into NSG mice bearing MM. IS multiple myeloma. After 21 days, the CAR-T cells were isolated from bone marrow for droplet-based scRNAseq with sgRNA capture. Human T cells were from a single healthy donor (ND 106) and were isolated from n=4 individual mice for scRNAseq analysis. FIG. 11B shows uniform manifold approximation and projection (UMAP) of 18,680 cells and 11 clusters identified among NGFR enriched BCMA CAR-T cells. FIG. 11C shows UMAPs of expression for representative T cell phenotypic marker genes. FIG. 11D shows UMAPs of cell cycle score FIG. HE shows UMAPs of T cell phenotypic gene signatures. FIG. HF shows cell density projections by gene target FIG. 11G shows hallmark gene set enrichment analysis (GSEA) of pseudo-bulk pooled PTPN2 KO (left panel) or CDKN1B KO (right panel) CAR-T cells compared to no guide CAR-T cells.
[0031] FIGs. 12A-12D demonstrate knockout of key T cell regulators enhances BCMA CAR-T cell expansion and cytotoxicity in vitro. FIG. 12A shows relative expansion of knockout CAR-T cells during production in IL-2. Data represent one or two technical replicates from CAR-T cells generated from two normal donors (ND 116, ND202), measured as their fold expansion (fold change in CAR+ cells in the culture over time) in vitro following CD3 negative selection. Data presented as mean + / - SEM. Statistical significance was measured by two-way ANOVA with Tukey’s multiple comparison test. FIG. 12B is a schematic overview of a repetitive stimulation assay. FIGs. 12C-12D show real-time cytotoxicity assay of CAR-T cells (taken from different restimulation time points (2nd, 4th, and 6th)) co-cultured with irradiated K562-BCMA target cells at a 1:1 effector:target (E:T) ratio (FIG. 12C), with quantification of total tumor growth after 118 hours of co-culture (FIG. 12D). Tumor cell growth is shown as the total area relative to day 0 (tumor seeding). Data represent technical replicates from CAR-T cells generated from one normal donor (ND 116). Statistical significance was measured by one-way ANOVA with Tukey’s multiple comparison test. Data presented as mean + / - SEM. *p<0.05, **p < 0.01, and ****p < 0.0001, ns: non- significant.
[0032] FIGs. 13A-13H demonstrate that CDKN1B KO enhances CAR-T cell function and persistence against myeloma. FIG. 13A shows MM. IS tumor burden as measured by bioluminescent imaging (BLI) of mice treated with intergenic control KO, IL2RA KO, PTPN2 KO, RASA2 KO or CDKN1B KO BCMA CAR-T cells. NSG mice were injected intravenously with 1E6 MM. IS followed by transfer of CAR-T cells 21 days later. n=5 mice per group from one healthy donor (ND 116). Data presented as mean + / - SEM. Statistical significance was measured compared to the intergenic KO CAR-T cell treated group at day 77 (CDKN1B KO, PTPN2 KO) or day 49 (IL2RA KO, RASA2 KO) as measured by two way ANOVA with Tukey’s multiple comparison test. FIG. 13B is CD8 immunohistochemistry staining of bone marrow from spine at day 21 after CAR-T cell transfer (top panel). Quantification of CD8+ cells per mm2 from 5 independent areas of n=2 mice (bottom panel). Data presented as mean + / - SEM with individual data points. Statistical significance was measured using two-tailed Student’s t-test. FIG. 13C shows RPMI-8226 tumor burden (top panel) and overall survival (bottom panel) of mice treated with intergenic control KO or CDKN1B KO BCMA CAR-T cells. NSG mice were subcutaneously injected with 5E6 RPMI-8226 followed by CAR-T cell transfer 14 days later. n=5 mice per group from two healthy donors (ND116, ND202) (10 mice total for each group). n=3 mice for tumor only group. Tumor volume was tracked by caliper measurements (mm3). Data presented as mean + / - SEM for tumor burden. For tumor burden, statistical significance was measured compared to the intergenic KO CAR-T cell treated group at day 42 measured by two-way ANOVA with Tukey’s multiple comparison test. For overall survival, statistical significance was measured by log rank (Mantel-Cox test) for Kaplan-Meier curves. FIG. 13D is a volcano plot of bulk RNAseq from intergenic control KO or CDKN1B KO BCMA CAR-T cells isolated from the bone marrow of mice 21 days after transfer to NSG mice engrafted with MM. IS myeloma. n=3 mice for intergenic control and n=5 mice for CDKN1B KO (ND 116). Select up regulated and down regulated genes in CDKN1B KO cells are shown. FIG. 13E is a heat map showing relative expression of genes within select hallmark gene sets. Genes contained in a gene set are labeled. FIG. 13F GSEA of intergenic control KO and CDKN1B KO CAR-T cells. FDR for all was <0.0001. FIG. 14G is a heatmap of RNA-seq- derived GSEA for memory, effector and exhausted CD8+ T cell gene sets comparing intergenic control KO and CDKN1B KO CAR-T cells. FIG. 13H shows intergenic and CDKN1B ko CAR-T cells, evaluated for 14-day viability, as measured by live / dead staining with DAPI, in the absence of IL-2 and antigen expressing tumor cells. Statistical significance for individual days between intergenic control KO and CD KN IB KO CAR-T cells was conducted by two way ANOVA with Tukey’s multiple comparison test. Data presented as mean + / - SEM. **p < 0.01, ***p < 0.001, and ****p < 0.0001, ns: non-significant. FIGs. 14A-14H shows that in vivo human CAR-T cell screening results are comparable across multiple healthy human donors. FIG. 14A show exemplary construct designs for the 4- 1BB BCMA CAR (pCAR) and double-guide cassette (pGuide) containing the Mario sgRNA library (variable sgRNA). FIG. 14B is a timeline of the MM. IS stress model with 21 day tumor engraftment and 2E6 CAR treatment. Tumor growth was tracked by BLI. Data presented as mean + / - SEM. n=3 mice (tumor only, Mario library (no CAR)) and n=5 (CAR-T, Mario-CAR- T) per group from one healthy donor (ND202). Statistical significance amongst groups at day 35 as measured by two-way ANOVA with Tukey’s multiple comparison. FIG. 14C shows CD3 expression after day -5 CD3 negative enrichment (ND216, ND99, ND106). FIG. 14D shows representative Mario-CAR-T cell staining for CD34 indicating CAR transduced cells and NGFR for sgRNA library transduced cells from ND216. FIG. 14E are replicate autocorrelation analysis scatter plots. Pearson’s correlations are calculated for the library distribution of one animal versus any other animal, two averaged animals versus any other two, and so on. The mean of all possible combinations is plotted. FIG. 14F shows quantification of replicate autocorrelation analysis. Pearson’s correlations are calculated for the library distribution of one animal versus any other animal, two averaged animals versus any other two, and so on. The mean of all possible combinations is plotted. FIG. 14G are z-scored abundance histograms of gene targeting or intergenic control sgRNAs across screening time points and conditions. FIG. 14H shows donor Pearson correlations across screening time points and conditions, ns = non-significant.
[0033] FIGs. 15A-15D relate to in vivo screens identifying genes that modify CAR-T cell abundance and transcriptional phenotype. FIG. 15A shows genes ranked by Log2(fold change) during in vitro manufacturing in IL-7 / IL-15 (end-of-production vs. baseline, left panel) and early in vivo (day 7 vs. end-of-production, middle panel) or late in vivo (day 21 vs. end-of-production, right panel). Enriched genes and depleted genes are shown, with circle size corresponding to - loglO (FDR), n = 2 healthy donor T cells (ND106, ND216). FIG. 15B shows the abundance of sgRNAs targeting individual genes across the entire screen workflow for Mario-CAR-T cells produced in IL-7 / IL-15. FIG. 15C is a heatmap showing relative expression of top differentially expressed genes amongst clusters of BCMA CAR-T cells. FIG. 15D shows proportions of each knockout cell type amongst clusters.
[0034] FIGs. 16A-16C relates to the generation and validation of knockout CAR-T cells. FIG. 16A is an exemplary construct design for the 4- IBB BCMA CAR (pCAR) and double-guide cassette (pGuide) containing individual gene sgRNAs (variable sgRNA): CDKN1B, IL2RA, PTPN2, and RASA2. FIG. 16B shows the quantification of insertions / deletions (indels) in sgRNA target region by next generation sequencing. Data represents target sgRNA 1 and 2 for CDKN1B, PTPN2, and RASA2, respectively; presented as mean + / - SEM. FIG. 16C shows IL2RA expression by flow cytometry, with IL2RA KO CAR-T cells (before electroporation / CD3 negative selection and after) compared to UTD and intergenic control KO (both IL-2 and IL-7 / IL- 15 -produced, respectively). UTD = untransduced T cells.
[0035] FIGs. 17A-17B relate to the in vitro cytotoxicity of knockout CAR-T cells. FIGs. 17A- 17B show a 16-hour luciferase-based killing assay of knockout CAR-T cells co-cultured with MM. IS tumor cells (FIG. 17A) or RPMI-8226 (FIG. 17B), in different effector to target (E:T) ratios (from 10:1 to 1:100). Upper panels display comparison of intergenic KO CAR-T cells to UTD. Middle and lower panels show relative killing of IL2RA KO (IL-2- or IL-7 / IL-15- produced; middle panel) or CDKN1B KO, PTPN2 KO, and RASA2 KO (lower panel) compared to intergenic KO CAR-T cells. Data represent technical replicates from CAR-T cells generated from two normal donors (ND116, ND202). Data presented as mean + / - SEM. Statistical significance was measured by two-way ANOVA with Tukey’s multiple comparison test. UTD = untransduced T cells. ***p < 0.001, and ns = non-significant.
[0036] FIGs. 18A-18C show that CDKN1B ablation increases the efficacy of BCMA CAR-T cells in vivo. FIG. 18A shows MM. IS tumor burden as measured by bioluminescent imaging (BLI) of mice treated with intergenic control KO, or CDKN1B KO BCMA CAR-T cells. NSG mice were injected intravenously with 1E6 MM. IS followed by transfer of CAR-T cells 21 days later. n=3 mice per group from one healthy donor (ND202). Data presented as mean + / - SEM. Statistical significance was measured compared to the intergenic KO CAR-T cell treated group at day 77 (CDKN1B KO, PTPN2 KO) as measured by two-way ANOVA with Tukey’s multiple comparison test. FIG. 18B shows the overall survival of mice treated with intergenic control KO or CD KN IB KO BCMA CAR-T cells. n=13 for tumor only and intergenic control KO CAR-T cell treated animals and n=16 for CD KN IB KO CAR-T cell treated animals. Data were combined from multiple experiments using T cells from two healthy human donors (ND202, ND116). Statistical significance was measured by log-rank (Mantel-Cox test) for Kaplan-Meier curves. FIG. 18C shows a comparison of cell cycle (G0 / G1, S, G2 / M) between CDKN1B KO and intergenic control KO CAR-T cells. Stimulation with irradiated K562-BCMA tumor cells was conducted on day 0 and day 6, with flow cytometry measurements on day 0 (before stimulation), day 1, day 7, and day 14 (schematic overview, left). *p < 0.05, and **p < 0.01. DETAILED DESCRIPTION
[0037] General Definitions
[0038] In some embodiments, the term "engineered" and its grammatical equivalents as used herein can refer to one or more human-designed alterations of a nucleic acid, e.g., the nucleic acid within an organism's genome. In another embodiment, engineered can refer to alterations, additions, and / or deletion of genes. An "engineered cell" can refer to a cell with an added, deleted and / or altered gene.
[0039] The term "cell" or "engineered cell" and their grammatical equivalents as used herein can refer to a cell of human or non-human animal origin.
[0040] As used herein, the term "operably linked" refers to a first polynucleotide molecule, such as a promoter, connected with a second transcribable polynucleotide molecule, such as a gene of interest, where the polynucleotide molecules are so arranged that the first polynucleotide molecule affects the function of the second polynucleotide molecule. The two polynucleotide molecules may or may not be part of a single contiguous polynucleotide molecule and may or may not be adjacent. For example, a promoter is operably linked to a gene of interest if the promoter regulates or mediates transcription of the gene of interest in a cell.
[0041] In some aspects, this disclosure describes a chimeric antigen receptor (CAR)-T cell comprising a loss of function mutation in a cyclin dependent kinase inhibitor IB (CDKN1B) gene.
[0042] The term "polynucleotide" is used herein interchangeably with "nucleic acid molecule" to indicate a polymer of nucleosides. Typically, a polynucleotide is composed of nucleosides that are naturally found in DNA or RNA (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) joined by phosphodiester bonds. However, the term encompasses molecules comprising nucleosides or nucleoside analogs containing chemically or biologically modified bases, modified backbones, etc., whether or not found in naturally occurring nucleic acids, and such molecules may be preferred for certain applications. Where this disclosure refers to a polynucleotide it is understood that both DNA, RNA, and in each case both single- and double-stranded forms (and complements of each single- stranded molecule) are provided. "Polynucleotide sequence" as used herein can refer to the polynucleotide material itself and / or to the sequence information (i.e., the succession of letters used as abbreviations for bases) that biochemically characterizes a specific nucleic acid. In some embodiments, the nucleic acid molecule is a heterologous nucleic acid molecule. As used herein the term, “heterologous nucleic acid molecule” refers to a nucleic acid molecule that does not naturally exist within a given cell.
[0043] A polynucleotide sequence presented herein is presented in a 5' to 3' direction unless otherwise indicated.
[0044] The term "polypeptide" as used herein refers to a polymer of amino acids. The terms "protein" and "polypeptide" are used interchangeably herein. A peptide may be a relatively short polypeptide, typically between about 2 and 60 amino acids in length. Polypeptides used herein typically contain amino acids such as the 20 L-amino acids that are most commonly found in proteins. However, other amino acids and / or amino acid analogs known in the art can be used. One or more of the amino acids in a polypeptide may be modified, for example, by the addition of a chemical entity such as a carbohydrate group, a phosphate group, a fatty acid group, a linker for conjugation, functionalization, etc. A polypeptide that has a non-polypeptide moiety covalently or noncovalently associated therewith is still considered a "polypeptide." Exemplary modifications include glycosylation and palmitoylation. Polypeptides can be purified from natural sources, produced using recombinant DNA technology or synthesized through chemical means such as conventional solid phase peptide synthesis, etc. The term "polypeptide sequence" or "amino acid sequence" as used herein can refer to the polypeptide material itself and / or to the sequence information (i.e., the succession of letters or three letter codes used as abbreviations for amino acid names) that biochemically characterizes a polypeptide. A polypeptide sequence presented herein is presented in an N-terminal to C-terminal direction unless otherwise indicated.
[0045] The term "gene" means the nucleic acid sequence which is transcribed (DNA) to RNA in vitro or in vivo when operably linked to appropriate regulatory sequences. The gene may or may not include regions preceding and following the coding region, e.g., 5' untranslated (5' UTR) or "leader" sequences and 3' UTR or "trailer" sequences, as well as intervening sequences (intrans) between individual coding segments (exons).
[0046] The terms "about" or “approximately” when used in connection with a value can mean that the value or a statement reciting the value encompasses a range within ±1%, ±2%, ±3%, ±4%, ±5%, ±6%, ±7%, ±8%, ±9%, ±10%, ±1-5%, ±2-7%, ±3-8%, ±4-9%, or ±5-10% of the value.
[0047] The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The abbreviation, "e.g.," is derived from the Latin exempli gratia, and is used herein to indicate a non-limiting example. Thus, the abbreviation "e.g.," is synonymous with the term "for example."
[0048] Other terms are defined within the description of the various aspects and embodiments of the technology, as set forth herein.
[0049] In accordance with this disclosure, there may be employed conventional molecular biology, microbiology, biochemical, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. Embodiments of this disclosure are further described in the following examples, which do not limit the scope of the methods and compositions of matter described in the claims.
[0050] In one aspect of the technology, the technology described herein relates to a pharmaceutical composition including activated CAR-T cells as described herein, and optionally a pharmaceutically acceptable carrier. The active ingredients of the pharmaceutical composition at a minimum include activated CAR-T cells as described herein. In some embodiments, the active ingredients of the pharmaceutical composition consist essentially of activated CAR-T cells as described herein. In some embodiments, the active ingredients of the pharmaceutical composition consist of activated CAR-T cells as described herein. Pharmaceutically acceptable carriers for cell-based therapeutic formulation include saline and aqueous buffer solutions, Ringer's solution, and serum components, such as serum albumin, HDL and LDL. The terms such as "excipient," "carrier," "pharmaceutically acceptable carrier", “pharmaceutically acceptable excipient” or the like are used interchangeably herein.
