Fully canine antibodies and uses thereof

The development of canine antibodies with a Fc region of IgGD and a hinge region of IgGB addresses the need for non-immunogenic antibodies against PD-1, achieving reduced cytotoxicity and improved manufacturing efficiency for treating veterinary diseases.

WO2025113570A1PCT designated stage expired Publication Date: 2025-06-05VETIGENICS LLC +1
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/135314
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-29
Filing Date
2024-11-28
Publication Date
2025-06-05

AI Technical Summary

Technical Problem

There is a need for non-immunogenic canine antibodies, particularly against immune checkpoint molecules like PD-1, that can be used to treat veterinary diseases or conditions in canine subjects, with improved manufacturing yield and reduced antibody-dependent cell-mediated cytotoxicity effect.

Method used

Development of antibodies comprising a Fc region and a hinge region of different canine IgG subclasses, specifically using IgGD as the Fc region and IgGB as the hinge region, to create a canine antibody with reduced immunogenicity and improved manufacturing efficiency.

Benefits of technology

The antibodies achieve reduced antibody-dependent cell-mediated cytotoxicity and improved manufacturing yield, making them effective for treating veterinary diseases while minimizing adverse immune responses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024135314_05062025_PF_FP_ABST
    Figure CN2024135314_05062025_PF_FP_ABST
Patent Text Reader

Abstract

Provided are canine antibodies (e.g., specific for canine programmed death protein 1) having improved yield during manufacturing and reduced antibody-dependent cell-mediated cytotoxicity effect. Also disclosed are nucleic acids encoding the same, methods of treatments, and other methods or uses thereof.
Need to check novelty before this filing date? Find Prior Art

Description

FULLY CANINE ANTIBODIES AND USES THEREOFCROSS-REFERENCE

[0001] This application claims the benefit of International Patent Application No. PCT / CN2023 / 135191, filed November 29, 2023, which application is herein incorporated by reference in its entirety.BACKGROUND

[0002] There is a need in the art for the development of non-immunogenic canine antibodies (e.g., canine antibodies against immune checkpoint molecules such as PD-1) that can be used to treat veterinary diseases or conditions (e.g., cancers) in canine subjects. Particularly, there is a need in the art for the development of non-immunogenic canine antibodies having improved yield during manufacturing and reduced antibody-dependent cell-mediated cytotoxicity effect.SUMMARY

[0003] In one aspect, disclosed herein is an antibody comprising a Fc region of canine IgG subclass IgGA, IgGB, IgGC, or IgGD, and a hinge region of canine IgG subclass IgGA, IgGB, IgGC, or IgGD, wherein the Fc region and the hinge region are of different canine IgG subclasses. In some embodiments, the Fc region is of canine IgG subclass IgGD. In some embodiments, the hinge region is of canine IgG subclass IgGB.

[0004] In one aspect, disclosed herein is an isolated nucleic acid encoding an antibody disclosed herein.

[0005] In one aspect, disclosed herein is a vector comprising an isolated nucleic acid the antibody disclosed herein.

[0006] In one aspect, disclosed herein is a host cell comprising an isolated nucleic acid disclosed herein.

[0007] In one aspect, disclosed herein is a pharmaceutical composition comprising an antibody disclosed herein, and a pharmaceutically acceptable excipient, carrier, or diluent.

[0008] In one aspect, disclosed herein is a kit comprising an antibody disclosed herein, or a pharmaceutical composition disclosed herein, and an instruction for use.

[0009] In one aspect, disclosed herein is a method for treating a disease or condition in a subject in need thereof, comprising administering to the subject an antibody disclosed herein, or a pharmaceutical composition disclosed herein.

[0010] In one aspect, disclosed herein is a method of making a pharmaceutical composition disclosed herein, comprising admixing the antibody disclosed herein, and a pharmaceutically acceptable excipient, carrier, or diluent.

[0011] In one aspect, disclosed herein is a method of producing an antibody disclosed herein comprising culturing a host cell disclosed herein.

[0012] The antibodies disclosed herein induce none or reduced antibody-dependent cell-mediated cytotoxicity effect when administered to a subject. Additionally, the antibodies disclosed herein lead to improved yield during manufacturing, at least because less half antibody and HC dimer production are generated during manufacturing. INCORPORATION BY REFERENCE

[0013] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The following detailed description of preferred embodiments of the present disclosure will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the present disclosure, there are shown in the drawings embodiments which are presently preferred. It should be understood, however, that the present disclosure is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.

[0015] Fig. 1: A bar graph plotting polyclonal phage binding to canine PD-1 by ELISA and showing an incremental increase in binding over 4 rounds of panning. Recombinant canine PD-1 was adsorbed to a microtiter plate overnight at 4℃. Wells were washed and blocked with 2%milk in PBS (MPBS) for 1 hour at 37℃. Initial unpanned library (P0) and libraries of phage obtained after each round of selection (P1 through P4) were added to coated plates and incubated for 1 hour at 37℃. Plates were washed with PBS supplemented with 0.1%Tween (PBST) and bound phage was detected using a 1: 5000 dilution of HRP-conjugated anti-M13 mAb in MPBS. Bound phage were detected with ABTS. OD was read at 405nm after 30 min using a Molecular Devices SpectraMax 340 spectrophotometer.

[0016] Fig. 2: (Left) A bar graph plotting 8 monoclonal phages from the third and fourth panning rounds binding to canine PD-1 by ELISA and showing a variability amongst clones of binding intensity. No binding is observed against the irrelevant human CD19 antigen. (Right) A bar graph plotting an additional 8 monoclonal phages from the third and fourth panning rounds binding to canine PD-1 by ELISA and showing a variability amongst clones of binding intensity. No binding is observed against the irrelevant canine IL-13Ra2 antigen. antigens including human CD19 and canine IL-13Ra2. Polyclonal phage from the third round of panning against human CD19 (left graph) , polyclonal phage from the fourth round of panning against IL-13Ra2 (right graph) and polyclonal phage from the fourth round of panning against cPD-1 (both graphs) , were used as positive controls against human CD19 (left-hand graph) and human IL-13Ra2 (right-hand graph) , and canine PD-1 (both graphs) , respectively. Each monoclonal phage was evaluated once for binding to PD-1.

