Nucleic acid detection method for detecting soybean plant mon 87705
Through the combination of nucleic acid sequence combination of LAMP-SD-CRISPR and the lateral flow chromatography sensor (LFB), the rapid, sensitive and specific detection of soybean plant MON87705 was achieved, solving the problems of high detection complexity and cost in the prior art, reaching the qualitative detection limit of 0.1 wt%.
Patent Information
- Application Number
- PCT/CN2023/134240
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-11-27
- Publication Date
- 2025-06-05
AI Technical Summary
When testing genetically modified foods, the prior art requires two tests of internal standard genes and transgenic transformants, which increases the detection cost and operational complexity and extends the detection time.
The nucleic acid sequence combination of LAMP-SD-CRISPR is used to combine with the lateral flow chromatography sensor (LFB), and the LAMP reaction, SD reaction and CRISPR/Cas12a system reaction are used to achieve rapid, sensitive and specific detection of soybean plant MON87705.
It reduces the detection cost and operational complexity, achieves rapid, sensitive and visual detection effects, and the qualitative detection limit can reach 0.1 wt%, meeting the testing needs in the fields of food safety and genetically modified food.
Smart Images

Figure CN2023134240_05062025_PF_FP_ABST
Abstract
Description
A nucleic acid detection method for detecting soybean plant MON87705 Technical Field
[0001] The present invention relates to a detection method for detecting soybean plant MON87705, in particular to a nucleic acid detection method for detecting soybean plant MON87705. Background Art
[0002] At present, the detection of genetically modified foods often requires two tests: the internal standard gene and the genetically modified transformant. This greatly increases the detection cost and operational complexity, and prolongs the detection time.
[0003] Loop-mediated isothermal amplification (LAMP) technology was pioneered by Notomi's team in 2000. It can isothermally amplify targeted nucleic acid templates to 109 copies or more in 1 hour or less. It has the advantages of a single enzyme system and high amplification efficiency. When combined with a lateral flow biosensor (LFB), it can achieve highly sensitive, rapid and intuitive detection with simple operation. However, the combination of the two often requires hapten labeling, and the constructed LFB often requires the use of antibodies as recognition elements, which is relatively expensive.
[0004] In summary, how to provide a simple, low-cost, rapid, sensitive and visual method for detecting genetically modified foods is one of the urgent issues that need to be addressed in the field of food safety and genetically modified foods.
[0005] Summary of the Invention
[0006] The present invention addresses the deficiencies of the prior art and aims to provide a LAMP-SD-CRISPR nucleic acid sequence combination for detecting soybean plant MON87705 and a nucleic acid detection method.
[0007] In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is:
[0008] In one aspect, the present invention provides a LAMP-SD-CRISPR nucleic acid sequence combination for detecting soybean plant MON87705, wherein the nucleic acid sequence combination comprises a dual LAMP primer set, a SD long-chain and short-chain combination, and crRNA;
[0009] Wherein, the dual LAMP primer set is selected from one or more of the following AE groups:
[0010] Primer set A, LectinF3, LectinB3, LectinFIP, LectinBIP, F31, B31, FIP1, and BIP1, represented by SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4, respectively;
[0011] Primer set B, LectinF3, LectinB3, LectinFIP, LectinBIP, F32, B32+3, FIP2, and BIP2+3, as shown in SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8, respectively;
[0012] Primer set C, LectinF3, LectinB3, LectinFIP, LectinBIP, F33, B32+3, FIP3, and BIP2+3, as shown in SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 9, SEQ ID NO: 6, SEQ ID NO: 10, and SEQ ID NO: 8, respectively;
[0013] Primer set D, LectinF3, LectinB3, LectinFIP, LectinBIP, F34, B34, FIP4, and BIP4, represented by SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14, respectively;
[0014] Primer set E, LectinF3, LectinB3, LectinFIP, LectinBIP, F35, B35, FIP5, and BIP5, as shown in SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, and SEQ ID NO: 18, respectively;
[0015] Preferably, the dual LAMP primer set is selected from primer sets A, C and D.
