Antibody against tumor necrosis factor-like ligand 1a and use thereof

Abstract

The present application discloses an antibody binding to a tumor necrosis factor-like ligand 1A (TL1A), a nucleic acid molecule encoding the antibody, a vector comprising the nucleic acid molecule, a host cell comprising the nucleic acid molecule or the vector, a method for preparing and purifying the antibody, and a use of the antibody.

Description

Antibodies against tumor necrosis factor-like ligand 1A and uses thereof

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to Chinese Patent Application No. 202311632076.1 filed on November 30, 2023, the entire contents of which are incorporated herein by reference in their entirety. Technical Field

[0003] The present application generally relates to the fields of genetic engineering and antibody drugs; in particular, to antibodies that bind to tumor necrosis factor-like ligand 1A and uses thereof. Background Art

[0004] Tumor necrosis factor-like ligand 1A (TL1A / VEGI-251 / TNFSF15) is a member of the tumor necrosis factor family, with a full length of 251 amino acids, and is a type II transmembrane glycoprotein. As a type II transmembrane protein, TL1A, like other members of the TNF family, forms a stable non-covalent homotrimeric structure composed of a β sandwich. TL1A is expressed in immune cells (such as monocytes, macrophages, dendritic cells, T lymphocytes, plasma cells, etc.) and non-immune cells (such as endothelial cells, synovial fibroblasts, etc.). TL1A initially exists in a membrane-bound form and can be cleaved at amino acid position 72 by variable splicing or tumor necrosis factor α-converting enzyme, releasing it as a soluble protein to perform its function. 1 The functional receptor corresponding to TL1A is death receptor 3 (DR3), and the non-functional receptor is decoy receptor 3 (DcR3) 2 TL1A binds to DR3, induces DR3 receptor oligomerization, recruits the adaptor protein tumor necrosis factor receptor-associated death domain protein (TRADD) through the intracellular death domain, and regulates downstream pathways (such as TRAF2, RIP1, PI3K, MAPK and NF-κB) to exert pro-inflammatory effects; or promotes cell apoptosis through the FADD, RIP3 and Caspase-8 / -3 / -7 pathways; at the same time, the NF-κB pathway can also activate c-IAP protein, thereby negatively regulating cell apoptosis. 1,3 .

[0005] Abnormal expression of TL1A is significantly associated with autoimmune diseases, including rheumatoid arthritis, inflammatory bowel disease, psoriasis, primary biliary cirrhosis, systemic lupus erythematosus, and ankylosing spondylitis. 1The key role of the TL1A and DR3 signaling pathways in autoimmune and inflammatory diseases suggests that inhibiting the TL1A-DR3 interaction may be an effective therapeutic strategy to improve autoimmune diseases and local inflammation of target organs. Currently developed monoclonal antibodies targeting TL1A have clinical indications including inflammatory bowel disease and systemic sclerosis-related interstitial lung disease. Among them, RVT3101 and PRA023 have both been observed to have significant clinical remission rates and endoscopic improvement rates in clinical trials for the treatment of inflammatory bowel disease.

[0006] Inflammatory bowel disease (IBD), including Crohn's disease (CD) and ulcerative colitis (UC), is a recurrent inflammatory disease involving the digestive tract characterized by intestinal inflammation and epithelial damage. The etiology of IBD is not fully understood and may be related to multiple factors such as genetics, environment, intestinal microecology, and intestinal immunity. 4 Current IBD treatment drugs include aminosalicylic acid preparations, oral glucocorticoids, oral small molecule Janus kinase inhibitors, tumor necrosis factor inhibitors, integrin receptor antagonists, interleukin (IL) 12 / 23 antagonists, etc. 5 However, the above treatment options still cannot induce adequate responses in IBD patients, and there is an unmet clinical need for the treatment of IBD.

[0007] Therefore, the development and application of new anti-human TL1A antibodies are needed in the art and have important biological and medical significance.

[0008] SUMMARY OF THE INVENTION

[0009] In a first aspect, the present application provides an antibody that binds to tumor necrosis factor-like ligand 1A (TL1A), comprising a heavy chain variable region comprising the amino acid sequences of HCDR1, HCDR2, and HCDR3, and a light chain variable region comprising the amino acid sequences of LCDR1, LCDR2, and LCDR3, wherein

[0010] The amino acid sequence of the HCDR1 is shown in SEQ ID NO: 1, the amino acid sequence of the HCDR2 is shown in SEQ ID NO: 2, the amino acid sequence of the HCDR3 is shown in SEQ ID NO: 3, the amino acid sequence of the LCDR1 is shown in SEQ ID NO: 4, the amino acid sequence of the LCDR2 is shown in SEQ ID NO: 5, and the amino acid sequence of the LCDR3 is shown in SEQ ID NO: 6; or

[0011] The amino acid sequence of the HCDR1 is shown in SEQ ID NO: 7, the amino acid sequence of the HCDR2 is shown in SEQ ID NO: 8, the amino acid sequence of the HCDR3 is shown in SEQ ID NO: 9, the amino acid sequence of the LCDR1 is shown in SEQ ID NO: 10, the amino acid sequence of the LCDR2 is shown in SEQ ID NO: 11, and the amino acid sequence of the LCDR3 is shown in SEQ ID NO: 12; or

[0012] The amino acid sequence of the HCDR1 is shown in SEQ ID NO: 7, the amino acid sequence of the HCDR2 is shown in SEQ ID NO: 13, the amino acid sequence of the HCDR3 is shown in SEQ ID NO: 9, the amino acid sequence of the LCDR1 is shown in SEQ ID NO: 14, the amino acid sequence of the LCDR2 is shown in SEQ ID NO: 15, and the amino acid sequence of the LCDR3 is shown in SEQ ID NO: 16; or

[0013] The amino acid sequence of the HCDR1 is shown in SEQ ID NO: 17, the amino acid sequence of the HCDR2 is shown in SEQ ID NO: 18, the amino acid sequence of the HCDR3 is shown in SEQ ID NO: 19, the amino acid sequence of the LCDR1 is shown in SEQ ID NO: 20, the amino acid sequence of the LCDR2 is shown in SEQ ID NO: 21, and the amino acid sequence of the LCDR3 is shown in SEQ ID NO: 22;

[0014] The HCDR and LCDR amino acid sequences are based on the Kabat definition.

[0015] In some embodiments of the first aspect, the amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 23, 24, 25, or 26.

[0016] In some embodiments of the first aspect, the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 27, 28, 29 or 30.

[0017] In some embodiments of the first aspect, the amino acid sequence of the antibody heavy chain variable region is shown in SEQ ID NO: 23, and the amino acid sequence of the antibody light chain variable region is shown in SEQ ID NO: 27; or

[0018] The amino acid sequence of the antibody heavy chain variable region is shown in SEQ ID NO: 24, and the amino acid sequence of the antibody light chain variable region is shown in SEQ ID NO: 28; or

[0019] The amino acid sequence of the antibody heavy chain variable region is shown in SEQ ID NO: 25, and the amino acid sequence of the antibody light chain variable region is shown in SEQ ID NO: 29; or

[0020] The amino acid sequence of the antibody heavy chain variable region is shown in SEQ ID NO: 26, and the amino acid sequence of the antibody light chain variable region is shown in SEQ ID NO: 30.

[0021] In some embodiments of the first aspect, the amino acid sequence of the heavy chain variable region of the antibody is at least 90% identical to SEQ ID NO: 23, 24, 25 or 26, and the amino acid sequence of the light chain variable region of the antibody is at least 90% identical to SEQ ID NO: 27, 28, 29 or 30.

[0022] In some embodiments of the first aspect, the antibody is a whole antibody, a Fab fragment, a F(ab')2 fragment, or a single-chain Fv fragment (scFv).

[0023] In some embodiments of the first aspect, the antibody is a monoclonal antibody.

[0024] In some embodiments of the first aspect, the antibody further comprises a heavy chain constant region selected from the IgG1 subtype, IgG2 subtype, or IgG4 subtype.

[0025] In some embodiments of the first aspect, the antibody further comprises a light chain constant region selected from the kappa subtype or the lambda subtype.

[0026] In some embodiments of the first aspect, the antibody binds to primate and / or rodent TL1A; and / or

[0027] The antibody inhibits the binding of TL1A to death receptor 3 (DR3); and / or

[0028] The antibody does not inhibit the binding of TL1A to decoy receptor 3 (DcR3); and / or

[0029] The antibody inhibits caspase activation in cells stimulated by TL1A; and / or

[0030] The antibody inhibits NF-κB activation in cells stimulated by TL1A; and / or

[0031] The antibody inhibits the ability of TL1A to stimulate PBMC to secrete interferon gamma.

