Method for treating tumor with combination of recombinant oncolytic virus and macromolecular antibody-based Anti-cancer drug

Abstract

The present invention relates to the field of biopharmaceutical technology, and particularly, to a method for treating a tumor with a combination of a recombinant oncolytic virus and a macromolecular antibody-based anti-cancer drug. The method comprises: using the recombinant oncolytic virus and the macromolecular antibody-based anti-cancer drug in combination to treat the tumor, wherein the macromolecular antibody anti-cancer drug includes, but is not limited to, macromolecular antibody-based anti-cancer drugs targeting HER2, EGFR, 5T4, B7-H3, TROP2, BCMA, VEGFR-2, SLAMF7, CD3, CD19, CD20, CD22, CD30, CD33, CD38, CD52, CD79b, GD2, VEGF, CTLA4, Claudin18.2, PD-1, PD-L1 and the like, i.e., monoclonal antibody-based drugs, polyclonal antibody-based drugs, antibody-drug conjugates and the like. The method can achieve a therapeutic effect comparable or superior to those of the monotherapies, or even a synergistic effect.

Description

Method for treating tumors by combining recombinant oncolytic virus and macromolecular antibody anticancer drug Technical Field

[0001] The present application relates to the technical field of biomedicine, and specifically to a method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug. Background Art

[0002] Oncolytic viruses are a class of replication-competent, tumor-killing viruses that are now widely accepted as an important branch of tumor immunotherapy. Oncolytic viruses can specifically target and infect tumor cells, for example by exploiting the inactivation or defects of oncolytic virus genes in tumor cells to selectively infect tumor cells. After infecting tumor cells, oncolytic viruses replicate massively within them and ultimately destroy them, killing them. At the same time, oncolytic viruses can also provide the immune stimulation signals necessary for the host's own anti-cancer response, thereby attracting more immune cells to continue killing residual tumor cells.

[0003] Although oncolytic viruses have good application prospects in tumor immunotherapy, wild-type oncolytic viruses often cause damage and dysfunction of body tissues and organs. There is also a high risk of pathogenicity when using wild-type viruses to infect tumor cells. Therefore, in order to further promote the clinical application of oncolytic viruses, it is necessary to modify wild-type oncolytic viruses to obtain attenuated oncolytic viruses. The attenuated oncolytic viruses can be used in clinical applications to reduce the pathogenicity risk of oncolytic viruses and improve their safety.

[0004] However, in the process of modifying oncolytic viruses, if only the wild-type oncolytic virus is randomly genetically modified, although its toxicity can be reduced, the modified oncolytic virus may have a poor cure rate, or even be unable to be packaged, which is not conducive to promoting the clinical application of oncolytic viruses.

[0005] With the advancement of modern molecular biology and the application of advanced technologies such as computer-aided drug design, structural biology, and combinatorial chemistry, the development of macromolecular drugs is accelerating. Biomacromolecule drugs (including peptides, proteins, antibodies, glycans, and nucleic acids) are widely used to treat major diseases such as cancer, AIDS, cardiovascular and cerebrovascular diseases, and hepatitis, and are considered one of the most promising areas of drug research and development in the 21st century. However, the use of biomacromolecule drugs still faces urgent challenges and obstacles, such as difficulty penetrating cell membranes, strong immunogenicity, difficulty effectively penetrating solid tumors, complex morphology (polymorphism, multiple conformations, and multi-scale issues), difficulty in separation and purification, and low stability. Consequently, the clinical application of macromolecular drugs has been limited to a certain extent.

[0006] Summary of the Invention

[0007] In order to further improve the therapeutic effect of tumor cells, the present application provides a method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug.

[0008] Oncolytic viruses are a type of tumor-killing virus with replication ability, and are currently accepted by the public as an important branch of tumor immunotherapy. Oncolytic viruses can specifically target and infect tumor cells, for example, by taking advantage of the inactivation or defects of oncolytic virus genes in tumor cells to selectively infect tumor cells; after infecting tumor cells, oncolytic viruses will replicate in large quantities within the tumor cells and eventually destroy the tumor cells, thereby killing the tumor cells. At the same time, oncolytic viruses can also provide the immune stimulation signals necessary to enhance the host's own anti-cancer response, thereby attracting more immune cells to continue to kill residual tumor cells. Therefore, oncolytic viruses have the ability to disrupt the tumor tissue microenvironment and turn "cold tumors" into "hot tumors."

[0009] This application adopts the principle of Mark+Kill. The recombinant oncolytic virus vaccine expresses the tumor antigen target and is constructed into a recombinant oncolytic virus vaccine. It not only targets tumor cells, but also transforms tumors that have no targets and cannot be treated with antibodies into tumors with targets and can be treated (referred to as Mark for short). It is then combined with monoclonal antibodies, bispecific antibodies, polyclonal antibodies and ADCs targeting the antigen target for combined treatment, and achieves or exceeds the efficacy of recombinant oncolytic virus monotherapy or large molecule antibody anticancer drug monotherapy, and even achieves the efficacy of 1+1 greater than 2 (referred to as Kill for short).

[0010] Furthermore, to enhance therapeutic efficacy, cytokines can be inserted and expressed in oncolytic viruses. The synergistic action of oncolytic viruses, cytokines, and macromolecular antibody anticancer drugs, combined with other anti-tumor mechanisms, results in a more potent anti-tumor effect.

[0011] The present application provides a method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug, which adopts the following technical solution:

[0012] A method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug, wherein the macromolecular antibody anticancer drug and the recombinant oncolytic virus are used to treat tumors;

[0013] The macromolecular antibody anticancer drugs include but are not limited to macromolecular antibody anticancer drugs targeting HER2, macromolecular antibody anticancer drugs targeting EGFR, macromolecular antibody anticancer drugs targeting PD-1, macromolecular antibody anticancer drugs targeting PD-L1, macromolecular antibody anticancer drugs targeting TROP2, macromolecular antibody anticancer drugs targeting BCMA, macromolecular antibody anticancer drugs targeting VEGFR-2, macromolecular antibody anticancer drugs targeting SLAMF7, macromolecular antibody anticancer drugs targeting CD3, macromolecular antibody anticancer drugs targeting CD19, macromolecular antibody anticancer drugs targeting CD20, macromolecular antibody anticancer drugs targeting CD22, macromolecular antibody anticancer drugs targeting CD30, macromolecular antibody anticancer drugs targeting CD33, macromolecular antibody anticancer drugs targeting CD38, macromolecular antibody anticancer drugs targeting CD52, macromolecular antibody anticancer drugs targeting CD Macromolecular antibody anticancer drugs targeting 79b, macromolecular antibody anticancer drugs targeting Met, macromolecular antibody anticancer drugs targeting GD2, macromolecular antibody anticancer drugs targeting VEGF, macromolecular antibody anticancer drugs targeting PDGFR-α, macromolecular antibody anticancer drugs targeting CTLA-4, macromolecular antibody anticancer drugs targeting RANKL, macromolecular antibody anticancer drugs targeting FRa, macromolecular antibody anticancer drugs targeting TF, macromolecular antibody anticancer drugs targeting IL6, macromolecular antibody anticancer drugs targeting GPRC5D, macromolecular antibody anticancer drugs targeting TNF-α, macromolecular antibody anticancer drugs targeting EPCAM, macromolecular antibody anticancer drugs targeting CD24, macromolecular antibody anticancer drugs targeting 5T4, macromolecular antibody anticancer drugs targeting B7-H3, macromolecular antibody anticancer drugs targeting GPC3, and macromolecular antibody anticancer drugs targeting Claudin 18.2.

[0014] The recombinant oncolytic virus includes M protein, G protein, N protein, P protein, and L protein.

[0015] Compared with the amino acid sequence shown in SEQ ID NO 1, the site mutation of the M protein includes any one or more of M51R, V221F, and S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; or the site mutation of the M protein includes N32S, N49D, M51R, H54Y, deletion of the 111th leucine coding base, V221F, V225I, and S226R. 25I, S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, L111A, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of G21E, N32S, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutation of the M protein includes G21 E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54 Y, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, A133T, V221F, V225I, S226R.

[0016] Compared with the amino acid sequence shown in SEQ ID NO 12, the site mutations of the G protein include any one or more of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.

[0017] Compared with the amino acid sequence shown in SEQ ID NO 14, the site mutations of the N protein include any one or more of I14V, R155K, and S353N.

[0018] Compared with the amino acid sequence shown in SEQ ID NO 16, the site mutations of the P protein include any one or more of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.

[0019] Compared with the amino acid sequence shown in SEQ ID NO 18, the site mutation of the L protein includes any one or more of S87P and I487T.

[0020] In the present application, the wild-type VSV virus Indiana Mudd Summer subtype M protein comprises the amino acid sequence shown in SEQ ID NO 1.

[0021] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 2.

[0022] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 3.

[0023] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 4.

[0024] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 5.

[0025] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 6.

[0026] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 7.

[0027] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 8.

[0028] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 9.

[0029] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 10.

[0030] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 11.

[0031] In the present application, the wild-type VSV virus Indiana Mudd Summer subtype G protein comprises the amino acid sequence shown in SEQ ID NO 12.

[0032] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 13.

[0033] In the present application, the wild-type VSV virus Indiana Mudd Summer subtype N protein comprises the amino acid sequence shown in SEQ ID NO 14.

[0034] In a specific embodiment, the N protein comprises the amino acid sequence shown in SEQ ID NO 15.

[0035] In the present application, the wild-type VSV virus Indiana Mudd Summer subtype P protein comprises the amino acid sequence shown in SEQ ID NO 16.

[0036] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 17.

[0037] In the present application, the wild-type VSV virus Indiana Mudd Summer subtype L protein comprises the amino acid sequence shown in SEQ ID NO 18.

[0038] In a specific embodiment, the L protein comprises the amino acid sequence shown in SEQ ID NO 19.

[0039] In some specific embodiments, the recombinant oncolytic virus is obtained by site-directed mutagenesis based on a rod-shaped virus.

[0040] In some specific embodiments, the recombinant oncolytic virus is obtained by site-directed mutagenesis based on Vesicular Stomatitis Virus (VSV).

[0041] In some specific embodiments, the recombinant oncolytic virus is obtained by site-directed mutagenesis based on the VSV Indiana Mudd Summer subtype.

[0042] Furthermore, the antigen is selected from any one or more of the following: CD19, CD22, BCMA, MUC1, NY-ESO-1, MAGE A4, MET, Claudin 18.2, MSLN, EGFR, VEGFR2, HER2, TPBG, AFP, MAGE-A10. Furthermore, the recombinant oncolytic virus further comprises a cytokine encoded by an exogenous gene.

[0043] Furthermore, the cytokine is selected from any one or more of the following: GMCSF, IL-2, IL-12, IL-15, IL-18, TNF-α, and IFN-β.

[0044] The antigen sequence inserted into the recombinant oncolytic virus can be the full sequence or a partial specific sequence. Similarly, the target sequence inserted into the recombinant oncolytic virus can be the full sequence or a partial specific sequence. Similarly, the cytokine inserted into the recombinant oncolytic virus can be the full sequence or a partial specific sequence.

[0045] The present application also provides a composition comprising the above-mentioned oncolytic virus vaccine and a macromolecular antibody anticancer drug.

[0046] In summary, this application has the following beneficial effects:

[0047] The method for treating tumors with a recombinant oncolytic virus combined with a macromolecular antibody anticancer drug provided in the present application has a significant inhibitory effect on tumor growth. Moreover, the experimental results of the combined treatment of tumors with a recombinant oncolytic virus directly combined with a macromolecular antibody anticancer drug are better than the experimental results of treating tumors with a recombinant oncolytic virus alone or with a macromolecular antibody anticancer drug alone; the experimental results of treating tumors with a recombinant oncolytic virus inserted and expressed antigens or antigen fragments and then combined with a macromolecular antibody anticancer drug targeting the antigen or antigen fragment are better than the experimental results of treating tumors with a recombinant oncolytic virus directly combined with a macromolecular antibody anticancer drug or the experimental results of treating tumors with a recombinant oncolytic virus inserted and expressed antigens or antigen fragments directly. Therefore, the method of treating tumors with a recombinant oncolytic virus and a macromolecular antibody anticancer drug provided in the present application further effectively improves the therapeutic effect on tumor cells.

[0048] The method for treating tumors using a recombinant oncolytic virus and a macromolecular antibody anticancer drug provided in this application has a good ability to inhibit the growth of tumor cells. It can be judged that the method for treating tumors using a recombinant oncolytic virus and a macromolecular antibody anticancer drug provided in this application also has a good ability to inhibit other cancer cells and has broad clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 shows the results of animal experiments using a recombinant oncolytic virus and the large molecule antibody anticancer drug Trastuzumab to treat tumors.

[0050] Figure 2 shows the results of animal experiments using a recombinant oncolytic virus and the large molecule antibody anticancer drug Necitumumab to treat tumors.

[0051] Figure 3 shows the results of animal experiments using a recombinant oncolytic virus and a large molecule antibody anticancer drug, Anti-5T4 antibody, to treat tumors.

[0052] Figure 4 shows the results of animal experiments using a recombinant oncolytic virus and a large molecule antibody anticancer drug, Anti-CD276 antibody, to treat tumors.

[0053] Figure 5 shows the results of animal experiments using a recombinant oncolytic virus and the large molecule antibody anticancer drug Sacituzumab govitecan to treat tumors.