[0051] In some aspects, this disclosure describes a chimeric antigen receptor (CAR)-T cell comprising a loss of function mutation in a cyclin dependent kinase inhibitor IB (CDKN1B) gene.
[0052] Chimeric Antigen Receptors (CARs)
[0053] The terms "chimeric antigen receptor" or "CAR" or "CARs", as used herein, refer to engineered T cell receptors, which graft a ligand or antigen specificity onto immune cells. In some embodiments, the immune cell is a T-cell (for example, naive T cells, central memory T cells, effector memory T cells or combinations thereof). CARs are also known as artificial T cell receptors, chimeric T cell receptors or chimeric immunoreceptors. A CAR places an antigen binding domain that specifically binds a target, e.g., a polypeptide, expressed on the surface of a cell to be targeted for a T cell response, onto a construct including a transmembrane domain and intracellular domain(s) of a T cell receptor molecule. In some embodiments, the antigen binding domain includes the antigen domain(s) of an antibody that specifically binds an antigen expressed on a cell to be targeted for a T cell response. In some embodiments, the antigen binding domain includes a ligand that specifically binds an antigen expressed on a cell to be targeted for a T cell response.
[0054] As used herein, a "CAR-T cell" or "CAR-T" refers to a T cell that expresses a CAR. When expressed in a T cell, CARs have the ability to redirect T cell specificity and reactivity toward a selected target in a non-MHC-restricted manner, exploiting the antigen binding properties of monoclonal antibodies. The non-MHC-restricted antigen recognition gives T cells expressing CARs the ability to recognize an antigen independent of antigen processing, thus bypassing a major mechanism of tumor escape.
[0055] As can be determined by those of skill in the art, various functionally similar or equivalent components of these CARs can be swapped or substituted with one another, as well as other similar or functionally equivalent components known in the art or listed herein.
[0056] Any cell-surface moiety can be targeted by a CAR. Often, the target will be a cellsurface polypeptide that may be differentially or preferentially expressed on a cell that one wishes to target for a T cell response. In some embodiments, the antigen binding domain binds to any one of CD19, CD37, CD70, CD79b, TACI, BCMA, MUC1, MUC16, B7H3, mesothelin, CD70, PSMA, PSCA, EGFRvIII, claudin6, binds to any pair of CD19 / CD79b, BCMA / TACI, or is a TriPRIL antigen binding domain, e.g., as described in PCT / US2020 / 065733, PCT / US2020 / 036108, PCT / US2018 / 013215, PCT / US2018 / 013213, PCT / US2018 / 027783, PCT / US2018 / 013221, PCT / US2018 / 022974, PCT / US2019 / 042268, PCT / US2019 / 038518, PCT / US2019 / 066357, PCT / US2019 / 013103, PCT / US2019 / 017727, PCT / US2020 / 051018, and / or PCT / US2018 / 013095.
[0057] Antigen binding domain
[0058] As used herein, the term "antigen binding domain" refers to a polypeptide found on the outside of the cell that is sufficient to facilitate binding to a target. CARs described herein comprise an antigen binding domain. The antigen binding domain specifically binds to its binding partner, i.e., the target. As non-limiting examples, the antigen binding domain can include an antigen domain of an antibody, or a ligand, which recognizes and binds with a cognate binding partner protein. In this context, a ligand is a molecule that binds specifically to a portion of a protein and / or receptor. The cognate binding partner of a ligand useful in the methods and compositions described herein can generally be found on the surface of a cell. Ligand:cognate partner binding can result in the alteration of the ligand-bearing receptor, or activate a physiological response, for example, the activation of a signaling pathway. In some embodiments, the ligand can be non-native to the genome. In some embodiments, the ligand has a conserved function across at least two species.
[0059] Any cell-surface moiety can be targeted by a CAR (e.g., the antigen binding domain of the CAR). In some embodiments, the target will be a cell- surface polypeptide that may be differentially or preferentially expressed on a cell that one wishes to target for a T cell response. To target Tregs, antibodies can be targeted against, e.g., Glycoprotein A Repetitions Predominant (GARP), latency-associated peptide (LAP), CD25, CTLA-4, ICOS, TNFR2, GITR, 0X40, 4-1BB, and LAG-3.
[0060] In some embodiments, the CAR encodes an antigen binding domain that binds to any one of CD19, CD79b, TACI, BCMA, MUC1, MUC16, B7H3, mesothelin, CD70, PSMA, PSCA, EGFRvIII, claudin6, binds to any pair of CD19 / CD79b, BCMA / TACI, or is a TriPRIL antigen binding domain.
[0061] In some embodiments, the CAR comprises an antigen binding domain that binds BCMA. In some embodiments, the mesothelin CAR comprises a polynucleotide encoding an antigen binding domain comprising a mesothelin antibody (e.g., scFv). In some embodiments, the BCMA scFv comprises SEQ ID NO: 5, or a variant thereof with mutations in the framework region.
[0062] Hinge and Transmembrane Domains
[0063] In some embodiments, the CAR polypeptide further comprises a transmembrane domain, or a hinge / transmembrane domain, which joins the antigen binding domain to the intracellular signaling domain. The binding domain of the CAR is, in some embodiments, followed by one or more "hinge domains," which plays a role in positioning the antigen binding domain away from the effector cell surface to enable proper cell / cell contact, antigen binding (by the antigen binding domain) and activation. A CAR may include one or more hinge domains between the binding domain and the transmembrane domain (TM). The hinge domain may be derived either from a natural, synthetic, semi- synthetic, or recombinant source. The hinge domain may include the amino acid sequence of a naturally occurring immunoglobulin hinge region or an altered immunoglobulin hinge region. Illustrative hinge domains suitable for use in the CARs described herein include the hinge region derived from the extracellular regions of type 1 membrane proteins such as CD8 (e.g., CD8alpha), CD4, CD28, 4- IBB, and CD7, which may be wild-type hinge regions from these molecules or may be altered. In some embodiments, the CAR comprises polynucleotide encoding CD8alpha hinge / transmembrane domain. In some embodiments, the CAR comprises a polynucleotide encoding a 41BB intracellular domain.
[0064] In some embodiments, the hinge region is derived from the hinge region of an immunoglobulin like protein (e.g., IgA, IgD, IgE, IgG, or IgM), CD28, or CD8. In some embodiments, the hinge domain includes a CD8a hinge region.
[0065] As used herein, "transmembrane domain" (TM domain) refers to the portion of the CAR that fuses the extracellular binding portion, in some embodiments via a hinge domain, to the intracellular portion (e.g., the costimulatory domain and intracellular signaling domain) and anchors the CAR to the plasma membrane of the immune effector cell. The transmembrane domain is a generally hydrophobic region of the CAR, which crosses the plasma membrane of a cell. The TM domain can be the transmembrane region or fragment thereof of a transmembrane protein (for example a Type I transmembrane protein or other transmembrane protein), an artificial hydrophobic sequence, or a combination thereof. While specific examples are provided herein and used herein, other transmembrane domains will be apparent to those of skill in the art and can be used in connection with alternate embodiments of the technology. A selected transmembrane region or fragment thereof would preferably not interfere with the intended function of the CAR.
[0066] As used in relation to a transmembrane domain of a protein or polypeptide, "fragment thereof" refers to a portion of a transmembrane domain that is sufficient to anchor or attach a protein to a cell surface.
[0067] In some embodiments, the transmembrane domain or fragment thereof of the CAR described herein includes a transmembrane domain selected from the transmembrane domain of an alpha, beta or zeta chain of a T cell receptor, CD2, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, KIRDS2, 0X40, CD2, CD27, LFA-1 (CDl la, CD18), ICOS (CD278), 4-1BB (CD137), 4- 1BBL, GITR, CD40, BAFFR, HVEM (EIGHTR), SEAMF7, NKp80 (KERFI), CD160, CD19, IE2R beta, IE2R gamma, IE7R a, ITGA1, VEA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VEA- 6, CD49f, ITGAD, CDl ld, ITGAE, CD103, ITGAL, CDl la, LFA-1, ITGAM, CDl lb, ITGAX, CD 11c, ITGB1, CD29, ITGB2, CD 18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRT AM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), SLAMF6 (NTB-A, LylO8), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, PAG / Cbp, NKp44, NKp30, NKp46, NKG2D, and / or NKG2C.
[0068] As used herein, a "hinge / transmembrane domain" refers to a domain including both a hinge domain and a transmembrane domain. For example, a hinge / transmembrane domain can be derived from the hinge / transmembrane domain of CD8, CD28, CD7, or 4- IBB. In some embodiments, the hinge / transmembrane domain is a CD2 hinge / transmembrane domain. In some embodiments, the hinge / transmembrane domain of a CAR or fragment thereof is derived from or includes the hinge / transmembrane domain of CD8 (e.g., SEQ ID NO: 49), or variants thereof). CD8 is an antigen preferentially found on the cell surface of cytotoxic T lymphocytes. CD8 mediates cell-cell interactions within the immune system and acts as a T cell co-receptor. CD8 consists of an alpha (CD8alpha or CD8a) and beta (CD813 or CD8b) chain. CD8a sequences are known for a number of species, e.g., human CD8a, (NCBI Gene ID: 925) polypeptide (e.g., NCBI Ref Seq NP 001139345.1) and mRNA (e.g., NCBI Ref Seq NM_ 000002.12). CD8 can refer to human CD8, including naturally occurring variants, molecules, and alleles thereof. In some embodiments of any of the aspects, e.g., in veterinary applications, CD8 can refer to the CD8 of, e.g., dog, cat, cow, horse, pig, and the like.
[0069] Homologs and / or orthologs of human CD8 are readily identified for such species by one of skill in the art, e.g., using the NCBI ortholog search function or searching available sequence data for a given species for sequence similar to a reference CD8 sequence.
[0070] In some embodiments, the CD8 hinge and transmembrane sequence corresponds to the amino acid sequence of SEQ ID NO: 49; or includes a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity to the sequence of SEQ ID NO: 49.
[0071] Co-stimulatory Domains
[0072] Each CAR described herein optionally includes the intracellular domain of one or more co-stimulatory molecule or co-stimulatory domain. As used herein, the term "co-stimulatory domain" refers to an intracellular signaling domain of a co-stimulatory molecule. Co-stimulatory molecules are cell surface molecules other than antigen receptors or Fe receptors that provide a second signal required for efficient activation and function of T lymphocytes upon binding to antigen. The co- stimulatory domain can be, for example, the co- stimulatory domain of 4- IBB, CD27, CD28, or 0X40. In one example, a 4- IBB intracellular domain (ICD) can be used (see, e.g., below and SEQ ID NO: 53, or variants thereof). Additional illustrative examples of such co-stimulatory molecules include CARD11, CD2, CD7, CD27, CD28, CD30, CD40, CD54 (ICAM), CD83, CD134 (0X40), CD137 (4-1BB), CD150 (SLAMF1), CD152 (CTLA4), CD223 (LAG3), CD270 (HVEM), CD273 (PD-L2), CD274 (PD-L1), CD278 (ICOS), DAP10, LAT, NKD2C SLP76, TRIM, and ZAP70. In some embodiments, the intracellular domain is the intracellular domain of 4-1BB. 4-1BB (CD137; TNFRS9) is an activation induced costimulatory molecule and is an important regulator of immune responses.
[0073] 4-1BB is a membrane receptor protein, also known as CD137, which is a member of the tumor necrosis factor (TNF) receptor superfamily. 4- IBB is expressed on activated T lymphocytes. 4- IBB sequences are known for a number of species, e.g., human 4-1 BB, also known as TNFRSF9 (NCBI Gene 25 ID: 3604) and mRNA (NCBI Reference Sequence: NM_001561.5). 4-1BB can refer to human 4-1BB, including naturally occurring variants, molecules, and alleles thereof. In some embodiments of any of the aspects, e.g., in veterinary applications, 4-1BB can refer to the 4-1BB of, e.g., dog, cat, cow, horse, pig, and the like. Homologs and / or orthologs of human 4- IBB are readily identified for such species by one of skill in the art, e.g., using the NCBI ortholog search function or searching available sequence data for a given species for sequence similar to a reference 4- IBB sequence. In some embodiments, the CAR-T cell comprises a 4- IBB costimulatory domain.
[0074] Intracellular Signaling Domains
[0075] The properties of the intracellular signaling domain(s) of the CAR can vary as known in the art and as disclosed herein, but the chimeric target / antigen binding domains(s) render the receptor sensitive to signaling activation when the chimeric target / antigen binding domain binds the target / antigen on the surface of a targeted cell.
[0076] With respect to intracellular signaling domains, so-called "first-generation" CARs include those that solely provide CD3-zeta signals upon antigen binding by the antigen binding domain. So-called "second-generation" CARs include those that provide both co-stimulation (e.g., CD28 or CD137) and activation (CD3-zeta;) domains, and so-called "third-generation" CARs include those that provide multiple costimulatory (e.g., CD28 and CD 137) domains and activation domains (e.g., CD3-zeta). In various embodiments, the CAR is selected to have high affinity or avidity for the target / antigen - for example, antibody-derived target or antigen binding domains will generally have higher affinity and / or avidity for the target antigen than would a naturally occurring T cell receptor. This property, combined with the high specificity one can select for an antibody provides highly specific T cell targeting by CAR-T cells.
[0077] CARs as described herein include an intracellular signaling domain. An "intracellular signaling domain" refers to the part of a CAR polypeptide that participates in transducing the message of effective CAR binding to a target antigen into the interior of the immune effector cell to elicit effector cell function, e.g., activation, cytokine production, proliferation and cytotoxic activity, including the release of cytotoxic factors to the CAR-bound target cell, or other cellular responses elicited following antigen binding to the extracellular CAR domain. In various examples, the intracellular signaling domain is from CD3-zeta; (see, e.g., below). Additional non-limiting examples of immunoreceptor tyrosine-based activation motif (ITAM)- containing intracellular signaling domains that are of particular use in the technology include those derived from TCR-zeta, FcR-gamma, FcR-beta, CD3-gamma, CD3-theta, CD3-sigma, CD3-eta, CD3-epsilon, CD3-zeta, CD22, CD79a, CD79b, and CD66d.
[0078] CD3 is a T cell co-receptor that facilitates T lymphocyte activation when simultaneously engaged with the appropriate co-stimulation (e.g., binding of a co- stimulatory molecule). A CD3 complex consists of 4 distinct chains; mammalian CD3 consists of a CD3-gamma chain, a CD3delta chain, and two CD3-epsilon chains.
[0079] These chains associate with a molecule known as the T cell receptor (TCR) and the CD3- zeta to generate an activation signal in T lymphocytes. A complete TCR complex includes a TCR, CD3-zeta, and the complete CD3 complex.
[0080] In some embodiments of any aspect, a CAR polypeptide described herein includes an intracellular signaling domain that includes an Immunoreceptor Tyrosine-based Activation Motif or ITAM from CD3-zeta, including variants of CD3-zeta such as IT AM-mutated CD3- zeta, CD3-eta, or CD3-theta. In some embodiments of any aspect, the ITAM includes three motifs of ITAM of CD3-zeta (ITAM3). In some embodiments of any aspect, the three motifs of ITAM of CD3-zeta are not mutated and, therefore, include native or wild-type sequences. In some embodiments, the CD3-zeta sequence includes the sequence of a CD3-zeta as set forth in the sequences provided herein, e.g., a CD3-zeta sequence of SEQ ID NO: 54, or variants thereof.
[0081] For example, a CAR polypeptide described herein includes the intracellular signaling domain of CD3-zeta. In some embodiments, the CD3-zeta intracellular signaling domain corresponds to an amino acid sequence of SEQ ID NO: 54 or includes a sequence of SEQ ID NO: 54; or includes a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity to a sequence of SEQ ID NO: 54.
[0082] In some embodiments, the intracellular domain is the intracellular domain of a 4-1 BB. In some embodiments, the 4- IBB intracellular domain corresponds to an amino acid sequence selected from SEQ ID NO: 53; or includes a sequence selected from SEQ ID NO: 53; or includes at least 75%, at least 80%, at least 85%, 35 at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity to a sequence selected from SEQ ID NO: 53.