[0016] The crRNA is selected from one of the following sequences:
[0017] In another aspect, the present invention provides a method for detecting a nucleic acid in a soybean plant MON87705, comprising the following steps:
[0018] S1, LAMP reaction performed with two sets of primers;
[0019] S2, SD reaction using LAMP reaction products;
[0020] S3, CRISPR / Cas12a system reaction with unincubated SD reaction mixture;
[0021] S4. Detection of SD reaction and CRISPR / Cas12a system reaction products using LFB.
[0022] As a further embodiment of the present invention, the LAMP reaction steps used in this method are:
[0023] (1) Sample pretreatment: DNA is extracted from biological samples to obtain a DNA template.
[0024] (2) Dilute all required reagents to appropriate concentrations.
[0025] (3) Add each reagent according to the system, react at 65℃ for 60 minutes, then maintain at 80℃ for 5 minutes to inactivate the enzyme. Store the product at 4℃ or proceed to the next step.
[0026] As a further embodiment of the present invention, the SD reaction steps used in this method are:
[0027] The long chain (as shown in SEQ ID NO: 26) and the short chain (as shown in SEQ ID NO: 27) were dissolved to 10 μM in 10×Cas12a-ssDNA Buffer II, and mixed at a volume ratio of 2.3:2.2 for the long chain: short chain. 4.5 μL and 0.5 μL ddH2O were taken out and added to 25 μL of LAMP product and mixed. 2 μL was taken out for CRISPR / Cas12a reaction, and the remaining was incubated at 37°C for 20 min and stored at 4°C for later use.
[0028] As a further embodiment of the present invention, the CRISPR / Cas12a system reaction steps used in this method are:
[0029] The unincubated 2 μL SD reaction mixture was added to the premixed CRISPR / Cas12a system reaction system, incubated at 37°C for 20 min, and then stored at 4°C for later use.
[0030] As a further embodiment of the present invention, the method uses the following steps to detect the reaction product using LFB:
[0031] SD product detection: Add 99 μL running buffer (4×SSC + 10 mM Tris-HAc + 0.002% Trition X-100 + 2% BSA + 0.1% Tween 20) and 1 μL SD product to the sample well. Spray 1.5 μL of gold-labeled antibody on the upper edge of the LFB sample pad. Insert the sensor sample pad into the sample well and wait a few minutes to observe the results (red color at CL indicates normal chromatography of the test paper; red color at TL indicates a positive result, i.e., the sample to be tested contains nucleic acid of the soybean standard gene Lectin).
[0032] CRISPR / Cas12a reaction product detection: Add 90 μL running buffer (4×SSC + 10 mM Tris-HAc + 0.002% TritionX-100 + 2% BSA + 0.1% Tween20) and 10 μL CRISPR / Cas12a reaction product to the sample well. Spray 1.5 μL of gold-labeled antibody on the upper edge of the LFB sample pad. Insert the test paper sample pad into the sample well and wait a few minutes to observe the results (red appears at CL, indicating that the test paper chromatography is normal; red appears at TL, indicating a negative result, i.e., the sample to be tested does not contain MON87705 genetically modified soybean transformant components).
[0033] According to the results of the two LFB tests, if red bands appear normally at TL and CL in the first test result, and red bands appear normally only at CL in the second test result, it can be determined that the genetically modified soybean MON87705 transformant component is detected in the sample; if red bands appear normally at TL and CL in the first test result, and red bands also appear normally at TL and CL in the second test result, it can be determined that the genetically modified soybean MON87705 transformant component is not detected in the sample; if red bands appear normally only at CL in the first test result, it can be determined that soybean components are not detected in the sample; if other situations occur, it can be determined that the test is invalid.
[0034] Compared with the prior art, the present invention has the following advantages and beneficial effects:
[0035] 1. The present invention constructs LFB using LAMP reaction, SD reaction, and CRISPR / Cas12a system reaction;
[0036] 2. This method eliminates the limitations of LFB using hapten markers and antibodies. By simply reading LFB results twice in a single test, it can logically detect the specific sequences of the soybean standard gene Lectin and the transgenic soybean MON87705 transformant.