[0054] Figure 6 shows the results of animal experiments using a recombinant oncolytic virus and the macromolecular antibody anticancer drug Belantamab Mafodotin to treat tumors.

[0055] Figure 7 shows the results of animal experiments using a recombinant oncolytic virus and the large molecule antibody anticancer drug Ramucirumab to treat tumors.

[0056] Figure 8 shows the results of animal experiments using a recombinant oncolytic virus and the large molecule antibody anticancer drug Elotuzumab to treat tumors.

[0057] Figure 9 shows the results of animal experiments using a recombinant oncolytic virus and the large molecule antibody anticancer drug Blinatumomab to treat tumors.

[0058] Figure 10 shows the results of animal experiments using a recombinant oncolytic virus and the large-molecule antibody anticancer drug loncastuximab tesirine to treat tumors.

[0059] Figure 11 shows the results of animal experiments using a recombinant oncolytic virus and the macromolecular antibody anticancer drug Polatuzumab vedotin to treat tumors.

[0060] Figure 12 shows the results of animal experiments using a recombinant oncolytic virus and a large-molecule antibody anticancer drug, Anti-Glypican3 antibody, to treat tumors.

[0061] Figure 13 shows the results of animal experiments using a recombinant oncolytic virus and the large-molecule antibody anticancer drug Anti-Claudin18.2 antibody to treat tumors.

[0062] Those skilled in the art can easily discern other aspects and advantages of the present application from the detailed description below. In the detailed description below, only exemplary embodiments of the present application are shown and described. As will be appreciated by those skilled in the art, the content of this application enables those skilled in the art to modify the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application relates. Accordingly, the descriptions in the drawings and specification of this application are merely exemplary and not restrictive. DETAILED DESCRIPTION

[0063] The following describes the implementation of the present invention through specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0064] Definition of terms

[0065] In this application, the term "oncolytic virus" (oncolytic virus) generally refers to a virus that can replicate in tumor cells and kill tumor cells. Oncolytic viruses include but are not limited to: Vesicular Stomatitis Virus (Vesicular Stomatitis Virus, referred to as "VSV virus"), poxvirus, herpes simplex virus (HSV), measles virus, Semliki Forest virus, poliovirus, reovirus, Seneca Valley virus (SVV), Echovirus, Coxsackie virus, Newcastle disease virus (NDV) and Maraba virus. In certain embodiments, the oncolytic virus is modified to improve the selectivity to tumor cells. In certain embodiments, the oncolytic virus is modified to reduce its immunogenicity.

[0066] In some embodiments, the VSV virus is a mutant of the Indiana Mudd Summer subtype of the VSV virus, which can be used to treat tumors. This virus does not interact with endogenous IFN-β in normal cells and can only selectively amplify and grow in tumor cells.

[0067] VSV virus can express a variety of cell surface molecules, including low-density lipoprotein receptors, phosphatidylserine, sialolipids, and heparan sulfate, and can attach to the cell surface through these molecules. Compared with other oncolytic virus platforms currently under development, VSV virus has the following advantages: (1) small genome, short replication time, and fast transsynaptic speed; (2) extremely high expression of exogenous genes, so it can have high titers, allowing large-scale production; (3) independent cell cycle, and no risk of transformation in the cytoplasm of host cells. This oncolytic virus will not integrate into DNA, and after attenuation, it can avoid the nervous system inflammation caused by wild-type viruses. Given the above characteristics, VSV has great potential in tumor immunotherapy.

[0068] In some embodiments, site-directed gene mutations can be performed on the M protein, and / or G protein, and / or N protein, and / or P protein, and / or L protein of the VSV virus.

[0069] In certain embodiments, the recombinant oncolytic virus described herein can be an oncolytic virus that has been genetically modified, such as by modification of one or more genes to improve its tumor selectivity and / or preferentially replicate in dividing cells. The genetic modification can be a modification of genes involved in DNA / RNA replication, nucleic acid metabolism, host tropism, surface attachment, virulence, lysis and diffusion processes, or it can be a modification of integrated exogenous genes. The exogenous genes may include exogenous immunomodulatory genes, exogenous screening genes, exogenous reporter genes, etc. The modified oncolytic virus may also be an oncolytic virus that has been modified at the amino acid level, such as insertion, deletion, or substitution of one or more amino acids.

[0070] In this application, the term "M protein" generally refers to the VSV viral matrix protein. M protein is an important virulence factor of the VSV virus and is also a protein in the VSV virus that is known to interfere with the natural immune response of mice. The term "M protein" also includes homologs, orthologs, variants, functionally active fragments, etc. In this application, the wild-type VSV virus Indiana Mudd Summer subtype M protein may comprise the amino acid sequence shown in SEQ ID NO 1. In this application, the M protein of the oncolytic virus may comprise the amino acid sequence shown in SEQ ID NO 2-11.

[0071] In this application, the term "G protein" generally refers to the glycoprotein of the VSV virus, also known as the envelope protein. The term "G protein" also includes its homologs, orthologs, variants, functionally active fragments, etc. In this application, the wild-type VSV virus Indiana Mudd Summer subtype G protein may comprise the amino acid sequence shown in SEQ ID NO 12. In this application, the G protein of the oncolytic virus may comprise the amino acid sequence shown in SEQ ID NO 13.

[0072] In this application, the term "N protein" generally refers to the nucleocapsid protein of the VSV virus. The term "N protein" also includes its homologs, orthologs, variants, functionally active fragments, etc. In this application, the wild-type VSV virus Indiana Mudd Summer subtype N protein may comprise the amino acid sequence shown in SEQ ID NO 14. In this application, the N protein of the oncolytic virus may comprise the amino acid sequence shown in SEQ ID NO 15.

[0073] In this application, the term "P protein" generally refers to the phosphoprotein of the VSV virus. The term "P protein" also includes its homologs, orthologs, variants, functionally active fragments, etc. In this application, the wild-type VSV virus Indiana Mudd Summer subtype P protein may comprise the amino acid sequence shown in SEQ ID NO 16. In this application, the P protein of the oncolytic virus may comprise the amino acid sequence shown in SEQ ID NO 17.

[0074] In this application, the term "L protein" generally refers to the VSV viral RNA polymerase protein. The L gene of the VSV virus encodes the RNA poly E protein. The term "L protein" also includes its homologs, orthologs, variants, functionally active fragments, etc. In this application, the wild-type VSV virus Indiana Mudd Summer subtype L protein may comprise the amino acid sequence shown in SEQ ID NO 18. In this application, the L protein of the oncolytic virus may comprise the amino acid sequence shown in SEQ ID NO 19.

[0075] In this application, protein mutation sites are generally described as "amino acid + amino acid position + mutated amino acid." In this application, mutations may include, but are not limited to, amino acid additions, substitutions, deletions, and / or deletions. For example, the term "M51R" generally refers to a mutation from methionine (M) at position 51 to arginine (R).

[0076] In this application, the term "amino acid substitution" generally refers to the replacement of an amino acid residue present in a parent sequence with another amino acid residue. The amino acid in the parent sequence can be replaced, for example, via chemical synthesis or by recombinant methods known in the art. Thus, "substitution at position xx" generally refers to the replacement of the amino acid present at position xx with an alternative amino acid residue. In this application, the amino acid substitution may include an amino acid mutation.

[0077] In this application, the term "mutation" generally refers to a change in the nucleotide or amino acid sequence of a wild-type molecule. Amino acid changes can include substitution, deletion, absence, insertion, addition, truncation, or protein processing or cleavage of amino acids.

[0078] In the present application, the recombinant oncolytic virus is a virus that integrates exogenous genes while performing site-directed gene mutations on the M protein, and / or G protein, and / or N protein, and / or P protein, and / or L protein of the VSV virus. The exogenous genes are specifically genes encoding antigens and / or cytokines.

[0079] Macromolecule drugs, also known as biological products, refer to medicines used for the prevention, treatment and diagnosis of human diseases that are prepared from biological materials such as microorganisms, cells, and various animal and human tissues and fluids obtained using conventional or biotechnological methods such as genetic engineering, cell engineering, protein engineering, and fermentation engineering.

[0080] The mechanism of action of macromolecular drugs is different from that of general drugs or small molecule drugs. Macromolecular drugs mainly exert their efficacy by stimulating the body's immune system to produce immune substances (such as antibodies), and humoral immunity, cellular immunity or cell-mediated immunity appear in the human body. The macromolecular drugs that have been successfully listed include trastuzumab, zenapax, rituximab, etc. Common biological macromolecular drugs such as peptides, proteins, antibodies, polysaccharides and nucleic acids. They are often developed into antibodies and vaccines clinically. In this application, the "macromolecular antibody anticancer drug" is an antibody anticancer drug.

[0081] In some specific embodiments, the macromolecular antibody anticancer drug may include but is not limited to:

[0082] 1. Macromolecular antibody anticancer drugs targeting HER2:

[0083] Trastuzumab (trastuzumab), trade name Herceptin (antibody drug), is humanized and targets HER2. Its FDA-approved indications are: HER2-positive metastatic / non-metastatic breast cancer; HER2-positive metastatic gastric or gastroesophageal junction adenocarcinoma.

[0084] Pertuzumab (Pertuzumab), trade name Perjeta (antibody drug), is humanized and targets HER2. The FDA-approved indications are: HER2-positive metastatic breast cancer; HER2-positive, locally advanced, inflammatory or early breast cancer.

[0085] Ado-trastuzumab emtansine (trastuzumab-emtansine conjugate), trade name Kadcyla, is humanized and targets HER2. The FDA-approved indications are: HER2-positive metastatic breast cancer and lung cancer.

[0086] Disitamab (vedicituzumab) targets HER2 and has FDA-approved indications for: gastric cancer; esophageal cancer.

[0087] Margetuximab targets HER2 and is FDA-approved for the treatment of breast cancer.

[0088] Inetetamab targets HER2 and is FDA-approved for the treatment of breast cancer.

[0089] Fam-trastuzumab deruxtecan-nxki (trastuzumab recombinant lyophilized powder) targets HER2 and has FDA-approved indications for: lung cancer; gastric cancer; breast cancer.

[0090] Trastuzumab deruxtecan targets HER2 and is FDA-approved for the treatment of breast cancer.

[0091] Disitamab vedotin targets HER2 and has FDA-approved indications for urothelial carcinoma, gastric cancer, and gastroesophageal junction cancer.

[0092] 2. Macromolecular antibody anticancer drugs targeting EGFR:

[0093] Cetuximab (Cetuximab), trade name Erbitux, type Chimeric, target EGFR, FDA-approved indications: metastatic colorectal cancer; head and neck squamous cell carcinoma; gastric cancer; esophageal cancer.

[0094] Panitumumab (panitumumab), trade name Vectibix, type is Human, target is EGFR, FDA-approved indications: metastatic colorectal cancer.

[0095] Necitumumab (Portrazza), trade name, is Human, targets EGFR, and is FDA-approved for the following indications: metastatic squamous NSCLC (non-small cell lung cancer).

[0096] Nimotuzumab targets EGFR and has FDA-approved indications for: head and neck cancer; pancreatic cancer.

[0097] Amivantamab targets EGFR and Met, and its FDA-approved indication is lung cancer.

[0098] Getuximab Saratolacan targets EGFR and is FDA-approved for the treatment of head and neck cancer.

[0099] 3. Macromolecular antibody anticancer drugs targeting PD-1;

[0100] Nivolumab (Nivolumab), trade name Opdivo, type is Human, target is PD-1, FDA-approved indications are: unresectable or metastatic melanoma; metastatic squamous NSCLC; metastatic NSCLC; advanced renal cancer; recurrent or metastatic head and neck squamous cell carcinoma; lymphoma, mesothelioma, bladder cancer, liver cancer, head and neck cancer, gastric cancer, esophageal cancer, biliary tract tumors, Merkel cell tumor, thymoma.

[0101] Pembrolizumab (pembrolizumab), trade name Keytruda, is humanized and targets PD-1. FDA-approved indications include: unresectable or metastatic melanoma; metastatic NSCLC; recurrent metastatic head and neck squamous cell carcinoma; lymphoma; solid tumors; lung cancer; Merkel cell tumor; cervical cancer; endometrial cancer; kidney cancer; bladder cancer; liver cancer; head and neck cancer; gastric cancer; esophageal cancer; biliary tract tumors; prostate cancer; alveolar soft tissue sarcoma; undifferentiated pleomorphic sarcoma; and thymoma.

[0102] Tislelizumab targets PD-1 and has FDA-approved indications for: lung cancer; liver cancer; bladder cancer; and lymphoma.

[0103] Sintilimab targets PD-1 and has FDA-approved indications for: lung cancer; liver cancer; lymphoma.

[0104] Cemiplimab targets PD-1 and has FDA-approved indications for lung cancer and melanoma.

[0105] Toripalimab targets PD-1 and has FDA-approved indications for: nasopharyngeal carcinoma; bladder cancer; melanoma; and head and neck cancer.

[0106] Camrelizumab targets PD-1 and has FDA-approved indications for: nasopharyngeal carcinoma; esophageal cancer; liver cancer; biliary tract tumors; kidney cancer; head and neck cancer; and lymphoma.

[0107] Dostarlimab targets PD-1 and is FDA-approved for the treatment of endometrial cancer.

[0108] Penpulimab targets PD-1 and is FDA-approved for the following indications: lymphoma.

[0109] Zimberelimab (sepalimab), which targets PD-1, is FDA-approved for the following indications: lymphoma.