[0032] In a second aspect, the present application provides a nucleic acid molecule encoding the antibody described in the first aspect.

[0033] In a third aspect, the present application provides a pharmaceutical composition comprising the antibody described in the first aspect and a pharmaceutically acceptable excipient, diluent or carrier.

[0034] In a fourth aspect, the present application provides use of the antibody described in the first aspect or the pharmaceutical composition described in the third aspect in the preparation of a medicament for preventing or treating TL1A-related diseases.

[0035] In a fifth aspect, the present application provides a method for preventing or treating a TL1A-related disease, comprising administering the antibody of the first aspect or the pharmaceutical composition of the third aspect to an individual in need thereof. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] FIG1 shows the results of the inhibition of caspase activation in TF-1 cells stimulated by TL1A by anti-TL1A mouse monoclonal antibody.

[0037] FIG2 shows the results of the inhibition of NF-κB activation in 293T-hDR3-NF-κB-RE-luci cells stimulated by TL1A by anti-TL1A mouse monoclonal antibody.

[0038] FIG3 shows the results of the inhibition of caspase activation in TF-1 cells stimulated by TL1A by anti-TL1A monoclonal antibody H3F1+L28E1.

[0039] FIG4 shows that the anti-TL1A monoclonal antibody H3F1+L28E1 inhibits NF-κB activation in 293T-hDR3-NF-κB-RE-luci cells stimulated by TL1A.

[0040] FIG5 shows the ability of anti-TL1A monoclonal antibody H3F1+L28E1 to inhibit TL1A-stimulated interferon-γ secretion from PBMCs.

[0041] FIG6 shows the results of ELISA analysis of anti-human TL1A monoclonal antibodies blocking the binding of human TL1A to human DR3.

[0042] FIG7 shows the results of ELISA analysis of the anti-TL1A monoclonal antibody blocking the binding activity of human DcR3 and human TL1A.

[0043] FIG8 shows the fecal scoring results of DNBS-induced acute ulcerative colitis in rats.

[0044] FIG9 shows the results of colon macroscopic injury scores in DNBS-induced acute ulcerative colitis in rats.

[0045] Sequence Description

[0046] SEQ ID NOs: 1-3 respectively show the amino acid sequences of HCDR1, HCDR2, and HCDR3 of the anti-TL1A single-chain antibody S4D3.

[0047] SEQ ID NOs: 4-6 respectively show the amino acid sequences of LCDR1, LCDR2, and LCDR3 of the anti-TL1A single-chain antibody S4D3.

[0048] SEQ ID NO: 7 shows the amino acid sequence of HCDR1 of the anti-TL1A single-chain antibodies S9H9 and S7B11.

[0049] SEQ ID NO: 8 shows the amino acid sequence of HCDR2 of the anti-TL1A single-chain antibody S9H9.

[0050] SEQ ID NO: 9 shows the amino acid sequence of HCDR3 of the anti-TL1A single-chain antibodies S9H9 and S7B11.

[0051] SEQ ID NOs: 10-12 respectively show the amino acid sequences of LCDR1, LCDR2, and LCDR3 of the anti-TL1A single-chain antibody S9H9.

[0052] SEQ ID NO: 13 shows the amino acid sequence of HCDR2 of the anti-TL1A single-chain antibody S7B11.

[0053] SEQ ID NOs: 14-16 respectively show the amino acid sequences of LCDR1, LCDR2, and LCDR3 of the anti-TL1A single-chain antibody S7B11.

[0054] SEQ ID NOs: 17-19 respectively show the amino acid sequences of HCDR1, HCDR2, and HCDR3 of the fully human anti-TL1A monoclonal antibody H3F1+L28E1.

[0055] SEQ ID NOs: 20-22 respectively show the amino acid sequences of LCDR1, LCDR2, and LCDR3 of the fully human anti-TL1A monoclonal antibody H3F1+L28E1.

[0056] SEQ ID NO: 23 shows the amino acid sequence of the heavy chain variable region of the anti-TL1A single-chain antibody S4D3.

[0057] SEQ ID NO: 24 shows the amino acid sequence of the heavy chain variable region of the anti-TL1A single-chain antibody S9H9.

[0058] SEQ ID NO: 25 shows the amino acid sequence of the heavy chain variable region of the anti-TL1A single-chain antibody S7B11.

[0059] SEQ ID NO: 26 shows the amino acid sequence of the heavy chain variable region of the fully human anti-TL1A monoclonal antibody H3F1+L28E1.

[0060] SEQ ID NO: 27 shows the amino acid sequence of the light chain variable region of the anti-TL1A single-chain antibody S4D3.

[0061] SEQ ID NO: 28 shows the amino acid sequence of the light chain variable region of the anti-TL1A single-chain antibody S9H9.

[0062] SEQ ID NO: 29 shows the amino acid sequence of the light chain variable region of the anti-TL1A single-chain antibody S7B11.

[0063] SEQ ID NO: 30 shows the amino acid sequence of the light chain variable region of the fully human anti-TL1A monoclonal antibody H3F1+L28E1.

[0064] SEQ ID NO: 31 shows the amino acid sequence of recombinant human TL1A (hTL1A).

[0065] SEQ ID NO: 32 shows the amino acid sequence of recombinant cynomolgus monkey TL1A (mfTL1A).

[0066] SEQ ID NO: 33 shows the amino acid sequence of recombinant mouse TL1A (mTL1A).

[0067] SEQ ID NO: 34 shows the amino acid sequence of recombinant rat TL1A (rTL1A).

[0068] SEQ ID NO: 35 shows the amino acid sequence of the Foldon domain of T4 bacteriophage fiber protein (Fib Foldon).

[0069] SEQ ID NO: 36 shows the amino acid sequence of the His tag.

[0070] SEQ ID NO: 37 shows the amino acid sequence of the human (homo sapiens) IgG1 subtype heavy chain constant region (CH-IgG1).

[0071] SEQ ID NO: 38 shows the amino acid sequence of human IgG1 subtype heavy chain constant region mutant IgG1m3 (CH-IgG1m3).

[0072] SEQ ID NO: 39 shows the amino acid sequence of the human IgG1 subtype heavy chain constant region mutant IgG1m3-YTE (CH-IgG1m3-YTE).

[0073] SEQ ID NO: 40 shows the amino acid sequence of the human (homo sapiens) kappa subtype light chain constant region.

[0074] SEQ ID NO: 41 shows the amino acid sequence of the human (homo sapiens) lambda subtype light chain constant region.

[0075] SEQ ID NO: 42 shows the amino acid sequence of the recombinant protein His-fib-hTL1A.

[0076] SEQ ID NO: 43 shows the amino acid sequence of the recombinant protein His-fib-mfTL1A.

[0077] SEQ ID NO: 44 shows the amino acid sequence of the recombinant protein His-fib-mTL1A.

[0078] SEQ ID NO: 45 shows the amino acid sequence of the recombinant protein His-fib-rTL1A.

[0079] SEQ ID NO: 46 shows the nucleotide sequence of primer PmCGR.

[0080] SEQ ID NO: 47 shows the nucleotide sequence of primer PmCKR.

[0081] SEQ ID NO: 48 shows the amino acid sequence of the single-chain antibody S4D3.

[0082] SEQ ID NO: 49 shows the amino acid sequence of the single-chain antibody S9H9.

[0083] SEQ ID NO: 50 shows the amino acid sequence of the single-chain antibody S7B11.

[0084] SEQ ID NO: 51 shows the amino acid sequence of the heavy chain variable region of the anti-TL1A monoclonal antibody RVT-3101.

[0085] SEQ ID NO: 52 shows the amino acid sequence of the light chain variable region of the anti-TL1A monoclonal antibody RVT-3101.

[0086] SEQ ID NO: 53 shows the amino acid sequence of the heavy chain variable region of the anti-TL1A monoclonal antibody PRA023.

[0087] SEQ ID NO: 54 shows the amino acid sequence of the light chain variable region of the anti-TL1A monoclonal antibody PRA023.

[0088] SEQ ID NO: 55 shows the amino acid sequence of the heavy chain variable region of the negative control antibody DP47.

[0089] SEQ ID NO: 56 shows the amino acid sequence of the light chain variable region of the negative control antibody DP47.