[0083] Individual CAR and other construct components as described herein can be used with one another and swapped in and out of various constructs described herein, as can be determined by those of skill in the art. Each of these components can include or consist of any of the corresponding sequences set forth herein, or variants thereof.
[0084] In some embodiments, the CAR comprises a polynucleotide encoding a CD3zeta intracellular signaling domain.
[0085] A more detailed description of CARs and CAR-T cells can be found in Maus et al., Blood 123:2624-2635, 2014; Reardon et al., Neuro-Oncology 16:1441-1458, 2014; Hoyos et al., Haematologica 97:1622, 2012; Byrd et al., J. Clin. Oncol. 32:3039-3047, 2014; Maher et al., Cancer Res 69:4559-4562, 2009; and Tamada et al., Clin. Cancer Res. 18:6436-6445, 2012; each of which is incorporated by reference herein in its entirety.
[0086] Signal Peptide
[0087] In some embodiments, a CAR polypeptide as described herein includes a signal peptide. Signal peptides can be derived from any protein that has an extracellular domain or is secreted. A CAR polypeptide as described herein may include any signal peptides known in the art. In some embodiments, the CAR polypeptide includes a CD8 signal peptide, e.g., a CD8 signal peptide corresponding to the amino acid sequence of SEQ ID NO: 55 or including an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity to the sequence of SEQ ID NO: 55.
[0088] In further embodiments, a CAR polypeptide described herein may optionally exclude one of the signal peptides described herein, e.g., a CD8 signal peptide of SEQ ID NO: 55 or an IgK signal peptide of SEQ ID NO: 56. Linker Domain
[0089] In some embodiments, the CAR further includes a linker domain. As used herein, "linker domain" refers to an oligo- or polypeptide region from about 2 to 100 amino acids in length, which links together any of the domains / regions of the CAR as described herein. In some embodiment, linkers can include or be composed of flexible residues such as glycine and serine so that the adjacent protein domains are free to move relative to one another. Linker sequences may be from 2 to 100 amino acids, 5 to 50 amino acids, 10 to 15 amino acids, 15 to 20 amino acids, or 18 to 20 amino acids in length, and include any suitable linkers known in the art. For instance, linker sequences may include, but are not limited to, glycine / serine linkers, e.g., SEQ ID NOs: 57-60 as described by Whitlow et al., Protein Eng. 6(8):989-95, 1993, the contents of which are incorporated herein by reference in its entirety; the linker sequence of SEQ ID NO: 61 as described by Andris-Widhopf et al., Cold Spring Harb. Protoc. 2011 (9), 2011, the contents of which are incorporated herein by reference in its entirety; as well as linker sequences with added functionalities, e.g., an epitope tag or an encoding sequence containing Cre-Lox recombination site as described by Sblattero et al., Nat. Biotechnol. 18( l):75-80, 2000, the contents of which are incorporated herein by reference in its entirety. Longer linkers may be used when it is desirable to ensure that two adjacent domains do not sterically interfere with one another.
[0090] Furthermore, linkers may be cleavable or non-cleavable. Examples of cleavable linkers include 2A linkers (e.g., P2A (SEQ ID NO: 62) and T2A (SEQ ID NO: 63), 2A-like linkers or functional equivalents thereof and combinations thereof.
[0091] In various examples, linkers having sequences as set forth herein, or variants thereof, are used. It is to be understood that the indication of a particular linker in a construct in a particular location does not mean that only that linker can be used there. Rather, different linker sequences (e.g., P2A and T2A) can be swapped with one another (e.g., in the context of the constructs of this disclosure), as can be determined by those of skill in the art. In some embodiments, the linker region is T2A derived from Thosea asigna virus. Non-limiting examples of linkers that can be used in this technology include T2A, P2A, E2A, BmCPV2A, and BmlFV2A. Linkers such as these can be used in the context of polyproteins, such as those described below. For example, they can be used to separate a CAR component of a polyprotein from a therapeutic agent (e.g., an antibody, such as a scFv, single domain antibody (e.g., a camelid antibody), or a bispecific antibody (e.g., a TEAM)) component of a polyprotein (see below). In some embodiments, a P2A linker sequence comprises the amino acid sequence of SEQ ID NO: 62. In some embodiments, a T2A linker sequence comprises the amino acid sequence of SEQ ID NO: 63.
[0092] Reporters
[0093] In some embodiments, the CAR comprises a reporter protein. In some embodiments, the reporter protein is selected from the group consisting of truncated CD34 (CD34t), truncated EGFR (tEGFR), truncated CD19 (tCD19), truncated CD20 (tCD20), and truncated Her2 (tHer2). In some embodiments, the CD34t comprises an amino acid sequence of SEQ ID NO: 71.
[0094] Exemplary CARs
[0095] In some embodiments, the CAR comprises an antigen binding domain, a hinge / transmembrane domain, a costimulatory domain, and an intracellular signaling domain. In some embodiments, the CAR further comprises a reporter protein. In some embodiments, the reporter protein is at the C-terminus of the CAR and a linker (e.g., a 2A peptide) is n-terminal of the reporter protein.
[0096] In some embodiments, the CAR is selected from a group consisting of (1) a CAR that binds to any one of CD19, CD79b, TACI, BCMA, MUC1, MUC16, B7H3, mesothelin, CD70, PSMA, PSCA, EGFRvIII, claudin6, (2) a CAR that binds to any pair of CD19 / CD79b, BCMA / TACI, or (3) is a TriPRIL antigen binding domain. In some embodiments, the CAR polypeptide comprises an amino acid sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or greater sequence identity of a sequence selected from any one of SEQ ID NOs: 6-47. In some embodiments, the CAR comprises an amino acid sequence of any one of SEQ ID NOs: 6-47. In some embodiments, the CAR polypeptide consists of an amino acid sequence of any one of SEQ ID NOs: 6-47. In some embodiments, the CAR polypeptide comprises an amino acid sequence of any one of SEQ ID NOs: 6-47.
[0097] In some embodiments the CAR is a BCMA binding CAR. In some embodiments, the BCMA binding CAR is an ABECMA (idecabtagene vicleucel) CAR. In some embodiments, the BCMA binding CAR is a CARVYKTI (ciltacabtagene autoleucel) CAR.
[0098] In some embodiments, the CAR comprises a polynucleotide encoding a CD8 leader, a BCMA scFv, a CD8 hinge / transmembrane, a 41BB intracellular domain, and a CD3zeta signaling domain. In some embodiments, the CAR polypeptide comprises an amino acid sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or greater sequence identity to a sequence selected from SEQ ID NO: 6 or 36. In some embodiments, the CAR comprises an amino acid sequence of SEQ ID NO: 6 or 36. In some embodiments, the CAR polypeptide comprises an amino acid sequence of SEQ ID NO: 6 or 36.
[0099] CDKN1B Loss of Function Mutations
[0100] In some embodiments, a CAR-T cell described herein (e.g., a BCMA binding CAR-T cell) comprises a loss of function mutation in a CDKN1B gene.
[0101] A “CDKN1B loss of function mutation” or “a loss of function mutation in a CDKN1B Gene” refers to a CDKN1B gene comprising a mutation that decreases the function or expression of the CDKN1B gene product (Cyclin-dependent kinase inhibitor IB (p27Kip1)). p27Kiplfunctions by interacting with different cyclin and cyclin dependent kinase (CDK) complexes (e.g., by binding to and inhibit cyclin / CDK complexes), which in turn can inhibit cell cycle progression. Lloyd RV et al. Am J Pathol. 1999 Feb; 154(2):313-23. p27Kiplis known to regulate the Gl / S transition, G2 / M progression, and cytokinesis completion e.g., as described in Bencivenga et al. Cells 10.9 (2021): 2254. p27Kiplis also known to function in other cellular processes including cell migration e.g., as described in Bencivenga et al. Cells 10.9 (2021): 2254. CDKN1B gene function may be measured using an assay that measures p27Kipl inhibition of a cyclin dependent kinase activity. In vitro assays for measuring cyclin dependent kinase activity using radioactive ATP are known, e.g., as described in Schonthal, Methods Mol Biol. 2004;281:105-24. The CDKN1B gene in the human genome comprises about 5,000 basepairs including intronic and exonic regions. In some embodiments, the mutation is an exonic region of the CDKN1B gene. In some embodiments, the mutation is in a conserved exonic region of the CDKN1B gene. In some embodiments, the mutation is an insertion. In some embodiments, the mutation is a deletion. In some embodiments, the mutation is a frameshift mutation. In some embodiments, the mutation is an insertion or deletion that results in a frameshift mutation in an exonic region of the CDKN1B gene. In some embodiments, the mutation is an insertion or deletion that results in a frameshift mutation which is in a conserved exonic region of the CDKN1B gene. In some embodiments, the loss of function mutation in CDKN1B is an insertion of deletion into exon 1 of the CDKN1B gene (e.g., exon 1 of the human CDKN1B gene). In some embodiments, the loss of function mutation in CDKN1B is an insertion of deletion into the polynucleotide sequence encoding SEQ ID NO: 3 or SEQ ID NO: 4 of exon 1 of the CDKN1B gene.
[0102] In some embodiments, the mutation introduces an early stop codon in an mRNA transcript transcribed from the CDKN1B gene. In some embodiments, the mutation results in a truncation of the p27Kiplprotein. In some embodiments, the mutation results in a truncation in the CDKN1B gene. In some embodiments, the mutation results in a truncation in the CDKN1B gene transcript.
[0103] In some embodiments, the CDKN1B loss of function mutation is a mutation induced by CRISPR gene editing. For example, the CDKN1B loss of function mutation may be induced using a Cas9 protein and a guide RNA that is complementary to CDKN1B, as described herein. It is known in the art that most mutations induced by CRISPR / Cas9 are insertions or deletions e.g., as described in Allen F et al. Nature biotechnology 37.1 (2019): 64-72.
[0104] In some embodiments, the mutation in the CDKN1B gene reduces the function of the p27Kiplprotein by at least 10% (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5%) as compared to an unmutated CDKN1B. In some embodiments, the mutation in the CDKN1B gene reduces the function of the p27Kiplprotein by 100% compared to an unmutated CDKN1B.
[0105] In some embodiments, the mutation in the CDKN1B gene expression of the CDKN1B transcript and / or the p27Kiplprotein (e.g., in a T cell) by at least 10% (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5%) as compared to an unmutated CDKN1B. In some embodiments, the mutation in the CDKN1B gene expression of the CDKN1B transcript and / or the p27Kiplprotein (e.g., in a T cell) by 100% as compared to an unmutated CDKN1B.
[0106] In some embodiments, the CDKN1B gene is a mammalian CDKN1B gene. In some embodiments, the gene is a human CDKN1B gene (e.g., NCBI GCF_000001405.40). In some embodiments, the gene is a mouse CDKN1B gene. In some embodiments, the CDKN1B gene is a CDNK1B gene that is endogenous to the CDNK1B gene in the CAR-T cell.
[0107] CRISPR In some aspects, this disclosure describes a CAR-T cell comprising a CAR as described herein and a CRISPR guide RNA comprising a homology region that is complementary to a CDKN1B gene.
[0108] As used herein the term “clustered regularly interspaced short palindromic repeats” or “CRISPR” may refer to a gene editing system that comprises a guide RNA component and a CRISPR associated (Cas) protein component. The guide RNA polynucleotide may comprise a homology region that is complementary to a target gene and a stem loop region that is capable of binding to a Cas protein. The Cas protein may comprise a guide RNA binding site and nuclease activity. The Cas protein and the guide RNA (gRNA) may form a complex that is capable of binding to the target gene (based on the homology region) and cleaving the DNA (using the nuclease activity of the Cas protein). In some embodiments, the Cas protein guide RNA complex binds to sequence that is adjacent to and downstream of a protospacer adjacent motif (PAM). Cleavage results in a DNA strand break and repair of that strand break may introduce a mutation (e.g., single nucleotide polymorphism, insertion, or deletion). In some embodiments, the Cas protein is any suitable Cas protein for mutating and / or altering the expression of a target gene (a Cas protein may also be referred to as a CRISPR protein herein). In some embodiments, the Cas protein is selected from the group consisting of a Cas9 protein, a Cas 12 protein, or a Cas 13 protein. The skilled person will understand that Cas proteins (e.g., Cas9) may have many different orthologs (e.g., SpyoCas9, spCas9, spyCas9, and geoCas9). In some embodiments, the Cas protein is SpyoCas9. Cas proteins and orthologs thereof are well known in the art as discussed in Gasiunas, Giedrius, et al., Nature communications 11.1 (2020): 1-10; and Fancheng Y et al., Cell Biology and Toxicology 35.6 (2019): 489-492, each of which is incorporated by reference in its entirety. Methods for designing guide RNAs (e.g., selecting homology region sequences for targeting a specific gene) are also well known in the art as described in Liu, Guanqing L. et al., Computational and Structural Biotechnology Journal 18 (2020): 35-44, which is incorporated by reference in its entirety. In some embodiments, gRNAs (encoded by gRNA polynucleotides) are designed using CRISPick (portals.broadinstitute.org / gppx / crispick / public), which performs as described in Doench et al., Nature Biotechnology, 34(2), 184-191 (2016) and Sanson et al., Nature Communications, 9(1), 5416 (2018), both of which are incorporated by reference in their entirety.
[0109] As used herein, the term “guide RNA (gRNA) polynucleotide” refers to a DNA or an RNA polynucleotide that encodes a guide RNA (gRNA). A guide RNA polynucleotide comprises a sequence that binds to a clustered regularly interspaced short palindromic repeats (CRISPR) protein or CRISPR-related protein and a sequence and comprises an additional sequence that is complementary to a target polynucleotide (i.e., a homology region). For example, a guide RNA polynucleotide may be a Cas9 protein guide RNA polynucleotide or a Casl2 protein guide RNA polynucleotide. Cas9 protein guide RNAs are compatible with Cas9 CRISPR proteins and are well known in the art e.g., as described in Adli et. al., Nature communications 9.1 (2018): 1-13, which is incorporated by reference in its entirety. Casl2 protein guide RNA polynucleotides are compatible with Casl2 CRISPR proteins and are well known in the art e.g., as described in Zetsche et al., Cell 163.3 (2015): 759-771, which is incorporated by reference in its entirety. In some embodiments, a guide RNA polynucleotide is a base editor guide RNA polynucleotide. In some embodiments, the gRNA is a prime editing guide RNA polynucleotide. In some embodiments, a guide RNA polynucleotide encodes a homology region (e.g., spacer) and a region that binds to a CRISPR protein (e.g., a direct repeat). In some embodiments, the guide RNA polynucleotide is a single guide RNA polynucleotide comprising a homology region and a region that binds to a CRISPR protein.
[0110] In some embodiments, the homology region comprises a sequential series of about 10-30 or about 15-25 nucleotides. In some embodiments, the homology region comprises about 20 nucleotides. In some embodiments, the homology region is complementary to a target gene (e.g., a gene associated with immune cell function). In some embodiments, the gRNAs are designed using an algorithm (e.g., CRISPick). CRISPick is described in Kim et al., Nat Biotechnology 36, 239-241 (2018); Doench et al. Nature Biotechnology, 34(2), 184-191 (2016); and Sanson et al., Nature Communications, 9(1), 5416 (2018), each of which are incorporated by reference in their entirety.
[0111] In some embodiments, the gRNA polynucleotides are not cross -reactive or minimally cross-reactive. Cross-reactive gRNA polynucleotides refer to guide RNA polynucleotides comprising homology regions having sufficient complementarity with more than one target polynucleotide (e.g., gene sequence) such that the gRNA may induce a CRISPR mutation in more than one target polynucleotide. Design algorithms may be used in guide RNA polynucleotide design to decrease the chances of cross -reactivity (e.g., gRNAs may be scored for on-target activity using Rule Set 3(RS3) with sequence and target information and the Chen2013 tracr (Chen, Baohui, et al. Cell 155.7 (2013): 1479-1491). gRNAs may also be scored for off-target activity using Tier-agnostic 1 mismatch aggregated Cutting Frequency Determination (CFD) scores). The skilled person will understand the gRNA polynucleotides designed with such an algorithm may still have some degree of cross -reactivity, however, the risk of cross reactivity is expected to be decreased or may be specified at a selected threshold in the algorithm. In some embodiments, cross reactivity is a function of complementarity. In some embodiments, gRNA polynucleotides that are not cross-reactive do not have greater than 80% complementarity to more than 1 gene. In some embodiments, gRNA polynucleotides that are not cross -reactive do not have greater than 85% complementarity to more than 1 gene. In some embodiments, gRNA polynucleotides that are not cross-reactive do not have greater than 90% complementarity to more than 1 gene. In some embodiments, gRNA polynucleotides that are not cross -reactive do not have greater than 95% complementarity to more than 1 gene.