[0110] Cadonilimab targets PD-1 and CTLA4, and its FDA-approved indication is cervical cancer.

[0111] 4. Macromolecular antibody anticancer drugs targeting PD-L1;

[0112] Atezolizumab (atezolizumab), trade name Tecentriq, is humanized and targets PD-L1. Its FDA-approved indications include: locally advanced or metastatic urothelial carcinoma; metastatic NSCLC; melanoma; breast cancer; bladder cancer; and liver cancer.

[0113] Durvalumab targets PD-L1 and has FDA-approved indications for lung cancer and bladder cancer.

[0114] Avelumab targets PD-L1 and has FDA-approved indications for: Merkel cell tumor; renal cancer; bladder cancer.

[0115] Sugemalimab targets PD-L1 and is FDA-approved for the treatment of lung cancer.

[0116] 5. Macromolecular antibody anticancer drugs targeting TROP2:

[0117] Sacituzumab govitecan (gosartuzumab), trade name Trodelvy, targets TROP2 and has FDA-approved indications for breast cancer and bladder cancer.

[0118] 6. Macromolecular antibody anticancer drugs targeting BCMA;

[0119] Belantamab Mafodotin targets BCMA and is FDA-approved for the treatment of multiple myeloma.

[0120] Elranatamab targets BCMA and CD3, and its FDA-approved indication is multiple myeloma.

[0121] Teclistamab targets BCMA and CD3, and its FDA-approved indication is multiple myeloma.

[0122] 7. Macromolecular antibody anticancer drugs targeting VEGFR-2;

[0123] Ramucirumab (Ciramza), trade name, is human, targets VEGFR-2, and has FDA-approved indications for: advanced or metastatic gastroesophageal junction adenocarcinoma; metastatic NSCLC; metastatic colorectal cancer; lung cancer; liver cancer; gastric cancer; and esophageal cancer.

[0124] 8. Macromolecular antibody anticancer drugs targeting SLAMF7;

[0125] Elotuzumab targets SLAMF7 (CS1 / CD319 / CRACC) and is FDA-approved for the treatment of multiple myeloma.

[0126] 9. Macromolecular antibody anticancer drugs targeting CD3;

[0127] Blinatumomab targets CD3 and CD19 and is FDA-approved for the following indications: leukemia.

[0128] Elranatamab targets BCMA and CD3, and its FDA-approved indication is multiple myeloma.

[0129] Teclistamab targets BCMA and CD3, and its FDA-approved indication is multiple myeloma.

[0130] Talquetamab targets CD3 and GPRC5D, and its FDA-approved indication is multiple myeloma.

[0131] Epcoritamab targets CD20 and CD3, and its FDA-approved indications include diffuse large B-cell lymphoma, high-grade B-cell lymphoma, mediastinal large B-cell lymphoma, and follicular lymphoma.

[0132] Glofitamab targets CD20 and CD3, and its FDA-approved indication is diffuse large B-cell lymphoma.

[0133] Mosunetuzumab targets CD20 and CD3, and its FDA-approved indication is follicular lymphoma.

[0134] Catumaxomab targets EPCAM and CD3, and its FDA-approved indications are: malignant pleural effusion and ascites.

[0135] 10. Macromolecular antibody anticancer drugs targeting CD19:

[0136] Blinatumomab targets CD3 and CD19 and is FDA-approved for the following indications: leukemia.

[0137] Loncastuximab tesirine targets CD19 and is FDA-approved for the treatment of B-cell lymphoma.

[0138] 11. Macromolecular antibody anticancer drugs targeting CD20;

[0139] Rituximab targets CD20 and is FDA-approved for the following indications: lymphoma.

[0140] Obinutuzumab targets CD20 and has FDA-approved indications for lymphoma and leukemia.

[0141] Tosituomab, which targets CD20, has FDA-approved indications for lymphoma.

[0142] Ofatumumab targets CD20 and is FDA-approved for the following indications: leukemia.

[0143] Ibritumomab (ibritumomab tiuxetan), which targets CD20, is FDA-approved for the following indications: lymphoma.

[0144] Ibritumomab tiuxetan, which targets CD20, has FDA-approved indications for multiple blood diseases.

[0145] Epcoritamab targets CD20 and CD3, and its FDA-approved indications include diffuse large B-cell lymphoma, high-grade B-cell lymphoma, mediastinal large B-cell lymphoma, and follicular lymphoma.

[0146] Glofitamab targets CD20 and CD3, and its FDA-approved indication is diffuse large B-cell lymphoma.

[0147] Mosunetuzumab targets CD20 and CD3 and is FDA-approved for the treatment of follicular lymphoma.

[0148] 12. Macromolecular antibody anticancer drugs targeting CD22;

[0149] Inotuzumab Ozogamicin targets CD22 and is FDA-approved for the following indications: leukemia.

[0150] Moxetumomab Pasudotox targets CD22 and is FDA-approved for the following indications: leukemia.

[0151] 13. Macromolecular antibody anticancer drugs targeting CD30;

[0152] Brentuximab (Brentuximab vedotin) targets CD30 and is FDA-approved for the following indications: lymphoma.

[0153] 14. Macromolecular antibody anticancer drugs targeting CD33;

[0154] Gemtuzumab targets CD33 and is FDA-approved for the following indications: leukemia.

[0155] Gemtuzumab ozogamicin targets CD33 and is FDA-approved for the treatment of acute myeloid leukemia.

[0156] 15. Macromolecular antibody anticancer drug targeting CD38;

[0157] Daratumumab targets CD38 and is FDA-approved for the treatment of multiple myeloma.

[0158] 16. Macromolecular antibody anticancer drug targeting CD52;

[0159] Alemtuzumab targets CD52 and is FDA-approved for the following indications: leukemia.

[0160] 17. Macromolecular antibody anticancer drug targeting CD79b;

[0161] Polatuzumab vedotin targets CD79b and is FDA-approved for the following indications: lymphoma and leukemia.

[0162] 18. Macromolecular antibody anticancer drug targeting Met;

[0163] Amivantamab targets EGFR and Met, and its FDA-approved indication is lung cancer.

[0164] 19. Macromolecular antibody anticancer drug targeting GD2;

[0165] Dinutuximab, trade name Unituxin, is a Chimeric drug with a target of GD2. Its FDA-approved indications include high-risk neuroblastoma and central nervous system sarcoma in children.

[0166] 20. Macromolecular antibody anticancer drug targeting VEGF;

[0167] Bevacizumab (bevacizumab), trade name Avastin, is humanized and targets VEGF. Its FDA-approved indications are: metastatic colorectal cancer; recurrent or metastatic non-squamous NSCLC; metastatic renal cell carcinoma; persistent, recurrent or metastatic cervical glioblastoma; recurrent cancer; epithelial ovarian cancer, fallopian tube cancer or primary peritoneal cancer; lung cancer; liver cancer; angiosarcoma; hemangiopericytoma; and central nervous system sarcoma.

[0168] Byvasda (bevacizumab), which targets VEGF, has FDA-approved indications for central nervous system sarcoma.

[0169] 21. Macromolecular antibody anticancer drug targeting PDGFR-α;

[0170] Olaratumab (Olarumab), trade name Lartruvo, type is Human, target is PDGFR-α, FDA-approved indications: soft tissue sarcoma.

[0171] 22. Macromolecular antibody anticancer drugs targeting CTLA-4;

[0172] Lpilimumab (Ipilimumab), trade name Yervoy, is of human type and targets CTLA-4. Its FDA-approved indications are: unresectable or metastatic melanoma; cutaneous melanoma; colorectal cancer; mesothelioma; kidney cancer; liver cancer; and thymoma.

[0173] Cadonilimab targets PD-1 and CTLA4, and its FDA-approved indication is cervical cancer.

[0174] 23. Macromolecular antibody anticancer drug targeting RANKL;

[0175] Denosumab, trade name Xgeva, is of Human type and targets RANKL. Its FDA-approved indications are: bone metastasis of solid tumors and giant cell tumor of bone.

[0176] 24. Macromolecular antibody anticancer drugs targeting FRa;

[0177] Mirvetuximab, which targets FRa, has an FDA-approved indication for ovarian cancer.

[0178] Mirvetuximab Soravtansine (Somituximab) targets FRα and has FDA-approved indications for ovarian cancer, fallopian tube cancer, and peritoneal cancer.

[0179] 25. Macromolecular antibody anticancer drugs targeting TF;

[0180] Tisotumab vedotin targets TF and its FDA-approved indication is cervical cancer.

[0181] 26. Macromolecular antibody anticancer drug targeting IL6;

[0182] Siltuximab targets IL6 and is FDA-approved for the following indications: lymphoma.

[0183] 27. Macromolecular antibody anticancer drug targeting GPRC5D;

[0184] Talquetamab targets CD3 and GPRC5D, and its FDA-approved indication is multiple myeloma.

[0185] 28. Macromolecular antibody anticancer drug targeting TNF-α;

[0186] Ozoralizumab targets TNF-α and Albumin, and its FDA-approved indication is rheumatoid arthritis.

[0187] 29. Macromolecular antibody anticancer drug targeting EPCAM;

[0188] Catumaxomab targets EPCAM and CD3, and its FDA-approved indications are: malignant pleural effusion and ascites.

[0189] 30. Macromolecular antibody anticancer drug targeting 5T4;

[0190] Anti-5T4 antibody [EPR5529] (ab134162) was purchased from abcam and targets 5T4 (TPBG).

[0191] GEN-1044 (Genmab) is indicated for bladder cancer, esophageal cancer, non-small cell lung cancer, prostate cancer, triple-negative breast cancer, and uterine cancer. It is a dual-antibody drug.

[0192] ALG.APV-527 (Aptevo Therapeutics, Inc. Alligator Bioscience AB), indicated for solid tumors, and the drug type is a bispecific antibody.

[0193] SYD-1875 (Synthon), indicated for solid tumors, drug type is ADC.

[0194] ASN-004 (Asana BioSciences LLC), indications include solid tumors, colorectal cancer, metastatic breast cancer, non-small cell lung cancer, and ovarian cancer, and the drug type is ADC.

[0195] CBA-1535, indication is tumor, drug type is triple antibody.

[0196] DM004 (Sidao Pharmaceuticals), indicated for solid tumors, drug type is bispecific ADC.

[0197] 31. Macromolecular antibody anticancer drug targeting B7-H3;

[0198] Anti-CD276 antibody [EPNCIR122] (ab134161) was purchased from abcam and targets B7-H3 (CD276).

[0199] Omburtamab is indicated for central nervous system tumor metastasis (clinical phase 2 / 3); meningeal tumors (clinical phase 2 / 3); neuroblastoma (neuroblastoma) (clinical phase 23); non-progressive diffuse lipoderm glioma (clinical phase 1).

[0200] Enoblituzumab, indicated for squamous cell carcinoma of the head and neck (Phase 2 clinical trial): melanin (Phase 1 clinical trial).

[0201] Omburtamab is indicated for tumors (clinical phase 1 / 2) and pediatric medulloblastoma (clinical phase 1 / 2).

[0202] MGC018, indicated for tumors (clinical phase 1 / 2).

[0203] Obrindatamab, indicated for tumors (Phase 1 clinical trial).

[0204] Mirzotamab clezutoclax is indicated for the treatment of tumors (clinical phase 1).

[0205] TAK 280, indicated for tumors (Phase 1 clinical trial).

[0206] YBL 018, indicated for tumors (clinical phase 1).

[0207] ATG 027, indications are tumors (preclinical) and blood tumors (preclinical).

[0208] MIL108, indicated for tumors (preclinical).

[0209] ITC 6146RO, indicated for tumors (preclinical).

[0210] GTB 5550, indicated for tumors (preclinical).

[0211] Hu8H9, indicated for tumors (preclinical).

[0212] SHR-1812, indicated for tumors (preclinical).

[0213] XmAb 808, indicated for tumors (preclinical).

[0214] BAT 8009, indicated for tumors (preclinical).

[0215] HS-20093, indicated for tumors (clinical phase 1).

[0216] 32. Macromolecular antibody anticancer drug targeting GPC3;

[0217] Anti-Glypican 3 antibody [SP86] (ab95363) was purchased from abcam and targets GPC3.

[0218] ECT-204 is indicated for liver cancer and hepatocellular carcinoma.

[0219] Codrituzumab / GC33 (Chugai Pharmaceutical Co., Ltd.; Roche), indicated for hepatocellular carcinoma.

[0220] GPC-3298306 (National Cancer Center of Japan), indicated for hepatocellular carcinoma and ovarian cancer.

[0221] ERY-974 (Chugai Pharmaceutical Co., Ltd.), indicated for solid tumors.

[0222] MDX-1414 (Bristol-Myers Squibb), indicated for tumors.

[0223] B010-A (Shanghai Pharmaceutical Group Co., Ltd.), indicated for hepatocellular carcinoma.

[0224] HLX-63 (Shanghai Henlius Biopharmaceutical Co., Ltd.), indicated for solid tumors.

[0225] LQ-102, indicated for hepatocellular carcinoma.

[0226] 33. Macromolecular antibody anticancer drug targeting Claudin 18.2;

[0227] Anti-Claudin18.2 antibody [EPR19202] (ab222512) was purchased from abcam and targets Claudin 18.2.

[0228] Zolbetuximab (Astellas Pharma (China) Co., Ltd.) is indicated for esophageal cancer, gastric cancer, adenocarcinoma, pancreatic cancer, gastrointestinal diseases, cystic lymphangioma, pain and solid tumors. The drug type is a chimeric monoclonal antibody.