[0017] Fig. 3: (Left) A line graph plotting the binding of soluble scFvs against an increasing concentration of plate-bound cPD-1 by ELISA. Six out of 14 clones show dose dependent increases in binding. No binding is seen with the irrelevant MERS soluble scFv. (Right) A line graph plotting the binding of soluble scFvs against an increasing concentration of plate-bound cPD-1 by ELISA. Four out of six clones show dose dependent increases in binding. No binding is seen with the irrelevant MERS soluble scFv. 19 unique soluble scFv were tested for binding to cPD-1 by ELISA. Increasing amounts of biotinylated canine PD-1 were added to streptavidin coated ELISA plate wells and incubated for 1 hour. 0.25mg / ml soluble HA-tagged scFv were added to the wells and bound scFv was detected using an AP-conjugated anti-HA antibody. An irrelevant soluble HA-tagged scFv against MERS (Middle East Respiratory Syndrome) was used as a negative control.

[0018] Fig. 4: (Panel A) A cartoon depicting the PD-1: PD-L1 inhibition assay. Biotinylated cPD-1 is incubated with cPD-L1 Fc and the complex is tethered to a streptavadin ELISA plate and signal of complex formation is provided via an anti-Fc antibody. In the presence of a soluble scFv that inhibits the cPD-1: cPD-L1 interaction, no complex is formed and no signal is detected. (Panel B) A bar graph plotting the optical density of a colorimetric substance that provides a readout if a cPD-1: cPD-L1 complex is detected. Increasing amounts of cPD-L1 are added to cPD-1 in the presence of different soluble cPD-1 specific scFvs. Difference scFvs show different degrees of cPD-1: cPD-L1 complex inhibition, with complete inhibition resulting in no signal being detected with the P3C6 soluble scFv.

[0019] Fig. 5: Individual flow cytometric plots of soluble scFv clones binding to target cells that do or do not express membrane bound cPD-1. Bound scFs are detected using an anti-HA antibody. The plots show no binding of the irrelevant MERS scFv to target cells with or without cell surface cPD-1. Four out of 6 clones shown demonstrate binding to target cells expressing cPD-1 but no binding to the same target cells that do not express cPD-1. The human erythroleukemic cell line K562 was gene edited to eliminate the FcgRII (CD32) (KTd32) . Retroviral transduction of edited cells to express cPD-1 was performed, and cPD-1 positive target cells were selected in puromycin. Soluble, purified, HA-tagged scFvs were incubated with target cells, and bound scFvs were detected using a fluorescent anti-HA antibody. The soluble scFv against MERS and clone 3-7 that showed low affinity binding to cPD-1 by ELISA, were used as negative controls.

[0020] Fig. 6: (Panel A) Alignment of VH amino acid sequences of PD-1 specific scFv clones showing high sequence homology amongst clones and with the canine IGHV3-38*01 VH gene. The amino acid sequences of the VL chains of clones P4B1 and P3C6 are also aligned and emphasizes their very different sequences reflecting their lambda and kappa origins respectively.

[0021] Fig. 6: (Panel B) Individual flow cytometric plots of full length IgGD antibodies containing mutations in the VH chain of P3C6 clone, binding to target cells expressing cPD-1 but not to the same target cells that do not express cPD-1, confirming specificity of binding to cPD-1. The plots show no binding of the irrelevant MERS full length antibody to target cells with or without cell surface cPD-1.

[0022] Fig. 7: (Panel A) A histogram plot showing expression of cCD20 and cPD-L1 on target cells engineered to express each target antigen. Cells not transduced to express cCD20 or cPD-L1 are negative. K562 cells were engineered to express canine CD20 (K562-cCD20) and canine PD-L1 (K562-cCD20-cPD-L1) and cell surface expression was confirmed by flow cytometry. (Panel B) A histogram plot with overlays showing cell proliferation by cell trace violet dilution. Expression of cPD-L1 on target cells inhibits T cell proliferation shown by less CTV dilution. In the presence of the P3C6mut3.1 antibody, the histograms of T cell proliferation against cPD-L1 positive and negative cells overlap. Canine CD20 CAR-T cells from one dog were labelled with cell trace violet (CTV) and co-cultured at an E: T ratio of 1: 1 with either K562-cCD20 or K562-cCD20-cPD-L1 in the presence of either anti-MERS antibody or P3C6mut3.1 mAb. After 72 hours of culture, proliferation of CD8+ CAR-T cells was assessed by flow cytometry. Plots are gated on live CD5+ CD8+ CAR+ cells. (Panel C) Flow cytometric plots showing a degranulation marker on the x-axis against forward scatter on the y-axis. Each plot shows canine CAR-T cells cultured with target cells expressing cCD20 with or without cPD-L1 in the presence of an irrelevant antibody or P3C6mut3.1 antibody. In the presence of the latter antibody the inhibitory effect of cPD-L1 on T cell degranulation is much reduced. Canine CD20 CAR-T cells from one dog were co-cultured at an E: T ratio of 1: 1 with the same target cells as in A. Expression of CD107b was determined after 4 hours of co-culture. Plots are gated on live CD5+ CD8+ CAR+cells.

[0023] Fig. 8: Two line graphs showing a biexponential serum concentration against time profile and dose normalized PK profiles of two different doses of P3C6mut3.1 antibody. The graphs show similar serum drug concentrations after a second dose of P3C6mut3.1 antibody suggesting the lack of anti-drug antibody formation. Healthy dogs were administered P3C6mut3.1 intravenously at either 2mg / kg (n=2) or 10mg / kg (n=2) on day 0 and day 21. Blood samples were taken at the indicated time points and analyzed for the presence of P3C6mut3.1 in the serum using a custom Meso Scale Discovery immunoassay. (Panel A) Serum pharmacokinetics of P3C6mut3.1 with data represented as mean ± SD. (Panel B) Dose-normalized concentration vs. time profiles for P3C6mut3.1.

[0024] Fig. 9: P3C6mut3.1 shows nanomolar binding affinities for soluble cPD-1. The affinity and binding kinetics of the full length P3C6mut 3.1 IgGD to the extracellular domain of cPD-1 were evaluated by surface plasmon resonance as described. Serial dilutions of P3C6mut3.1 IgGD (0-200nM) were used.