[0090] Detailed Description of the Invention

[0091] The inventors of this application have developed novel antibodies that bind to tumor necrosis factor-like ligand 1A (TL1A) through antibody engineering techniques. Various aspects of this application include novel anti-tumor necrosis factor-like ligand 1A (TL1A) antibodies, nucleic acid molecules encoding these antibodies, vectors containing these nucleic acid molecules, host cells containing these nucleic acid molecules or vectors, methods for preparing and purifying these antibodies, and medical and biological applications of these antibodies. Based on the amino acid sequences of the variable regions of the antibodies provided herein, full-length antibody molecules can be constructed as pharmaceuticals for the prevention or treatment of TL1A-related diseases.

[0092] The practice of the present application employs, unless otherwise indicated, conventional techniques of molecular biology, microbiology, cell biology, biochemistry, and immunology within the skill of the art.

[0093] Unless otherwise specified, the terms used in this application have the meanings commonly understood by those skilled in the art.

[0094] definition

[0095] As used herein, the term "antibody" refers to an immunoglobulin molecule that can specifically bind to a target via at least one antigen recognition site located in the variable region of the immunoglobulin molecule. Targets include, but are not limited to, carbohydrates, polynucleotides, lipids, polypeptides, and the like. "Antibodies" as used herein include not only complete (i.e., full-length) antibodies, but also antigen-binding fragments thereof (e.g., Fab, Fab', F(ab')2, Fv), variants thereof, fusion proteins comprising antibody portions, humanized antibodies, chimeric antibodies, diabodies, linear antibodies, single-chain antibodies, multispecific antibodies (e.g., bispecific antibodies), and any other modified configurations of immunoglobulin molecules comprising antigen recognition sites of desired specificity, including glycosylation variants of antibodies, amino acid sequence variants of antibodies, and covalently modified antibodies.

[0096] Typically, a complete or full-length antibody comprises two heavy chains and two light chains. Each heavy chain contains a heavy chain variable region (VH) and the first, second, and third constant regions (CH1, CH2, and CH3). Each light chain contains a light chain variable region (VL) and a constant region (CL). A full-length antibody can be any class of antibody, such as IgD, IgE, IgG, IgA, or IgM (or subclasses thereof), but antibodies do not need to belong to any specific class. Immunoglobulins can be assigned to different classes based on the antibody amino acid sequence of the heavy chain constant domain. Generally, there are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these classes can be further divided into subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant domains corresponding to different immunoglobulin classes are called α, δ, ε, γ, and μ, respectively. The subunit structure and three-dimensional structure of different classes of immunoglobulins are well known.

[0097] As used herein, the term "antigen-binding fragment or antigen-binding portion" refers to a portion or region of an intact antibody molecule that is responsible for binding to an antigen. The antigen-binding domain may comprise a heavy chain variable region (VH), a light chain variable region (VL), or both. Each of the VH and VL typically contains three complementary determining regions (CDR1, CDR2, and CDR3).

[0098] It is well known to those skilled in the art that the complementarity determining regions (CDRs, typically CDR1, CDR2, and CDR3) are the regions in the variable region that have the greatest impact on the affinity and specificity of an antibody. There are two common definitions of the amino acid sequence of the CDRs of VH or VL, namely the Chothia definition and the Kabat definition. See, for example, Kabat, "Sequences of Proteins of Immunological Interest", National Institutes of Health, Bethesda, Md. (1991). 7 ; Al-Lazikani et al., J. Mol. Biol. 273:927-948 (1997) 8 ; and Martin et al., Proc. Natl. Acad. Sci. USA 86:9268-9272 (1989) 9 For a given antibody variable region amino acid sequence, the CDR amino acid sequences in the VH and VL amino acid sequences can be determined according to the Chothia definition or the Kabat definition. In the embodiments of the present application, the Kabat definition of CDR amino acid sequences is used.

[0099] For a given antibody variable region amino acid sequence, the CDR amino acid sequence in the variable region amino acid sequence can be analyzed in a variety of ways, for example, it can be determined using the online software Abysis (http: / / www.abysis.org / ).

[0100] Examples of antigen-binding fragments include, but are not limited to: (1) a Fab fragment, which can be a monovalent fragment having a VL-CL chain and a VH-CH1 chain; (2) a F(ab')2 fragment, which can be a bivalent fragment having two Fab' fragments connected by a disulfide bridge at the hinge region (i.e., a dimer of Fab'); (3) an Fv fragment having the VL and VH domains of a single arm of an antibody; (4) a single-chain Fv (scFv), which can be a single polypeptide chain consisting of a VH domain and a VL domain via a peptide linker; and (5) (scFv)2, which can comprise two VH domains connected by a peptide linker and two VL domains, wherein the two VL domains are combined with the two VH domains via a disulfide bridge.

[0101] As used herein, the term "specific binding" refers to a non-random binding reaction between two molecules, such as the binding of an antibody to an antigen epitope.

[0102] The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, ie, the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor individuals.

[0103] In a first aspect, the present application provides an antibody that binds to tumor necrosis factor-like ligand 1A (TL1A), comprising a heavy chain variable region comprising the amino acid sequences of HCDR1, HCDR2, and HCDR3, and a light chain variable region comprising the amino acid sequences of LCDR1, LCDR2, and LCDR3, wherein

[0104] The amino acid sequence of the HCDR1 is shown in SEQ ID NO: 1, the amino acid sequence of the HCDR2 is shown in SEQ ID NO: 2, the amino acid sequence of the HCDR3 is shown in SEQ ID NO: 3, the amino acid sequence of the LCDR1 is shown in SEQ ID NO: 4, the amino acid sequence of the LCDR2 is shown in SEQ ID NO: 5, and the amino acid sequence of the LCDR3 is shown in SEQ ID NO: 6; or

[0105] The amino acid sequence of the HCDR1 is shown in SEQ ID NO: 7, the amino acid sequence of the HCDR2 is shown in SEQ ID NO: 8, the amino acid sequence of the HCDR3 is shown in SEQ ID NO: 9, the amino acid sequence of the LCDR1 is shown in SEQ ID NO: 10, the amino acid sequence of the LCDR2 is shown in SEQ ID NO: 11, and the amino acid sequence of the LCDR3 is shown in SEQ ID NO: 12; or

[0106] The amino acid sequence of the HCDR1 is shown in SEQ ID NO: 7, the amino acid sequence of the HCDR2 is shown in SEQ ID NO: 13, the amino acid sequence of the HCDR3 is shown in SEQ ID NO: 9, the amino acid sequence of the LCDR1 is shown in SEQ ID NO: 14, the amino acid sequence of the LCDR2 is shown in SEQ ID NO: 15, and the amino acid sequence of the LCDR3 is shown in SEQ ID NO: 16; or

[0107] The amino acid sequence of the HCDR1 is shown in SEQ ID NO: 17, the amino acid sequence of the HCDR2 is shown in SEQ ID NO: 18, the amino acid sequence of the HCDR3 is shown in SEQ ID NO: 19, the amino acid sequence of the LCDR1 is shown in SEQ ID NO: 20, the amino acid sequence of the LCDR2 is shown in SEQ ID NO: 21, and the amino acid sequence of the LCDR3 is shown in SEQ ID NO: 22;

[0108] The HCDR and LCDR amino acid sequences are based on the Kabat definition.

[0109] In some embodiments of the first aspect, the amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 23, 24, 25, or 26.

[0110] In some embodiments of the first aspect, the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 27, 28, 29 or 30.

[0111] In some embodiments of the first aspect, the amino acid sequence of the antibody heavy chain variable region is shown in SEQ ID NO: 23, and the amino acid sequence of the antibody light chain variable region is shown in SEQ ID NO: 27.

[0112] In some embodiments of the first aspect, the amino acid sequence of the antibody heavy chain variable region is shown in SEQ ID NO: 24, and the amino acid sequence of the antibody light chain variable region is shown in SEQ ID NO: 28.

[0113] In some embodiments of the first aspect, the amino acid sequence of the antibody heavy chain variable region is shown in SEQ ID NO: 25, and the amino acid sequence of the antibody light chain variable region is shown in SEQ ID NO: 29.

[0114] In some embodiments of the first aspect, the amino acid sequence of the antibody heavy chain variable region is shown in SEQ ID NO: 26, and the amino acid sequence of the antibody light chain variable region is shown in SEQ ID NO: 30.

[0115] In some embodiments of the first aspect, the amino acid sequence of the heavy chain variable region of the antibody is at least 90% identical to SEQ ID NO: 23, 24, 25 or 26, and the amino acid sequence of the light chain variable region of the antibody is at least 90% identical to SEQ ID NO: 27, 28, 29 or 30.