[0229] Q-1802 (Qiyu Biotechnology (Shanghai) Co., Ltd.), indicated for solid tumors, and the drug type is a bispecific antibody.

[0230] LM-102 (Lixin Pharmaceutical Technology (Shanghai) Co., Ltd.), indication is solid tumors, drug type is biological drug.

[0231] TJ-CD48 (Tiantian Biotechnology (Shanghai) Co., Ltd.), the indication is tumor, and the drug type is a bispecific antibody.

[0232] Recombinant humanized anti-Claudin 18.2 monoclonal antibody (Shanghai Co., Ltd.), indicated for solid tumors, gastric cancer and pancreatic cancer, the drug type is a humanized monoclonal antibody.

[0233] Claudin18.2 humanized monoclonal antibody (Mabspacebio) (Mabspace Biosciences CoLtd), indicated for gastric cancer, solid tumors, tumors, bile duct cancer, gallbladder cancer, lung cancer and esophageal cancer, the drug type is a humanized monoclonal antibody.

[0234] HBM-1029 (Harbin Biopharma), indicated for solid tumors, and the drug type is a monoclonal antibody.

[0235] HLX-58 (Shanghai Henlius Biopharmaceutical Co., Ltd.), indicated for solid tumors.

[0236] SOT-102 (Sotio), indicated for solid tumors, and the drug type is antibody-drug conjugate.

[0237] In some specific embodiments, the polyclonal antibody anticancer drug may include but is not limited to:

[0238] Amivantamab, Blinatumomab, Ofatumumab, Elranatamab, Teclistamab, Talquetamab, Epcoritamab, Glofitamab, Cadonilimab, Mosunetuzumab, Ozoralizumab, Catumaxomab.

[0239] In addition, polyclonal antibody anticancer drugs also include the following:

[0240] Enfortumab vedotin, which targets Nectin-4, is FDA-approved for the treatment of urothelial carcinoma.

[0241] Emicizumab, which targets FIX, has FDA-approved indications for hemophilia A, acquired hemophilia A, and bleeding.

[0242] In some specific embodiments, the antibody-drug conjugate may include but is not limited to:

[0243] Ado-trastuzumab emtansine, Fam-trastuzumab deruxtecan-nxki, Trastuzumab deruxtecan, etuximab Saratolacan, Tisotumab vedotin, Loncastuximab tesirine, Belantamab mafodotin, Sacituzumab govitecan, Moxetumomab pasudotox, Inotuzumab ozogamicin, Brentuximab Vedotin, Mirvetuximab Soravtansine, Disitamab vedotin, Polatuzumab vedotin, Gemtuzumab ozogamicin.

[0244] In this application, the term "monoclonal antibody" (mAb) refers to a highly homogeneous antibody produced by a single B cell clone that recognizes only a specific epitope of an antigen.

[0245] In this application, the term "polyclonal antibody" (polyantibody) is an antibody produced by multiple B lymphocyte clones, stimulated by multiple epitopes, and capable of binding to multiple antigen epitopes. To some extent, polyclonal antibodies are a mixture of multiple monoclonal antibodies.

[0246] In this application, the term "Antibody-Drug Conjugate" (ADC) refers to the combination of a highly targeted antibody drug with a powerful chemotherapy drug, which precisely delivers the drug to tumor cells while avoiding the chemotherapy drug's damage to normal cells, thereby reducing adverse reactions during treatment. The first ADC drug, Mylotarg, was approved for marketing in 2000. Currently approved ADC drugs include -trastuzumab emtansine, Trastuzumab deruxtecan, Sacituzumab govitecan, Ibritumomab tiuxetan, Inotuzumab Ozogamicin, Moxetumomab Pasudotox, Brentuximab, Gemtuzumab ozogamicin, Polatuzumab vedotin, and Enfortumab vedotin.

[0247] In this application, the term "antigen" refers to a substance that can cause the production of antibodies or immune cells, and is any substance that can induce an immune response in the body. That is, it can be specifically recognized and bound by the antigen receptors (TCR / BCR) on the surface of T / B lymphocytes, activating T / B cells, causing them to proliferate and differentiate, produce immune response products (sensitized lymphocytes or antibodies), and can specifically bind to the corresponding products in vivo and in vitro. Therefore, antigenic substances have two important characteristics: immunogenicity and immunoreactivity. Immunogenicity refers to the ability of an antigen to induce a specific immune response in the body and produce antibodies and / or sensitized lymphocytes; immunoreactivity refers to the ability to undergo a specific binding reaction with the corresponding immune effector substances (antibodies or sensitized lymphocytes) in vivo and in vitro.

[0248] In some specific embodiments, the antigen is exogenous, meaning that the antigen is from a different species.

[0249] In some specific embodiments, the antigen is an endogenous antigen. Specifically, the antigen is an antigen normally expressed on tumor cells.

[0250] In a specific implementation method, the antigen is a tumor associated antigen (Tumor Associated Antigen: TAA) or a tumor specific antigen (Tumor Specific Antigen: TSA).

[0251] In a specific embodiment, TAA or TSA encompasses a molecule or a portion thereof that is presented on the cell surface (antigens recognized by CAR) or within the cell membrane (antigens recognized by TCR) or present in the tumor environment (e.g., in the tumor microenvironment).

[0252] In some specific embodiments, the cell is a tumor cell.

[0253] In some specific embodiments, the TAA or TSA comprises a tumor-associated antigen or a tumor-specific antigen on the cell surface or in the cell membrane.

[0254] In some specific embodiments, the cells are non-tumor cells present in a tumor environment, such as, but not limited to, cells present in vasculature tissue associated with a tumor or cancer.

[0255] In some specific embodiments, the TAA or TSA is an angiogenesis antigen in the tumor microenvironment.

[0256] In some specific embodiments, the TAA or TSA is an antigen on a blood vessel in the tumor microenvironment.

[0257] In some specific embodiments, the cells are stromal cells present in a tumor environment.

[0258] In some specific embodiments, the TAA or TSA is a stromal cell antigen in the tumor microenvironment.

[0259] In some specific embodiments, TAA or TSA includes extracellular epitopes of tumor cell surface antigens, tetramers inside and outside the tumor cell membrane, or other structures that can be recognized by antibodies or immune cells.

[0260] In some specific embodiments, the TAA or TSA comprises an extracellular matrix antigen.

[0261] In some specific embodiments, the TAA or TSA comprises an antigen present in the tumor microenvironment (TME).

[0262] In some specific embodiments, the TAA or TSA comprises a molecule secreted by a tumor cell into the TME.

[0263] In some specific embodiments, the TAA or TSA comprises an effector molecule that is secreted by tumor cells into the TME.

[0264] In some specific embodiments, the TAA or TSA comprises an effector molecule that is secreted by tumor cells into the TME to downregulate or inhibit the activity of cytotoxic natural killer (NK) cells or T cells.

[0265] In some specific embodiments, the TAA or TSA comprises a soluble activating receptor ligand that is secreted by tumor cells into the TME to block recognition of tumor cells by NK cells or T cells.

[0266] In some specific embodiments, examples of TAAs or TSAs include, but are not limited to, 5T4, ROR1, EGFR, FcγRI, FcγRIIa, FcγRIIb, FcγRIIIa, FcγRIIIb, CD24, CD28, CD137, CTLA-4, FAS, FAP (fibroblast activation protein), LGR5, C5aR1, A2AR, fibroblast growth factor receptor 1 (FGFR1), FGFR2, FGFR3, FGFR4, glucocorticoid-induced TNFR-related (GITR) protein, lymphotoxin-β receptor (LTβR), toll-like receptor (TLR), tumor necrosis factor-related apoptosis-inducing ligand receptor 1 (TRAIL receptor 1), TRAIL receptor 2, prostate-specific membrane antigen (PSMA) protein, prostate stem cell antigen (PSCA) protein, tumor-associated protein carbonic anhydrase IX (CAIX), epidermal growth factor receptor 1 (EGFR1), EGFRvIII, human epidermal growth factor receptor 2 (HER2 / neu;Erb2), ErbB3 (Her3), folate receptor, ephrin receptor, PDGFRa, ErbB2, CD2, CD20, CD22, CD30, CD33, CD40, CD37, CD38, CD70, CD74, CD56, CD80, CD86, CD123, CCAM5, CCAM6, BCMA, p53, MET (tyrosine protein kinase Met), hepatocyte growth factor receptor (HGFR), MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A1 2, BAGE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, tyrosinase, Wilms tumor antigen (WT1), TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iCE, MUC1, MUC2, P-cadherin, myostatin (Myosin tatin)(GDF8), Cripto(TDGF1), MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, WT1, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, Annexin II, CDC27 / m, TPI / mbcr-a bl, ETV6 / AML, LDLR / FUT, Pml / RARα, TEL / AML1, CD28, CD137, CanAg, mesothelin, DR5, PD-1, PD-L1, HER2, HER3, IGF-1R, CXCR4, neuropilin 1, glypicans, EphA2, CD138, B7-H3, B7-H4, gpA33, GPC3, SSTR2 or VEGF-R2, CEA, EpCAM, Nectin-4, KARS, CD39, CD73, TIGIT, CD47, DLL3, Claudin 18.1.

[0267] In this application, the term "cytokines" (cytokines) is a biologically active substance that is synthesized and secreted by immune cells (lymphocytes, mononuclear macrophages, etc.) and their related cells (vascular endothelial cells, fibroblasts, etc.) to regulate the functions of other immune cells or target cells. It is a macromolecular polypeptide or glycoprotein. Cytokines with immunomodulatory effects can be expressed by recombinant oncolytic viruses. According to their main functions, cytokines are divided into: interleukin (IL), interferon (IFN), tumor necrosis factor (TNF), colony stimulating factor (CSF), transforming growth factor-β family (TGF-βfamily), growth factor (GF), chemokine family (chemokine family).

[0268] Interleukins include IL-1, IL-2, IL-7, IL-9, IL-15, IL-21, IL-4, IL-12, and IL-18.

[0269] Specifically, interleukin-12 (IL-12): IL-12 acts on activated T and NK cells and has a wide range of biological activities, mediated by the activator of the transcriptional protein STAT4 to exert its effects on lymphocytes. IL-12 is required for the T-cell-independent induction of IFN-γ and plays a crucial role in the differentiation of Th1 and Th2 cells. IL12B binds to IL23A to form IL-23 interleukin, which has both innate and adaptive immune functions. IL-12 is a drug target. In cellular immunotherapy, IL-12 promotes the differentiation of CD4+ T cells into CD4+ Th1 T cells and enhances the activity of CD8+ CTLs. The therapeutic effect of IL-12 is related to its dose, duration of action, and other interacting cytokines, promoting the tumor-killing activity of immune cells through multiple mechanisms. In a mouse anti-melanoma model, high-dose IL-12 exerts its tumor-killing effect through NK cells, while low-dose IL-12 exerts its tumor-killing effect through NKT cells.

[0270] Specifically, interleukin 18 (IL-18): IL-18, also known as interferon-γ inducing factor, is a proinflammatory cytokine produced by macrophages and other cells. IL-18 can stimulate NK cells and CD8+T cells to secrete IFN-γ, enhancing the cytotoxic effect of NK cells and CD8+T cells. IL-18 can also activate macrophages, promote the development of Th1 CD4+T cells, and promote the expression of FasL in lymphocytes and other functions. IL-18 may provide a potential therapeutic target for allergic diseases. In addition, the synergistic effect of IL-18, IL-12, and IL-15 can maintain Th1 responses and monokine production in autoimmune diseases.

[0271] In this application, the term "nucleic acid molecule" generally refers to nucleotides of any length. In this application, the term "nucleic acid molecule" can encode the protein contained in the oncolytic virus. In this application, the nucleic acid molecule can include DNA and / or RNA. In some cases, the RNA can include single-stranded RNA (ssRNA) or double-stranded RNA (dsRNA), and the single-stranded RNA can include sense RNA, antisense RNA (anti-sense RNA), or ambisense RNA.

[0272] In this application, the term "prevention" generally refers to preventing the generation and onset, recurrence, and / or spread of a disease or one or more symptoms thereof by taking certain measures in advance. In this application, the term "treatment" generally refers to eliminating or improving a disease, or one or more symptoms associated with a disease. In certain embodiments, treatment generally refers to administering one or more drugs to a patient suffering from the disease so that the disease is eliminated or alleviated. In certain embodiments, "treatment" can be administering the drug combination and / or pharmaceutical product in the presence or absence of other drugs after the onset of symptoms of a particular disease. For example, the use of the drug combination and / or pharmaceutical product described herein prevents the generation, development, recurrence, and / or metastasis of a tumor.

[0273] In this application, the term "tumor" generally refers to any new pathological tissue growth. Tumors may be benign or malignant. In this application, the tumor may be a solid tumor and / or a hematologic tumor. For research purposes, these tissues can be isolated from readily available sources using methods well known to those skilled in the art.

[0274] In some specific embodiments, the tumor includes but is not limited to acute lymphoblastic leukemia, acute B-lymphocytic leukemia, chronic non-lymphocytic leukemia, non-Hodgkin's lymphoma, anal cancer, astrocytoma, basal cell carcinoma, bile duct cancer, bladder cancer, breast cancer, breast cancer (BRCA), cervical cancer, chronic myeloproliferative neoplasms, colorectal cancer, endometrial cancer, ependymoma, esophageal cancer, diffuse large B-cell lymphoma (DLBCL), sensorineuroblastoma, Ewing sarcoma, fallopian tube cancer, gallbladder cancer, Gastric cancer, gastrointestinal carcinoid tumor, hepatocellular carcinoma, hypopharyngeal cancer, Kaposi sarcoma, kidney cancer, Langerhans cell hyperplasia, laryngeal cancer, liver cancer, lung cancer, melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor, pharyngeal cancer, pituitary tumor, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous neck cancer, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and vascular tumors.