[0025] Fig. 10: P3C6 labelling of canine lymph node tissue. (Top) isotype control; (Bottom) full-length, HA-tagged P3C6mut3.1 IgGD labelling. Arrows indicate lymphocytes with intense PD-1 staining. Bar=35mM

[0026] Fig. 11: SDS-PAGE analysis of P3C6mut3.1. SDS page of the original sequence P3C6mut3.1 IgGD sequence (left panel) and the IgGD / B sequence (after hinge modification) (right panel) was performed under reducing (R) and non-reducing (NR) conditions (left) . Heavy chain dimers (at approximately 100 kD) and single chain antibody fragments (at approximately 80 kD) are more pronounced in the original sequence clone (left) compared to the modified clone (right) .DETAILED DESCRIPTION

[0027] Definitions

[0028] In the detailed description, certain specific details are set forth in order to provide a thorough understanding of various embodiments. However, one skilled in the art will understand that the embodiments provided can be practiced without these details. Unless the context requires otherwise, throughout the specification and claims which follow, the word “comprise” and variations thereof, such as, “comprises” and “comprising” are to be construed in an open, inclusive sense, that is, as “including, but not limited to. ” As used in this specification and the appended claims, the singular forms “a, ” “an, ” and “the” include plural referents unless the content clearly dictates otherwise. It should also be noted that the term “or” is generally employed in its sense including “and / or” unless the content clearly dictates otherwise. Further, headings provided herein are for convenience only and do not interpret the scope or meaning of the claimed embodiments.

[0029] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.

[0030] As used herein the term “about” refers to an amount that is near the stated amount by 10%or less. As used herein the term “individual, ” “patient, ” or “subject” refers to individuals diagnosed with, suspected of being afflicted with, or at-risk of developing at least one disease for which the described compositions and method are useful for treating. In certain embodiments the individual is a mammal. In certain embodiments, the mammal is a mouse, rat, rabbit, dog, cat, horse, cow, sheep, pig, goat, llama, alpaca, or yak. In certain embodiments, the individual is a dog or canine.

[0031] The term “antibody, ” as used herein, refers to an immunoglobulin molecule which specifically binds with an antigen. Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules comprising two heavy chain and two light chain polypeptides. Each polypeptide chain contains three complementarity-determining regions (CDRs) , which bind to the antigen and defines the antibody’s antigen specificity.

[0032] As used herein, the term “antibody” and “antibodies” can also include polypeptides or polypeptide complexes derived from full-length antibodies. These polypeptide complexes can be naturally occurring or constructed from single chain antibodies or antibody fragments and retain an antigen-specific binding ability. The antibodies of the present disclosure can exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F (ab') 2, as well as single chain antibodies, scFv, caninized antibodies, canine antibodies, humanized antibodies, and human antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85: 5879-5883; Bird et al., 1988, Science 242: 423-426) . For preparation of suitable antibodies, e.g., recombinant, monoclonal, or polyclonal antibodies, many techniques known in the art can be used (see, e.g., Kohler &Milstein, Nature 256: 495-497 (1975) ; Kozbor et al., Immunology Today 4: 72 (1983) ; Cole et al., pp. 77-96 in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. (1985) ; Coligan, Current Protocols in Immunology (1991) ; Harlow &Lane, Antibodies, A Laboratory Manual (1988) ; and Goding, Monoclonal Antibodies: Principles and Practice (2d ed. 1986) ) . The genes encoding the heavy and light chains of an antibody of interest can be cloned from a cell, e.g., the genes encoding a monoclonal antibody can be cloned from a hybridoma and used to produce a recombinant monoclonal antibody. Gene libraries encoding heavy and light chains of monoclonal antibodies can also be made from hybridoma or plasma cells. Random combinations of the heavy and light chain gene products generate a large pool of antibodies with different antigenic specificity (see, e.g., Kuby, Immunology (3rd ed. 1997) ) . Techniques for the production of single chain antibodies or recombinant antibodies (U.S. Pat. Nos. 4,946,778, 4,816,567) can be adapted to produce antibodies of this disclosure. Also, transgenic mice, or other organisms such as other mammals, can be used to express humanized or human antibodies as well as caninized or canine antibodies (see, e.g., U.S. Pat. Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, Marks et al., Bio / Technology 10: 779-783 (1992) ; Lonberg et al., Nature 368: 856-859 (1994) ; Morrison, Nature 368: 812-13 (1994) ; Fishwild et al., Nature Biotechnology 14: 845-51 (1996) ; Neuberger, Nature Biotechnology 14: 826 (1996) ; and Lonberg &Huszar, Intern. Rev. Immunol. 13: 65-93 (1995) ) . Alternatively, phage display technology can be used to identify antibodies and heteromeric Fab fragments that specifically bind to selected antigens (see, e.g., McCafferty et al., Nature 348: 552-554 (1990) ; Marks et al., Biotechnology 10: 779-783 (1992) ) . Antibodies can also be made bispecific, i.e., able to recognize two different antigens (see, e.g., WO 93 / 08829, Traunecker et al., EMBO J. 10: 3655-3659 (1991) ; and Suresh et al., Methods in Enzymology 121: 210 (1986) ) . Antibodies can also be heteroconjugates, e.g., two covalently joined antibodies, or immunotoxins (see, e.g., U.S. Pat. No. 4,676,980, WO 91 / 00360; WO 92 / 200373; and EP 03089) .

[0033] Herein a molecule, peptide, polypeptide, antibody, or antibody fragment can be referred to as “bispecific” or “dual-specific” including grammatical equivalents. A bispecific molecule possesses the ability to specifically bind to at least two structurally distinct targets. The specific binding can be the result of two distinct binding moieties that are structurally distinct at the molecular level, including but not limited to distinct non-identical amino acid sequences; or a single binding moiety that is able to specifically bind to two structurally distinct targets with high affinity (e.g., with a KD less than about 1x10-6) . A molecule, peptide, polypeptide, antibody, or antibody fragment referred to as “multi-specific” refers to a molecule that possesses the ability to specifically bind to at least three structurally distinct targets. A “bispecific antibody” including grammatical equivalents refers to a bispecific molecule that preserves at least one fragment of an antibody able to specifically bind a target, for example, a variable region, heavy or light chain, or one or more complementarity determining regions from an antibody molecule. A “multi-specific antibody” including grammatical equivalents refers to a multi-specific molecule that preserves at least one fragment of an antibody able to specifically bind with a target, for example, a variable region, heavy or light chain, or complementarity determining region from an antibody molecule.