[0037] 3. The present invention reduces the manufacturing cost of LFB and has good detection specificity, with a qualitative detection limit of up to 0.1 wt%. BRIEF DESCRIPTION OF THE DRAWINGS
[0038] The drawings described herein are used to provide a further understanding of the embodiments of the present invention, constitute a part of this application, and do not constitute a limitation of the embodiments of the present invention. In the drawings:
[0039] Figure 1 shows the detection principles of genetically modified soybean MON87705 (A. LAMP principle; B. SD principle; C. CRISPR / Cas12a reaction principle; D. LFB principle).
[0040] Figure 2 shows transmission electron microscopy images of gold nanoparticles (A) and gold nano-nucleic acid signal probes (B) and their 400-600 nm UV-visible absorption spectra (C).
[0041] Figure 3 is the electrophoresis diagram of the LAMP products of MON87705 primers (A. Primer group 1; B. Primer group 2; C. Primer group 3; D. Primer group 4; E. Primer group 5; Lane M: D2000 DNA Marker; Lane 1: negative control; Lane 2: transgenic soybean MON87705 genomic template group).
[0042] Figure 4 is an electrophoresis diagram of LAMP products using Lectin gene primers and MON87705 primers (Lectin gene primers; A. Primer group 1; B. Primer group 3; C. Primer group 4; Lane M: D2000 DNA Marker; Lane 0: negative control; Lane 1: non-transgenic soybean genomic template group; Lane 2: transgenic soybean MON87705 genomic template group).
[0043] Figure 5 shows the SD results of LAMP products (A. LFB band; B. Image J peak area; a: Lectin gene primers and negative control; b: Lectin gene primers and non-transgenic soybean genomic template; c: Lectin gene primers and transgenic soybean MON87705 genomic template; d: Primer 1 and non-transgenic soybean genomic template; e: Primer group 1 and transgenic soybean MON87705 genomic template; f: Primer group 3 and non-transgenic soybean genomic template; g: Primer 3 and transgenic soybean MON87705 genomic template; h: Primer group 4 and non-transgenic soybean genomic template; i: Primer group 4 and transgenic soybean MON87705 genomic template).
[0044] Figure 6 shows the SD results of dual LAMP products (A. LFB band; B. Image J peak area; a: negative control; b: primer group 1 and non-transgenic soybean genomic template; c: primer group 1 and transgenic soybean MON87705 genomic template; d: primer group 4 and non-transgenic soybean genomic template; e: primer group 4 and transgenic soybean MON87705 genomic template).
[0045] Figure 7 shows the optimization of primer addition amount in the dual LAMP system (A. LFB band; B. Image J peak area; a: 2 μL Lectin gene long primer and negative control; b: 2 μL Lectin gene long primer and soybean genome template; c: 2.5 μL Lectin gene long primer and negative control; d: 2.5 μL Lectin gene long primer and soybean genome template).
[0046] FIG8 shows the optimization of the SD long-short chain ratio (A. LFB band; B. Image J peak area; a: negative control; b: soybean genome template).
[0047] Figure 9 shows crRNA selection in the CRISPR / Cas12a reaction (A. LFB bands; B. Image J peak area; a: negative control; b: non-transgenic soybean genome template; c: transgenic soybean MON87705 genome template).
[0048] FIG10 shows the specificity of SD reaction (A. LFB band; B. Image J peak area; a: soybean genome template; b: maize genome template; c: rapeseed genome template).
[0049] Figure 11 shows the specificity of LAMP-LFB logical detection of transgenic soybean MON87705 (A. LFB band; B. Image J peak area; a: soybean genomic template SD result; b: transgenic soybean MON87705 genomic template (10wt%)10; c: transgenic soybean MON87769 genomic template (100wt%); d: transgenic soybean GTS40-3-2 genomic template (100wt%)).
[0050] Figure 12 shows the sensitivity of LAMP-LFB logical detection of transgenic soybean MON87705 (A. LFB band; B. Image J peak area; a: soybean genome template SD result; b: non-transgenic soybean genome; c: transgenic soybean MON87705 genome template (10wt%); d: transgenic soybean MON87705 genome template (1wt%); e: transgenic soybean MON87705 genome template (0.1wt%); f: transgenic soybean MON87705 genome template (0.01wt%)). DETAILED DESCRIPTION
[0051] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention.