[0275] Detailed Description of the Invention

[0276] A wild-type VSV virus, specifically the Indiana strain of VSV virus, or the Indiana Mudd Summer subtype of VSV virus. The amino acid sequence of its M protein is shown in SEQ ID NO 1; the amino acid sequence of its G protein is shown in SEQ ID NO 12; the amino acid sequence of its N protein is shown in SEQ ID NO 14; the amino acid sequence of its P protein is shown in SEQ ID NO 16; and the amino acid sequence of its L protein is shown in SEQ ID NO 18. In the present application, the M protein, G protein, N protein, P protein, and L protein can all be modified.

[0277] A recombinant oncolytic virus is obtained by mutating sites on the amino acid sequences of the wild-type VSV virus, including its M protein, G protein, N protein, P protein, and L protein.

[0278] The present application provides a method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug, specifically comprising: using a macromolecular antibody anticancer drug and a recombinant oncolytic virus to treat tumors.

[0279] Macromolecular antibody anticancer drugs include, but are not limited to, macromolecular antibody anticancer drugs targeting HER2, macromolecular antibody anticancer drugs targeting EGFR, macromolecular antibody anticancer drugs targeting PD-1, macromolecular antibody anticancer drugs targeting PD-L1, macromolecular antibody anticancer drugs targeting TROP2, macromolecular antibody anticancer drugs targeting BCMA, macromolecular antibody anticancer drugs targeting VEGFR-2, macromolecular antibody anticancer drugs targeting SLAMF7, macromolecular antibody anticancer drugs targeting CD3, macromolecular antibody anticancer drugs targeting CD19, macromolecular antibody anticancer drugs targeting CD20, macromolecular antibody anticancer drugs targeting CD22, macromolecular antibody anticancer drugs targeting CD30, macromolecular antibody anticancer drugs targeting CD33, macromolecular antibody anticancer drugs targeting CD38, macromolecular antibody anticancer drugs targeting CD52, and macromolecular antibody anticancer drugs targeting CD7. 9b-targeting macromolecular antibody anticancer drugs, Met-targeting macromolecular antibody anticancer drugs, GD2-targeting macromolecular antibody anticancer drugs, VEGF-targeting macromolecular antibody anticancer drugs, PDGFR-α-targeting macromolecular antibody anticancer drugs, CTLA-4-targeting macromolecular antibody anticancer drugs, RANKL-targeting macromolecular antibody anticancer drugs, FRa-targeting macromolecular antibody anticancer drugs, TF-targeting macromolecular antibody anticancer drugs, IL6-targeting macromolecular antibody anticancer drugs, GPRC5D-targeting macromolecular antibody anticancer drugs, TNF-α-targeting macromolecular antibody anticancer drugs, EPCAM-targeting macromolecular antibody anticancer drugs, CD24-targeting macromolecular antibody anticancer drugs, 5T4-targeting macromolecular antibody anticancer drugs, B7-H3-targeting macromolecular antibody anticancer drugs, GPC3-targeting macromolecular antibody anticancer drugs, and Claudin 18.2-targeting macromolecular antibody anticancer drugs;

[0280] The recombinant oncolytic virus includes M protein, G protein, N protein, P protein, and L protein.

[0281] Compared with the amino acid sequence shown in SEQ ID NO 1, the site mutation of the M protein includes any one or more of M51R, V221F, and S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; or the site mutation of the M protein includes N32S, N49D, M51R, H54Y, deletion of the 111th leucine coding base, V221F, V225I, and S226R. 25I, S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, L111A, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of G21E, N32S, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutation of the M protein includes G21 E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54 Y, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, A133T, V221F, V225I, S226R.

[0282] Compared with the amino acid sequence shown in SEQ ID NO 12, the site mutations of the G protein include any one or more of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.

[0283] Compared with the amino acid sequence shown in SEQ ID NO 14, the site mutations of the N protein include any one or more of I14V, R155K, and S353N.

[0284] Compared with the amino acid sequence shown in SEQ ID NO 16, the site mutations of the P protein include any one or more of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.

[0285] Compared with the amino acid sequence shown in SEQ ID NO 18, the site mutation of the L protein includes any one or more of S87P and I487T.

[0286] Furthermore, the recombinant oncolytic virus is obtained by introducing an exogenous gene encoding an antigen into the above-mentioned recombinant oncolytic virus.

[0287] Furthermore, the macromolecular antibody anticancer drug is selected from any one or more of the following: Trastuzumab, Necitumumab, Pembrolizumab, Atezolizumab, Sacituzumab govitecan, Belantamab Mafodotin, Ramucirumab, Elotuzumab, Blinatumomab, loncastuximab tesirine, and Polatuzumab vedotin.

[0288] Furthermore, large molecule antibody anticancer drugs include monoclonal antibody drugs, polyclonal antibody drugs and antibody-drug conjugates targeting specific targets.

[0289] Furthermore, the recombinant oncolytic virus also includes an antigen encoded by an exogenous gene.

[0290] Furthermore, the antigen is selected from any one or more of the following: HER2, EGFR, 5T4, B7-H3, TROP2, BCMA, VEGFR-2, SLAMF7, CD19, CD79b, CPC3, and Claudin 18.2.

[0291] Furthermore, the recombinant oncolytic virus also includes cytokines encoded by exogenous genes.

[0292] Furthermore, the cytokine is selected from any one or more of the following: IL-12, IL-18.

[0293] In the present application, the recombinant oncolytic virus described in the present application can be obtained through a virus packaging process and a virus rescue process. The specific process can include inoculating BSR-T7 cells with a poxvirus vTF7-3 expressing T7 RNA polymerase, and performing lipofectamine transfection using expression plasmids and backbone plasmids cloned with VSV N, VSV P, and VSV L genes, respectively, to obtain the target oncolytic virus.

[0294] The present application provides a composition comprising the above-mentioned recombinant oncolytic virus and a macromolecular antibody anticancer drug.

[0295] In certain embodiments, the composition may include one or more (pharmaceutically effective) adjuvants, stabilizers, excipients, diluents, solubilizers, surfactants, emulsifiers and / or preservatives. The acceptable ingredients of the composition are preferably non-toxic to the recipient at the dosage and concentration used. The composition of the present application includes but is not limited to liquid, frozen and lyophilized compositions.

[0296] In certain embodiments, the pharmaceutically acceptable carrier can include any and all solvents, dispersion media, coatings, isotonic agents, and absorption delaying agents that are compatible with pharmaceutical administration and are generally safe and non-toxic.

[0297] In certain embodiments, the composition can include parenteral, subcutaneous, intracavitary, intra-arterial, intravenous, intrathecal and / or intranasal administration or direct injection into tissue.For example, the composition can be administered to a patient or subject by infusion or injection. In certain embodiments, the administration of the composition can be carried out in different ways, such as intravenous, intraperitoneal, subcutaneous, intramuscular, intradermal or intra-tissue administration. In certain embodiments, the composition can be administered uninterruptedly. The uninterrupted (or continuous) administration can be achieved by a small pump system worn by the patient, to measure the therapeutic agent flowing into the patient, as described in WO2015 / 036583.

[0298] The present application also provides use of the above composition in preparing a medicament for preventing and / or treating a disease and / or condition.

[0299] The present application is further described in detail below with reference to the preparation examples and examples.

[0300] Preparation Example

[0301] Preparation Example 1-10

[0302] Preparation Examples 1-10 respectively provide a method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug.

[0303] This method uses a combination of recombinant oncolytic viruses and large molecule antibody anticancer drugs to treat tumors.

[0304] The recombinant oncolytic virus includes M protein, G protein, N protein, P protein and L protein. Among them, M protein, G protein, N protein, P protein and L protein are all obtained by point mutation based on the wild-type VSV virus Indiana Mudd Summer subtype.

[0305] The differences between the preparation examples are: the mutation sites of the M protein are different. The mutation sites of the M protein are as shown in the amino acid sequences of SEQ ID NO 2 to SEQ ID NO 11, respectively. The G protein comprises the amino acid sequence shown in SEQ ID NO 13, the N protein comprises the amino acid sequence shown in SEQ ID NO 15, the P protein comprises the amino acid sequence shown in SEQ ID NO 17, and the L protein comprises the amino acid sequence shown in SEQ ID NO 19.

[0306] The mutation sites of each protein and the types of macromolecular antibody anticancer drugs are shown in Table 1 .

[0307] The construction methods of the recombinant oncolytic viruses provided in the above preparation examples are as follows:

[0308] (1) Construction of vector

[0309] Using the pRV-core plasmid (BioVector NTCC Plasmid Vector Culture Cell Gene Collection Center) as a template, PCR technology was used to introduce the M protein mutation site, G protein mutation site, N protein mutation site, P protein mutation site, and L protein mutation site shown in Table 1.

[0310] Gene fragments containing the above-mentioned protein mutation sites, each containing XbaI and MluI restriction sites, were synthesized and used as templates for PCR amplification. The PCR products were then subjected to 1% agarose gel electrophoresis, double-digested with XbaI and MluI, and recovered using a gel recovery kit to obtain gene fragments containing the M protein mutation site, the G protein mutation site, the N protein mutation site, the P protein mutation site, and the L protein mutation site, respectively. The RV-core plasmid was double-digested with XbaI and MluI, and recovered using a gel recovery kit to obtain the pRV-core restriction-digested backbone fragment.

[0311] The above-mentioned gene fragments with M protein mutation sites, G protein mutation sites, N protein mutation sites, P protein mutation sites, and L protein mutation sites were respectively connected with the backbone fragments recovered by enzyme digestion of pRV-core and transformed into plates. Single clones were selected for PCR verification to obtain the constructed plasmid pRV-core Mut, which was sent to a sequencing company for sequencing.

[0312] Table 1 Recombinant oncolytic viruses and macromolecular antibody anticancer drugs in preparation examples 1-10

[0313] (2) Virus rescue

[0314] The constructed plasmid pRV-core Mut was transfected into BSR-T7 cells (purchased from ATCC, American Type Culture Collection, also known as the American Type Culture Collection) by cell transfection technology using a calcium phosphate transfection kit (Thermo Fisher Scientific).

[0315] The four plasmids pRV-core Mut, pP, pN, and pL were mixed in a mass ratio of 10:5:4:1, resulting in a total of 5 μg of plasmid. The plasmids were diluted in 200 μl of opti-MEM medium (Thermo Fisher Scientific), and 7.5 μl of Transfection Reagent Plus Reagent (Life Technologies) were added to obtain a transfection plasmid premix. Among them, pP (a plasmid carrying the baculovirus phosphoprotein gene), pN (a plasmid carrying the baculovirus nucleoprotein gene), and pL (a plasmid carrying the baculovirus polymerase protein gene) were all derived from the pCAGGS vector (purchased from ATCC).

[0316] 10 μl of lipofectamine LTX (Thermo Fisher Scientific) was diluted with 200 μl of opti-MEM medium to obtain an LTX mixture;

[0317] Plasmid transfection was performed according to the instructions of lipofectamine LTX. After 6 h, BSR-T7 cells were washed twice with PBS and further inoculated in DMEM medium containing 10% fetal bovine serum (Thermo Fisher Scientific) and cultured for 3 days;

[0318] The cell supernatant obtained from culturing BSR-T7 cells was transferred to Vero cells (Thermo Fisher Scientific), and the Vero cells were cultured at 37°C for 3 days. The green fluorescence in the cells was observed under a fluorescence microscope to determine the virus rescue. The rescued mutant rod-shaped virus library was further passaged through Vero cells, and monoclonal virus strains were selected using an established plaque screening system.

[0319] (3) Gene sequencing. Viral genomic RNA was extracted using a Trizol kit, and reverse transcription was performed using random primers. PCR was performed on the reverse-transcribed cDNA using primers designed for the M protein gene sequence, primers designed for the G protein gene sequence, primers designed for the N protein gene sequence, primers designed for the P protein gene sequence, primers designed for the L protein gene sequence, and primers designed for the antigen-encoding gene sequence;

[0320] The primer sequences designed for the M protein gene sequence are:

[0321] PF:ATGAGTTCCTTAAAGAA;

[0322] PR:TCATTTGAAGTGG.

[0323] The primer sequences designed for the G protein gene sequence are:

[0324] PF:ATGAAGTGCCTTTTGTACTTAG;

[0325] PR:TTACTTTCCAAGTCGGTTCATCT.

[0326] The primer sequences designed for the N protein gene sequence are:

[0327] PF:ATGTCTGTTACAGTCAAGAG;

[0328] PR:TCATTTGTCAAATTCTGACTT.

[0329] The primer sequences designed for the P protein gene sequence are:

[0330] PF:ATGGATAATCTCACAAAAGTTCG;

[0331] PR:CTACAGAGAATATTTGACTCTCG.

[0332] The primer sequences designed for the L protein gene sequence are:

[0333] PF:ATGGAAGTCCACGATTTTGAGA;

[0334] PR:TTAATCTCTCCAAGAGTTTTCCT.

[0335] The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 1.