[0034] A “linker” herein is also referred to as “linker sequence” “spacer” “tethering sequence” or grammatical equivalents thereof. A “linker” as referred herein connects two distinct molecules that by themselves possess target binding, catalytic activity, or are naturally expressed and assembled as separate polypeptides, or comprise separate domains of the same polypeptide. For example, two distinct binding moieties or a heavy-chain / light-chain pair. A number of strategies can be used to covalently link molecules together. Linkers described herein can be utilized to join a light chain variable region and a heavy chain variable region in an scFv molecule; or can be used to tether an scFv or other antigen binding fragment on the N-or C-terminus of an antibody heavy chain; or the N-or C-terminus of a light chain to create a bispecific or multi-specific binding molecule. These include but are not limited to polypeptide linkages between N-and C-termini of proteins or protein domains, linkage via disulfide bonds, and linkage via chemical cross-linking reagents. In one aspect of this embodiment, the linker is a peptide bond, generated by recombinant techniques or peptide synthesis. The linker peptide can predominantly include the following amino acid residues: Gly, Ser, Ala, or Thr. The linker peptide should have a length that is adequate to link two molecules in such a way that they assume the correct conformation relative to one another so that they retain the desired activity. In one embodiment, the linker is from about 1 to 50 amino acids in length or about 1 to 30 amino acids in length. In one embodiment, linkers of 1 to 20 amino acids in length can be used. Useful linkers include glycine-serine polymers, including for example (GS) n, (GSGGS) n, (GGGGS) n, and (GGGS) n, where n is an integer of at least one, glycine-alanine polymers, alanine-serine polymers, and other flexible linkers. Exemplary, linkers for linking antibody fragments or single chain variable fragments can include AAEPKSS, AAEPKSSDKTHTCPPCP, GGGG, or GGGGDKTHTCPPCP. Alternatively, a variety of non-proteinaceous polymers, including but not limited to polyethylene glycol (PEG) , polypropylene glycol, polyoxyalkylenes, or copolymers of polyethylene glycol and polypropylene glycol, can find use as linkers.

[0035] The terms “complementarity determining region, ” and “CDR, ” which are synonymous with “hypervariable region” or “HVR, ” are known in the art to refer to non-contiguous sequences of amino acids within antibody variable regions, which confer antigen specificity and / or binding affinity. In general, there are three CDRs in each heavy chain variable region (CDR-H1, CDR-H2, CDR-H3) and three CDRs in each light chain variable region (CDR-L1, CDR-L2, CDR-L3) . “Framework regions” and “FR” are known in the art to refer to the non-CDR portions of the variable regions of the heavy and light chains. In general, there are four FRs in each full-length heavy chain variable region (FR-H1, FR-H2, FR-H3, and FR-H4) , and four FRs in each full-length light chain variable region (FR-L1, FR-L2, FR-L3, and FR-L4) . The precise amino acid sequence boundaries of a given CDR or FR can be readily determined using any of a number of well-known schemes, including those described by Kabat et al. (1991) , “Sequences of Proteins of Immunological Interest, ” 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD ( “Kabat” numbering scheme) , Al-Lazikani et al., (1997) JMB 273, 927-948 ( “Chothia” numbering scheme) ; MacCallum et al., J. Mol. Biol. 262: 732-745 (1996) , “Antibody-antigen interactions: Contact analysis and binding site topography, ” J. Mol. Biol. 262, 732-745. ” ( “Contact” numbering scheme) ; Lefranc MP et al., “IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains, ” Dev Comp Immunol, 2003 Jan; 27 (1) : 55-77 ( “IMGT” numbering scheme) ; Honegger A and Plückthun A, “Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool, ” J Mol Biol, 2001 Jun 8; 309 (3) : 657-70, ( “Aho” numbering scheme) ; and Whitelegg NR and Rees AR, “WAM: an improved algorithm for modelling antibodies on the WEB, ” Protein Eng. 2000 Dec; 13 (12) : 819-24 ( “AbM” numbering scheme. In certain embodiments, the CDRs of the antibodies described herein can be defined by a method selected from Kabat, Chothia, IMGT, Aho, AbM, or combinations thereof.

[0036] The boundaries of a given CDR or FR can vary depending on the scheme used for identification. For example, the Kabat scheme is based on structural alignments, while the Chothia scheme is based on structural information. Numbering for both the Kabat and Chothia schemes is based upon the most common antibody region sequence lengths, with insertions accommodated by insertion letters, for example, “30a, ” and deletions appearing in some antibodies. The two schemes place certain insertions and deletions ( “indels” ) at different positions, resulting in differential numbering. The Contact scheme is based on analysis of complex crystal structures and is similar in many respects to the Chothia numbering scheme. In certain embodiments, the CDRs of the antibodies described herein can be defined by IMGT method.

[0037] The term “variable region” or “variable domain” refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to antigen. The variable domains of the heavy chain and light chain (VH and VL, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three CDRs (See e.g., Kindt et al. Kuby Immunology, 6th ed., W. H. Freeman and Co., page 91 (2007) ) . A single VH or VL domain can be sufficient to confer antigen-binding specificity. Furthermore, antibodies that bind a particular antigen can be isolated using a VH or VL domain from an antibody that binds the antigen to screen a library of complementary VL or VH domains, respectively (See e.g., Portolano et al., J. Immunol. 150: 880-887 (1993) ; Clarkson et al., Nature 352: 624-628 (1991) ) .

[0038] Specific binding or binding of antibody molecules described herein refers to binding mediated by one or more CDR portions of the antibody. Not all CDRs may be required for specific binding. Specific binding can be demonstrated for example by an ELISA against a specific recited target or antigen that shows significant increase in binding compared to an isotype control antibody.

[0039] An “epitope” refers to the binding determinant of an antibody or fragment described herein minimally necessary for specific binding of the antibody or fragment thereof to a target antigen. When the target antigen is a polypeptide, the epitope will be a continuous or discontinuous epitope. A continuous epitope is formed by one region of the target antigen, while a discontinuous epitope can be formed from two or more separate regions. A discontinuous epitope, for example, can form when a target antigen adopts a tertiary structure that brings two amino acid sequences together and forms a three-dimensional structure bound by the antibody. When the target antigen is a polypeptide, the epitope will generally be a plurality of amino acids linked into a polypeptide chain. A continuous epitope can comprise 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous amino acids. While an epitope can comprise a contiguous polymer of amino acids, not every amino acid of the polymer can be contacted by an amino acid residue of the antibody. Such non-contacted amino acids will still comprise part of the epitope as they can be important for the structure and linkage of the contacted amino acids. The skilled artisan can determine if any given antibody binds an epitope of a reference antibody, for example, by cross-blocking experiments with a reference antibody. In certain embodiments, described herein, are antibodies that bind the same epitope of the described antibodies. In certain embodiments, described herein, are antibodies that are competitively blocked by the described antibodies. In certain embodiments, described herein, are antibodies that compete for binding with the described antibodies.