[0112] The term “complementary” as described herein refers to the degree of Watson-Crick base pairing between two polynucleotides. For example, two polynucleotides may be 90% complementary if 9 / 10 nucleotides of each of the polynucleotides form a Watson Crick base pair. In some embodiments, complementary may refer to at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%) of nucleotides in a first polynucleotide Watson- Crick base pairing with a second polynucleotide. In some embodiments, a homology region of a gRNA is complementary to a gene sequence when the homology region is capable of hybridizing to the gene sequence and at least a threshold percentage (e.g., at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%) of nucleotides are Watson Crick base pairs to the gene sequence. In some embodiments, a homology region is complementary to a gene sequence when the homology region is capable of hybridizing to the gene sequence and initiating cleavage of the gene sequence by a CRISPR protein and at least a threshold percentage (e.g., at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%) of nucleotides are Watson Crick base pairs to the gene sequence. In some embodiments, a homology region is complementary to a target gene sequence (e.g., a CDKN1B gene sequence) when the nucleotides of the homology region are 100% complementary to a sequential portion of the target gene sequence (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 sequential nucleotides of the target gene sequence, e.g., 20 sequential nucleotides). In some embodiments, the homology region is complementary to the sense strand of the target gene sequence. In some embodiments, the homology region is complementary to the anti-sense strand of the target gene sequence. In some embodiments, a homology region that is complementary to a gene encoded by a sequence (e.g., SEQ ID NO: 72) may refer to a homology region that is complementary to either the sense strand of the gene sequence (e.g., SEQ ID NO: 72) or the antisense strand of the gene sequence (e.g., the reverse compliment of SEQ ID NO: 72). For example, a homology region described herein may be complementary to CDKN1B sense strand (e.g., SEQ ID NO: 71) or the reverse complement of SEQ ID NO: 71 (i.e., antisense strands).
[0113] In some embodiments, the homology region is complementary to a region of the target gene sequence this is adjacent to a protospacer adjacent motif (PAM). In some embodiments, the homology region is complementary to a region of the target gene sequence that is downstream of and adjacent to a protospacer adjacent motif (PAM).
[0114] In some embodiments, this disclosure describes a CAR-T cell comprising a first polynucleotide encoding a CAR as described herein (e.g., a BCMA binding CAR) and a second polynucleotide encoding a CRISPR guide RNA polynucleotide comprising a homology region that is complementary to CD KN IB.
[0115] In some embodiments, this disclosure describes a CAR-T cell comprising a single polynucleotide encoding a CAR as described herein (e.g., a BCMA binding CAR) and encoding a CRISPR guide RNA polynucleotide comprising a homology region that is complementary to CDKN1B.
[0116] In some embodiments, this disclosure describes a CAR-T cell comprising an ABECMA (idecabtagene vicleucel) CAR and encoding a CRISPR guide RNA polynucleotide comprising a homology region that is complementary to CDKN1B.
[0117] In some embodiments, this disclosure describes a CAR-T cell comprising an CARVYKTI (ciltacabtagene autoleucel) CAR and encoding a CRISPR guide RNA polynucleotide comprising a homology region that is complementary to CD KN IB.
[0118] In some embodiments, this disclosure describes a CAR-T cell comprising an ABECMA (idecabtagene vicleucel) CAR and CDKN1B insertion or deletion mutation.
[0119] In some embodiments, this disclosure describes a CAR-T cell comprising an CARVYKTI (ciltacabtagene autoleucel) CAR and CDKN1B insertion or deletion mutation.
[0120] In some embodiments, this disclosure describes a CAR-T cell comprising a single polynucleotide encoding a BCMA-binding CAR of SEQ ID NO: 6 or 36 and encoding a CRISPR guide RNA polynucleotide comprising a homology region of any one of SEQ ID NO: 1-2 or 65-70.
[0121] In some embodiments, this disclosure describes a CAR-T cell comprising a single polynucleotide encoding a BCMA-binding CAR of SEQ ID NO: 6 or 36 and encoding a CRISPR guide RNA polynucleotide comprising a homology region of any one of SEQ ID NO: 1-2. In some embodiments, the CAR-T cell further comprises a CRISPR protein (e.g., a Cas9 protein). In some embodiments, the CAR-T cell comprises a CDKN1B insertion or deletion mutation. Table 1: Sequences
[0122]
[0123] Methods of Treatment
[0124] In some aspects, this disclosure describes a method of treating a BCMA expressing cancer in a subject, the method comprising administering a CAR-T cell comprising a BCMA binding CAR and a CDKN1B gene loss of function mutation (e.g., as descried herein) to the subject. In some embodiments, this disclosure describes a method of treating a subject having multiple myeloma, the method comprising administering a CAR-T cell comprising a BCMA binding CAR and a CDKN1B gene loss of function mutation (e.g., as descried herein) to the subject. In some embodiments, the CAR is CARVYKTI (ciltacabtagene autoleucel) CAR. In some embodiments, the CAR is ABECMA (idecabtagene vicleucel) CAR. In some embodiments, the CAR comprises a sequence of any one of SEQ ID NOs: 6 or 36. In some embodiments, the CAR comprises a sequence of SEQ ID NO: 6. In some embodiments, the CAR-T cell comprises a guide RNA polynucleotide that is complementary to CDKN1B. In some embodiments, the CAR-T cell comprises a guide RNA polynucleotide comprising a homology region of any one of SEQ ID NO: 1-2 or 65-70. In some embodiments, the CAR-T cell comprises a guide RNA polynucleotide comprising a homology region of SEQ ID NO: 1 or 2. In some embodiments, the CAR-T cell comprises a CRISPR protein (e.g., a Cas9 protein).
[0125] Cancer
[0126] "Cancer" as used herein can refer to a hyperproliferation of cells whose unique trait, loss of normal cellular control, results in unregulated growth, lack of differentiation, local tissue invasion, and metastasis. A BCMA expressing cancer expresses BCMA. BCMA expression may be determined by detecting cell surface BCMA on the cancer cell or by detecting BCMA mRNA expression.. For example, BCMA expression can be detected on a cancer cell surface using an anti-BCMA antibody as described in Ndacayisaba, Libere J., et al. International Journal of Molecular Sciences 23.21 (2022): 13427. In some embodiments, the BCMA expressing cancer is multiple myeloma.
[0127] Efficacy
[0128] The efficacy of activated BCMA-binding CAR-T cells in, e.g., the treatment of a BCMA expressing cancer, or to induce a response as described herein (e.g., a reduction in cancer cells) can be determined by the skilled clinician. However, a treatment is considered "effective treatment," as the term is used herein, if one or more of the signs or symptoms of a condition described herein is altered in a beneficial manner, other clinically accepted symptoms are improved, or even ameliorated, or a desired response is induced, e.g., by at least 10% following treatment according to the methods described herein. Efficacy can be assessed, for example, by measuring a marker, indicator, symptom, duration of a desired response and / or the incidence of a condition treated according to the methods described herein or any other measurable parameter appropriate.
[0129] Treatment according to the methods described herein can reduce levels of a marker or symptom of a condition, e.g., by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80 % or at least 90% or more.
[0130] Efficacy can also be measured by a failure of an individual to worsen as assessed by hospitalization, or need for medical interventions (i.e., progression of the disease is halted). Methods of measuring these indicators are known to those of skill in the art and / or are described herein. Treatment includes any treatment of a disease in an individual or an animal (some nonlimiting examples include a human or an animal) and includes: (1) inhibiting the disease, e.g., preventing a worsening of symptoms (e.g., pain or inflammation); or (2) relieving the severity of the disease, e.g., causing regression of symptoms. An effective amount for the treatment of a disease means that amount which, when administered to a subject in need thereof, is sufficient to result in effective treatment as that term is defined herein, for that disease. Efficacy of an agent can be determined by assessing physical indicators of a condition or desired response. It is well within the ability of one skilled in the art to monitor efficacy of administration and / or treatment by measuring any one of such parameters, or any combination of parameters. Efficacy of a given approach can be assessed in animal models of a condition described herein. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant change in a marker is observed.
[0131] Subject
[0132] As used herein, a "subject" means a human or animal. Usually, the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. Primates include, for example, chimpanzees, cynomolgus monkeys, spider monkeys, and macaques, e.g., rhesus. Rodents include, for example, mice, rats, woodchucks, ferrets, rabbits and hamsters. Domestic and game animals include, for example, cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, canine species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon. In some embodiments, the subject is a mammal, e.g., a primate, e.g., a human. The terms, "individual," "patient," and "subject" are used interchangeably herein. Preferably, the subject is a mammal. The mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but is not limited to these examples. Mammals other than humans can be advantageously used as subjects that represent animal models of disease, e.g., cancer. A subject can be male or female.
[0133] A "subject in need" of treatment for a particular condition can be a subject having that condition, diagnosed as having that condition, or at risk of developing that condition. Pharmaceutical Compositions
[0134] As used herein, the term "pharmaceutical composition" refers to the active agent (e.g., a BCMA binding CAR-T cell comprising a CDKN1B loss of function mutation) in combination with a pharmaceutically acceptable carrier e.g., a carrier commonly used in the pharmaceutical industry.
[0135] The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. In some embodiments of any of the aspects, a pharmaceutically acceptable carrier can be a carrier other than water. In some embodiments of any of the aspects, a pharmaceutically acceptable carrier can be a cream, emulsion, gel, liposome, nanoparticle, and / or ointment. In some embodiments of any of the aspects, a pharmaceutically acceptable carrier can be an artificial or engineered carrier, e.g., a carrier in which the active ingredient would not be found to occur in nature.
[0136] In one aspect of the technology, the technology described herein relates to a pharmaceutical composition including activated CAR-T cells as described herein, and optionally a pharmaceutically acceptable carrier. The active ingredients of the pharmaceutical composition at a minimum include activated CAR-T cells as described herein. In some embodiments, the active ingredients of the pharmaceutical composition consist essentially of activated CAR-T cells as described herein. In some embodiments, the active ingredients of the pharmaceutical composition consist of activated CAR-T cells as described herein. Pharmaceutically acceptable carriers for cell-based therapeutic formulation include saline and aqueous buffer solutions, Ringer's solution, and serum components, such as serum albumin, HDL and LDL. The terms such as "excipient," "carrier," "pharmaceutically acceptable carrier", “pharmaceutically acceptable excipient” or the like are used interchangeably herein.
[0137] Dosage
[0138] In some embodiments, the CAR-T cells described herein are administered as a monotherapy, i.e., another treatment for the condition is not concurrently administered to the subject. A pharmaceutical composition including the T cells described herein can generally be administered at a dosage of 104to 109cells / kg body weight. If necessary, T cell compositions can also be administered multiple times at these dosages. The cells can be administered by using infusion techniques that are commonly known in immunotherapy (see, e.g., Rosenberg et al., New Eng. J. Med. 30 319:1676, 1988).
[0139] In certain aspects, it may be desired to administer activated CAR-T cells to a subject and then subsequently redraw blood (or have an apheresis performed), activate T cells therefrom as described herein, and reinfuse the patient with these activated and expanded T cells. This process can be carried out multiple times every few weeks. In certain aspects, T cells can be activated from blood draws of from 35 10 cc to 400 cc. In certain aspects, T cells are activated from blood draws of 20 cc, 30 cc, 40 cc, 50 cc, 60cc, 70cc, 80cc, 90cc, or lOOcc.
[0140] Administration
[0141] In some embodiments, the methods described herein relate to treating a subject having or diagnosed as having a BCMA-expressing cancer (e.g., multiple myeloma) with a T cell comprising a BCMA binding CAR and a CDKN1B loss of function mutation as described herein. Subjects having a BMCA-expressing cancer can be identified by a physician using current methods of diagnosing the condition. Tests that may aid in a diagnosis of, e.g., the BCMA-expressing cancer include, but are not limited to, blood screening and bone marrow testing, and are known in the art for a given condition. A family history for a BCMA-expressing cancer, or exposure to risk factors for a condition can also aid in determining if a subject is likely to have the condition or in making a diagnosis of the condition.
[0142] The compositions described herein can be administered to a subject having or diagnosed as having a BCMA-expressing cancer. In some embodiments, the methods described herein include administering an effective amount of activated BCMA binding CAR-T cells described herein to a subject having a BCMA-expressing cancer in order to alleviate a symptom of the condition. As used herein, "alleviating a symptom of the condition" is ameliorating any condition or symptom associated with the condition. As compared with an equivalent untreated control, such reduction is by at least 5%, 10%, 20%, 40%, 50%, 60%, 80%, 90%, 95%, 99% or more as measured by any standard technique. A variety of means for administering the compositions described herein to subjects are known to those of skill in the art. In some embodiments, the compositions described herein are administered systemically or locally. In a preferred embodiment, the compositions described herein are administered intravenously. In another embodiment, the compositions described herein are administered at the site of a tumor. The term "effective amount" as used herein refers to the amount of activated BCMA binding CAR-T cells needed to alleviate at least one or more symptom of the BCMA-expressing cancer (e.g., multiple myeloma) and relates to a sufficient amount of the cell preparation or composition to provide the desired effect. The term "therapeutically effective amount" therefore refers to an amount of activated BCMA binding CAR-T cells that is sufficient to provide a particular anti-condition effect when administered to a typical subject. An effective amount as used herein, in various contexts, would also include an amount sufficient to delay the development of a symptom of the disease, alter the course of a symptom disease (for example but not limited to, slowing the progression of a condition), or reverse a symptom of the condition. Thus, it is not generally practicable to specify an exact "effective amount." However, for any given case, an appropriate "effective amount" can be determined by one of ordinary skill in the art using only routine experimentation.
[0143] Modes of Administration
[0144] Modes of administration of BCMA binding CAR-T cells comprising CDKN1B gene loss of function mutations can include, for example intravenous (iv) injection or infusion. The compositions described herein can be administered to a patient transarterially, intratumor ally, intranodally, intraperitoneally, intrathecally or intramedullary. In some embodiments, the compositions of T cells may be injected directly into a tumor, lymph node, or site of infection. In some embodiments, the compositions described herein are administered into a body cavity or body fluid (e.g., ascites, pleural fluid, peritoneal fluid, or cerebrospinal fluid).
[0145] In a particular exemplary aspect, subjects may undergo leukapheresis, wherein leukocytes are collected, enriched, or depleted ex vivo to select and / or isolate the cells of interest, e.g., T cells. These T cell isolates can be expanded by contact with an artificial APC (aAPC), e.g., an aAPC expressing anti-CD28 and anti-CD3 CDRs, and treated such that one or more CAR constructs of the technology may be introduced, thereby creating a CAR-T cell. T cells may also be contacted with a CRISPR gRNA that comprises a homology region complementary to CDKN1B and a CRISPR protein (e.g., a Cas9 guide RNA and protein). Subjects in need thereof can subsequently undergo standard treatment with high dose chemotherapy followed by peripheral blood stem cell transplantation. Following or concurrent with the transplant, subjects can receive an infusion of the expanded CAR-T cells. In some embodiment, expanded cells are administered before or following surgery. In some embodiments, lymphodepletion is performed on a subject prior to administering one or more CAR-T cells as described herein. In such embodiments, the lymphodepletion can include administering one or more of melphalan, cytoxan, cyclophosphamide, and fludarabine. The dosage of the above treatments to be administered to a patient will vary with the precise nature of the condition being treated and the recipient of the treatment. The scaling of dosages for human administration can be performed according to art- accepted practices.
[0146] In some embodiments, a single treatment regimen is required. In others, administration of one or more subsequent doses or treatment regimens can be performed. For example, after treatment biweekly for three months, treatment can be repeated once per month, for six months or a year or longer. In some embodiments, no additional treatments are administered following the initial treatment.