[0336] Preparation Examples 11-23

[0337] Preparation Examples 11-23 respectively provide a method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug.

[0338] This method uses a combination of recombinant oncolytic viruses and large molecule antibody anticancer drugs to treat tumors.

[0339] The recombinant oncolytic virus comprises M protein, G protein, N protein, P protein, L protein and antigen. The mutation sites of M protein, G protein, N protein, P protein and L protein are the same as the corresponding mutation sites in Preparation Example 10.

[0340] The differences lie in the types of antigens and the types of macromolecular antibody anticancer drugs. The mutation sites, antigen types, and macromolecular antibody anticancer drug types of each protein are shown in Table 2.

[0341] The construction method of the recombinant oncolytic virus provided in the above preparation example is the same as the construction method of Preparation Example 10. The specific differences in the construction method are:

[0342] Between step (1) constructing the vector and step (2) rescuing the virus, the following steps are also included: inserting the exogenous gene encoding the antigen. Specifically, the plasmid pRV-core Mut obtained in step (1) is treated with Xho I and Mlu I for double enzyme digestion to recover the long fragment. The exogenous gene encoding the antigen is synthesized by a gene synthesis company and amplified with corresponding primers, and double enzyme digestion is performed with Xho I and Nhe I to recover the target gene fragment. The pRV-core Mut treated with double enzyme digestion and the exogenous gene fragment are connected and transformed, and a single clone is selected. After PCR or enzyme digestion identification, it is sent to a sequencing company for sequencing to obtain the plasmid pRV-core Mut carrying the exogenous gene. In step (2) virus rescue, the plasmid pRV-core Mut carrying the exogenous gene is used to transfect BSR-T7 cells.

[0343] Step (3) involves sequencing each type of antigen. Viral genomic RNA is extracted using a Trizol kit, reverse transcribed using random primers, and the reverse transcribed cDNA is subjected to PCR using primers designed for the antigen-encoding gene sequence.

[0344] The primer sequences designed for the antigen gene sequence are:

[0345] 1)HER2 F:ATGGAGCTGGCGGCCTTGTGCC;

[0346] HER2 R:TTAGATGAGGATCCCAAAGACCA。

[0347] 2)EGFR F:ACGCTCGAGATGCGACCCTCCGGGACGG;

[0348] EGFR R:TCTGGCTAGCTTACATGAAGAGGCCGAT。

[0349] 3) 5T4 F:ATGTCTTCTCCCACCTCCTCCG;

[0350] 5T4 R:TCACAAATACAAAACCAGGAG。

[0351] 4)B7-H3 F:ATGCTGCGTCGGCGGGGCAGC;

[0352] B7-H3 R:CACGAAAGCCAGGGCCACCAG。

[0353] 5)TROP2 F:ATGGCTCGGGGCCCCGGCCTC;

[0354] TROP2 R:CTACAAGCTCGGTTCCTTTCT。

[0355] 6) BCMA F:ATGTTGCAGATGGCTGGGCAG;

[0356] BCMA R:TTACCTAGCAGAAATTGATTT。

[0357] 7)VEGFR-2F:AGGCGCTGGGAGAAAGAACCG;

[0358] VEGFR-2R:TTAATGCGGCTACTTCCTGCT。

[0359] 8) SLAMF7 F:ATGGCTGGTTCCCCAACATGC;

[0360] SLAMF7 R:TCATAGGCAAATAGCCTTGGT。

[0361] 9)CD19(SEQ ID NO 28)F:ACGCTCGAGATGCCACCTCCTCGCCTCC;

[0362] CD19(SEQ ID NO 28)R:TCTGGCTAGCTCATCTTTTCCTCCTCAGG。

[0363] 10)CD19(SEQ ID NO 29)F:ATGCCCGAGGAACCCTAGTG;

[0364] CD19(SEQ ID NO 29)R:TTAAAGATGAAGAATGCCCAC。

[0365] 11)CD79b F:ATGGCCAGGCTGGCGTTGTCT;

[0366] CD79b R:TCACTCCTGGCCTGGGTGCTC。

[0367] 12)GPC3 F:ATGGCCGGGACCGTGCGCACC;

[0368] GPC3 R:TCAGTGCACCAGGAAGAAGAA。

[0369] 13)Claudin 18.2F:ACGCTCGAGATGGACCAGTGGAGCACCC;

[0370] Claudin 18.2R:TCTGGCTAGCTTAGGCGATGCACATCATC。

[0371] 14)VEGF F:ATGACGGACAGACAGACAGAC;

[0372] VEGF R:TCACCGCCTCCGGCTTGTCACA。

[0373] 15)HER3 F:ATGAGGGCGAACGACGCTCTG;

[0374] HER3 R:GAGAAAGTGCCGCCCAGCAT。

[0375] 16)NY-ESO-1F:ATGCAGGCAGAAGGAAGAGGC;

[0376] NY-ESO-1R:TCATCTTCTCTGTCCGCTAGG。

[0377] 17)MSLN F:ACGCTCGAGATGGAAGTGGAGAAGACAG;

[0378] MSLN R:TCTGGCTAGCTCAGGCCAGGGTGGAGGCT.

[0379] 18) CD30 F: ATGCGCGTCCTCTCGCCGCG;

[0380] CD30 R: TCACTTTCCAGAGGCAGCTGT.

[0381] The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 2.

[0382] Table 2 Recombinant oncolytic viruses and macromolecular antibody anticancer drugs in preparation examples 11-23

[0383] Preparation Examples 24-49

[0384] Preparation Examples 24-49 respectively provide a method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug.

[0385] This method uses a combination of recombinant oncolytic viruses and large molecule antibody anticancer drugs to treat tumors.

[0386] The difference between the above preparation example and preparation example 11 is that the recombinant oncolytic virus includes not only M protein, G protein, N protein, P protein, L protein and antigen, but also cytokines. The mutation sites of M protein, G protein, N protein, P protein and L protein are the same as the corresponding mutation sites in preparation example 10.

[0387] The differences are: the type of cytokine and the type of macromolecular antibody anticancer drug. The mutation site, antigen type, cytokine type, and macromolecular antibody anticancer drug type of each protein are shown in Table 3.

[0388] The construction method of the recombinant oncolytic virus provided in the above preparation example is the same as the construction method of Preparation Example 10. The specific differences in the construction method are:

[0389] Between step (1) constructing the vector and step (2) rescuing the virus, the following steps are also included: inserting an exogenous gene encoding a cytokine, with specific reference to the step of inserting an exogenous gene encoding an antigen. The antigen and cytokine are inserted between the G protein and the L protein. The order of insertion of the two can be to insert the cytokine first and then the antigen; or to insert the antigen first and then the cytokine. In this application, the cytokine is inserted first and then the antigen.

[0390] Step (3) also includes sequencing of cytokines. Viral genomic RNA is extracted using a Trizol kit, reverse transcribed using random primers, and the reverse transcribed cDNA is subjected to PCR using primers designed for the cytokine gene sequence.

[0391] The primer sequences designed for the cytokine gene sequences are:

[0392] IL2(mut4)F:ATGGCCCCACAAGCTC,

[0393] IL2(mut4)R:TTAGGTCAGTGTGCTG.

[0394] IL2(mut2)F:ATGGCCCCACAAGCTC,

[0395] IL2(mut2)R:TTAGCCGGTACAAATCAG.

[0396] IL12 F:CCCTCGAGATGTGGCCCCCTGGGT,

[0397] IL12 R: CGGCTAGCTTAACTGCAGGGCACAGATG.

[0398] GMCSF F: ATGTGGCTGCAGAGCCTGCTG;

[0399] GMCSFR:TCACTCCTGGACTGGCTCCCA.

[0400] The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 3.

[0401] Table 3 Recombinant oncolytic viruses and macromolecular antibody anticancer drugs in Preparation Examples 24-49

[0402] Preparation Examples 50-82

[0403] Preparation Examples 50-82 respectively provide a method for treating tumors using a recombinant oncolytic virus.

[0404] The recombinant oncolytic viruses in the above preparation examples are the recombinant oncolytic viruses in Preparation Examples 10, 11-23, and 24-36, respectively. The details are shown in Table 4. The difference is that the recombinant oncolytic viruses express different types of antigens (for example, Preparation Examples 51-66, Preparation Examples 67-82) or the recombinant oncolytic viruses do not express antigens (for example, Preparation Example 50).

[0405] Table 4 Recombinant oncolytic viruses in preparation examples 50-82

[0406] Preparation Examples 83-95

[0407] Preparation Examples 83-95 respectively provide a method for treating tumors using macromolecular antibody anticancer drugs.

[0408] The macromolecular antibody anticancer drugs in the above preparation examples are the macromolecular antibody anticancer drugs in Preparation Examples 11 to 23, as shown in Table 5. The difference is that the macromolecular antibody anticancer drugs are of different types.

[0409] Table 5 Macromolecular Anti-cancer Antibodies in Preparation Examples 83-95

[0410] Example

[0411] This example uses the recombinant oncolytic virus and / or macromolecular antibody anticancer drug provided in Preparation Examples 1-95 to conduct animal experiments on the method of treating tumors.

[0412] Prepare Balb / c mice and inoculate them with mouse colon cancer cell line MC38 at a concentration of 1×10^6 / 0.1mL / mouse. When the average tumor size of the mice reaches 50mm 3 The mice were weighed three times a week and observed once a day. The weight (g) and tumor volume (mm) of the mice were recorded during the experiment. 3 ) changes.

[0413] Euthanize mice if: 1. Tumor volume reaches 2000 mm 3 ; 2. The weight of the mice decreases by more than 20%; 3. There is ulceration on the surface of the tumor; 4. The mice become paralyzed, etc.

[0414] The wild-type and recombinant oncolytic viruses were administered via intratumoral (IT) and / or intravenous (IV) injections, with a dose of 3e8 PFU / mouse. The IT administration volume was 2.5 ml / kg. The IV administration volume was 5 ml / kg, and the frequency of administration was every 2 days for 7 consecutive times (Q2D*7).

[0415] The administration method of the macromolecular antibody anticancer drug is intraperitoneal administration (PO), the dosage is related to the type of macromolecular antibody anticancer drug, the administration volume is 10 ml / kg, and the administration frequency is BIW administration (once on days 0, 3, 7, and 10, for a total of 4 administrations).

[0416] The vehicle control (blank control) used (10% DMSO + 40% PEG300 + 5% Tween-80 + 45% saline) instead of a large molecule antibody anticancer drug, the administration method was intraperitoneal administration (PO), the dosage was N / A, the administration volume was 10 ml / kg, and the administration frequency was BIW (once on days 0, 3, 7, and 10, for a total of 4 doses).

[0417] 1. Animal trials of the macromolecular antibody anticancer drug Trastuzumab

[0418] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or macromolecular antibody anticancer drugs provided in Preparation Examples 1-10, 11, 24, 37, 51, 67, 50, and 83. The specific details of the experiments are shown in Table 6.

[0419] The test results are shown in Figure 1.

[0420] Table 6 Animal studies of the macromolecular antibody anticancer drug Trastuzumab

[0421] 2. Animal trials of the macromolecular antibody anticancer drug Necitumumab

[0422] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or macromolecular antibody anticancer drugs provided in Preparation Examples 12, 25, 38, 52, 68, 50, and 84, respectively. The specific details of the experiments are shown in Table 7.

[0423] The test results are shown in Figure 2.

[0424] Table 7 Animal studies of the macromolecular antibody anticancer drug Necitumumab

[0425] III. Animal Testing of the Macromolecular Anticancer Anti-5T4 Antibody

[0426] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or macromolecular antibody anticancer drugs provided in Preparation Examples 13, 26, 39, 53, 69, 50, and 85, respectively. The specific details of the experiments are shown in Table 8.

[0427] The test results are shown in Figure 3.

[0428] Table 8 Animal testing of the macromolecular antibody anticancer drug Anti-5T4 antibody

[0429] IV. Animal Testing of the Macromolecular Anticancer Anti-CD276 Antibody

[0430] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or macromolecular antibody anticancer drugs provided in Preparation Examples 14, 27, 40, 54, 70, 50, and 86. The specific details of the experiments are shown in Table 9.

[0431] The test results are shown in Figure 4.

[0432] Table 9 Animal testing of the macromolecular antibody anticancer drug Anti-CD276 antibody

[0433] 5. Animal trials of the macromolecular antibody anticancer drug Sacituzumab govitecan

[0434] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or macromolecular antibody anticancer drugs provided in Preparation Examples 15, 28, 41, 55, 71, 50, and 87. The specific details of the experiments are shown in Table 10.

[0435] The test results are shown in Figure 5.

[0436] Table 10 Animal studies of the macromolecular antibody anticancer drug Sacituzumab govitecan

[0437] VI. Animal Trials on the Macromolecular Anticancer Drug Belantamab Mafodotin

[0438] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or macromolecular antibody anticancer drugs provided in Preparation Examples 16, 29, 42, 56, 72, 50, and 88. The specific details of the experiments are shown in Table 11.

[0439] The test results are shown in Figure 6.

[0440] Table 11 Animal studies of the macromolecular antibody anticancer drug Belantamab Mafodotin

[0441] VII. Animal Trials on the Macromolecular Anticancer Drug Ramucirumab

[0442] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or macromolecular antibody anticancer drugs provided in Preparation Examples 17, 30, 43, 57, 73, 50, and 89, respectively. The specific details of the experiments are shown in Table 12.

[0443] The test results are shown in Figure 7.