[0052] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0053] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.
[0054] The present invention will be described in detail below through embodiments in conjunction with the accompanying drawings, but this does not limit the present invention and is only used as an example.
[0055] Example 1 Principle Design and Verification of Nucleic Acid Detection Method for Detecting Soybean Plant MON87705
[0056] (1) Principle design and verification
[0057] The present invention combines LAMP, SD, CRISPR / Cas12a, and LFB to detect transgenic soybean MON87705. The principle is shown in Figure 1. A nucleic acid template containing the soybean standard gene Lectin undergoes a SD reaction with the double-stranded structure formed after incubation of the long and short strands in the LAMP-generated product. This releases the short-stranded nucleic acid, whose 3' end sequence is bound by a gold nanoparticle-nucleic acid signal probe on the LFB based on base complementarity. As the sensor moves upward, the nucleic acid on the T line complements the 5' end sequence of the short-stranded nucleic acid, forming a "gold nanoparticle-nucleic acid signal probe-short strand-T line nucleic acid" sandwich structure at the T line, causing the T line to develop color. The C line directly binds to the gold nanoparticle-nucleic acid signal probe and develops color. In addition to the SD reaction, the double-stranded LAMP product produced by the specific sequence of the transgenic soybean MON87705 transformant stimulates the CRISPR / Cas12a reaction, activating the trans-single-strand cleavage activity of Cas12a. This fragments the short strands released by the SD reaction, preventing the formation of the "gold nanoparticle-nucleic acid signal probe-short strand-T-line nucleic acid" sandwich structure at the T line, and thus preventing color development. The C line still directly binds to the gold nanoparticle-nucleic acid signal probe to produce color.
[0058] The verification process of the present invention involves agarose gel electrophoresis, and the specific steps are:
[0059] First, prepare 50×TAE buffer (dissolve 242.2g of tris(hydroxymethyl)aminomethane in 500mL of water with heating and stirring, then add 500mM disodium ethylenediaminetetraacetic acid solution (pH 8.0), adjust the pH to 8.0 with glacial acetic acid, and dilute to 1000mL with water). Dilute to 1×TAE buffer before use. For agarose gel electrophoresis, first clean the gel-making tools with distilled water and set up the gel using a suitable gel-making plate and comb. Accurately weigh 2g of agarose powder and dissolve it in 100mL of 1×TAE buffer in a 250mL Erlenmeyer flask to prepare a 2% agarose gel. Place the breathable sealing film on the conical flask in a microwave oven and heat to melt. After cooling until it is not hot, add 5μL of EB solution (10mg / mL) and mix well. Pour it into the gel-casting plate. After it solidifies, remove the comb. Then place the gel-casting plate together with the gel into an electrophoresis tank with an appropriate amount of 1×TAE buffer. Expel the air in the comb holes and take it out. Take 5μL of the test product and add 1μL of 6×Loading Buffer. Mix evenly and load it into the comb holes. Add D2000 DNA Marker to the appropriate comb holes. After loading, put the gel back into the electrophoresis tank and turn on the power. Run electrophoresis at 120V for 25 minutes, then remove the gel and observe the position of the test product and marker on the UV gel imaging system.
[0060] The verification process of the present invention involves the construction of LFB, the specific steps are:
[0061] Preparation of gold nanoparticles: After soaking in an acid jar (overnight), wash the round-bottom flask three times with tap water, distilled water, and ultrapure water. Dry and use as a reaction vessel. Bring 100 mL of 1 mM chloroauric acid solution to a boil, then vertically add 10 mL of 38.8 nM trisodium citrate (replace the pipette tip after each addition to prevent superheated steam from affecting the experimental results; wrap the flask with tin foil, leaving a small opening visible). Immediately time the reaction and seal the flask to prevent evaporation. Observe the color change from yellow to black to red for a total of 10 minutes. Stop heating after 10 minutes. Cool in a water bath to room temperature (protect from light is recommended) (refrigerate), and store at 4°C.