[0147] EXAMPLES
[0148] Example 1. In vivo and in vitro efficacy of B-cell maturation antigen (BCMA)-directed chimeric antigen receptors (CARs).
[0149] Background
[0150] Engineering T cells to express chimeric antigen receptors (CARs) specific for particular cancer antigens (CAR-T cells) has proven promising in some instances of cancer treatment but is not always successful. Even in instances in which treatment with CAR-T cells initially shows promise, tumor regrowth and patient relapse is often observed due to a lack of CAR-T cell persistence, for example in patients with multiple myeloma. Tumor resistance mechanisms, such as antigen escape, a complex tumor microenvironment (TME), and intrinsic expression of genes in CAR-T cells that suppress their proliferation or cytotoxicity all pose obstacles in the longterm survival and functionality of CAR-T cells in anti-cancer therapy.
[0151] The mechanisms that regulate proliferation, survival, and cytotoxicity of CAR-T cells are many and complex, and they vary depending on the context. Provided herein are CAR-T cells expressing a CAR against B-cell maturation antigen (BCMA), a protein expressed on the cell surface of multiple myeloma cells, engineered with loss-of-function mutations in genes that regulate cell proliferation, survival, and / or cytotoxicity (e.g., cyclin dependent kinase inhibitor IB (CDKN1B), protein tyrosine phosphatase non-receptor type 2 (PTPN2), RAS p21 protein activator 2 (RASA2), cluster of differentiation 160 (CD 160), and interleukin-2 receptor alpha (IL2RA)). These different gene knockouts were screened in vivo to measure their effects on T cell proliferation. Gene knockouts that increased T cell proliferation were further screened for in vivo multiple myeloma cancer killing efficacy. Results showed that CD KN IB knockout both increases persistence and multiple myeloma cancer killing efficacy in vivo.
[0152] Methods
[0153] CAR-T cell generation
[0154] T cells were activated on day -14 and transduced one day later with a BCMA CAR and guide RNA (gRNA) library comprising guide RNAs targeting 135 genes thought to be associated with T cell function (see PCT / US2023 / 067350). On day -7, cas9 mRNA was introduced into the T cells via electroporation. Two days later, CAR-T cells were purified via negative selection, and transduction efficiency was measured one day after selection. Control CAR-T cells and CAR-T cells with gene knockouts (“knockout CAR-T cells”) were either used for in vitro assays or injected into mice to evaluate in vivo persistence and anti-tumor efficacy, and remaining CAR-T cells were frozen down and kept for pre- versus post-injection comparisons (FIG. 1).
[0155] In vitro assays
[0156] In vitro assays were performed during the in vitro period (days -11 to 0; FIG. 1). CAR-T cell persistence was measured following culture in either IL-2 or IL-7 and IL- 15 from day -14 to day 0 (FIG. 2A), and expansion and phenotype of CAR-T cells was analyzed following purification (FIGs. 3A-3C). Control and knockout CAR-T cells were co-cultured with cancer cells and evaluated for tumor killing efficiency and expansion in the presence of cancer cells (FIGs. 4A-4B).
[0157] To assess CAR-T cell functionality following prolonged antigen exposure, CAR-T cells were co-cultured with cancer cells at a 1:1 ratio for 72 hours (one round of “stimulation”, FIG. 5 A), at which point CAR-T cells were counted and re-seeded for up to 6 total rounds of stimulation. CAR-T cells were phenotyped and assessed for killing capacity following 2, 4, and 6 rounds of simulation (FIGs. 5B-5D).
[0158] In vivo assays
[0159] On day 0 of the CAR-T cell generation protocol described above (FIG. 1), 2 x 106CAR- T cells were injected into immunodeficient NOD. Cg-Prkdc scid I12rg tmlWjl / SzJ (NSG®) mice that had been engrafted with 1 x 106MM. Is cells (a B lymphoblast cell line) at day -21. Femurs, tibias, and spines were collected on day 7 or day 14 and blood was collected on day 14 for analysis. In vivo tumor growth was measured via full-body bioluminescent imaging (FIGs. 6B- 6D). CAR-T cell persistence was measured for CAR-T cells originally engineered in either IL-2 or IL-7 and IL-15, isolated from mice on day 21(FIG. 2B).
[0160] Results
[0161] In vitro assays
[0162] Transduction of T cells with a BCMA CAR and guide construct library generated BCMA- specific CAR-T cells with knockouts in genes that may influence CAR-T cell survival, proliferation, and / or cytotoxicity (“knockout CAR-T cells”). In vitro analysis of persistence of transduced CAR-T cells following culture in either IL-2 or IL-7 and IL- 15 revealed RASA2 ko CAR-T cells (FIG. 2A) as the best performing knockout in vitro. In proliferation assays, RASA2 ko, PTPN2 ko, and CDKN1B ko CAR-T cells expanded better than control CAR-T cells (FIG. 3 A, top), while CD 160 ko CAR-T cells and IL2RA ko CAR-T cells (cultured in IL-7 and IL- 15) expanded similarly to control CAR-T cells. IL2RA ko CAR-T cells cultured in IL-2 had severely decreased expansion (FIG. 3A, bottom).
[0163] Phenotypic analysis of knockout CAR-T cells showed similar percentages of CD4+ versus CD8+ T cells, with the exception of PTPN2 ko CAR-T cells, which had a greater percentage of CD4+ T cells (FIG. 3B). All knockout CAR-T cells had similar percentages of CD4+ and CD8+ T cell subsets (naive, effector, effector memory, and central memory) compared to control CAR-T cells (FIG. 3C).
[0164] In culture, tumor-killing efficacy was similar across knockout CAR-T cells, as measured by the volume of tumor growth (FIG. 4A), and CDKN1B ko and PTPN2 ko CAR-T cells showed increased expansion, as measured by CAR-T cell area, compared to other CAR-T cell populations (FIG. 4B).
[0165] To evaluate knockout CAR-T cell efficacy following long-term antigen exposure in vitro, knockout CAR-T cells were co-cultured with MM. Is cancer cells at a 1:1 ratio for 72 hours for one round of simulation (FIG. 5A). CAR-T cells were then collected and reseeded for up to 6 total rounds of stimulation. Following the second, fourth, and sixth stimulations, CDKN1B ko, RASA2 ko, and PTPN2 ko CAR-T cells outperformed all other knockout and control CAR-T cells in cytotoxicity in vitro, as measured by a decrease in tumor area (FIGs. 5B-5D), indicating that knocking these genes out in CAR-T cells results in enhanced cytotoxicity against tumor cells.
[0166] In vivo assays
[0167] Analysis of transduced CAR-T cells following culture in either IL-2 or IL-7 and IL- 15 revealed PTPN2 and CDKN1B as the best performing gene knockouts in in vivo persistence screens (FIG. 2B). To assess the anti-tumor efficacy of knockout CAR-T cells in vivo, mice were engrafted with 1 x 106MM. Is cells for 21 days before treatment with 2 x 106knockout or control CAR-T cells (FIG. 6A). IL2RA ko CAR-T cells did not confer tumor control, while RASA2 ko, PTPN2, and CD 160 ko CAR-T cells exerted the same level of tumor control as control CAR-T cells (FIGs. 6B-6C). CDKN1B ko CAR-T cells significantly outperformed control CAR-T cells in anti-tumor efficacy and maintained high efficacy throughout the experiment (FIG. 6C). This finding was recapitulated in a second experiment using CDKN1B ko CAR-T cells derived from a second donor (FIG. 6D). Blood was taken from mice 14 days following infusion of knockout or control CAR-T cells to evaluate exhaustion phenotype. Flow cytometric analysis of exhaustion markers showed a decrease in PD-1, LAG3, and Tim-3 expression on CDKN1B ko and PTPN2 ko CAR-T cells compared to other knockout CAR-T cells or control CAR-T cells (FIGs. 7A-7C).
[0168] CDKN1B encodes an enzyme inhibitor that controls cell cycle progression by slowing the cell division cycle at the G1 phase. To determine whether the persistence and decreased exhaustion of CDKN1B ko CAR-T cells was due to an effect on the cell cycle, CDKN1B ko and control CAR-T cells were cultured in either control conditions or with K562 BCMA-expressing cancer cells. Knockout of CDKN1B in CAR-T cells did not have an effect on any stage of the cell cycle (FIG. 8), indicating that absence of CDKN1B contributes to CAR-T cell cytotoxicity and persistence via other mechanisms.
[0169] The spines of MM. IS -engrafted mice that were treated with either CDKN IB ko or control CAR-T cells were collected on day 21 and histologically assessed for the presence of CD8+ (cytotoxic) T cells. Mice treated with CDKN1B ko CAR-T cells had a marked increase in CAR-T cell infiltration to the spine (FIG. 9B) compared to mice treated with control CAR-T cells (FIG. 9A), indicating that CDKN1B ko CAR-T cells are able to migrate to the site of tumor metastasis.
[0170] Example 2. In vivo CRISPR screening identifies CDKN1B ablation enhances BCMA-CAR- T cell persistence
[0171] Chimeric antigen receptor (CAR) T cells are highly effective in hematologic malignancies. However, loss of CAR-T cells can contribute to relapse in a significant number of patients. These limitations could potentially be overcome by targeted gene editing to increase CAR-T cell persistence. Here, in vivo loss of function (LOF) CRISPR screens were performed in BCMA-targeting CAR-T cells to investigate genes that influence CAR-T cell persistence, function and efficacy in a multiple myeloma model. The expansion and persistence of CRISPR- library edited T cells was tracked in vitro and then at early and late timepoints in vivo to track the performance of gene modified CAR-T cells from manufacturing to survival in tumors. The screens revealed several context- specific regulators of CAR-T cell expansion and persistence. Ablation of RASA2 and SOCS1 enhanced T cell expansion in vitro, while ablation of PTPN2, ZC3H12A, and RC3H1 promoted robust expansion of CAR-T cells at early timepoints in vivo. Strikingly, cyclin-dependent kinase inhibitor IB (CDKNIB), a cell cycle regulator, was identified as the most important factor limiting CAR-T cell persistence at late timepoints in vivo. CDKN1B ablation increased BCMA-CAR-T cell proliferation and effector function in response to antigen, significantly enhancing tumor clearance and overall survival. These effects were most pronounced in preclinical models of multiple myeloma, raising the possibility that the key regulators of CAR-T cell persistence may differ between cancer types. Thus, the findings presented in this Example reveal differing effects of gene-perturbation on CAR-T cells over time and in different selective environments, highlight CDKN1B as a promising target to generate highly effective CAR-T cells for multiple myeloma, and underscore the importance of in vivo screening as a tool for identifying genes to enhance CAR-T cell function and efficacy.
[0172] Introduction
[0173] Chimeric antigen receptor (CAR) T cells have changed the landscape of treatment in hematologic malignancies, including B-cell leukemia, lymphoma, and multiple myeloma. However, the currently approved CAR-T cells are not curative for patients with relapsed or refractory multiple myeloma, and most patients eventually progress with disease that maintains expression of the target antigen. Patients often show a progressive loss of circulating CAR-T cells. Thus, the results presented in this Example may be used to enhance long-term CAR-T efficacy and persistence.
[0174] Many genes and signaling pathways are involved in the persistence and efficacy of CAR- T cells. One strategy to identify genetic modifications that confer increased persistence of CAR- T cells is to use pooled loss-of-function genetic screens with CRISPR-Cas9-mediated genome editing. To date, these types of screens have largely been performed in vitro, where the selective pressure that is applied to the pool of gene-modified cells consists of either single or repetitive stimulation with antigen and the identification of cells that continue to produce cytokines or proliferate. However, in vivo models likely impose different selective pressures for persistence of CAR-T cells and might better reflect the timelines and conditions that occur in patients.
[0175] Here, an in vivo pooled loss-of-function genetic screen was developed and applied to identify gene perturbations that can improve the expansion and therapeutic efficacy of BCMA- CAR-T cells against multiple myeloma as well as enhance their functionality and increase persistence.
[0176] Results Longitudinal CRISPR screens in BCMA-CAR-T cells reveal genes that influence expansion and persistence in vitro and in vivo
[0177] A CRISPR-based CAR-T cell screening platform was developed to discover genes that modify the expansion and persistence of human BCMA-CAR-T cells targeting MMl.s, a mouse xenograft model of human myeloma. To enable full recovery of a screening library in vivo, a CRISPR single guide (sg)RNA library (the ‘Mario’ library) targeting 135 genes with known or proposed functions in T cells was designed, with 8 sgRNAs targeting each gene to maximize statistical confidence in each gene hit (FIG. 10A). One hundred intergenic sgRNAs were included as controls for a total library size of 1,080 sgRNAs. The Mario sgRNA delivery vector included an NGFR reporter and a dual sgRNA cassette in which the sgRNA library was cloned at position 1, downstream of the human U6 promoter, with a TCRa constant (TRAC) -targeting sgRNA downstream of the human Hl promoter on the reverse strand in position 2 (FIG. 14A). Deletion of TRAC enabled the enrichment of successfully genome-edited cells through magnetic bead-based depletion of CD3+ cells (see Methods). The modular approach of a separate Mario sgRNA delivery vector enabled the flexibility to evaluate CAR negative (CAR-) or targetspecific dependencies using a second lentiviral vector encoding the CAR (FIG. 14A). Here, the anti-BCMA CAR vector was synthesized based on idecabtagene vicleucell 3 (and contained a 4- 1BB costimulatory domain), and included a truncated CD34 reporter as a transduction marker (FIG. 14A). The timing and dosing of the MMl.s myeloma model was optimized such that unedited BCMA-CAR-T cells and edited anti-BCMA Mario CAR-T cells showed equivalent anti-tumor activity, and relapse began 21 days post-CAR-T cell transfer (FIG. 14B).
[0178] Cytokine conditions during ex- vivo T cell product manufacturing have significant effects on T cell phenotype and proliferation. To understand how in vitro culture conditions may alter the expansion and persistence of different knockout T cells in vitro and in vivo, Mario-CAR-T cells were generated and cultured in IL-2 or a combination of IL-7 and IL- 15, both of which are commonly used to manufacture CAR-T cells (FIG. 10B). Healthy human T cells from three normal donors were activated with anti-CD3 / CD28 beads, cultured in the specified cytokine(s) throughout, and transduced with the Mario and CAR lentiviral vectors. A “baseline” sample of cells was collected 48 hours after lentiviral transduction, as a measure of library representation in cells prior to genome-editing. Following continued expansion in cytokines for 4 additional days, T cells were electroporated with Cas9 mRNA, cultured for 48 hours to enable genome editing and reduction in surface CD3 following editing of the TRAC locus, and subsequently enriched through CD3-negative selection (FIG. 10B and FIG. 14C). The efficiency of CRISPR- editing in BCMA CAR+ T cells, hereafter “Mario-CAR-T cells,” was characterized via flow cytometry, and it was determined that the anti-BCMA CAR was expressed on up to -59% of the CRISPR-edited, CD3-negative T cell population (FIG. 14D). The CD3-negative enriched T cells were expanded an additional 5 days in the presence of cytokines prior to transfer into mice bearing BCMA-positive MMl.s myeloma tumors. A sample of cells from each donor was collected at the time of T cell infusion in mice to assess the effects of gene deletion on in vitro expansion of T cells (FIG. 10B). To evaluate the effects of genetic perturbations on CAR-T cell expansion and persistence in vivo, mice were sacrificed either 7 (“early in vivo ') or 21 days (“late in vivo”) after CAR-T injection, and cells were isolated and enriched via NGFR-positive selection from bone marrow (FIG. 10B).
[0179] Genomic DNA was isolated from the collected in vitro and in vivo samples for PCR amplification and sequencing of the integrated sgRNAs. Replicate screens were conducted using Mario-CAR-T cells generated from multiple healthy human donors. All screens showed excellent replicate correlation and sgRNA recovery, as both gene-targeting and control sgRNAs formed a normal distribution across all timepoints and donors, indicating that our sgRNA level representation in the in vivo screen was sufficient for rigorous hit calling for both enriched and depleted genes (FIGs. 14E-14G). Additionally, there was a high correlation of enriched and depleted sgRNAs between donors both in vitro and in vivo (FIG. 14H).