[0116] In some embodiments of the first aspect, the amino acid sequence of the heavy chain variable region of the antibody is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 23, 24, 25 or 26.

[0117] In some embodiments of the first aspect, the amino acid sequence of the light chain variable region of the antibody is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 27, 28, 29 or 30.

[0118] In some embodiments of the first aspect, the amino acid sequence of the heavy chain variable region of the antibody differs from the amino acid sequence shown in SEQ ID NO: 23, 24, 25 or 26 by about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions, deletions and / or additions.

[0119] In some embodiments of the first aspect, the amino acid sequence of the light chain variable region of the antibody differs from the amino acid sequence shown in SEQ ID NO: 27, 28, 29 or 30 by about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid substitutions, deletions and / or additions.

[0120] In some embodiments of the first aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO: 23, 24, 25 or 26 can also be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids while still maintaining the function of the heavy chain variable region of similar antibodies.

[0121] In some embodiments of the first aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids can be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO: 23, 24, 25 or 26, and the resulting amino acid sequence still retains the function of the heavy chain variable region of the similar antibody.

[0122] In some embodiments of the first aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added or deleted in the region other than the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO: 23, 24, 25 or 26, as long as the altered amino acid sequence substantially maintains the function of the heavy chain variable region of the similar antibody.

[0123] In some embodiments of the first aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO: 27, 28, 29 or 30 can also be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids while still maintaining the function of the light chain variable region of similar antibodies.

[0124] In some embodiments of the first aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids can be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO: 27, 28, 29 or 30, and the resulting amino acid sequence still retains the function of the light chain variable region of the similar antibody.

[0125] In some embodiments of the first aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added or deleted in the region other than the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO: 27, 28, 29 or 30, as long as the altered amino acid sequence substantially maintains the function of the light chain variable region of the similar antibody.

[0126] In some embodiments of the first aspect, the antibody is a whole antibody, a Fab fragment, a F(ab')2 fragment, or a single-chain Fv fragment (scFv).

[0127] In some embodiments of the first aspect, the antibody is a fully human antibody.

[0128] In some embodiments of the first aspect, the antibody is a monoclonal antibody.

[0129] In some embodiments of the first aspect, the antibody further comprises a heavy chain constant region selected from the IgG1 subtype, IgG2 subtype, or IgG4 subtype.

[0130] In some embodiments of the first aspect, the heavy chain constant region is of the IgG1 subtype.

[0131] In some embodiments of the first aspect, the heavy chain constant region comprises the Fc segment sequence of the IgG1 subtype heavy chain constant region, and the amino acid sequences at positions 234, 235, and 331 of the Fc segment sequence are F, E, and S, respectively; wherein the amino acid sequence of the antibody constant region is determined according to EU numbering.

[0132] In some embodiments of the first aspect, the heavy chain constant region comprises the Fc segment sequence of the IgG1 subtype heavy chain constant region, and the amino acid sequences at positions 252, 254, and 256 of the Fc segment sequence are Y, T, and E, respectively; wherein the amino acid sequence of the antibody constant region is determined according to EU numbering.

[0133] In some embodiments of the first aspect, the heavy chain constant region comprises the Fc segment sequence of the IgG1 subtype heavy chain constant region, and the amino acid sequences at positions 234, 235, and 331 of the Fc segment sequence are F, E, and S, respectively, and the amino acid sequences at positions 252, 254, and 256 of the Fc segment sequence are Y, T, and E, respectively; wherein the amino acid sequence of the antibody constant region is determined according to EU numbering.

[0134] In some embodiments of the first aspect, the antibody further comprises a light chain constant region selected from the kappa subtype or the lambda subtype.

[0135] In some embodiments of the first aspect, the antibody binds to TL1A of a primate. In some embodiments, the primate is a human, or a monkey (eg, a cynomolgus monkey).

[0136] In some embodiments of the first aspect, the antibody binds to TL1A of a rodent. In some embodiments, the rodent is a murine, such as a rat or a mouse.

[0137] In some embodiments of the first aspect, the antibody binds recombinant human TL1A (SEQ ID NO: 31).

[0138] In some embodiments of the first aspect, the antibody binds recombinant monkey (eg, cynomolgus monkey) TL1A (SEQ ID NO: 32).

[0139] In some embodiments of the first aspect, the antibody binds recombinant mouse TL1A (SEQ ID NO: 33).

[0140] In some embodiments of the first aspect, the antibody binds recombinant rat TL1A (SEQ ID NO: 34).

[0141] In some embodiments of the first aspect, the antibody inhibits binding of TL1A to death receptor 3 (DR3).

[0142] In some embodiments of the first aspect, the antibody does not inhibit binding of TL1A to decoy receptor 3 (DcR3).

[0143] In some embodiments of the first aspect, the antibody inhibits caspase activation in TL1A-stimulated cells (such as tumor cells, eg, TF-1 cells).

[0144] In some embodiments of the first aspect, the antibody inhibits NF-κB activation in TL1A-stimulated cells (eg, 293T-hDR3-NF-κB-RE-luci cells).

[0145] In some embodiments of the first aspect, the antibody inhibits the ability of TL1A to stimulate PBMCs to secrete interferon gamma.

[0146] In a second aspect, the present application provides a nucleic acid molecule encoding the antibody described in the first aspect.

[0147] In some embodiments, the nucleic acid molecule is operably linked to a regulatory sequence that is recognized by a host cell transformed with the vector.

[0148] In a third aspect, the present application provides a pharmaceutical composition comprising the antibody described in the first aspect and a pharmaceutically acceptable excipient, diluent or carrier.

[0149] In some embodiments of the third aspect, the pharmaceutical composition is used to prevent or treat a TL1A-related disease.

[0150] In some embodiments of the third aspect, the TL1A-associated disease is rheumatoid arthritis, inflammatory bowel disease (e.g., Crohn's disease (CD) and ulcerative colitis (UC)), psoriasis, primary biliary cirrhosis, systemic lupus erythematosus, ankylosing spondylitis, and systemic sclerosis-associated interstitial lung disease.

[0151] In some embodiments of the third aspect, the pharmaceutical composition may further comprise one or more of the following: lubricants, such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifiers; suspending agents; preservatives, such as benzoic acid, sorbic acid, and calcium propionate; sweeteners and / or flavorings, and the like.

[0152] In some embodiments of the third aspect, the pharmaceutical composition of the present application can be formulated into the form of tablets, pills, powders, lozenges, elixirs, suspensions, emulsions, solutions, syrups, suppositories or capsules.

[0153] In some embodiments of the third aspect, the pharmaceutical composition of the present application can be delivered by any physiologically acceptable mode of administration, including but not limited to oral administration, parenteral administration, nasal administration, rectal administration, intraperitoneal administration, intravascular injection, subcutaneous administration, transdermal administration, inhalation administration, etc.

[0154] In some embodiments of the third aspect, pharmaceutical compositions for therapeutic use can be formulated for storage in the form of lyophilized preparations or aqueous solutions by mixing reagents having the desired purity with, optionally, pharmaceutically acceptable carriers, excipients, and the like.

[0155] In a fourth aspect, the present application provides use of the antibody described in the first aspect and the pharmaceutical composition described in the third aspect in the preparation of a medicament for preventing or treating TL1A-related diseases.

[0156] In some embodiments of the fourth aspect, the TL1A-associated disease is rheumatoid arthritis, inflammatory bowel disease (e.g., Crohn's disease (CD) and ulcerative colitis (UC)), psoriasis, primary biliary cirrhosis, systemic lupus erythematosus, ankylosing spondylitis, and systemic sclerosis-associated interstitial lung disease.

[0157] In a fifth aspect, the present application provides a method for preventing or treating a TL1A-related disease, comprising administering the antibody of the first aspect or the pharmaceutical composition of the third aspect to an individual in need thereof.

[0158] In some embodiments of the fifth aspect, the TL1A-associated disease is rheumatoid arthritis, inflammatory bowel disease (e.g., Crohn's disease (CD) and ulcerative colitis (UC)), psoriasis, primary biliary cirrhosis, systemic lupus erythematosus, ankylosing spondylitis, and systemic sclerosis-associated interstitial lung disease.

[0159] In other aspects, the application also provides vectors comprising nucleic acid molecules encoding antibodies of the present invention or their light or heavy chains, host cells comprising the nucleic acid molecules or the vectors, and methods for producing the antibodies. In some embodiments, the nucleic acid molecules are operably linked to regulatory nucleotide sequences that can be recognized by host cells transformed with the vectors. In some embodiments, the method for producing the antibodies comprises culturing the host cells to express the nucleic acid. In some embodiments, the method for producing the antibodies further comprises recovering the antibodies from the host cell culture medium.