[0062] Preparation of gold nanoparticle-nucleic acid signal probe: First, add 1 μL of 100 mM dATP to 1 mL of gold nanoparticles, and then incubate the mixture at room temperature for 20 minutes. Then, slowly add 15 μL of 1% SDS solution to the mixture and incubate on a shaker for 10 minutes. Then, add 100 μL of NaCl solution (0.2 M) to the mixture at a rate of 20 μL every ten minutes. Place 0.25 OD of DNA fragment (as shown in SEQ ID NO: 28) and the mixture in a 60°C water bath and incubate for 3 hours. After the incubation is completed, the obtained solution is centrifuged at 12000 rpm for 15 min, the supernatant is discarded, and the precipitate is washed with PBS. The obtained ruby-colored precipitate is dispersed and stored in 20 μL of eluent (20 nM Na3PO4·12H2O+5% BSA+0.25% Tween-20+10% sucrose), which is the gold nanoparticle-nucleic acid signal probe, and stored at 4°C.
[0063] LFB assembly: 0.5 OD of T-line nucleic acid (as shown in SEQ ID NO:29) and C-line nucleic acid (as shown in SEQ ID NO:30) were mixed and incubated overnight with an equal volume of 1 mg / mL streptavidin. This mixture served as the T-line and C-line solutions. The T-line solution was loaded into nozzle 1 of the 3D spraying platform and positioned 1.1 cm from the bottom edge of the NC membrane. The C-line solution was loaded into nozzle 2 of the 3D spraying platform and positioned 1.6 cm from the bottom edge of the NC membrane, ensuring a distance of 5.0 mm between the T-line and C-line nozzles. The NC membrane was adhered to a PVC substrate, and the streaking speed was set to 1.0 μL / cm. The streaking solution was evenly sprayed onto the NC membrane. The sprayed NC membrane was dried at 37°C for 3 hours. An absorbent pad was attached to the backing plate, close to the upper edge, and carefully smoothed. A conjugate pad was attached to the backing plate in an appropriate position, and carefully smoothed. A sample pad was attached to the backing plate, close to the lower edge, and carefully smoothed. Use a programmable strip cutter to cut the pasted test paper strips into 3.5mm wide test papers, put the cut test papers into a packaging bag containing desiccant, and store them at room temperature for future use.
[0064] The characterization of gold nanoparticles and gold nano-nucleic acid signal probes is shown in Figure 2.
[0065] (2) Primer selection
[0066] The five LAMP primer sets designed in Table 1 were used to amplify genomic DNA (50 ng / μL) extracted from transgenic soybean MON87705 using the single-plex LAMP system described in Table 2. LAMP products were detected by 2% agarose gel electrophoresis, as shown in Figure 3. Primer sets 1, 3, and 4 specifically amplified genomic DNA extracted from transgenic soybean MON87705 and were selected for subsequent experiments. Using primers for the soybean Lectin gene, the first, third, and fourth transgenic soybean MON87705 primers, respectively, the non-transgenic soybean genome (50 ng / μL) and the transgenic soybean MON87705 genome (50 ng / μL) were subjected to LAMP reactions according to the system described in Table 2. LAMP products were detected by 2% agarose gel electrophoresis (containing 0.1 μg / mL EB) (Figure 4). The third primer set produced unexpected products when amplifying the non-transgenic soybean genome, so subsequent experiments were performed using primer sets 1 and 4. Simultaneously, SD reactions were performed using the LAMP products of each primer set. The results are shown in Figure 5. These results indicate that the LAMP products of these primer sets did not interfere with the SD reaction results, making them suitable for subsequent experiments. The dual LAMP system described in Table 3 was also used to perform SD reactions using primer sets 1 and 4, along with primers for the soybean Lectin gene. The LAMP products were then detected using LFB, as shown in Figure 6.
[0067] Table 1 LAMP primer set sequences
[0068] Table 2 Single-plex LAMP reaction system
[0069] Table 3 Dual LAMP initial reaction system
[0070] Example 2 Detection Condition Optimization Results
[0071] (1) Primer addition amount for dual LAMP system
[0072] The SD reaction results were detected using LFB, except that 2.5 μL of the long primer for the soybean Lectin gene, a standard gene within the soybean, was added. All other conditions remained the same as those for the dual LAMP system in Table 3. The results are shown in Figure 7. Compared to the original conditions, the use of 2.5 μL of the long primer for the soybean Lectin gene, a standard gene within the soybean, resulted in a significant color improvement. Subsequent experiments required the addition of 2.5 μL of the long primer for the Lectin gene.