[0180] The enrichment and depletion of sgRNAs in Mario-CAR-T cells generated through either expansion protocol over time in several contexts were evaluated: 1) after 11 days of in vitro culture and cytokine-mediated expansion compared to original library representation in unedited cells (“Tn vitro expanded vs. baseline”); 2) at 7 days in vivo compared to the day of injection (“Early in vivo vs. in vitro expanded”); and 3) after 21 days in vivo compared to the day of injection (“Late in vivo vs. in vitro expanded”) (FIG. 10C and FIG. 15A). Following in vitro cytokine expansion, strong depletion of sgRNAs targeting known common essential genes such as DNMT1, PCBP2 and SMARCB1, as well as the key T cell transcriptional regulator IRF4, was observed. Also observed was a striking enrichment of sgRNAs targeting RASA2 (log-fold change (LFC): 2.89; p<0.0001). Enrichment of SOCS1, a negative regulator of JAKl(Liau et al. 2018; Sporri et al. 2001), and, uniquely in the Mario-CAR-T cells generated through IL-2 expansion, depletion of sgRNAs targeting 1L2RA (LFC: -7.23; p<0.0001), was also observed, consistent with the requirement for IL-2 driven T cell proliferation in vitro. Collectively, these in vitro observations indicated that the sgRNA library delivery and CRISPR editing was robust and could recover known biology. To understand which genetic modifications specifically enhance T cell persistence in vivo, the abundance of sgRNAs at early or late in vivo time points was compared to the library representation in T cells at the time of injection. Loss of the common essential genes NDUFB10 and ELOB was observed and led to strong depletion both early in vivo and late in vivo. In the early in vivo condition, the most highly enriched sgRNAs targeted PTPN2 (LFC: 2.41; p<0.0001), a negative regulator of JAK / STAT and TCR signaling. Deletion of the RNA regulatory genes ZC3H12A (REGNASE- 1 ) and RC3H1 (ROQUIN-1 ), known to play important roles in T cell responses, also resulted in enhanced T cell expansion early in vivo (FIG. 10C). As long-term expansion and persistence is a significant challenge in CAR-T therapeutic efficacy, sgRNA enrichment late in vivo was next assessed, and it was observed that CDKN1B KO T cells were the most abundant compared to cells at injection (LFC: 3.49; p<0.0001). Also observed was a significant enrichment of sgRNAs targeting either SOCS1 or PTPN2 at the later time point in vivo, suggesting a long-term beneficial effect of increased JAK / STAT activation, as well as enrichment of cells lacking TGFBR.
[0181] To directly compare gene effects across the life cycle of Mario-CAR-T, the enrichment of sgRNAs targeting the top gene for each of the previous comparisons was juxtaposed, and it was observed that despite its strong effect on proliferation in vitro, sgRNAs targeting RASA2 conferred no benefit to Mario-CAR-T expansion in vivo (FIG. 10D). In contrast, sgRNAs targeting PTPN2 were enriched in both in vivo time points despite no discernible effect in vitro, while sgRNAs targeting CDKN1B showed a modest enrichment during in vitro expansion but the largest enrichment after 21 days in vivo (FIG. 10D). Although there were some differences in depleted sgRNAs depending on the cytokines used during in vitro expansion, notably 1L2RA and DNMT1, the overall depletion and enrichment of sgRNAs were largely concordant between manufacturing approaches (FIGs. 2A-2B and FIG. 10E). Next, patterns of enrichment and depletion of different guides over time in vitro and in vivo were more comprehensively characterized by examining z-scored guide abundance at each time point for each cytokine expansion protocol (FIG. 10F and FIG. 15B). The impact of loss of IRF4 or STAT3, critical mediators of TCR-activated proliferation and differentiation, during in vitro expansion led to durably low abundance in vivo. Cells lacking 1L2RA showed reduced survival in vivo regardless of the differential sensitivity to its loss during in vitro expansion in IL-2 or IL-7 / 15 (FIG. 10F and FIG. 15B). While loss of RASA2 led to enhanced proliferation in vitro, leading to increased abundance in the pool at the time of injection, these cells exhibited diminished abundance at both time points in vivo. In contrast, cells lacking PTPN2 or CDKN1B showed a progressive increase in frequency in vitro and in vivo, regardless of the cytokines used during in vitro expansion (FIG. 10F and FIG. 15B). Collectively, the screening data revealed that many genes play variable roles regulating CAR-T expansion in vitro and in vivo over time, and suggest that in vitro models may be insufficient for identification of genes important for in vivo persistence.
[0182] Perturb-seq identifies features associated with enhanced persistence in vivo
[0183] To understand how various gene deletions affect T cell transcriptional state and frequency after 21 days in vivo, a subset of the top enriched and depleted genes from the original screens was selected (CDKNiB. IL2RA, PTPN2, RASA2, RC3H1, SOCS1, TGFBR2, ZC3H12A, and CD 160 as a gene-targeting negative control) to evaluate by Perturb-seq. Four sgRNAs were designed to target each gene, as well as 16 intergenic control sgRNAs, for a total library size of 52 sgRNAs. Guide RNAs were cloned into the original screening vector that included a paired, fixed TRAC sgRNA to enable CD3-negative selection of CRISPR-edited T cells. Following transduction with the vectors containing the sgRNA library and the CAR, engineered T cells were enriched by negative magnetic bead selection and transferred into mice previously engrafted with MM1.S myeloma (FIG. 11 A). After 21 days, mice were euthanized and the modified CAR-T cells were isolated from the bone marrow by NGFR -positive selection for analysis by droplet-based scRNAseq (see Methods). Leiden clustering of 18,680 cells generated 11 cell clusters (FIG. 11B). Clustering was primarily driven by transcripts associated with lineage, cell cycle, and transcriptional states including exhaustion, effector, and memory (FIGs. 11C-11E and FIG. 15C). To link the single cell transcriptional states with gene loss-of-function, analysis was focused on a subset of 4,991 cells in which a single genetic perturbation per cell was detected (obligate pair of gene- and TRAC-targeting sgRNA). The distribution of detected perturbations across clusters, compared to cells containing an intergenic control sgRNA and those with no detected sgRNA (no guide) cells was examined (FIG. 11F and FIG. 15D). It was observed that the majority of no guide and intergenic KO cells were represented in the early effector CD8+, late effector CD8+, and memory-like clusters. Cells lacking PTPN2, RC3H1 and ZC3H12A enriched amongst proliferating S phase Effector CD8+ and MKI67+ CD8+ cells (FIG. 1 IF). CDKN1B KO T cells were specifically enriched in the MKI67+ CD8+ cluster, while TGFBR2 KO cells specifically enriched within the progenitor exhausted cluster (FIG. 1 IF). SOCS1 and RC3H1 KO caused an enrichment of proliferating CD4+ T cells (FIG. 1 IF) . Thus, deletion of genes that promote CAR-T cell persistence in vivo have differing effects on the transcriptional profile of CAR-T cells in the tumor microenvironment. Gene set enrichment analysis (GSEA) was performed on pseudo-bulk pooled knockout cells to look more in depth at knockout specific gene signatures distributed across various clusters compared to unperturbed cells (FIG. 11G). PTPN2 KO cells showed an enrichment of the IL2 STAT5 signaling and IL6 JAK STAT3 gene signatures, consistent with the role of PTPN2 as a dampener of JAK-STAT signaling. Cells lacking CDKN1B, PTPN2. RC3H1, SOCS1, or ZC3H12A showed significant enrichment of the hallmark G2M Checkpoint, E2F Targets, and Mitotic Spindle gene sets, suggesting that loss of function in these genes was associated with increased cell proliferation.
[0184] CDKN1B KO CAR-T cells display higher expansion and reduced exhaustion in in vitro coculture conditions
[0185] To better understand which genetic perturbations will generate CAR-T cells with favorable in vitro expansion and in vivo persistence, deeper characterization of the function of CAR-T cells following deletion of individual genes was performed. Four genes were chosen based on their in vitro and in vivo pooled screen trajectories and transcriptional profiles. PTPN2 and CDKN1B were selected based on their in vivo phenotypes, RASA2 for its robust effect on in vitro expansion, and 1L2RA for its deleterious effects during in vitro expansion in IL-2.
[0186] To simplify T cell production into a single lentiviral vector, the double guide cassette was cloned into the BCMA CAR vector and included a sgRNA for the chosen candidate gene or an intergenic control sgRNA (FIG. 16A). The expansion rate of each individual KO CAR-T cell product in culture was measured (FIG. 3A and FIG. 12A). RASA2 and CDKN1B KO CARs expanded significantly more compared to the intergenic control T cells during in vitro culture, whereas 1L2RA KO CARs cultured in IL2 expanded significantly less. The expansion of 1L2RA KO T cells could be rescued by culturing in IL-7 / 15 rather than IL-2. Gene disruption was confirmed by next-generation sequencing (NGS, FIG. 16B) for CDKN1B, PTPN2, and RASA2, and via flow cytometry for IL2RA (FIG. 16C).
[0187] To investigate if each individual gene KO influenced in vitro CAR-T cell killing capacity, luciferase-based killing assays were performed at different effector to target (E:T) ratios using two luciferase-expressing human myeloma cell lines, MMl.s and RPMI 8226; no significant differences were found (FIGs. 17A-17B). There were also no differences in cytotoxic capacity among KO CARs in a 5-day cytotoxicity assay with RPML8226 (effector to target ratio 1 : 1; FIG. 17C). However, these assays only measured the response to acute antigen exposure. To better mimic the chronic antigen exposure CAR-T cell experience in vivo, a repetitive stimulation assay was performed, in which CAR-T cells were stimulated every 72 hours with fresh irradiated K562 cells transduced to express BCMA at an E:T ratio of 1:1 (FIG. 12B). Ablation of CDKN1B, PTPN2, or RASA2 preserved cytotoxicity over multiple rounds of stimulation compared to intergenic KO and 1L2RA KO CAR T cells, which failed to control the expansion of tumor cells after repeated exposures (FIGs. 4A-4B, FIGs. 5B-5D, and FIG. 12C). Collectively, these data demonstrate that loss of CDKN1B, PTPN2, or RASA2 enhances T cell cytotoxicity and prevents T cell dysfunction in vitro during repetitive antigen encounter.
[0188] CDKN1B KO enhances CAR-T cell antitumor activity and persistence in vivo
[0189] After evaluating the in vitro performance of our knockout CAR-T cells, they were further characterized in vivo. Following engraftment of MMl.s multiple myeloma, mice were treated with PTPN2, CDKN1B, RASA2, IL2RA, or intergenic control BCMA CAR-T cells, all cultured in IF-2 during production. CDKN1B KO-BCMA CAR-T cells resulted in significant prolonged tumor control (FIGs. 6B-6D and FIG. 13A). Mice receiving PTPN2 KO T cells showed a transient improvement in tumor control, but later relapsed similar to mice given intergenic KO CAR-T cells. RASA2 deficient CAR-T cells had similar in vivo efficacy to intergenic KO CAR-T cells despite enhanced cytotoxicity in vitro, with mice relapsing 28 days after CAR-T cell injection. 1L2RA KO T cells showed marked lack of tumor control and reduced overall survival.
[0190] Based on the CDKN1B KO cells enrichment in the late in vivo pooled screen and their striking improvement in tumor control, CDKN1B KO CAR-T cell function in vivo was further characterized. CDKN1B KO CAR-T cells were generated from an additional human donor, which also displayed improved in vivo tumor control against MM. IS (FIG. 18A). Collectively, mice receiving CDKN1B KO CAR-T cells from either donor had improved overall survival compared to intergenic control KO CAR-T cells (FIG. 18B). A total marrow harvest (femur, tibia, spine) was performed at day 21 after T cell transfer and cells were stained for CD8 to quantify T cell abundance in the bone marrow. Mice treated with CDKN1B KO CAR-T cells had more CD8+ cells compared to those treated with intergenic KO CAR-T cells (FIGs. 9A-9B and FIG. 13B). These data suggest that loss of CDKN1B increases CD8+ CAR-T cell expansion and / or persistence in vivo.
[0191] Next, the therapeutic efficacy of CDKN1B KO CAR-T cells was validated using a different xenograft model of multiple myeloma. Mice were engrafted subcutaneously with the RPMI-8226 myeloma cell line and treated with BCMA CAR-T cells 21 days later. CDKN1B KO CAR-T cells displayed superior anti-tumor activity as well as increased survival (FIG. 13C). To better understand how the loss of CDKN1B enhanced T cell function, bulk RNAseq was performed on cells isolated from bone marrow 21 days after CAR-T cell transfer using the MMl.s myeloma model (FIGs. 13D-13E). Differential gene expression identified many upregulated cell cycle genes in CDKN1B KO CARs including MCM4, MCM2, TOP2A, and PCNA. The expression of key regulators of NFKB and API transcriptional activity NFKB1A, JUN, and FOS were lower in CDKN1B KO CARs. Additionally, CDKN1B KO CARs had lower expression of the transcription factors ZFP36, NR4A1, and NR4A2. GSEA amongst the hallmark gene sets showed that CDKN1B KO T cells were highly enriched for genes in the E2F Targets, G2M Checkpoint, Mitotic Spindle and MYC Targets VI, whereas the TNFA signaling via NFKB signature was more enriched in intergenic control CARs (FIG. 13F). Additional GSEA for genes differentially expressed amongst effector, memory and exhausted CD8 T cells was performed, and CDKN1B KO T cells were found to display a relative enrichment of the effector gene signature and a relative depletion of the memory gene signature (FIG. 13G). These data suggest that CDKN1B KO CARs have increased proliferation through enhanced E2F transcriptional activity. This increase in proliferation corresponds with a reduction in CAR- mediated API and NFKB signaling, potentially insulating CDKN1B KO cells from chronic antigen exposure. Cell cycle progression was quantified using a cell permeable DNA dye in vitro in the presence of BCMA+ tumor cells (FIG. 18C). Immediately following initial stimulation, nearly all CDKN1B KO and intergenic control cells were in G2 / M phase. After 7 and 14 days, a population of intergenic control cells emerged in G0 / G1, while nearly all CDKN1B KO cells remained in the bright G2 / M population. To understand whether CDKN1B KO T cells had increased resistance to apoptosis or had undergone malignant transformation, long term culture with or without IL2 and with or without antigen stimulation was performed. In the absence of antigen and IL2, CDKN1B KO CAR-T cells had higher viability after 1-2 days, but this difference was lost after 7 days of culture with >95% of cells non-viable (FIG. 13H) These data suggest that deletion of CDKN1B increases BCMA CAR-T cell proliferation and function without conferring any cytokine- or antigen-independent growth. In summary, this Example used a novel in vitro-in vivo CAR-T cell screen to identify important regulators of CAR-T cell expansion and persistence in vivo. The Example additionally demonstrated that CDKN1B KO BCMA CAR-T cells have enhanced anti-tumor effects in vivo using multiple models of human multiple myeloma.
[0192] Discussion Current CAR-T cell therapies face intrinsic and extrinsic tumor resistance mechanisms, severely reducing CAR persistence and, thus, preventing long-term remission. Rather than ablating one gene at a time, pooled loss-of-function genetic screens were used to investigate a library of genes for their influence on CAR function and persistence in vitro and in vivo, showcasing a new approach for target discovery in cellular immunotherapy.
[0193] Genetic perturbations were identified in vivo that enhanced CAR-T cell expansion and function in vivo. The combined in vitro-in vivo screen allowed the identification of targets that may specifically alter T cell phenotype in one condition but not the other. For example, loss of RASA2 led to greatly increased expansion in vitro. However, RASA2 KO T cells did not score in the screen in vivo and had similar anti-tumor efficacy to control CARs in vivo. Ablation of PTPN2 showed early increased activity, in correlation with its strong in vivo screen scoring until day 7, but did not exhibit increased persistence or enhanced anti-tumor activity in the models of multiple myeloma that were tested.