[0160] It should be understood that the above detailed description is only for the purpose of enabling those skilled in the art to more clearly understand the content of the present application and is not intended to limit the present invention in any respect. Those skilled in the art can make various modifications and variations to the embodiments described. Example

[0161] The following examples are for illustration purposes only and are not intended to limit the scope of this application.

[0162] Example 1: Preparation of recombinant protein

[0163] The preparation and characterization of anti-TL1A antibodies utilizes a variety of recombinant proteins, including human TL1A (hTL1A, SEQ ID NO: 31), cynomolgus macaque TL1A (mfTL1A, SEQ ID NO: 32), mouse TL1A (mTL1A, SEQ ID NO: 33), and rat TL1A (rTL1A, SEQ ID NO: 34). The addition of the Foldon domain of the T4 phage fiber protein (Fib Foldon, SEQ ID NO: 35) to the N-terminus of these recombinant proteins helps maintain the native trimeric conformation of TL1A and enhances its stability. Furthermore, the addition of a His tag (His, SEQ ID NO: 36) to the N-terminus of these recombinant proteins facilitates purification and functional characterization. When preparing recombinant antibodies, the antibody heavy chain constant region can be human IgG1 subtype (CH-IgG1, SEQ ID NO: 37) or various mutants of a limited human IgG1 subtype, such as IgG1m3 (CH-IgG1m3, SEQ ID NO: 38) and IgG1m3-YTE (CH-IgG1m3-YTE, SEQ ID NO: 39); the light chain constant region can be human κ subtype (CK, SEQ ID NO: 40) or human λ subtype (CL, SEQ ID NO: 41).

[0164] Based on the amino acid sequences of the recombinant proteins in the Uniprot database, genes for the various recombinant proteins described above (including the His tag and Fib Foldon domain) were designed and synthesized. The synthesized recombinant protein genes were cloned into suitable eukaryotic expression vectors (e.g., pcDNA3.1 from Invitrogen) using conventional molecular biology techniques. The prepared recombinant protein expression plasmids were then transfected into HEK293 cells (e.g., HEK293F from Invitrogen) using liposomes (e.g., 293fectin from Invitrogen) or other cationic transfection reagents (e.g., PEI). The cells were cultured in serum-free suspension culture for 3-4 days, and the culture supernatant was harvested by centrifugation or other methods.

[0165] The His-tag fusion recombinant proteins His-fib-hTL1A (SEQ ID NO: 42), His-fib-mfTL1A (SEQ ID NO: 43), His-fib-mTL1A (SEQ ID NO: 44), and His-fib-rTL1A (SEQ ID NO: 45) were purified from the culture supernatant using a metal chelate affinity chromatography column (e.g., GE's HisTrap FF). Recombinant antibodies were purified using a Protein A / G affinity chromatography column (e.g., GE's Mabselect SURE). The recombinant protein storage buffer was then exchanged with PBS (pH 7.0) or another suitable buffer using a desalting column (e.g., GE's Hitrap desaulting). After filtration sterilization, the aliquots were stored at -20°C until use.

[0166] Example 2: Preparation and screening of immune libraries

[0167] 2.1 Mouse immunization and antibody library preparation

[0168] BALB / c mice aged 6-8 weeks were used. Before immunization, blood was collected from the tail vein to collect background serum. For the first immunization, His-fib-hTL1A fusion protein was emulsified in Freund's complete adjuvant, and each mouse was injected with 50 μg of fusion protein. Boost immunizations were performed two weeks apart. For the first and third booster immunizations, His-fib-hTL1A fusion protein was emulsified in Freund's incomplete adjuvant, and each mouse was injected with 50 μg of fusion protein. Blood was collected by tail cutting before injection. For the second and fourth booster immunizations, His-fib-mfTL1A was emulsified in Freund's incomplete adjuvant, and each mouse was injected with 100 μg of fusion protein. For the sixth immunization, unadjuvanted His-fib-hTL1A recombinant antigen was used as the immunogen, and each mouse was injected with 50 μg of fusion protein. Three days after the boost immunization, the mice were sacrificed and spleen cells were collected.

[0169] Mouse spleen lymphocytes were isolated using mouse lymphocyte separation medium (Beijing Dakoway Biotechnology Co., Ltd., CAT#DKW33-R0100), and total lymphocyte RNA was extracted using a cell total RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., CAT#DP430). Using the extracted total RNA as a template, the cDNA of the heavy chain variable region and the light chain variable region were synthesized using a first-strand cDNA synthesis kit (Thermo scientific, CAT#K1621). The reverse transcription primers used gene-specific primers, and the primer pairing regions were located in the antibody heavy chain constant region and the antibody light chain constant region, respectively. The specific sequences were PmCGR:TGCATTTGAACTCCTTGCC (SEQ ID NO: 46) and PmCKR: CCATCAATCTTCCACTTGAC (SEQ ID NO: 47). The synthesized cDNA was immediately stored at -70°C for future use. The cDNA obtained by reverse transcription was then used as a template and the cDNA was synthesized according to references. 6 Primers were synthesized and PCR was used to amplify the mouse antibody VH and VK genes respectively. Then, overlap extension PCR was used to construct the single-chain antibody (scFv) gene. Finally, the prepared mouse single-chain antibody gene was cloned into the vector pADSCFV-S (see Chinese Patent Application No. 201510097117.0). 7 ) to construct a scFv library. The library capacity of this antibody library reached 6.0E+8, with an accuracy rate of 70%.

[0170] 2.2 Screening of mouse single-chain antibody library

[0171] Using His-fib-hTL1A and His-fib-mfTL1A prepared in Example 1 as antigens, a solid phase screening strategy was used (the experimental protocol is based on Phage Display: A General Experimental Guide, edited by Clarkson, T. and Lowman, H.B.; translated by Ma Lan et al., Chemical Industry Press, May 2008). 8 The phage library displaying mouse single-chain antibodies constructed above was screened. Three rounds of screening were performed by binding, elution, neutralization, infection, and amplification. Ultimately, three single-chain antibodies with different sequences were obtained: S4D3 (SEQ ID NO: 48), S9H9 (SEQ ID NO: 49), and S7B11 (SEQ ID NO: 50).

[0172] Using conventional molecular biological methods, single-chain antibodies S4D3, S9H9 and S7B11 were prepared into IgG1m3 subtype full antibodies. 9, synthesized the heavy chain variable region (SEQ ID NO: 51) and light chain variable region (SEQ ID NO: 52) of RVT-3101; refer to U.S. Patent No. US20210122828A1 10 , synthesized the heavy chain variable region (SEQ ID NO: 53) and light chain variable region (SEQ ID NO: 54) of PRA023. RVT-3101 and PRA023 were prepared into IgG1m3 subtype full antibodies as positive controls. DP47 (germline gene antibody, refer to US Patent No. US20160200833A1) was used as a control. 11 , DP47VH, SEQ ID NO: 55; DP47VK, SEQ ID NO: 56) were prepared into IgG1m3 subtype full antibody for use as a negative control.

[0173] Example 3: Identification of anti-TL1A mouse monoclonal antibodies

[0174] 3.1 Affinity analysis of anti-TL1A mouse monoclonal antibodies S4D3, S9H9, and S7B11

[0175] The affinity of the mouse anti-human TL1A monoclonal antibody was determined by surface plasmon resonance using a Biacore T200. Reagents and consumables, including the amino coupling kit (BR-1000-50), human antibody capture kit (BR-1008-39), S-series CM5 chip (14100530), and 10× HBS-EP, pH 7.4 (BR100669), were purchased from GE healthcare. Following the kit instructions, the carboxylated CM5 chip surface was activated with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS). Anti-human IgG (Fc) antibody (capture antibody) was diluted to 25 μg / mL in 10 mM sodium acetate, pH 5.0, and injected at a flow rate of 10 μL / min to achieve a coupling capacity of approximately 10,000 response units (RU). Following injection of the capture antibody, 1 M ethanolamine was injected to block unreacted groups. For kinetic measurements, anti-TL1A monoclonal antibody was diluted to 1 μg / mL and injected at 10 μL / min to ensure approximately 200 RU of antibody was captured by the anti-human Fc antibody. A series of concentration gradients (e.g., 1.23 nM, 3.7 nM, 11.1 nM, 33.3 nM, and 100 nM) of His-fib-hTL1A, His-fib-mTL1A, and His-fib-mfTL1A were set up, respectively. The concentrations were injected from low to high concentrations at a flow rate of 30 μL / min, with an association time of 90 s and a dissociation time of 1200 s. The chip surface was regenerated by injecting 3 M MgCl2 for 30 s at a flow rate of 10 μL / min. The association rate (K) was calculated by fitting the association and dissociation sensorgrams with a 1:1 binding model using Biacore T200 Evaluation Software version 3.2.1. a ) and dissociation rate (K d ). With ratio K d / K a Calculate the dissociation equilibrium constant (K D ). The fitting results are shown in Table 1, Table 2 and Table 3.