[0040] The term “antibody fragment” refers to a polypeptide comprising or derived from a portion of an intact antibody and comprises the antigen-binding determining variable regions of an intact antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab', F (ab') 2, and Fv fragments, linear antibodies, scFv antibodies, single-domain antibodies, such as camelid antibodies (Riechmann, 1999, Journal of Immunological Methods 231: 25-38) , composed of either a VL or a VH domain which exhibit sufficient affinity for the target, and multi-specific antibodies formed from antibody fragments. Antibody fragments can be made by various techniques, including but not limited to proteolytic digestion of an intact antibody as well as production by recombinant host cells. In some embodiments, the antibodies are recombinantly-produced fragments, such as fragments comprising arrangements that do not occur naturally, such as those with two or more antibody regions or chains joined by synthetic linkers, e.g., polypeptide linkers, and / or those that are not produced by enzyme digestion of a naturally-occurring intact antibody. In some aspects, the antibody fragments are scFvs.

[0041] A Fab or Fab fragment contains the constant domain of the light chain and the first constant domain (CH1) of the heavy chain. Fab′or Fab′fragments differ from Fab fragments by the addition of a few residues at the carboxyl terminus of the heavy chain CH1 domain including one or more cysteines from the antibody hinge region. Fab′fragments are produced by cleavage of the disulfide bond at the hinge cysteines of the F (ab′) 2 pepsin digestion product. Additional chemical couplings of antibody fragments are known to those of ordinary skill in the art. Fab and F (ab′) 2 fragments lack the Fragment crystallizable (Fc) region of an intact antibody, clear more rapidly from the circulation of animals, and can have less nonspecific tissue binding than an intact antibody. “Fv” fragment is the minimum fragment of an antibody that contains a complete target recognition and binding site. This region consists of a dimer of one heavy and one light chain variable domain in a tight, non-covalent association (VH-VL dimer) . It is in this configuration that the three CDRs of each variable domain interact to define a target binding site on the surface of the VHVL dimer. In some cases, the six CDRs confer target binding specificity to the antibody. However, in some cases. even a single variable domain (or half of an Fv comprising only three CDRs specific for a target) can have the ability to recognize and bind target. Single domain antibodies (sdAb)  / single-chain fragments are composed of a single VH or VL domain which exhibit sufficient affinity to an antigen. The antibody fragment also includes a canine antibody or a caninized antibody or a portion of a canine antibody or a caninized antibody. A scFv (Single-chain Fv) refers to antibody binding fragments comprise the VH and VL domains of an antibody, where these domains are present in a single polypeptide chain. Generally, the scFv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the scFv to form a structure favorable for target binding.

[0042] The term “diabodies” refers to small antibody fragments prepared by constructing scFv fragments with short linkers (about 5-10 residues) between the VH and VL domains such that inter-chain but not intra-chain pairing of the variable domains is achieved, resulting in a bivalent fragment, i.e., fragment having two antigen-binding sites. Bispecific diabodies are heterodimers of two “crossover” scFv fragments in which the VH and VL domains of the two antibodies are present on different polypeptide chains.

[0043] The term “linear antibodies” generally refers to the antibodies comprise a pair of tandem Fd segments (VH-CH1-VH-CH1) which, together with complementary light chain polypeptides, form a pair of antigen binding regions. Linear antibodies can be bispecific or monospecific.

[0044] An “antibody heavy chain, ” as used herein, refers to the larger of the two types of polypeptide chains present in all antibody molecules in their naturally occurring conformations.

[0045] An “antibody light chain, ” as used herein, refers to the smaller of the two types of polypeptide chains present in all antibody molecules in their naturally occurring conformations. κ and λ light chains refer to the two major antibody light chain isotypes.

[0046] By the term “synthetic antibody” as used herein, is meant an antibody which is generated using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage as described herein. The term should also be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and which DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence technology which is available and well known in the art.

[0047] The term “antigen” or “Ag” as used herein is defined as a molecule that provokes an immune response. This immune response can involve either antibody production, or the activation of specific immunologically-competent cells, or both. The skilled artisan will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. Furthermore, antigens can be derived from recombinant or genomic DNA. A skilled artisan will understand that any DNA, which comprises a nucleotide sequences or a partial nucleotide sequence encoding a protein that elicits an immune response therefore encodes an “antigen” as that term is used herein. Furthermore, one skilled in the art will understand that an antigen need not be encoded solely by a full length nucleotide sequence of a gene. It is readily apparent that the present disclosure includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to elicit the desired immune response. Moreover, a skilled artisan will understand that an antigen need not be encoded by a “gene” at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample. Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell or a biological fluid.

[0048] The term “anti-tumor effect” as used herein, refers to a biological effect which can be manifested by a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in the number of metastases, an increase in life expectancy, or amelioration of various physiological symptoms associated with the cancerous condition. An “anti-tumor effect” can also be manifested by the ability of the peptides, polynucleotides, cells and antibodies of the present disclosure in prevention of the occurrence of tumor in the first place.

[0049] As used herein, the term “autologous” is meant to refer to any material derived from the same individual to which it is later to be re-introduced into the individual.

[0050] “Allogeneic” refers to a graft derived from a different animal of the same species.

[0051] “Xenogeneic” refers to a graft derived from an animal of a different species.

[0052] The term “cancer” as used herein is defined as disease characterized by the rapid and uncontrolled growth of aberrant cells. Cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body. Examples of various cancers include but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer and the like. In certain embodiments, the cancer is medullary thyroid carcinoma.

[0053] As used herein, the term “conservative sequence modifications” is intended to refer to amino acid modifications that do not significantly affect or alter the binding characteristics of the antibody containing the amino acid sequence. Such conservative modifications include amino acid substitutions, additions and deletions. Modifications can be introduced into an antibody of the present disclosure by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are ones in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine) , acidic side chains (e.g., aspartic acid, glutamic acid) , uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan) , nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine) , beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine) . Thus, one or more amino acid residues within the CDR regions of an antibody of the present disclosure can be replaced with other amino acid residues from the same side chain family and the altered antibody can be tested for the ability to bind GFRα4 using the functional assays described herein.

[0054] “Co-stimulatory ligand” , as the term is used herein, includes a molecule expressed by an antigen presenting cell (e.g., an aAPC, dendritic cell, B cell, and the like) that specifically binds a cognate co-stimulatory molecule on a T cell, thereby providing a signal which, in addition to the primary signal provided by, for instance, binding of a TCR / CD3 complex with an MHC molecule loaded with peptide, mediates a T cell response, including, but not limited to, proliferation, activation, differentiation, and the like. A co-stimulatory ligand can include, but is not limited to, CD7, B7-1 (CD80) , B7-2 (CD86) , PD-L1, PD-L2, 4-1BBL, OX40L, inducible costimulatory ligand (ICOS-L) , intercellular adhesion molecule (ICAM) , CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin beta receptor, 3 / TR6, ILT3, ILT4, HVEM, an agonist or antibody that binds Toll ligand receptor and a ligand that specifically binds with B7-H3. A co-stimulatory ligand also encompasses, inter alia, an antibody that specifically binds with a co-stimulatory molecule present on a T cell, such as, but not limited to, CD27, CD28, 4-1BB, OX40, CD30, CD40L, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1) , CD2, CD7, LIGHT, NKG2C, B7-H3, and a ligand that specifically binds with CD83.