[0194] Using the in vivo screen, CDKN1B was uncovered as a promising target for engineering persistent CAR-T cells in vivo. The results suggest that loss of CDKN1B enhances CAR-T proliferation and promotes the expression of effector genes, leading to prolonged anti-tumor activity in xenograft models of human multiple myeloma. Loss of CDKN1B led to an upregulation of cell proliferation genes and downregulation of cell cycle inhibitors. Notably, this increased proliferation did not drive these cells to exhaustion or dysfunction. BCMA-directed CAR-T cells with CDKN1B KO were less exhausted in vitro and had an increased proportion of CD8+ T cells compared to control BCMA CAR-T cells. It was also observed that CDKN1B KO CARs had increased anti-tumor activity despite chronic antigen exposure in vitro and in vivo. In addition to increased cell cycle activity, CDKN1B KO CAR-T cells had reduced expression of NFKB transcriptional targets, including other members of the API transcription factor family. Since NFKB and API are activated directly downstream of the 4- IBB CAR, rapidly expanding CDKN1B KO CARs may experience less chronic antigen exposure, which may prevent them from becoming exhausted and dysfunctional. There have been recent reports of T cell lymphoma occurring after CAR-T cell therapy (one case targeting BCMA, and one case CD 19). Whether knockout of CDKN1B might lead to T cell transformation was examined, and it was found that the growth of CDKN1B KO and intergenic KO CAR-T cells in the absence of cytokine and antigen was similar, with >95% of cells being non-viable after 7 days. Additionally, no genetic alterations of CDKN1B have been observed in published clinical cases to date. In summary, the findings of this Example demonstrate that CDKN1B ablation increases the functional persistence of CAR-T cell therapy in multiple myeloma, which may prolong the duration of long-term remission for patients. Furthermore, the data suggest that there are key differences in the selective pressures that occur during antigen stimulation in vitro compared to the chronic antigen exposure and physiological environment of in vivo mouse models of human cancer.
[0195] Methods
[0196] Study design
[0197] This study was designed to identify the loss of genes that enhance persistence and function of CAR-T cells targeting BCMA for the treatment of myeloma. To validate the targets found in the loss of function in vivo CRISPR screen, in vitro and in vivo functional and killing assays were performed. Additional validation was performed utilizing CD 19 as a target antigen for CAR-T cells against other hematologic tumor models outside of myeloma.
[0198] As a source of T cells anonymized human blood samples were used with approval of Institutional Review Board (IRB) at the Massachusetts General Hospital (MGH) and declared as hum- human subjects research’’ . Mice used in in vivo experiments were randomized prior to CAR-T cell involving experiments and all animal work was performed according to protocols approved by the Institutional Animal Care and Use Committee (IACUC).
[0199] Mice and cell lines
[0200] All in vivo experiments were performed in male and female mice according to MGH Institutional Animal Care and Use Committee approved protocols. Purchased Jackson laboratory NOD-SCID-y chain-7-(NSG) mice were bred under pathogen-free conditions at the MGH Center for Cancer Research. All mice were maintained in 12: 12 h light:dark cycles at 30-70% humidity and a room temperature of 21.1-24.5 °C. All cell lines (for myeloma: MMl.s, RPMI- 8226, and U266; for mantle cell lymphoma: JeKo-1; for acute lymphoblastic leukemia: Nalm6) were obtained from the American Type Culture Collection and maintained under conditions as outlined by the supplier; cell lines were routinely tested for mycoplasma contamination (and were negative) and authenticated by STR profiling in a 3-year cycle. Cell lines were transduced to express click beetle green (CBG) luciferase in all experiments with enhanced GFP (eGFP) and, afterwards, sorted on either BD FACSAria II, FACSAria Fusion or FACSymphony S6 cell sorter to obtain a 100% transduced population. Construction ofCARs and double guide cassette
[0201] All CAR constructs contained a CD8 hinge and transmembrane domain, 4- IBB costimulatory domain, and CD3(^ signaling domain. Geneious Prime (Version 2022.0.2, 2021) was used for transgene design, which then were synthesized and cloned into second-generation lentiviral vectors under the regulation of a human EF-la promoter. BCMA (bb2121) CAR-T constructs used for double transduction contained truncated CD34 to evaluate transduction efficiency. A double sgRNA cassette utilizing the human U6 and Hl promoters was adapted for T cell screening by adding a fixed TRAC sgRNA and golden-gate cloning compatible BsmbI sites for variable sgRNA introduction.
[0202] The validation CAR-T cell constructs also contained a CD8 hinge and transmembrane domain, 4- IBB costimulatory domain, and CD3(^ signaling domain, with the fluorescent reporter mCherry to evaluate transduction efficiency. Additionally, they featured the same double guide cassette (TRAC sg and guide sg) system. CD19-targeting validation CAR-T cells were generated utilizing a lentiviral vector encoding the regular CAR construct with the additional modification of upstream CRISPR / Cas9 guide RNA sequences for either the TRAC KO or in combination with the best scoring guide for CDKN1B from the in vivo CRISPR screen.
[0203] Lentivirus and CAR-T cell production
[0204] Replication deficient lentivirus was produced by transfecting plasmids into HEK293T cells, after they were expanded in R10 media (RPMI + Glutamax + HEPES (ThermoFisher Scientific, Cat-no. 72400047), supplemented with 10% FBS, penicillin, and streptomycin). Supernatant was collected at 24 and 48 hours after transfection. Filtered virus was then concentrated by ultracentrifugation on the ThermoFisher Scientific Sorvall™ WX+ Ultracentrifuge and afterwards stored at 80C.
[0205] Human T cells were purified (Stem Cell Technologies, Cat-no. 15061) from anonymous human healthy donor leukopaks purchased from the Massachusetts General Hospital blood bank under an Institutional Review Board-exempt protocol. T cells were isolated using Stem Cell Technologies T cell Rosette Sep Isolation kit. To generate CAR-T cells, bulk human T cells were activated on day -14 using CD3 / CD28 Dynabeads (ThermoFisher Scientific, Cat-no. 40203D) at a 1:3 T celkbead ratio cultured in R10 media and 20 IU of recombinant human IE-2 (Peprotech, Cat-no. 200-02). For some settings, IE7 (Peprotech, Cat-no. 200-07) and IE15 (Peprotech, Cat- no. 200-15) were used instead of IE2 according to the following scheme: after Dynabead activation, IL- 15 (10 ng / ml) and IL-7 (10 ng / ml) was added, followed by addition of IL- 15 twice per week and IL-7 once per week during CAR-T cell production. Cells were transduced with CAR lentivirus at a multiplicity of infection (MOI) of 5 on day -13 and expanded with media doubling and IL-2 replacement every 2 days. For production of BCMA / guide library, CAR-T cells were transduced sequentially, first with the BCMA CAR and then with guide library lentivirus (both MOI 5). On day -8, the Dynabeads were removed with magnetic separation. The next day (day -7) the cells were washed 3 times in Opti-Mem. Up to 5E6 cells were then resuspended in 100 pl Opti-MEM and electroporated with 10 pg CleanCap™ Cas9 mRNA (TriLink, Cat-no. L-7206). On day -5, CD3 negative selection was performed utilizing the EasySep™ Human APC Positive Selection Kit II (Stem Cell Technologies, Cat-no. 17661) with CD3 APC antibody (Biolegend, Anti-Human Clone OKT3, Cat-no. 317318). CAR-T cells were assessed for transduction efficiency via tCD34 / APC (BCMA CAR / guide library) or mCherry (validation) expression on day -4 and stored in liquid nitrogen.
[0206] For production of BCMA CAR / guide library used in the CRISPR screen run, three healthy normal donors (ND) were used (ND216, ND99, ND106). For the IL7 / 15 screen, ND216 and ND 106 were used. Validation experiments of the respective gene knockout constructs were tested in two other healthy donors T cells (ND116, ND202).
[0207] Individual genetically modified BCMA-CAR-T cells were grown in a similar manner with the following modifications: cells were de-beaded at day 7 and washed 3 times in Opti- Mem. Up to 5E6 cells were then resuspended in 100 pl Opti-MEM and electroporated with 10 pg Cas9 mRNA. Cells were maintained in culture. Untransduced T cells from corresponding donors were grown at the same time for controls. The same formula was used for production of CD19-CARs with intergenic KO and CDKN1B KO.
[0208] Mario library curation and preparation
[0209] The ‘Mario’ library targeted the following 135 genes: ADORA2A, AGO1, AGPS, ARID 1 A, ARID2, ARIH2, ATF6, BATF3, BCL6, BTLA, CABP4, CBLB, CD 160, CD2, CD244, CD5, CD69, CDKN1B, CPT1B, CRELD1, CTBS, CTLA4, CXCR3, CYB5R4, DGKA, DGKZ, DLAT, DNMT1, DNMT3A, DNMT3B, DUSP4, EED, ELOB, ENTPD1, EOMES, EPAS1, ERG, ETS1, EZH2, FIBP, FLU, FLT1, FOXP3, FUBP1, GATA3, GGH, GLRX, GNA13, HAVCR2, HIF1A, ID2, IFNAR1, IFNAR2, IFNG, IFNGR1, IFNGR2, IKZF1, IKZF2, IL10RA, IL10RB, IL13, IL18R1, ILIA, IL2RA, IREB2, IRF2, IRF4, ITK, JUNB, KDM1A, KDR, KLRB1, KLRC1, KLRD1, LAG3, LCP2, LEF1, LTA, MEF2D, MOCS3, NDUFB10, NFATC1, NFATC2, NR4A1, NR4A2, NR4A3, NT5E, PBRM1, PCBP2, PDCD1, PDCL, PDHA1, PDHB, PEX13, PRDM1, PRDM15, PTPN2, RARA, RARB, RARG, RASA2, RC3HI, RCOR1, RNF145, RPRD1B, RUNX1, RUNX3, SETDBI, SFRP1, SMAD2, SMARCA4, SMARCBI, SOCS1, STAT3, STAT6, TASOR, TBLIXRI, TCF7, TET2, TGFBRI, TGFBR2, TIGIT, TMEM222, TNFAIP3, TNFAIP8, TNFRSFI8, TNFRSF9, TNIP1, TOX, UBASH3A, VAV1, VHL, VTI1A, ZC3H12A, ZFP36L1. Eight guides per gene were designed using the Broad Institute Genetic Perturbation Platforms CRISPICK tool. The library also included 100 sequences targeting intergenic sites as negative controls. sgRNA sequences for CDKN1B are included in Table 1.
[0210] In vivo loss of function CRISPR screen
[0211] NGS mice were injected intravenously with MMl.s tumor cells on day -21 to engraft. CAR-T cells were prepared as stated in the method section ‘Eentiviral and CAR-T cell production’’ and injected intravenously on day 0. Mice were euthanized at either day 7 or day 21, and femur, tibia, and spine were collected. From these samples, guide-positive T cells were selected using the EasySep™ Human PE Positive Selection Kit II (Stem Cell Technologies, Cat- no. 17654) with PE NGFR antibody (Biolegend, Cat-no. 345106).
[0212] After NGFR positive selection, genomic DNA was isolated using the Qiagen QIAmp DNA Mini kit (Cat-no. 51304). sgRNA sequences were PCR amplified from genomic DNA and sequenced on an Illumina MiSeq using MiSeq Reagent Kit v2 50 cycle (Cat-no. MS-102-2001). Samples were processed as previously published.
[0213] Analysis of in vivo loss of function CRISPR screen
[0214] The residuals for each guide RNA across different sample-control comparisons represent the difference between the observed Sample log2rpm values and their expected values based on the fitted cubic spline model, reflecting deviations from the modeled relationship between Control and Sample. These residuals were plotted in the sweissogram, where each guide is plotted as a distinct line on the distribution of all values in the given comparison. In the volcano plot, the log fold change (LFC) values for each gene were calculated by averaging the residuals of the top performing guides for each condition comparison. Then the p-values were calculated by using the hypergeometric distribution to assess the significance of enrichment or depletion of a gene’s signal. Lastly, the p-values were transformed by calculating their -loglO value.
[0215] Genes were classified into patterns based on changes in gene expression (calculated as z- scored log2 fold change values) for the respective investigated timeframes (in vitro, day 0 to 7 and day 7 to 21 (in vivo)). Then each value was given a score where a log2 fold change > 1 between two conditions was scored as +1; a log2 fold change < -1 was scored as -1; and a log2 fold change between 1 and -1 was scored as 0. The relative gene expression was then plotted starting all genes at a baseline of 0, then plotting the scores between each condition.
[0216] Selection of gene candidates for validation
[0217] Specific guides used to create knockout CAR-T cells were the top two scoring guides as identified in the LOF in vivo CRISPR:
[0218] CDKN1B guide 1 (GGAGAAGCACTGCAGAGACA (SEQ ID NO: 1)) and guide 2 (GCAGTGCTTCTCCAAGTCCC (SEQ ID NO: 2)), IL2RA guide 1 (TGTGTAGAGCCCTGTATCCC (SEQ ID NO: 73)) and guide 2 (ACTGCAGGGAACCTCCACCA (SEQ ID NO: 74)), PTPN2 guide 1 (GCGCTCTGGCACCTTCTCTC (SEQ ID NO: 75)) and guide 2 (GCACTACAGTGGATCACCGC (SEQ ID NO: 76)), RASA2 guide 1 (GGGTACGATAAACTTCTTCC (SEQ ID NO: 77)) and guide 2 (ATGAATAGTACATACCTATA (SEQ ID NO: 78)).
[0219] Knockout confirmation by next- generation sequencing
[0220] From 1E6 CAR-T cells, genomic DNA was isolated using the QIAamp DNA Mini Kit (Qiagen, Cat-no. 51304). After PCR, next- generation sequencing was performed (complete amplicon sequencing) by the Massachusetts General Hospital DNA Core.
[0221] Perturb-seq
[0222] The Perturb-seq pool included 4 guides per gene targeting CD 160, CDKN1B, 1L2RA, PTPN2, RASA2, RC3H1, SOCS1, TGFBR2, ZC3H12A, and intergenic controls. sgRNA sequences for CDKN1B are included in Table 1. After NGFR positive selection, droplet based scRNA seq was performed using the lOx Chromium Next GEM Single Cell 5' Reagent Kit v2 (Dual Index) with Feature Barcode technology for CRISPR Screening. Sequencing was performed on an Illumina NovaSeq 6000 instrument.
[0223] Bulk-RNA sequencing
[0224] T cells were isolated from the spine and femurs of intergenic control KO and CDKN1B KO BCMA CAR-T cell-treated animals 21 days after T cell transfer. CAR+T cells were sorted on a Sony SH800 Cell Soter. Following sorting, RNA was isolated using the Qiagen RNeasy Micro Kit (Cat-no. 74004). Bulk RNA sequencing libraries were prepared using the NEB Next Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, Cat-no. E7765) and sequenced on an Illumina NextSeq 500 instrument.
[0225] Flow cytometry
[0226] In general, all cells were washed with 2% FBS in PBS, incubated with antibody for 25- 30 minutes at 4 C in the dark, after which they were washed twice again. For some experiments, DAPI (ThermoFisher Scientific, Cat-No. PI62247) was added to distinguish live versus dead separation prior to analysis on a BD Fortessa X20. For antibodies that required secondary staining the procedure was similar: after primary staining as described above, secondary was added (prior to addition of DAPI), stained for 20 min at 4 °C in the dark and washed twice. For flow cytometry analysis, the following antigens were stained using the indicated antibody clones:
[0227] NGFR (Mouse anti-Human, Biolegend, PE Clone ME20.4, Cat-no. 345106), NGFR (Mouse anti-Human, Biolegend, APC Clone ME20.4, Cat-no. 345108), CD34 (Mouse antiHuman, Biolegend, BV650 Clone 561, Cat-no. 343623), CD3 (Mouse anti-Human, Biolegend, APC Clone OKT3, Cat-no. 317318), CD3 (Mouse anti-Human, Biolegend, BV421 Clone UCHT1, Cat-no. 562426), CD5 (Mouse anti-Human, Biolegend, BV421 Clone UCHT2, Cat-no. 562646), CD25 (Mouse anti-Human, Biolegend, APC Clone BC96, Cat-no. 302610), Tim-3 (Mouse anti-Human, BD Biosciences, BV711 Clone 7D3 (RUO), Cat-no. 565567), LAG-3 (Mouse anti-Human, BD Biosciences, Alexa Fluor 647 Clone T47-530, Cat-no. 565716), CD3 (Mouse anti-Human, BD Biosciences, APC-H7 Mouse Anti-Human Clone SK7, Cat-no. 641397). Also, brilliant stain buffer (BD Biosciences, Cat-no. 566349) was used to optimize phenotype staining.
[0228] For the cell cycle analysis, Vybrant™ DyeCycle™ Green Stain (ThermoFisher Scientific, Cat-no. V35004) was used following manufacturer’s instructions.