[0176] Table 1. Affinity constants of TL1A monoclonal antibodies binding to human TL1A (His-fib-hTL1A)

[0177] Table 2. Affinity constants of TL1A monoclonal antibodies binding to mouse TL1A (His-fib-mTL1A)

[0178] NB: No binding detected

[0179] Table 3. Affinity constants of TL1A monoclonal antibodies binding to monkey TL1A (His-fib-mfTL1A)

[0180] 3.2 Anti-TL1A mouse monoclonal antibody inhibits TL1A-stimulated caspase activation in TF-1 cells

[0181] TF-1 cells (ATCC, CRL-2003, human erythroid leukemia cells) were purchased from ATCC. Cell growth is completely dependent on IL-3 or GM-CSF and is unresponsive to IL-5. These cells express the TL1A receptor DR3, which stimulates caspase 3 / 7 activation. Cycloheximide (CHX) is a eukaryotic protein synthesis inhibitor that inhibits cellular protein synthesis. RPMI 1640 + 5% inactivated FBS was used as the assay medium. TF-1 cells were resuspended to 2 × 10 5 50 μL / well of the diluted antibody was plated in a 96-well plate. Antibodies were diluted in assay medium containing 800 ng / mL His-fib-hTL1A, starting at 40 nM and serially diluted 1.7-fold for a total of 10 concentration points. 50 μL / well of the diluted antibody was added to TF-1 cells in a total volume of 100 μL / well and incubated at 37°C, 5% CO2 for 5 hours. Caspase 3 / 7 activity was detected using the Caspase-glo 3 / 7 kit (Promega, G8093) and the cells were analyzed using a multifunctional microplate reader (Molecular Devices, Full-wavelength scanning was performed using a 13X microscope (Figure 1) and fitting analysis was performed based on the chemiluminescence readings. The results (Figure 1 and Table 4) showed that the anti-TL1A mouse monoclonal antibodies S4D3, S9H9, and S7B11 effectively inhibited caspase activation induced by His-fib-hTL1A, with activity comparable to that of RVT-3101.

[0182] Table 4. Results of the inhibition of caspase activation in TF-1 cells stimulated by TL1A by anti-TL1A mouse monoclonal antibodies

[0183] 3.3 Anti-TL1A mouse monoclonal antibody inhibits NF-κB activation in 293T-hDR3-NF-κB-RE-luci cells stimulated by TL1A

[0184] 293T-NF-κB-RE-luci (Cat. No. CS025) was purchased from Yingmao Shengye Biotechnology Co., Ltd. and is a NF-κB reporter gene cell line. Based on this cell line, hDR3 was expressed by liposome transfection, and the 293T-hDR3-NF-κB-RE-luci cell line stably expressing hDR3 was screened and used to evaluate the activity of anti-TL1A antibodies. DMEM + 2% FBS was used as the test medium. The test antibody was diluted in the test medium containing 240ng / mL His-fib-hTL1A. The starting concentration was 20nM, and a 1.7-fold serial dilution was performed for a total of 10 concentration points. The 293T-hDR3-NF-κB-RE-luci cells were diluted to 4×10 6 Cells were mixed with 50 μL of antibody and inoculated into 96-well plates. The cells were cultured at 37°C in 5% CO2 for 20 hours. The activities of firefly luciferase and Renilla luciferase were detected using a Dual-glo luciferase assay kit (Promega, E2920). A multifunctional microplate reader (Molecular Devices, Full-wavelength scanning was performed using a 13X microscope, and the ratio of the firefly luciferase to sea cucumber luciferase luminescence signals was used for fitting analysis. The results (Figure 2 and Table 5) show that the anti-TL1A mouse monoclonal antibodies S4D3, S9H9, and S7B11 effectively inhibited NF-κB signaling induced by His-fib-hTL1A, with activity comparable to that of RVT-3101.

[0185] Table 5. Results of inhibition of NF-κB activation in 293T-hDR3-NF-κB-RE-luci cells stimulated by anti-TL1A mouse monoclonal antibodies

[0186] Example 4: Screening of a fully human Fab recombinant library

[0187] Using the recombinant His-fib-hTL1A and His-fib-mfTL1A prepared in Example 1 as antigens, a solid-phase screening strategy was used (refer to Phage Display: A General Protocol, Clarkson, T., Lowman, H.B., eds.; translated by Ma Lan et al., Chemical Industry Press, May 2008) to screen a fully human Fab phage library (see Chinese Patent Application No. 202210871809.6). Three rounds of screening were performed using binding, elution, neutralization, infection, and amplification. Ultimately, a monoclonal antibody, H3F1+L28E1, was obtained that specifically binds to human, cynomolgus macaque, mouse, and rat TL1A (the amino acid sequence of H3F1VH is shown in SEQ ID NO: 26; the amino acid sequence of L28E1VK is shown in SEQ ID NO: 30).

[0188] Using conventional molecular biological methods, H3F1+L28E1 was prepared into IgG1m3 subtype full antibody.

[0189] Example 5: Identification of fully human anti-TL1A monoclonal antibodies

[0190] 5.1 Affinity Analysis of Anti-TL1A Monoclonal Antibody H3F1+L28E1

[0191] Referring to Example 3.1, the affinity of TL1A monoclonal antibody H3F1+L28E1 binding to TL1A of different species was analyzed using Biacore T200. The results are shown in Tables 6, 7, 8 and 9.

[0192] Table 6. Affinity constants of anti-TL1A monoclonal antibody H3F1+L28E1 binding to human TL1A (His-fib-hTL1A)

[0193] Table 7. Affinity constants of anti-TL1A monoclonal antibody H3F1+L28E1 binding to mouse TL1A (His-fib-mTL1A)

[0194] NB: No binding detected

[0195] Table 8. Affinity constants of anti-TL1A monoclonal antibody H3F1+L28E1 binding to rat TL1A (His-fib-rTL1A)

[0196] NB: No binding detected

[0197] Table 9. Affinity constants of anti-TL1A monoclonal antibody H3F1+L28E1 binding to monkey TL1A (His-fib-mfTL1A)

[0198] 5.2 H3F1+L2831 inhibits caspase activation in TF-1 cells stimulated by TL1A

[0199] Referring to Example 3.2, the ability of H3F1+L2831 to inhibit caspase activation in TF-1 cells stimulated by TL1A was evaluated. Antibodies were diluted in assay medium containing 800 ng / mL His-fib-hTL1A. All antibodies were diluted starting at 40 nM and serially diluted 1.7-fold over a total of 10 concentration points. The results (Figure 3 and Table 10) showed that H3F1+L28E1 effectively inhibited His-fib-TL1A-induced caspase signaling, demonstrating superior activity to the control antibodies RVT-3101 and PRA023.

[0200] Table 10. Results of H3F1+L2831 inhibiting caspase activation in TF-1 cells stimulated by TL1A

[0201] 5.3 H3F1+L28E1 inhibits NF-κB activation in 293T-hDR3-NF-κB-RE-luci cells stimulated by TL1A

[0202] Referring to Example 3.3, the ability of H3F1+L28E1 to inhibit NF-κB activation in 293T-hDR3-NF-κB-RE-luci cells stimulated by TL1A was evaluated. The test antibodies were diluted in assay medium containing 240 ng / mL His-fib-hTL1A, starting at 20 nM and serially diluted 1.7-fold over a total of 10 concentration points. The results (Figure 4 and Table 11) show that H3F1+L28E1 effectively inhibits His-fib-hTL1A-stimulated NF-κB signaling, demonstrating superior activity to RVT-3101 and PRA023.