[0055] A “co-stimulatory molecule” refers to cell-surface molecules expressed by T cells that specifically bind with co-stimulatory ligands expressed by antigen-presenting cells (APCs) , thereby providing a “secondary signal” which, in combination with the “primary signal” delivered through MHC / HLA-antigen interactions with the T Cell Receptor (TCR) results in optimal T cell activation including, but not limited to, cytokine production and proliferation. Co-stimulatory molecules include, but are not limited to CD27, CD28, 4-1BB, OX40, CD30, CD40L, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1) , CD2, CD7, LIGHT, NKG2C, B7-H3, and a ligand that specifically binds with CD83.

[0056] The term “dysregulated” when used in the context of the level of expression or activity of PD-1 or it’s ligands PD-L1 and PD-L2 refers to the level of expression or activity that is different from the expression level or activity of PD-1 or it’s ligands in an otherwise identical healthy animal, organism, tissue, cell or component thereof. The term “dysregulated” also refers to the altered regulation of the level of expression and activity of PD-1, PD-L1, compared to the regulation in an otherwise identical healthy animal, organism, tissue, cell or component thereof.

[0057] “Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.

[0058] Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA can include introns.

[0059] “Effective amount” or “therapeutically effective amount” are used interchangeably herein, and refer to an amount of a compound, formulation, material, or composition, as described herein effective to achieve a particular biological result. Such results can include, but are not limited to, the inhibition of virus infection as determined by any means suitable in the art.

[0060] As used herein “endogenous” refers to any material from or produced inside an organism, cell, tissue or system.

[0061] As used herein, the term “exogenous” refers to any material introduced from or produced outside an organism, cell, tissue or system.

[0062] The term “expression” as used herein is defined as the transcription and / or translation of a particular nucleotide sequence driven by its promoter.

[0063] “Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.

[0064] “Homologous” as used herein, refers to the subunit sequence identity between two polymeric molecules, e.g., between two nucleic acid molecules, such as, two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit; e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position. The homology between two sequences is a direct function of the number of matching or homologous positions; e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two sequences are homologous, the two sequences are 50%homologous; if 90%of the positions (e.g., 9 of 10) , are matched or homologous, the two sequences are 90%homologous.

[0065] “Humanized” or “caninized” and “chimeric” forms of non-human or non-canine (e.g., mouse) antibodies are immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F (ab') 2 or other antigen-binding subsequences of antibodies) which contain minimal sequences derived from non-human or non-canine immunoglobulin. For the most part, humanized, caninized, and chimeric antibodies are human or canine immunoglobulins (recipient antibody) in which residues from a complementary-determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human or non-canine species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and capacity. In some instances, Fv framework region (FR) residues of the human or canine immunoglobulin are replaced by corresponding non-human or non-canine residues. Furthermore, humanized, caninized, and chimeric antibodies can comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are made to further refine and optimize antibody performance. In general, the humanized, caninized, and chimeric antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human or canine immunoglobulin sequence. The caninized and chimeric antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc) , typically that of a canine immunoglobulin.

[0066] “Fully canine” or “canine antibody” refers to an immunoglobulin, such as an antibody, with an amino acid sequence corresponding to that of an antibody produced by a canine or a canine cell, or non-canine source that utilizes canine antibody repertoires or other canine antibody-encoding sequences, including canine antibody libraries. The term excludes caninized forms of non-canine antibodies comprising non-canine antigen-binding regions, such as those in which all or substantially all CDRs are non-canine. In some cases, a fully canine antibody does not include a portion of an antibody sequence from non-canine species. Canine antibodies can be prepared by administering an immunogen to a transgenic animal that has been modified to produce intact canine antibodies or intact antibodies with canine variable regions in response to antigenic challenge. Such animals typically contain all or a portion of the canine immunoglobulin loci, which replace the endogenous immunoglobulin loci, or which are present extrachromosomally or integrated randomly into the animal’s chromosomes. In such transgenic animals, the endogenous immunoglobulin loci have generally been inactivated. Canine antibodies also can be derived from canine antibody libraries, including phage display and cell-free libraries, containing antibody-encoding sequences derived from a canine repertoire.

[0067] As used herein, an “instructional material” includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the compositions and methods of the present disclosure. The instructional material of the kit of the present disclosure can, for example, be affixed to a container which contains the nucleic acid, peptide, and / or composition of the present disclosure or be shipped together with a container which contains the nucleic acid, peptide, and / or composition. Alternatively, the instructional material can be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively by the recipient.

[0068] “Identity” as used herein refers to the percent (%) sequence identity with respect to a reference polypeptide sequence is the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the reference polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are known for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Appropriate parameters for aligning sequences are able to be determined, including algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For purposes herein, however, %amino acid sequence identity values are generated using the sequence comparison computer program ALIGN-2. The ALIGN-2 sequence comparison computer program was authored by Genentech, Inc., and the source code has been filed with user documentation in the U.S. Copyright Office, Washington D. C., 20559, where it is registered under U.S. Copyright Registration No. TXU510087. The ALIGN-2 program is publicly available from Genentech, Inc., South San Francisco, Calif., or can be compiled from the source code. The ALIGN-2 program should be compiled for use on a UNIX operating system, including digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.

[0069] In situations where ALIGN-2 is employed for amino acid sequence comparisons, the %amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B (which can alternatively be phrased as a given amino acid sequence A that has or comprises a certain %amino acid sequence identity to, with, or against a given amino acid sequence B) is calculated as follows: 100 times the fraction X / Y, where X is the number of amino acid residues scored as identical matches by the sequence alignment program ALIGN-2 in that program's alignment of A and B, and where Y is the total number of amino acid residues in B. It will be appreciated that where the length of amino acid sequence A is not equal to the length of amino acid sequence B, the %amino acid sequence identity of A to B will not equal the %amino acid sequence identity of B to A. Unless specifically stated otherwise, all %amino acid sequence identity values used herein are obtained as described in the immediately preceding paragraph using the ALIGN-2 computer program.