[0229] Luciferase-based cytotoxicity assays
[0230] Assessment of cytotoxicity was performed by a co-culture of CAR-T cells with CBG- expressing tumor cells (MMl.s, RPMI-8226) at the different effector to target (E:T) ratios (ranging from 10:1 to 1:100) for a time period of approximately 16 hours. A Synergy Neo2 microplate reader by Biotek was used to measure luciferase activity. Percentage specific lysis was calculated using the following formula: (target cells-only relative luminescence units (RLU) - total RLU with CAR-T cells) / ( target cells-only RLU) x 100%.
[0231] Real-time cytotoxicity assay
[0232] CD9 antibody (Clone: HI9a, Biolegend, Cat-no. 312102; 4 pl in 1ml PBS) was used to coat a 48-well plate, which was incubated over night at 4 degrees Celsius. On the set-up day, CD9 was removed with three PBS washes. RPMI 8226 tumor cells, expressing CBG-GFP, were seeded and plates were allowed to settle at 37 degrees Celsius for 30 min. Next, CAR-T Cells were seeded and the plates were placed in the Incucyte machine. All cells were cultured in R10 media, with Images taken every 60 min using the Incucyte software over the course of the experiments.
[0233] Repetitive stimulations
[0234] CAR-T Cells were co-cultured with tumor cells (irradiated BCMA expressing K562) at a 1:1 ratio (both 2.5E5). After 3 days, CAR-T cells were counted by flow-cytometry and then rechallenged with fresh iK562-BCMA in the same 1:1 ratio (2.5E5). This was repeated six times overall (six re-stimulations). After two, four, and six re- stimulations, 1E5 CAR-T cells were taken to analyze T cell subsets, phenotype, and exhaustion. After two, four, and six restimulations, CAR-T cells were seeded with RPML8226 tumor cells in the real-time cytotoxicity assay (described above) to assay CAR function after repetitive stimulation.
[0235] In vivo validation models
[0236] All mouse injections were performed by one animal technician and monitoring was blinded to expected outcomes. Mouse experiments included at least 3 mice per group, with the exact numbers used for each experiment are specified in the figure legends. Mice were randomized on day -1, therefore post-tumor injection and one day prior to treatment. Multiple myeloma MM1S cells were administered intravenously with 1E6 cells in 100 pl PBS and engrafted for 21 days prior to treatment with 2E6 BCMA-CAR-T cells, also in 100 pl PBS given intravenously. The lymphoma model of JeKo-1 used 1E6 tumor cells administered 7 days before treatment with 0.5E6 CD19-CAR-T cells, with each treatment injected intravenously in 100 pl PBS. For leukaemic Nalm6 mouse experiments, tumor cells were washed twice in PBS and 1E6 cells were administered via tail-vein injection in 100 pl PBS. Like the JeKo-1 model, 0.5E6 CD19-CAR-T cells were injected intravenously 7 days later in 100 pl PBS. Mice were monitored for bioluminescent emission biweekly as previously described and euthanized as per the experimental protocol or when they met pre-specified endpoints defined by the IACUC. Aura software was used to analyze images.
[0237] Pooled CRISPR Screening analysis
[0238] Guide sequences were demultiplexed and quantified using PoolQ v.2.2.0. Barcode count data was initially processed and quality checked. Samples with a ‘Normalized Match’ value < 10 were excluded from the analysis to ensure data reliability. The PCR replicates counts are summed together and the biological replicates of mice are averaged together for each condition in the data. The counts data is then normalized to reads per million (RPM) and log2 transformed with a pseudocount of 1. The guide distribution in the library is visualized as the density of log2rpm values. Pearson’s correlations were calculated for the library distribution in one biological replicate versus any other replicate, two averaged replicates versus any other two, and so on. The mean of all possible combinations was plotted. Z-score normalization was applied to the log2rpm data for all sgRNAs using the control sgRNA distribution as the baseline. Natural cubic splines with 4 degrees of freedom were fitted to the zlog2rpm data for each sample-control pair to calculate residuals. The z-log fold changes (zLFC) were calculated as the difference between the sample and control zlog2rpm values, while the residuals (zresid) were calculated as the deviations from the spline fit. Density scatter plots were produced, where each point represents the zlog2rpm values for a given guide in the control (x-axis) and sample (y-axis) where deviations from the spline fit line represent the residuals used in downstream analysis. Density distribution plots were generated to visualize the distribution of guide residuals across different donors and conditions. To further assess donor concordance within each screen, Pearson correlation values of log2RPM values were calculated. The correlations of log2rpm and zresid values were additionally visualized using scatter plots. These analyses confirmed that the donors were concordant. Consequently, further analysis was conducted using the averaged data from all donors. Parallel guide abundance plots visualize log2rpm values over time for each guide associated with selected genes of interest to investigate the performance of each guide. The zresid values were plotted in a sweissogram, where each guide is represented as a distinct line on the distribution of all values in the given comparison. In the volcano plots, the LFC values for each gene were calculated by averaging the zresid values of the top performing guides for each condition comparison. Then the p-values are calculated by using the hypergeometric distribution to assess the significance of enrichment or depletion of a gene’s signal which are then -loglO transformed. To compare the hits in each screen the zLFC values from each screen are plotted against each other for a given comparison in a scatter plot.
[0239] Perturb-seq analysis
[0240] Alignment and count aggregation were performed using CellRanger (v.7.1.0). Gene expression and sgRNA reads were aligned using cellranger count with default settings. Gene expression reads were aligned to the “refdata-gex-GRCh38-2020-A” human transcriptome. sgRNA reads were aligned to the library using the pattern TTCCAGCATAGCTCTTAAAC(BC) (SEQ ID NO: 79) (BC = barcode). Before count aggregation and read depth normalization, there were an estimated 23,424 cells recovered across 4 replicates of day 21 samples, from one donor. Counts were then aggregated using cellranger aggr with default settings. Before any further filtering of cells, there were an estimated 83,685 cells across the remaining samples. Next, a series of quality control checks were performed using Scanpy (v.1.9.5). Cells with greater than 10% mitochondrial gene content were removed. Cells with reads less than 2,000 counts and greater than 18,000 counts were removed to ensure the overall read depth per cell is within a reasonable range. Cells that had less than 1,150 genes were excluded due to poor gene capture. To remove any remaining doublets, the Scrublet tool was employed with an expected doublet rate of 10% and 50 principal components. The resulting population of cells after standard quality control filters was 67,979 cells. If at least one sgRNA read is detected in a cell, that cell is assigned as containing the associated guide accordingly. This resulted in a distribution of guides in cells where the majority of cells contain 1 guide, and the maximum number of guides in any given cell is 5. The data was not filtered on CRISPR read counts as there was poor guide capture and the majority of cells had 1 CRISPR read count.
[0241] Principal component analysis (PCA) and nearest neighbor graphs were calculated on a set of 10,000 highly variable genes using log transformed gene expression data to visualize on a UMAP plot. Harmony batch correction was then used to correct principal component analysis (PCA) embeddings for technical batch effects between the remaining samples.
[0242] The cells were grouped into 11 clusters using the Leiden algorithm with a resolution of 0.4. Leiden clusters were classified on the basis of the built-in Scanpy function one-versus-rest differential expression, expression of marker genes of interest, CD4+ versus CD8+ expression, and cell cycle scoring to determine T cell subset identity. Cell cycle scoring was calculated using Scanpy with a previously published cell cycle gene list. This analysis highlighted which guides were more likely to be associated with certain T-cell subsets. Notably, cells containing the RASA2, IL2RA, and CD 160 guides were excluded from the chi-squared analysis and further analysis due to low cell counts (< 100).
[0243] For each subset of guide containing cells, irrespective of T-cell identity, a pseudo-bulk expression profile was created by summing the counts of the cells containing a given guide. This data was then converted into a counts table where low counts (< 10) were removed, TCR genes were filtered out, and genes not found in at least one sample were excluded. Subsequently, a differential expression analysis was performed to identify differentially expressed genes between each guide containing subset and the subset of cells with no guide. Ranked lists of differentially expressed genes were created using the log2foldchange values calculated by DeSeq2 (pydeseq2 v.0.4.8). These ranked lists were passed to GSEA Pre-rank to search for enriched hallmark gene sets using gseapy (v.1.0.5).
[0244] Bulk RNA-seq analysis
[0245] Reads were adapter- and quality-trimmed using Trimmomatic (v.0.36). Trimmed reads were quantified by pseudoalignment to GRCh38 using Kallisto (v.0.44.0). Abundance estimates were then transformed into gene counts using Tximport (v.1.8.0). Differentially expressed genes were qualified using DESeq2 (v.1.38.3) and GSEA pre-rank was performed using gseapy (v.1.0.5) to determine enriched hallmark genesets. From the Human MSigDB v.2023.2.Hs collection, the memory signature was defined as the overlapping genes between GSE9650_EFFECTOR_VS_MEMORY_CD8_TCELL_DN and GSE9650_EXHAUSTED_VS_MEMORY_CD8_TCELL_DN. The effector gene signature was defined as the overlap between GSE9650_EFFECTOR_VS_EXHAUSTED_CD8_TCELL_UP and GSE9650_EFFECTOR_VS_MEMORY_CD8_TCELL_UP. The exhausted signature was defined as the overlap between GSE9650_EFFECTOR_VS_EXHAUSTED_CD8_TCELL_DN and GSE9650_EXHAUSTED_VS_MEMORY_CD8_TCELL_UP.
[0246] Statistical methods
[0247] Analyses were performed with GraphPad Prism 9 (version 9.0). Unless otherwise stated, data were presented as mean ± SEM and a two-tailed Student’s t-test or one- or two-way ANOVA test were used. All tests were two-sided unless otherwise specified. Significance was considered for p < 0.05 as the following: *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001. For experiments with multiple groups, multiple comparisons corrections were used as indicated in the figure legends.
Claims
CLAIMSWhat is claimed is:
1. A chimeric antigen receptor (CAR)-T cell comprising a loss of function mutation in a cyclin dependent kinase inhibitor IB (CDKN1B) gene.
2. The CAR-T cell of claim 1, wherein the loss of function mutation is an early stop codon, a truncation, a frameshift mutation, a deletion, or an insertion in the CDKN1B gene.
3. The CAR-T cell of claim 1, wherein the loss of function mutation is a deletion or an insertion in the CDKN1B gene.
4. The CAR-T cell of claim 1, wherein the loss of function mutation is a deletion or an insertion in exon one of the CDKN1B gene.
5. The CAR-T cell of claim 1, wherein the loss of function mutation is a deletion or an insertion in SEQ ID NO: 3 or 4 of exon one of the CDKN1B gene.
6. The CAR-T cell of any one of claims 1-5, further comprising a polynucleotide encoding a clustered regularly interspaced short palindromic repeats (CRISPR) guide RNA polynucleotide comprising a homology region that is complementary to CDKN1B gene.
7. A CAR-T cell comprising a polynucleotide encoding CRISPR guide RNA polynucleotide comprising a homology region that is complementary to a CDKN1B gene.
8. The CAR-T cell of claim 6 or claim 7, wherein the homology region comprises a polynucleotide sequence of any one of SEQ ID NOs: 1-2 or 65-70.
9. The CAR-T cell of claim 6 or claim 7, wherein the homology region comprises a polynucleotide sequence of any one of SEQ ID NOs: 1-2.
10. The CAR-T cell of any one of claims 6-9, further comprising a CRISPR protein.
11. The CAR-T cell of claim 10, wherein the CRISPR protein is a Cas9 protein.
12. The CAR-T cell of any one of claims 1-11, wherein the CAR comprises:(i) an antigen binding domain;(ii) a transmembrane domain; and(iii) an intracellular signaling domain.
13. The CAR-T cell of claim 12, wherein the antigen binding domain binds to any one of BCMA, CD19, CD79b, TACI, MUC1, MUC16, B7H3, mesothelin, CD70, PSMA, PSCA, EGFRvIII, claudin6, binds to any pair of CD19 / CD79b, BCMA / TACI, or is a TriPRIL antigen binding domain.
14. The CAR-T cell of claim 13, wherein the antigen binding domain binds to BCMA.
15. The CAR-T cell of claim 14, wherein the antigen binding domain that binds to BCMA comprises an amino acid sequence of SEQ ID NO: 5.
16. The CAR-T cell of any one of claims 12-15, wherein the transmembrane domain comprises a alpha, beta or zeta chain of a T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, KIRDS2, 0X40, CD2, CD27, LFA-1 (CDlla, CD18), ICOS (CD278), 4-1BB (CD137), 4- 1BBL, GITR, CD40, BAFFR, HVEM (EIGHTR), SEAMF7, NKp80 (KERFI), CD160, CD19, IE2R beta, IE2R gamma, IE7R a, ITGA1, VEA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VEA- 6, CD49f, ITGAD, CDlld, ITGAE, CD103, ITGAE, CDlla, EFA-1, ITGAM, CDllb, ITGAX, CDllc, ITGB1, CD29, ITGB2, CD18, EFA-1, ITGB7, TNFR2, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRT AM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), SLAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, PAG / Cbp, NKp44, NKp30, NKp46, NKG2D, or NKG2C transmembrane domain.
17. The CAR-T cell of claim 16, wherein the transmembrane domain comprises a CD8 transmembrane domain.
18. The CAR-T cell of claim 17, wherein the CD8 transmembrane domain comprises an amino acid sequence of SEQ ID NO: 49.
19. The CAR-T cell of any one of claims 12-18, wherein the intracellular signaling domain comprises a CD3y, CD3s, CD35, or CD3(^ intracellular signaling domain.
20. The CAR-T cell of any one of claims 12-18, wherein the intracellular signaling domain comprises a CD3(^ intracellular signaling domain.
21. The CAR-T cell of claim 20, wherein the CD3(^ intracellular signaling domain comprises an amino acid sequence of SEQ ID NO: 54.
22. The CAR-T cell of any one of claims 12-21, wherein the CAR further comprises a co stimulatory domain.
23. The CAR-T cell of claim 22, wherein the costimulatory domain comprises a CD28, 4- 1BB, CD27, TCR-zeta, FcR-gamma, FcR-beta, CD3-gamma, CD3-theta, CD3-sigma, CD3-eta, CD3-epsilon, CD3-zeta, CD22, CD79a, CD79b, or CD66d costimulatory domain.
24. The CAR-T cell of claim 18, wherein the costimulatory domain comprises a 4- IBB co stimulatory domain.
25. The CAR-T cell of any one of claims 12-24, wherein the CAR further comprises a truncated CD34 (CD34t) protein.
26. The CAR-T cell of claim 25, wherein the CD34t protein comprises an amino acid sequence of SEQ ID NO: 71.
27. The CAR-T cell of claim 25 or claim 26, wherein the CAR comprises a 2A peptide between the intracellular signaling domain and the CD34t protein.
28. The CAR-T cell of any one of claims 12-27, wherein the CAR further comprises a signal peptide.
29. The CAR-T cell of claim 28, wherein the signal peptide comprises a CD8 signal peptide or an IgK signal peptide.
30. The CAR-T cell of claim 29, wherein the CD8 signal peptide comprises an amino acid sequence of SEQ ID NO: 55.
31. The CAR-T cell of any one of claims 1-30, wherein the CAR comprises from N-terminal to C-terminal:(i) a CD8 leader sequence;(ii) antigen binding domain that binds to BCMA;(iii) a CD8 transmembrane domain;(iv) a 4- IBB costimulatory domain; and(v) a CD3(^ intracellular signaling domain.
32. The CAR-T cell of claim 12, wherein the CAR comprises an amino acid sequence of SEQ ID NO: 6 or 36.
33. The CAR-T cell claim 12, wherein the CAR comprises an amino acid sequence of any one of SEQ ID NOs: 6-47.
34. A method of treating a BCMA expressing cancer in a subject, the method comprising administering the CAR-T cell of any one of claims 14-33 to the subject.
35. The method of claim 34, wherein the BCMA expressing cancer is a B cell cancer.
36. The method of claim 34 or claim 35, wherein the BCMA expressing cancer is multiple myeloma.
37. The method of any one of claims 34-36, wherein the subject is a human subject.
Citation Information
Patent Citations
Modified immune cells having enhanced Anti-neoplasia activity and immunosuppression resistance
US20220133790A1