[0203] Table 11. H3F1+L28E1 inhibits NF-κB activation in 293T-hDR3-NF-κB-RE-luci cells stimulated by TL1A

[0204] 5.4 H3F1+L28E1 inhibits the ability of TL1A to stimulate PBMC to secrete interferon-γ

[0205] NK cells and activated T cells express the TL1A receptor DR3 on their surfaces. With the help of co-stimulatory factors such as IL-12 / IL-18, TL1A binds to NK cells or activated T cells, activating downstream signaling pathways and ultimately leading to the secretion of interferon-γ. The inhibitory effect of anti-TL1A antibodies on TL1A can be evaluated by measuring interferon-γ levels in the cell supernatant.

[0206] Blood (50 mL) was collected from normal volunteers, including volunteers provided by the inventors and their colleagues, and all volunteers signed informed consent forms. The inclusion criteria for volunteers were:

[0207] 1. Aged 18 and above;

[0208] 2. No HIV or HBV infection;

[0209] 3. Routine blood test results are normal;

[0210] 4. Non-pregnant or breastfeeding women.

[0211] Human peripheral blood mononuclear cells (PBMCs) were isolated from healthy human peripheral blood using Ficoll density gradient centrifugation. RPMI 1640 + 5% inactivated FBS was used as the assay medium, and PBMCs were resuspended to 6 × 10 cells / mL in the assay medium containing 0.5 ng / mL IL-12 and 2 ng / mL IL-18. 5 100 μL / well of the diluted antibody was plated in a 96-well plate and incubated at 37°C, 5% CO2 for 3 hours. After 3 hours, the antibody was diluted in assay medium containing 2.4 μg / mL His-fib-hTL1A. The antibody was tested starting at 200 nM and serially diluted 2.3-fold over a total of 8 concentration points. The diluted antibody was added to PBMCs at 100 μL / well in a total volume of 200 μL / well and incubated at 37°C, 5% CO2 for 20 hours. Interferon-γ content in the cell supernatant was determined using a human IFN-γ pre-coated ELISA kit (Dayou, 1110002). The values ​​were read at OD450 nm using a microplate reader (800TS, Biotek). A standard curve of concentration and absorbance was constructed using the interferon-γ standard provided in the assay kit. The interferon-γ content in the supernatant was calculated by conversion and fitted analysis was performed. The results ( FIG5 and Table 12 ) showed that H3F1+L28E1 could effectively inhibit the secretion of interferon-γ by PBMCs stimulated by His-fib-hTL1A, and its activity was superior to that of RVT-3101 and PRA023.

[0212] Table 12. H3F1+L28E1 inhibits the ability of TL1A to stimulate PBMC to secrete interferon-γ

[0213] Example 6: Anti-TL1A monoclonal antibodies selectively neutralize functional receptor DR3

[0214] Biotin labeling kit (EZ-Link TM Sulfo-NHS-Biotin, No-Weigh TMHuman DR3 (Recombinant Human DR3 / TNFRSF25 Fc Chimera Protein, CF, R&DSYSTEMS, 943-D3-050) was biotinylated using a 4 μg / mL His-fib-hTL1A ELISA format (Thermo Fisher, A39256). His-fib-hTL1A was coated onto a 96-well ELISA plate at 4 μg / mL, 100 μL / well, and coated overnight at 4°C. Blocked with blocking buffer (3% skim milk-PBST) at 37°C for 1 hour. Anti-human TL1A monoclonal antibodies (RVT-3101 and H3F1+L28E1) were serially diluted with 10 μg / mL biotinylated human DR3, starting at 200 μg / mL. The plates were diluted 3-fold over a total of 8 concentration gradients, and 100 μL / well was added to the blocked 96-well ELISA plate and incubated at 37°C for 1 hour. The ELISA plate was washed with PBST, and then horseradish peroxidase-conjugated streptavidin (Streptavidin / HRP, Biosun, bs-0437P-HRP) was added and incubated at 37°C for 1 hour. The plate was washed with PBST, and OPD substrate development solution was added. After 5-10 minutes, development was stopped with 1M H2SO4, and the optical density at a single wavelength of 490 nm was measured using a microplate reader. The ELISA analysis results are shown in Figure 6: RVT-3101 and H3F1+L28E1 blocked the binding of human DR3 to human TL1A.

[0215] Human DcR3 (Recombinant Human DcR3 / TNFRSF6B Fc Chimera Protein, CF, R&D Systems, 142-DC-100) was coated onto a 96-well ELISA plate at 3 μg / mL, 100 μL / well, overnight at 4°C. Blocking was performed with blocking buffer (3% skim milk in PBST) at 37°C for 1 hour. Anti-human TL1A monoclonal antibodies (RVT-3101, PRA023, S4D3, S9H9, S7B11, and H3F1+L28E1) were serially diluted with 3 μg / mL His-fib-hTL1A, starting at 100 μg / mL. Eleven dilutions were performed, each 100 μL / well, into the blocked 96-well ELISA plate and incubated at 37°C for 1 hour. The ELISA plate was washed with PBST, and then HRP-conjugated anti-His tag mouse monoclonal antibody (Congwei Century, cw0285M) was added and incubated at 37°C for 1 hour. The plate was washed with PBST, and OPD substrate development solution was added. After 5-10 minutes, color development was stopped with 1M H2SO4, and the optical density at a single wavelength of 490 nm was measured using a microplate reader. The ELISA analysis results are shown in Figure 7: RVT-3101 and PRA023 blocked human DcR3 binding to human TL1A, while S4D3, S9H9, S7B11, and H3F1+L28E1 did not.

[0216] DcR3, as a common decoy receptor for TNF family cytokines (Fas-L, LIGHT, and TL1A), has a natural antagonistic function in vivo. S4D3, S9H9, S7B11, and H3F1+L28E1 neutralize DR3 but not DcR3, indicating that these antibodies do not disrupt the natural antagonistic activity of DcR3, helping to maintain DcR3 homeostasis in the body and having a better safety profile.

[0217] Example 7: Effect of anti-TL1A monoclonal antibody on DNBS-induced acute ulcerative colitis in rats

[0218] Male Wistar rats with no history of drug administration were purchased from Shanghai Slake Experimental Animal Breeding Co., Ltd. and adapted to the animal room environment 3 days in advance. Rats were fasted for 40 hours before DNBS modeling, and 5% glucose injection (10 mL / kg) was subcutaneously injected as an energy supplement during the fasting period. DNBS powder was dissolved in 30% ethanol to a final concentration of 60 mg / mL. On day 0, fasting rats were anesthetized with Zotai (intraperitoneal injection, 25-50 mg / kg) and xylazine (intraperitoneal injection, 5-10 mg / kg). Specific animal grouping and dosing regimen are shown in Table 13. Among them, the G2-G4 groups had a hose inserted from the anus into the colon, and DNBS enema was used to induce colitis in rats. The G1 group was enemaed using 30% ethanol in the same way. The isotype control was DP47 antibody.

[0219] Table 13. Grouping and dosing regimen

[0220] During the experiment, the fecal characteristics of the experimental animals were scored daily (0 = normal, 1 = moist / sticky, 2 = loose, 3 = liquid). The weight of the experimental animals was measured and recorded daily. On the 6th day, all experimental animals were euthanized by asphyxiation with excessive carbon dioxide. After that, the abdominal cavity was cut open, the colon was removed, and it was longitudinally dissected. After flushing, the colon ulcer surface was observed, and the colon length, weight, and ulcer area were recorded. The macroscopic damage score of the colon was calculated. The results (Figures 8 and 9) showed that the fecal characteristics and intestinal damage of the experimental animals in the G4 group (H3F1+L28E1) were significantly improved compared with the G2 group (model-isotype control group).

[0221] All patents, patent application publications, and non-patent literature mentioned and / or listed in this application are incorporated herein by reference in their entirety. The exemplary embodiments of the inventions of this application are described above. However, those skilled in the art can modify or improve the exemplary embodiments described in this application without departing from the essence and scope of this application, and the resulting variations or equivalents also fall within the scope of this application.

[0222] Sequence information

[0223] References

[0224] 1. Xu WD, Li R, Huang AF. Role of TL1A in Inflammatory Autoimmune Diseases: A Comprehensive Review. Front Immunol. 2022 Jul 14; 13:891328.

[0225] 2.Migone TS,Zhang J,Luo X,Zhuang L,Chen C,Hu B,Hong JS,Perry JW,Chen SF,Zhou JX,Cho YH,Ullrich S,Kanakaraj P,Carrell J,Boyd E,Olsen HS,Hu G,Pukac L,Liu D,Ni J,Kim S,Gentz R,Feng P,Moore PA,Ruben SM,Wei P.TL1A is a TNF-like ligand for DR3 and TR6 / DcR3 and functions as a T cell costimulator.Immunity.2002 Mar;16(3):479-92.