[0073] (2) Optimization of SD long-short chain ratio
[0074] More long chains can maximize saturation of short chains, but this also affects the efficiency of subsequent transgene-specific transformation detection. Therefore, the long chain (such as that shown in SEQ ID NO:26) and the short chain (such as that shown in SEQ ID NO:27) were mixed in ratios of 2.1:2.0, 2.2:2.1, 2.3:2.2, 2.4:2.3, and 2.5:2.4, and the volume was made up to 5 parts with water according to the ratio. SD reactions were performed and the results were detected by LFB, as shown in Figure 8. The best detection effect was achieved when the long-short chain addition ratio was 2.3:2.2, so the long-short chain ratio of 2.3:2.2 was selected for subsequent SD experiments.
[0075] (3) CRISPR / Cas12a reaction crRNA selection
[0076] The CRISPR / Cas12a reaction was performed with the dual LAMP product of the first set of primers and the soybean standard gene Lectin gene primer, and the reaction product was detected by LFB. The results are shown in Figure 9. Cas12a cleavage efficiency was highest when GMO crRNA2 (as shown in SEQ ID NO: 24) was used, and GMO crRNA2 was selected for subsequent experiments.
[0077] Detection performance of the detection method of Example 3
[0078] (1) Specificity
[0079] Under optimized experimental conditions, the specificity of LAMP and SD reactions for the soybean genome was tested. The SD reaction results after LAMP using the soybean genome (50 ng / μL), maize genome (100 ng / μL), and rapeseed genome (100 ng / μL) were detected by LFB, as shown in Figure 10. The LAMP and SD reactions showed good specificity, with only soybean samples triggering the reaction.
[0080] Under optimized experimental conditions, the specificity of the method for detecting transgenic soybean MON87705 constructed using LAMP, SD, and CRISPR / Cas12a in combination with LFB was tested. The genomes of transgenic soybeans MON87705 (10 wt%), MON87769 (100 wt%), and GTS40-3-2 (100 wt%) were extracted and diluted to a concentration of 50 ng / μL. The method for detecting transgenic soybean MON87705 constructed using LAMP, SD, and CRISPR / Cas12a in combination with LFB was tested. The reaction results were detected by LFB, as shown in Figure 11. The method for detecting transgenic soybean MON87705 constructed using LAMP, SD, and CRISPR / Cas12a in combination with LFB can specifically identify the genome of transgenic soybean MON87705 with good specificity.
[0081] (2) Sensitivity
[0082] To determine the qualitative detection limit (LDL) of the LAMP, SD, and CRISPR / Cas12a-based method for detecting transgenic soybean MON87705, constructed using LFB, GM soybean powder was added to 100g of non-GM soybean powder at concentrations of 10, 1, 0.1, and 0.01g. The resulting soybean samples contained 10, 1, 0.1, and 0.01wt% of GM soybean MON87705, respectively. The genome was extracted and tested at 50ng / μL. The results were analyzed by LFB, as shown in Figure 12. This method confirmed that the qualitative detection limit for GM soybean MON87705 was 0.1wt%, consistent with the detection limit specified in "Ministry of Agriculture Announcement No. 2122-4-2014: Qualitative PCR Method for Detection of Herbicide-Tolerant and Quality-Improved Soybeans MON87705 and Their Derivatives for Components of Transgenic Plants and Their Products: Qualitative PCR Method."
[0083] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.
Claims
1. A nucleic acid sequence combination of LAMP-SD-CRISPR for detecting soybean plant MON87705, characterized in that, it includes a dual LAMP primer set, an SD long-chain and short-chain combination, and a crRNA.