[0070] “Isolated” means altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not “isolated, ” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated. ” An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.

[0071] In the context of the present disclosure, the following abbreviations for the commonly occurring nucleic acid bases are used. “A” refers to adenosine, “C” refers to cytosine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine.

[0072] Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence that encodes a protein or an RNA can also include introns to the extent that the nucleotide sequence encoding the protein can in some version contain an intron (s) .

[0073] The term “operably linked” refers to functional linkage between a regulatory sequence and a heterologous nucleic acid sequence resulting in expression of the latter. For example, a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame.

[0074] “Parenteral” administration of an immunogenic composition includes, e.g., subcutaneous (s.c. ) , intravenous (i.v. ) , intramuscular (i.m. ) , or intrasternal injection, or infusion techniques.

[0075] The term “polynucleotide” as used herein is defined as a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. Thus, nucleic acids and polynucleotides as used herein are interchangeable. One skilled in the art has the general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric “nucleotides. ” The monomeric nucleotides can be hydrolyzed into nucleosides. As used herein polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCRTM, and the like, and by synthetic means.

[0076] As used herein, the terms “peptide, ” “polypeptide, ” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide’s sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.

[0077] The term “promoter” as used herein is defined as a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a polynucleotide sequence.

[0078] As used herein, the term “promoter / regulatory sequence” means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter / regulatory sequence. In some instances, this sequence can be the core promoter sequence and in other instances, this sequence can also include an enhancer sequence and other regulatory elements which are required for expression of the gene product. The promoter / regulatory sequence can, for example, be one which expresses the gene product in a tissue specific manner.

[0079] A “constitutive” promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.

[0080] An “inducible” promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell substantially only when an inducer which corresponds to the promoter is present in the cell.

[0081] A “tissue-specific” promoter is a nucleotide sequence which, when operably linked with a polynucleotide encodes or specified by a gene, causes the gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.

[0082] A “signal transduction pathway” refers to the biochemical relationship between a variety of signal transduction molecules that play a role in the transmission of a signal from one portion of a cell to another portion of a cell. The phrase “cell surface receptor” includes molecules and complexes of molecules capable of receiving a signal and transmitting signal across the plasma membrane of a cell. An example of a “cell surface receptor” is human GFRα4.

[0083] “Single chain antibodies” refer to antibodies formed by recombinant DNA techniques in which immunoglobulin heavy and light chain fragments are linked to each other using an engineered span of amino acids to recapitulate the Fv region of an antibody as a single polypeptide. Various methods of generating single chain antibodies are known, including those described in U.S. Pat. No. 4,694,778; Bird (1988) Science 242: 423-442; Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85: 5879-5883; Ward et al. (1989) Nature 334: 54454; Skerra et al. (1988) Science 242: 1038-1041.

[0084] The term “subject” is intended to include living organisms in which an immune response can be elicited (e.g., mammals) . A “subject” or “patient, ” as used therein, can be a human or non-human mammal. Non-human mammals include, for example, livestock and pets, such as ovine, bovine, porcine, canine, feline and murine mammals. Preferably, the subject is canine.

[0085] As used herein, a “substantially purified” cell is a cell that is essentially free of other cell types. A substantially purified cell also refers to a cell which has been separated from other cell types with which it is normally associated in its naturally occurring state. In some instances, a population of substantially purified cells refers to a homogenous population of cells. In other instances, this term refers simply to cell that have been separated from the cells with which they are naturally associated in their natural state. In some embodiments, the cells are cultured in vitro. In other embodiments, the cells are not cultured in vitro.

[0086] The term “therapeutic” as used herein means a treatment and / or prophylaxis. A therapeutic effect is obtained by suppression, remission, or eradication of a disease state.

[0087] The term “transfected” or “transformed” or “transduced” as used herein refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell. A “transfected” or “transformed” or “transduced” cell is one which has been transfected, transformed or transduced with exogenous nucleic acid. The cell includes the primary subject cell and its progeny.

[0088] The phrase “under transcriptional control” or “operatively linked” as used herein means that the promoter is in the correct location and orientation in relation to a polynucleotide to control the initiation of transcription by RNA polymerase and expression of the polynucleotide.

[0089] A “vector” is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term “vector” includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, and the like.

[0090] By the term “specifically binds, ” as used herein, is meant an antibody, or a ligand, which recognizes and binds with a cognate binding partner (e.g., a stimulatory and / or costimulatory molecule present on a T cell) protein present in a sample, but which antibody or ligand does not substantially recognize or bind other molecules in the sample.

[0091] By the term “stimulation, ” is meant a primary response induced by binding of a stimulatory molecule (e.g., a TCR / CD3 complex) with its cognate ligand thereby mediating a signal transduction event, such as, but not limited to, signal transduction via the TCR / CD3 complex. Stimulation can mediate altered expression of certain molecules, such as downregulation of TGF-β, and / or reorganization of cytoskeletal structures, and the like.

[0092] A “stimulatory molecule, ” as the term is used herein, means a molecule on a T cell that specifically binds with a cognate stimulatory ligand present on an antigen presenting cell and / or on a tumor cell.

[0093] A “stimulatory ligand, ” as used herein, means a ligand that when present on an antigen presenting cell (e.g., an aAPC, a dendritic cell, a B-cell, and the like) or a tumor cell, can specifically bind with a cognate binding partner (referred to herein as a “stimulatory molecule” ) on a T cell, thereby mediating a primary response by the T cell, including, but not limited to, activation, initiation of an immune response, proliferation, and the like. Stimulatory ligands are well-known in the art and encompass, inter alia, an MHC Class I molecule loaded with a peptide, an anti-CD3 antibody, a super-agonist anti-CD28 antibody, and a super-agonist anti-CD2 antibody.