[0226] 3.Valatas V,Kolios G,Bamias G.TL1A(TNFSF15)and DR3(TNFRSF25):A Co-stimulatory System of Cytokines With Diverse Functions in Gut Mucosal Immunity.Front Immunol.2019 Mar 27;10:583.

[0227] 4.Ramos GP,Papadakis KA.Mechanisms of Disease:Inflammatory Bowel Diseases.Mayo Clin Proc.2019 Jan;94(1):155-165.

[0228] 5.Li N,Ye M.Advances in biological agents in the treatment of inflammatory bowel disease[J].Yixue Xinzhi Zazhi,2022,32(4):310-320.

[0229] 6. Krebber A, Bornhauser S, Burmester J, Honegger A, Willuda J, Bosshard HR, Plückthun A. Reliable cloning of functional antibody variable domains from hybridomas and spleen cell repertoires employing a reengineered phage display system. J Immunol Methods. 1997 Feb 14; 201(1):35-55.

[0230] 7.CN201510097117.0.

[0231] 8. Phage Display: A General Experimental Guide / Clarkson, T., Lowman, H.B. (eds.); translated by Ma Lan et al. Chemical Industry Press, May 2008.

[0232] 9.US20150132311A1

[0233] 10.US20210122828A1

[0234] 11.US20160200833A1

Claims

1. An antibody that binds to tumor necrosis factor-like ligand 1A (TL1A), comprising a heavy chain variable region containing the amino acid sequences of HCDR1, HCDR2, and HCDR3, and a light chain variable region containing the amino acid sequences of LCDR1, LCDR2, and LCDR3, wherein the amino acid sequence of said HCDR1 is as shown in SEQ ID NO: 1, the amino acid sequence of said HCDR2 is as shown in SEQ ID NO: 2, the amino acid sequence of said HCDR3 is as shown in SEQ ID NO: 3, the amino acid sequence of said LCDR1 is as shown in SEQ ID NO: 4, the amino acid sequence of said LCDR2 is as shown in SEQ ID NO: 5, and the amino acid sequence of said LCDR3 is as shown in SEQ ID NO: 6; or the amino acid sequence of said HCDR1 is as shown in SEQ ID NO: 7, the amino acid sequence of said HCDR2 is as shown in SEQ ID NO: 8, the amino acid sequence of said HCDR3 is as shown in SEQ ID NO: 9, the amino acid sequence of said LCDR1 is as shown in SEQ ID NO: 10, the amino acid sequence of said LCDR2 is as shown in SEQ ID NO: 11, and the amino acid sequence of said LCDR3 is as shown in SEQ ID NO: 12; or the amino acid sequence of said HCDR1 is as shown in SEQ ID NO: 7, the amino acid sequence of said HCDR2 is as shown in SEQ ID NO: 13, the amino acid sequence of said HCDR3 is as shown in SEQ ID NO: 9, the amino acid sequence of said LCDR1 is as shown in SEQ ID NO: 14, the amino acid sequence of said LCDR2 is as shown in SEQ ID NO: 15, and the amino acid sequence of said LCDR3 is as shown in SEQ ID NO: 16; or the amino acid sequence of said HCDR1 is as shown in SEQ ID NO: 17, the amino acid sequence of said HCDR2 is as shown in SEQ ID NO: 18, the amino acid sequence of said HCDR3 is as shown in SEQ ID NO: 19, the amino acid sequence of said LCDR1 is as shown in SEQ ID NO: 20, the amino acid sequence of said LCDR2 is as shown in SEQ ID NO: 21, and the amino acid sequence of said LCDR3 is as shown in SEQ ID NO: 22; wherein, the HCDR and LCDR amino acid sequences are defined according to Kabat.

2. The antibody according to claim 1, wherein the amino acid sequence of the heavy chain variable region of said antibody is as shown in SEQ ID NO: 23, 24, 25, or 26.

3. The antibody according to claim 1, wherein the amino acid sequence of the light chain variable region of said antibody is as shown in SEQ ID NO: 27, 28, 29, or 30.

4. The antibody according to any one of claims 1-3, wherein The amino acid sequence of the variable region of the heavy chain of the antibody is as shown in SEQ ID NO: 23, and the amino acid sequence of the variable region of the light chain of the antibody is as shown in SEQ ID NO: 27; or The amino acid sequence of the variable region of the heavy chain of the antibody is as shown in SEQ ID NO: 24, and the amino acid sequence of the variable region of the light chain of the antibody is as shown in SEQ ID NO: 28; or The amino acid sequence of the variable region of the heavy chain of the antibody is as shown in SEQ ID NO: 25, and the amino acid sequence of the variable region of the light chain of the antibody is as shown in SEQ ID NO: 29; or The amino acid sequence of the variable region of the heavy chain of the antibody is as shown in SEQ ID NO: 26, and the amino acid sequence of the variable region of the light chain of the antibody is as shown in SEQ ID NO:

30.

5. The antibody according to any one of claims 1-4, wherein the amino acid sequence of the variable region of the heavy chain of the antibody has at least 90% identity with SEQ ID NO: 23, 24, 25 or 26, and the amino acid sequence of the variable region of the light chain of the antibody has at least 90% identity with SEQ ID NO: 27, 28, 29 or 30.

6. The antibody according to any one of claims 1-5, wherein The antibody is a whole antibody, Fab fragment, F(ab’) 2 fragment or single-chain Fv fragment (scFv), preferably, the antibody is a fully human antibody; and / or the antibody is a monoclonal antibody; and / or the antibody further comprises a heavy chain constant region selected from the IgG1 subtype, IgG2 subtype or IgG4 subtype; preferably, the heavy chain constant region is the IgG1 subtype; more preferably, the heavy chain constant region comprises the Fc segment sequence of the IgG1 subtype heavy chain constant region, and the amino acid sequences at positions 234, 235, 331 of the Fc segment sequence are F, E, S respectively, and / or the amino acid sequences at positions 252, 254, 256 of the Fc segment sequence are Y, T and E respectively; wherein the amino acid sequence of the constant region of the antibody is determined according to EU numbering; and / or the antibody further comprises a light chain constant region selected from the κ subtype or λ subtype.

7. The antibody according to any one of claims 1-6, wherein the antibody binds to TL1A of primates and / or rodents; preferably, the primate is a human or a monkey family animal (such as cynomolgus monkey), and / or the rodent is a murine animal (such as a rat or a mouse); and / or the antibody inhibits the binding of TL1A to death receptor 3 (DR3); and / or the antibody does not inhibit the binding of TL1A to decoy receptor 3 (DcR3); and / or the antibody inhibits the caspase activation of cells stimulated by TL1A; and / or the antibody inhibits the NF-κB activation of cells stimulated by TL1A; and / or the antibody inhibits the ability of TL1A to stimulate PBMC to secrete interferon γ.

8. A nucleic acid molecule encoding the antibody according to any one of claims 1-7.

9. A pharmaceutical composition comprising the antibody according to any one of claims 1-7 and a pharmaceutically acceptable excipient, diluent or carrier.

10. The pharmaceutical composition according to claim 9, which is used for preventing or treating TL1A-related diseases; preferably, the TL1A-related diseases are rheumatoid arthritis, inflammatory bowel disease (such as Crohn's disease (CD) and ulcerative colitis (UC)), psoriasis, primary biliary cirrhosis, systemic lupus erythematosus, ankylosing spondylitis, and interstitial lung disease related to systemic sclerosis.

11. Use of the antibody according to any one of claims 1-7, or the pharmaceutical composition according to claim 9 or 10, in the preparation of a medicament for preventing or treating TL1A-related diseases; preferably, the TL1A-related diseases are rheumatoid arthritis, inflammatory bowel disease (such as Crohn's disease (CD) and ulcerative colitis (UC)), psoriasis, primary biliary cirrhosis, systemic lupus erythematosus, ankylosing spondylitis, and interstitial lung disease related to systemic sclerosis.

12. A method for preventing or treating TL1A-related diseases, which comprises administering to an individual in need the antibody according to any one of claims 1-7 or the pharmaceutical composition according to claim 9 or 10; preferably, the TL1A-related diseases are rheumatoid arthritis, inflammatory bowel disease (such as Crohn's disease (CD) and ulcerative colitis (UC)), psoriasis, primary biliary cirrhosis, systemic lupus erythematosus, ankylosing spondylitis, and interstitial lung disease related to systemic sclerosis.

Images