2. The nucleic acid sequence combination according to claim 1, characterized in that, the dual LAMP primer set is selected from one or more of the following groups A-E: Primer set A: LectinF3, LectinB3, LectinFIP, LectinBIP, F31, B31, FIP1, and BIP1, shown as SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4 respectively; Primer set B: LectinF3, LectinB3, LectinFIP, LectinBIP, F32, B32+3, FIP2, and BIP2+3, shown as SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8 respectively; Primer set C: LectinF3, LectinB3, LectinFIP, LectinBIP, F33, B32+3, FIP3, and BIP2+3, shown as SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:9, SEQ ID NO:6, SEQ ID NO:10, and SEQ ID NO:8 respectively; Primer set D: LectinF3, LectinB3, LectinFIP, LectinBIP, F34, B34, FIP4, and BIP4, shown as SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14 respectively; Primer set E: LectinF3, LectinB3, LectinFIP, LectinBIP, F35, B35, FIP5, and BIP5, shown as SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, and SEQ ID NO:18 respectively; Preferably, the dual LAMP primer set is selected from primer sets A, C, and D.
3. The nucleic acid sequence combination according to claim 1, wherein, in the SD long-chain and short-chain combination, the long-chain sequence is CGACTTATTGAGTTGTAACTTTCCCGA, as shown in SEQ ID NO:26; the short-chain sequence is ACAACTCAATAAGTCG, as shown in SEQ ID NO:
27.
4. The nucleic acid sequence combination according to claim 1, wherein, for the crRNA, it is characterized in that the crRNA is selected from one of the following sequences: UAAUUUCUACUAAGUGUAGAUAGGACAACGGUGCCUUGGCC, SEQ ID NO:23; UAAUUUCUACUAAGUGUAGAUCCGGACAUGAAGCCAUUUAC, SEQ ID NO:24; UAAUUUCUACUAAGUGUAGAUCAAUUGAAGAGACUCAGGGU, SEQ ID NO:
25.
5. A nucleic acid detection method for detecting soybean plant MON87705 using the nucleic acid sequence combination according to claim 1, wherein, it includes the following steps: S1, LAMP reaction carried out by two groups of primers; S2, SD reaction carried out with the LAMP reaction product; S3, CRISPR / Cas12a system reaction carried out with the unincubated SD reaction mixture; S4, detection of the products of the SD reaction and the CRISPR / Cas12a system reaction with LFB.
6. The detection method according to claim 5, wherein, it includes the nucleic acid sequence combination according to claim 1.
7. The detection method according to claim 5, wherein, the LAMP reaction system is: The final concentrations of two groups of long primers (FIP, BIP) are 1 μM and 0.8 μM respectively; the final concentration of all short primers (F3, B3) is 0.1 μM; the final concentration of the deoxynucleotide solution mixture is 1.4 mM; the final concentration of betaine is 0.8 M; the final concentration of magnesium sulfate is 5 mM; the final concentration of Bst enzyme is 320 U / mL; using the DNA extracted from the biological sample in a buffer system with a total volume of 25 μL and reacting at 65 °C for 60 min.
8. The detection method according to claim 5, wherein, the SD reaction system is: Add 4.5 μL of a mixture with a long-chain to short-chain volume ratio of 2.3:2.2 at a concentration of 10 μM to 25 μL of the LAMP reaction product, add 0.5 μL of ddH 2 O, mix well, take out 2 μL and incubate at 37 °C for 20 min in a buffer system.
9. The detection method according to claim 5, wherein, the CRISPR / Cas12a system reaction system is: 2 μL of the pre-incubation mixture of the SD reaction; crRNA with a final concentration of 0.5 μM; LbaCas12a Nuclease with a final concentration of 0.5 μM; incubating at 37 °C for 20 min in a buffer system with a total volume of 20 μL.
10. Application of the nucleic acid sequence combination according to claim 1 or the detection method according to claim 5 in the detection of transgenic soybean components in soy products and the development of kits.
Citation Information
Patent Citations
LAMP detection primer group, kit, and detection method of transgenic soybean MON87705
CN105063207A
LAMP primer group for Lectin detection and gene isothermal amplification method
CN105420359A
PCR (polymerase chain reaction) primer composition to detect transgenic soybean line MON87705 and application thereof
CN109971879A
Immunochromatography test strip special for Cas12a as well as preparation method and application of immunochromatography test strip
CN115932243A
Nucleic acid detection method for detecting soybean plant MON87705
CN117305512A