[0444] Table 12 Animal studies of the macromolecular antibody anticancer drug Ramucirumab

[0445] 8. Animal Trials on the Macromolecular Anticancer Drug Elotuzumab

[0446] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or macromolecular antibody anticancer drugs provided in Preparation Examples 18, 31, 44, 58, 74, 50, and 90, respectively. The specific details of the experiments are shown in Table 13.

[0447] The test results are shown in Figure 8.

[0448] Table 13 Animal trials of the macromolecular antibody anticancer drug Elotuzumab

[0449] IX. Animal trials of the macromolecular antibody anticancer drug Blinatumomab

[0450] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or macromolecular antibody anticancer drugs provided in Preparation Examples 19, 32, 45, 59, 75, 50, and 91. The specific details of the experiments are shown in Table 14.

[0451] The test results are shown in Figure 9.

[0452] Table 14 Animal trials of the macromolecular antibody anticancer drug Blinatumomab

[0453] 10. Animal trials of the macromolecular antibody anticancer drug Loncastuximab tesirine

[0454] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or macromolecular antibody anticancer drugs provided in Preparation Examples 20, 33, 46, 60, 76, 50, and 92. The specific details of the experiments are shown in Table 15.

[0455] The test results are shown in Figure 10.

[0456] Table 15 Animal studies of the macromolecular antibody anticancer drug Loncastuximab tesirine

[0457] 11. Animal Trials of the Macromolecular Anticancer Drug Polatuzumab vedotin

[0458] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or macromolecular antibody anticancer drugs provided in Preparation Examples 21, 34, 47, 61, 77, 50, and 93. The specific results of the experiments are shown in Table 16.

[0459] The test results are shown in Figure 11.

[0460] Table 16 Animal studies of the macromolecular antibody anticancer drug Polatuzumab vedotin

[0461] 12. Animal testing of the macromolecular antibody anticancer drug Anti-Glypican 3 antibody

[0462] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or macromolecular antibody anticancer drugs provided in Preparation Examples 22, 35, 48, 62-64, 78-80, 50, and 94, respectively. The specific details of the experiments are shown in Table 17.

[0463] The test results are shown in Figure 12.

[0464] Table 17 Animal testing of macromolecular antibody anticancer drug Anti-Glypican 3 antibody

[0465] 13. Animal trials of the macromolecular anticancer drug Anti-Claudin18.2 antibody

[0466] Animal experiments were conducted using the methods for treating tumors using the recombinant oncolytic viruses and / or macromolecular antibody anticancer drugs provided in Preparation Examples 23, 36, 49, 65-66, 81-82, 50, and 95, respectively. The specific results of the experiments are shown in Table 18.

[0467] The test results are shown in Figure 13.

[0468] Table 18 Animal testing of the macromolecular antibody anticancer drug Anti-Claudin18.2 antibody

[0469] The test results are shown in Figures 1 to 13.

[0470] As can be seen from the above figures, the method for treating tumors using a recombinant oncolytic virus and a macromolecular antibody anticancer drug provided by the present application has a significant inhibitory effect on tumor growth. And the test results of the combined treatment of tumors with recombinant oncolytic viruses directly combined with macromolecular antibody anticancer drugs are better than the test results of treating tumors with recombinant oncolytic viruses alone or using macromolecular antibody anticancer drugs alone; the test results of combining the treatment of tumors with recombinant oncolytic viruses expressing antigens or antigen fragments and then combining macromolecular antibody anticancer drugs targeting the antigens or antigen fragments are better than the test results of combining the treatment of tumors with recombinant oncolytic viruses directly combined with macromolecular antibody anticancer drugs or the test results of directly treating tumors with recombinant oncolytic viruses expressing antigens or antigen fragments. Therefore, the method for treating tumors using a recombinant oncolytic virus and a macromolecular antibody anticancer drug provided by the present application further effectively improves the therapeutic effect on tumor cells.

[0471] At the same time, in the present application, the method for treating tumors by combining recombinant oncolytic viruses and macromolecular antibody anticancer drugs, when the recombinant oncolytic virus has a target paired with a macromolecular antibody anticancer drug, the test results are better than the test results when the recombinant oncolytic virus does not have a target paired with a macromolecular antibody anticancer drug. Furthermore, when the recombinant oncolytic virus has a target paired with a macromolecular antibody anticancer drug and the recombinant oncolytic virus expresses cytokines, the test results are better than the test results when the recombinant oncolytic virus has a target paired with a macromolecular antibody anticancer drug but the recombinant oncolytic virus does not express cytokines.

[0472] The above test results indicate that the combined tumor treatment method using a recombinant oncolytic virus and a macromolecular antibody anticancer drug provided herein has a good inhibitory effect on tumor cell growth. It can be inferred that the combined tumor treatment method using a recombinant oncolytic virus and a macromolecular antibody anticancer drug provided herein also has a good inhibitory effect on other cancer cells and has broad clinical application prospects.

[0473] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make non-creative modifications to the present embodiment as needed, but as long as they are within the scope of the claims of the present application, they are protected by the patent law.

Claims

1. A method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug, characterized in that: Combination therapy of tumors using macromolecular antibody anticancer drugs and recombinant oncolytic viruses; The macromolecular antibody anticancer drugs include macromolecular antibody anticancer drugs targeting HER2, macromolecular antibody anticancer drugs targeting EGFR, macromolecular antibody anticancer drugs targeting PD-1, macromolecular antibody anticancer drugs targeting PD-L1, macromolecular antibody anticancer drugs targeting TROP2, macromolecular antibody anticancer drugs targeting BCMA, macromolecular antibody anticancer drugs targeting VEGFR-2, macromolecular antibody anticancer drugs targeting SLAMF7, macromolecular antibody anticancer drugs targeting CD3, macromolecular antibody anticancer drugs targeting CD19, macromolecular antibody anticancer drugs targeting CD20, macromolecular antibody anticancer drugs targeting CD22, macromolecular antibody anticancer drugs targeting CD30, macromolecular antibody anticancer drugs targeting CD33, macromolecular antibody anticancer drugs targeting CD38, macromolecular antibody anticancer drugs targeting CD52, and macromolecular antibody anticancer drugs targeting CD79. b macromolecular antibody anticancer drugs, macromolecular antibody anticancer drugs targeting Met, macromolecular antibody anticancer drugs targeting GD2, macromolecular antibody anticancer drugs targeting VEGF, macromolecular antibody anticancer drugs targeting PDGFR-α, macromolecular antibody anticancer drugs targeting CTLA-4, macromolecular antibody anticancer drugs targeting RANKL, macromolecular antibody anticancer drugs targeting FRa, macromolecular antibody anticancer drugs targeting TF, macromolecular antibody anticancer drugs targeting IL6, macromolecular antibody anticancer drugs targeting GPRC5D, macromolecular antibody anticancer drugs targeting TNF-α, macromolecular antibody anticancer drugs targeting EPCAM, macromolecular antibody anticancer drugs targeting CD24, macromolecular antibody anticancer drugs targeting 5T4, macromolecular antibody anticancer drugs targeting B7-H3, macromolecular antibody anticancer drugs targeting GPC3, macromolecular antibody anticancer drugs targeting Claudin 18.2; The recombinant oncolytic virus includes M protein, G protein, N protein, P protein, and L protein; Compared with the amino acid sequence shown in SEQ ID NO 1, The site mutation of the M protein includes any one or more of M51R, V221F, and S226R; Or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, deletion of the leucine encoding base at position 111, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, L111A, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of G21E, N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of G21E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; Compared with the amino acid sequence shown in SEQ ID NO 12, the site mutations of the G protein include any one or more of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; Compared with the amino acid sequence shown in SEQ ID NO 14, the site mutation of the N protein includes any one or more of I14V, R155K, and S353N; Compared with the amino acid sequence shown in SEQ ID NO 16, the site mutation of the P protein includes any one or more of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D; Compared with the amino acid sequence shown in SEQ ID NO 18, the site mutation of the L protein includes any one or more of S87P and I487T.

2. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 1, characterized in that: The recombinant oncolytic virus includes any one or more of rhabdovirus, poxvirus, herpes simplex virus, measles virus, Semliki Forest virus, poliovirus, reovirus, Seneca Valley virus, echovirus, coxsackievirus, Newcastle disease virus and Maraba virus.

3. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 2, characterized in that: The rhabdovirus includes vesicular stomatitis virus.

4. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 1, characterized in that: The M protein comprises an amino acid sequence as shown in any one of SEQ ID NOs 4-11; The G protein comprises the amino acid sequence shown in SEQ ID NO 13; The N protein comprises the amino acid sequence shown in SEQ ID NO 15; The P protein comprises the amino acid sequence shown in SEQ ID NO 17; The L protein comprises the amino acid sequence shown in SEQ ID NO 19.

5. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 1, characterized in that: The injection method of the recombinant oncolytic virus or the macromolecular antibody anticancer drug includes any one or more of intratumor injection, intravenous injection, intraperitoneal injection, thoracic injection, pelvic injection, subcutaneous injection, intrathecal injection, intramuscular injection, and intranasal administration.

6. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 1, characterized in that: The recombinant oncolytic virus also includes an antigen encoded by an exogenous gene.

7. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 1, characterized in that: The antigen is selected from the group consisting of a hematological tumor antigen and a solid tumor antigen.

8. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 7, characterized in that: The solid tumor antigens include 5T4, ROR1, EGFR, FcγRI, FcγRIIa, FcγRIIb, CD24, CD28, CD137, CTLA-4, HER2, HER3, FAS, FAP, LGR5, C5aR1, A2AR, FGFR1, FGFR2, FGFR3, FGFR4, glucocorticoid-induced TNFR-related protein, LTβR, TRAIL receptor 1, TRAIL receptor 2, prostate-specific membrane antigen protein (PSMA), prostate stem cell antigen protein, tumor-associated protein carbonic anhydrase IX, EGFR1, EGFRvIII, ErbB3, folate receptor, ephrin receptor, PDGF Ra, ErbB-2, CD2, CD40, CD74, CD80, CD86, CCAM5, CCAM6, p53, MET, HGFR, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, BACE, D AM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, Tyrosinase, TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iCE, MUC2, P-cadherin, myostatin, Cripto, MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, annexin II, CDC27 / m, TPI / mbcr-abl, ETV6 / AML, LDLR / FUT, Pml / RARα, TEL / AML1, CD28, CD137, CanAg, Mesothelin (MSLN), DR5, PD-1, PD-L1, IGF-1R, CXCR4, neuropilin 1, phosphatidylinositol proteoglycans, EphA2, B7-H3, B7-H4, gpA33, GPC3, SSTR2, GD2, VEGF-A, VEGFR-2, PDGFR-a, ANKL, RANKL, MSLN, EBV, TROP2, FOLR1, AXL, Claudin 18.2、MUC1、TPBG、CEA、EpCAM、Nectin-4、KARS、CD39、CD73、TIGIT、CD47、DLL3、Claudin 18.1;. The blood tumor antigens include BCMA, CD4, CD5, CD7, CD10, FcγRIIIa, FcγRIIIb, CD19, CD20, CD22, CD23, CD30, CD33, CD34, CD37, CD38, CD44, CD47, CD56, CD70, CD117, CD123, CD138, CD174, CLL-1, ROR1, NKG2DL1 / 2, IL1R3, FCRL5, GPRC5D, CLEC12A, WT1, FLT3, TLR8, SHP2, KAT6A / B, CSNK1A1, FLI1, IKZF1 / 3, PI3K, c-Kit, SLAMF3, SLAMF7, TCR B-chain, ITGB7, k-1gG, TACI, TRBCI, LeY, CD79b.

9. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 6, characterized in that: The antigen expressed by the recombinant oncolytic virus is at least one or more antigens, and the antigen is the entire sequence or a partial sequence of the antigen.

10. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 1, characterized in that: The amino acid sequence of the antigen expressed by the recombinant oncolytic virus is any one or more of the following: The antigen HER2 comprises the amino acid sequence shown in SEQ ID NO 20; The antigen EGFR comprises the amino acid sequence shown in SEQ ID NO 21; The antigen 5T4 (TPBG) comprises the amino acid sequence shown in SEQ ID NO 22; The antigen B7-H3 comprises the amino acid sequence shown in SEQ ID NO 23; The antigen TROP2 comprises the amino acid sequence shown in SEQ ID NO 24; The antigen BCMA comprises the amino acid sequence shown in SEQ ID NO 25; The antigen VEGFR-2 comprises the amino acid sequence shown in SEQ ID NO 26; The antigen SLAMF7 comprises the amino acid sequence shown in SEQ ID NO 27; The antigen CD19 comprises the amino acid sequence shown in SEQ ID NO 28; The antigen CD19 comprises the amino acid sequence shown in SEQ ID NO 29; The antigen CD79b comprises the amino acid sequence shown in SEQ ID NO 30; The antigen GPC3 comprises the amino acid sequence shown in SEQ ID NO 31; The antigen GPC3 comprises the amino acid sequence shown in SEQ ID NO 32; The antigen GPC3 comprises the amino acid sequence shown in SEQ ID NO 33; The antigen Claudin 18.2 comprises the amino acid sequence shown in SEQ ID NO 34; The antigen Claudin 18.2 comprises the amino acid sequence shown in SEQ ID NO 35; The antigen VEGF comprises the amino acid sequence shown in SEQ ID NO 36; The antigen HER3 comprises the amino acid sequence shown in SEQ ID NO 37; The antigen NY-ESO-1 comprises the amino acid sequence shown in SEQ ID NO 38; The antigen MLSN comprises the amino acid sequence shown in SEQ ID NO 39; The antigen CD30 comprises the amino acid sequence shown in SEQ ID NO 40; The antigen MUC1 comprises the amino acid sequence shown in SEQ ID NO 41; The antigen MAGE A4 comprises the amino acid sequence shown in SEQ ID NO 42; The antigen MAGE A4 comprises the amino acid sequence shown in SEQ ID NO 43; The antigen Met comprises the amino acid sequence shown in SEQ ID NO 44; The antigen CD22 comprises the amino acid sequence shown in SEQ ID NO 45.

11. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 1, characterized in that: The macromolecular antibody anticancer drug includes: Large molecule antibody anticancer drugs targeting HER2, including Trastuzumab, Pertuzumab, Ado-trastuzumab emtansine, Disitamab, Margetuximab, Inetetamab, Fam-trastuzumab deruxtecan-nxki, Trastuzumab deruxtecan, Disitamab vedotin; Large molecule antibody anticancer drugs targeting EGFR, including Cetuximab, Panitumumab, Necitumumab, Nimotuzumab, Amivantamab, Getuximab Saratolacan; Large molecule antibody anticancer drugs targeting PD-1, including Nivolumab, Pembrolizumab, Tislelizumab, Sintilimab, Cemiplimab, Toripalimab, Camrelizumab, Dostarlimab, Penpulimab, Zimberelimab, Cadonilimab; Large molecule antibody anticancer drugs targeting PD-L1, including Atezolizumab, Durvalumab, Avelumab, Sugemalimab; Macromolecular antibody anticancer drugs targeting TROP2, including Sacituzumab govitecan; Large molecule antibody anticancer drugs targeting BCMA, including Belantamab Mafodotin, Elranatamab, and Teclistamab; Large molecule antibody anticancer drugs targeting VEGFR-2, including Ramucirumab; Large molecule antibody anticancer drugs targeting SLAMF7, including Elotuzumab; Large molecule antibody anticancer drugs targeting CD3, including Blinatumomab, Epcoritamab, Glofitamab, and Mosunetuzumab; Large molecule antibody anticancer drugs targeting CD19, including Blinatumomab and loncastuximab tesirine; Large molecule antibody anticancer drugs targeting CD20, including Rituximab, Obinutuzumab, Tosituomab, Ofatumumab, Ibritumomab, and Ibritumomab tiuxetan; Large molecule antibody anticancer drugs targeting CD22, including Inotuzumab Ozogamicin and Moxetumomab Pasudotox; Large molecule antibody anticancer drugs targeting CD30, including Brentuximab; Large molecule antibody anticancer drugs targeting CD33, including Gemtuzumab and Gemtuzumab ozogamicin; Large molecule antibody anticancer drugs targeting CD38, including Daratumumab; Large molecule antibody anticancer drugs targeting CD52, including Alemtuzumab; Large molecule antibody anticancer drugs targeting CD79b, including Polatuzumab vedotin; Large molecule antibody anticancer drugs targeting Met, including Amivantamab; Large molecule antibody anticancer drugs targeting GD2, including Dinutuximab; Large molecule antibody anticancer drugs targeting VEGF, including Bevacizumab and Byvasda; Large molecule antibody anticancer drugs targeting PDGFR-α, including Olaratumab; Large molecule antibody anticancer drugs targeting CTLA-4, including Lpilimumab; Large molecule antibody anticancer drugs targeting RANKL, including Denosumab; Macromolecular antibody anticancer drugs targeting FRa, including Mirvetuximab and Mirvetuximab Soravtansine; Macromolecular antibody anticancer drugs targeting TF, including Tisotumab vedotin; Large molecule antibody anticancer drugs targeting IL6, including Siltuximab; Large molecule antibody anticancer drugs targeting GPRC5D, including Talquetamab; Large molecule antibody anticancer drugs targeting TNF-α, including Ozoralizumab; Macromolecular antibody anticancer drugs targeting EPCAM, including Catumaxomab; Large molecule antibody anticancer drugs targeting 5T4, including Anti-5T4 antibody [EPR5529] (ab134162), GEN-1044, ALG.APV-527, SYD-1875, ASN-004, CBA-1535, and DM004; Large molecule antibody anticancer drugs targeting B7-H3, including Anti-CD276 antibody [EPNCIR122] (ab134161), Omburtamab, Enoblituzumab, Omburtamab, MGC018, Obrindatamab, Mirzotamab clezutoclax, TAK 280, YBL 018, ATG 027, MIL108, ITC 6146RO, GTB 5550, Hu8H9, SHR-1812, XmAb808, BAT 8009, HS-20093; Macromolecular antibody anticancer drugs targeting GPC3, including Anti-Glypican 3antibody [SP86] (ab95363), ECT-204, Anti-CD3 / MUC1-armed-cytokine induced killer cells, Codrituzumab, GPC-3298306, ERY-974, MDX-1414, B010-A, HLX-63, and LQ-102; Large molecule antibody anticancer drugs targeting Claudin 18.2, including Anti-Claudin18.2 antibody [EPR19202] (ab222512), Zolbetuximab, Q-1802, LM-102, TJ-CD48, Recombinant humanized anti-Claudin 18.2 monoclonal antibody, HBM-1029, HLX-58, and SOT-102.

12. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 1, characterized in that: The macromolecular antibody anticancer drug is selected from any one or more of the following: Trastuzumab, Necitumumab, Pembrolizumab, Atezolizumab, Sacituzumab govitecan, Belantamab Mafodotin, Ramucirumab, Elotuzumab, Blinatumomab, loncastuximab tesirine, Polatuzumab vedotin, Anti-5T4 antibody [EPR5529] (ab134162), Anti-CD276 antibody [EPNCIR122] (ab134161), Anti-Glypican 3 antibody [SP86] (ab95363), Anti-Claudin18.2 antibody [EPR19202] (ab222512).

13. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 1, characterized in that: The macromolecular antibody anticancer drugs include monoclonal antibody drugs, polyclonal antibody drugs and antibody-coupled drugs targeting specific targets.

14. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 1, characterized in that: The recombinant oncolytic virus also includes cytokines encoded by exogenous genes.

15. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 14, characterized in that: The cytokine is selected from the group consisting of interleukin, interferon, tumor necrosis factor, colony stimulating factor, transforming growth factor β, and chemokine family.

16. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 14, characterized in that: The cytokines are selected from any one or more of the following: GMCSF, G-CSF, M-CSF, IL-1, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-23, IL-27, IFN-α, IFN- β, IFN-γ, IFN-β, TGF-β and TNF-α.

17. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 14, characterized in that: The amino acid sequence of the cytokine is any one or more of the following: The cytokine IL-2 comprises the amino acid sequence shown in SEQ ID NO 46; The cytokine IL-2 comprises the amino acid sequence shown in SEQ ID NO 47; The cytokine IL-12A comprises the amino acid sequence shown in SEQ ID NO 48; The cytokine IL-12B comprises the amino acid sequence shown in SEQ ID NO 49; The cytokine GMCSF comprises the amino acid sequence shown in SEQ ID NO 50; The cytokine IL-2 comprises the amino acid sequence shown in SEQ ID NO 51; The cytokine IL-15 comprises the amino acid sequence shown in SEQ ID NO 52; The cytokine IL-15 comprises the amino acid sequence shown in SEQ ID NO 53; The cytokine IL-18 comprises the amino acid sequence shown in SEQ ID NO 54; The cytokine IL-18 comprises the amino acid sequence shown in SEQ ID NO 55; The cytokine TNF-α comprises the amino acid sequence shown in SEQ ID NO 56; The cytokine INF-β comprises the amino acid sequence shown in SEQ ID NO 57; The cytokine IL-12A comprises the amino acid sequence shown in SEQ ID NO 58; The cytokine IL-12A comprises the amino acid sequence shown in SEQ ID NO 59; The cytokine IL-12A comprises the amino acid sequence shown in SEQ ID NO 60.

18. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 1, characterized in that: The recombinant oncolytic virus comprises a nucleic acid molecule; the nucleic acid molecule comprises a nucleic acid sequence encoding the M protein with a site mutation, a nucleic acid sequence encoding the G protein with a site mutation, a nucleic acid sequence encoding the N protein with a site mutation, a nucleic acid sequence encoding the P protein with a site mutation, and a nucleic acid sequence encoding the L protein with a site mutation.

19. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 18, characterized in that: The nucleic acid molecule further comprises a nucleic acid sequence encoding a cytokine; and / or the nucleic acid molecule further comprises a nucleic acid sequence encoding an antigen.

20. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 19, characterized in that: The nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the G protein with a site mutation and the nucleic acid sequence encoding the L protein with a site mutation; and / or, the nucleic acid sequence encoding the antigen is located between the nucleic acid sequence encoding the G protein with a site mutation and the nucleic acid sequence encoding the L protein with a site mutation.

21. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 1, characterized in that: The method for treating tumors by combining the recombinant oncolytic virus and the macromolecular antibody anticancer drug is used to continuously kill abnormally proliferative cells.

22. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 21, characterized in that: The abnormally proliferative cells are selected from tumor cells or cells related to tumor tissue.

23. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 22, characterized in that: The tumor includes a solid tumor or a hematological tumor.

24. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 22, characterized in that: The tumors include acute lymphoblastic leukemia, acute B-lymphocytic leukemia, chronic non-lymphocytic leukemia, non-Hodgkin's lymphoma, anal cancer, astrocytoma, basal cell carcinoma, bile duct cancer, bladder cancer, breast cancer, breast cancer, cervical cancer, chronic myeloproliferative tumors, colorectal cancer, endometrial cancer, ependymoma, esophageal cancer, diffuse large B-cell lymphoma, sensorineuroblastoma, Ewing's sarcoma, fallopian tube cancer, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, hepatocellular carcinoma, Hypopharyngeal cancer, Kaposi's sarcoma, kidney cancer, Langerhans cell hyperplasia, laryngeal cancer, liver cancer, lung cancer, melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumors, pharyngeal cancer, pituitary tumors, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous neck cancer, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer and vascular tumors.

25. The method for treating tumors by combining a recombinant oncolytic virus and a macromolecular antibody anticancer drug according to claim 22, characterized in that: Using recombinant oncolytic viruses to express tumor antigen targets and combining them with large molecule antibody anticancer drugs targeting the targets to attack and kill tumor cells can achieve or exceed the efficacy of recombinant oncolytic viruses alone or large molecule antibody anticancer drugs alone.

26. A composition, characterized in that The composition comprises the recombinant oncolytic virus according to claim 1 and a macromolecular antibody anticancer drug, wherein the macromolecular antibody anticancer drug comprises a macromolecular antibody anticancer drug targeting HER2, a macromolecular antibody anticancer drug targeting EGFR, a macromolecular antibody anticancer drug targeting PD-1, a macromolecular antibody anticancer drug targeting PD-L1, a macromolecular antibody anticancer drug targeting TROP2, a macromolecular antibody anticancer drug targeting BCMA, a macromolecular antibody anticancer drug targeting VEGFR-2, a macromolecular antibody anticancer drug targeting SLAMF7, a macromolecular antibody anticancer drug targeting CD3, a macromolecular antibody anticancer drug targeting CD19, a macromolecular antibody anticancer drug targeting CD20, a macromolecular antibody anticancer drug targeting CD22, a macromolecular antibody anticancer drug targeting CD30, a macromolecular antibody anticancer drug targeting CD33, a macromolecular antibody anticancer drug targeting CD38, and a macromolecular antibody anticancer drug targeting CD52. macromolecular antibody anticancer drugs targeting CD79b, macromolecular antibody anticancer drugs targeting Met, macromolecular antibody anticancer drugs targeting GD2, macromolecular antibody anticancer drugs targeting VEGF, macromolecular antibody anticancer drugs targeting PDGFR-α, macromolecular antibody anticancer drugs targeting CTLA-4, macromolecular antibody anticancer drugs targeting RANKL, macromolecular antibody anticancer drugs targeting FRa, macromolecular antibody anticancer drugs targeting TF, macromolecular antibody anticancer drugs targeting IL6, macromolecular antibody anticancer drugs targeting GPRC5D, macromolecular antibody anticancer drugs targeting TNF-α, macromolecular antibody anticancer drugs targeting EPCAM, macromolecular antibody anticancer drugs targeting CD24, macromolecular antibody anticancer drugs targeting 5T4, macromolecular antibody anticancer drugs targeting B7-H3, macromolecular antibody anticancer drugs targeting GPC3, macromolecular antibody anticancer drugs targeting Claudin 18.2; The recombinant oncolytic virus includes M protein, G protein, N protein, P protein, and L protein; Compared with the amino acid sequence shown in SEQ ID NO 1, The site mutation of the M protein includes any one or more of M51R, V221F, and S226R; Or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, deletion of the leucine encoding base at position 111, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, L111A, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of G21E, N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of G21E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; Compared with the amino acid sequence shown in SEQ ID NO 12, the site mutations of the G protein include any one or more of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; Compared with the amino acid sequence shown in SEQ ID NO 14, the site mutation of the N protein includes any one or more of I14V, R155K, and S353N; Compared with the amino acid sequence shown in SEQ ID NO 16, the site mutation of the P protein includes any one or more of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D; Compared with the amino acid sequence shown in SEQ ID NO 18, the site mutation of the L protein includes any one or more of S87P and I487T.

Images