[0094] Ranges: throughout this present disclosure, various aspects of the present disclosure can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the present disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

[0095] Binding Polypeptides, Antibodies, and scFvs

[0096] In aspects, disclosed herein are antibodies or antigen-binding fragment thereof (or “binding polypeptides, ” which is used interchangeably) which are characterized by particular functional features or properties of the antibodies or antigen-binding fragment thereof. For example, the binding polypeptides and antibodies specifically bind to canine programmed death protein 1 ( “cPD-1” or “canine PD-1” are used interchangeably) . The binding polypeptides and antibodies of the present disclosure can bind to canine PD-1 with high affinity. The binding polypeptides and antibodies of the present disclosure can specifically recognize naturally expressed canine PD-1 protein on a cell. In some cases, the binding polypeptides and antibodies of the present disclosure do not cross-react to other surface molecules on such cell. The binding polypeptides and antibodies of the present disclosure can specifically bind to naturally expressed canine PD-1 protein on a cell, so that such binding prevents canine PD-1 from binding to a natural ligand of canine PD-1, such as canine programmed death-ligand 1 ( “cPD-L1” or “canine PD-L1) . In some cases, the cell is a tumor cell (e.g., melanoma, non-small cell lung carcinoma and hepatocellular carcinoma) . In some cases, the cell is an immune cell. In some cases, the immune cell comprises a T cell (e.g., an activated T cell) , a B cell, a Natural Killer (NK) cell, a regulatory T cell, a macrophage, or a Dendritic cell (DC) . In some cases, the immune cell comprises an activated T cell. In some cases, the immune cell comprises a tumor-infiltrating lymphocyte. In some cases, the cPD-L1 is overexpressed on a tumor cell. In some cases, the antibody or the antigen-binding fragment thereof can bind to cPD-1 and inhibit cPD-1 signaling pathway.

[0097] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof that specifically binds to canine programmed death protein 1 (PD-1) . In some cases, the antibody or antigen-binding fragment thereof comprises a heavy chain complementarity determining region 1 (HCDR1) . In some cases, the antibody or antigen-binding fragment thereof comprises a heavy chain complementarity determining region 2 (HCDR2) . In some cases, the antibody or antigen-binding fragment thereof comprises a heavy chain complementarity determining region 3 (HCDR3) . In some cases, the antibody or antigen-binding fragment thereof comprises a light chain complementarity determining region 1 (LCDR1) . In some cases, the antibody or antigen-binding fragment thereof comprises a light chain complementarity determining region 2 (LCDR2) . In some cases, the antibody or antigen-binding fragment thereof comprises a light chain complementarity determining region 3 (LCDR3) . In some cases, the antibody or antigen-binding fragment thereof comprises an antigen-binding domain that specifically binds to canine programmed death protein 1 (PD-1) . In certain embodiments, the antigen-binding domain comprises a heavy chain variable region that comprises three heavy chain complementarity determining regions (HCDRs) and a light chain variable region that comprises three light chain complementarity determining regions (LCDRs) .

[0098] In certain aspects, the present disclosure provides an isolated binding polypeptide comprising an HCDR1 comprising the amino acid sequences set forth in SEQ ID NOs: 1, 27, or 43. Also provided is an isolated binding polypeptide comprising an HCDR2 comprising the amino acid sequences set forth in SEQ ID NOs: 2, 28, or 44. Also provided is an isolated binding polypeptide comprising an HCDR3 comprising the amino acid sequences set forth in SEQ ID NOs: 3, 29, or 45. Also provided is an isolated binding polypeptide comprising a light chain variable region that comprises an LCDR1 comprising the amino acid sequences set forth in SEQ ID NOs: 4, 30, or 46. Also provided is an isolated binding polypeptide comprising an LCDR2 comprising the amino acid sequences set forth in SEQ ID NOs: 5, 31, or 47. Also provided is an isolated binding polypeptide comprising an LCDR3 comprising the amino acid sequences set forth in SEQ ID NOs: 6, 32, or 48.

[0099] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprising a heavy chain complementarity determining region 1 (HCDR1) , comprising the amino acid sequence set forth in SEQ ID NOs: 1, 27, or 43, a heavy chain complementarity determining region 2 (HCDR2) , comprising the amino acid sequence set forth in SEQ ID NOs: 2, 28, or 44, a heavy chain complementarity determining region 3 (HCDR3) , comprising the amino acid sequence set forth in SEQ ID NOs: 3, 29, or 45, a light chain complementarity determining region 1 (LCDR1) , comprising the amino acid sequence set forth in SEQ ID NOs: 4, 30, or 46, a light chain complementarity determining region 2 (LCDR2) , comprising the amino acid sequence set forth in SEQ ID NOs: 5, 31, or 47, and a light chain complementarity determining region 3 (LCDR3) , comprising the amino acid sequence set forth in SEQ ID NOs: 6, 32, or 48. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) . In some cases, the antibody or antigen-binding fragment comprises a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NOs: 7, 9, 33, or 49. In some cases, the antibody or antigen-binding fragment comprises a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NOs: 11, 35, or 51. In some cases, the antibody or antigen-binding fragment comprises an immunoglobulin heavy chain, comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NOs: 19, 21, 23, 39, 55, or 70-75. In some cases, the antibody or antigen-binding fragment comprises an immunoglobulin light chain, comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NOs: 25, 41, or 57.

[0100] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprising a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NOs: 7, 9, 33, or 49 and a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NOs: 11, 35, or 51. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) .

[0101] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NOs: 7, 9, 33, or 49; and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NOs: 11, 35, or 51. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) .

[0102] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprising an immunoglobulin heavy chain, comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NOs: 19, 21, 23, 39, 55, or 70-75, and an immunoglobulin light chain, comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NOs: 25, 41, or 57. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) .

[0103] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprising an immunoglobulin heavy chain, comprising the amino acid sequence set forth in SEQ ID NOs: 19, 21, 23, 39, 55, or 70-75, and an immunoglobulin light chain, comprising the amino acid sequence set forth in SEQ ID NOs: 25, 41, or 57. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) .

[0104] In certain aspects, the present disclosure provides an isolated binding polypeptide comprising an HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 1, an HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 2, an HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 3, an LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 4, an LCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 5, and an LCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 6. In some embodiments, the isolated binding polypeptide is an antibody or antigen-binding fragment thereof that specifically binds to canine programmed death protein 1 (PD-1) . In some embodiments, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NOs: 7 or 9. In some embodiments, the antibody or antigen-binding fragment thereof comprises a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 11. In some embodiments, the antibody or antigen-binding fragment thereof comprises an immunoglobulin heavy chain, comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NOs: 19, 21, or 23. In some embodiments, the antibody or antigen-binding fragment thereof comprises an immunoglobulin light chain, comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 25.

[0105] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NOs: 7 or 9; and a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 11. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) .

[0106] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7; and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 11. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) .

[0107] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9; and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 11. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) .

[0108] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprises an immunoglobulin heavy chain, comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NOs: 19, 21, or 23, and an immunoglobulin light chain, comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 25. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) .

[0109] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprises an immunoglobulin heavy chain, comprising the amino acid sequence set forth in SEQ ID NOs: 19, and an immunoglobulin light chain, comprising the amino acid sequence set forth in SEQ ID NO: 25. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) .

[0110] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprises an immunoglobulin heavy chain, comprising the amino acid sequence set forth in SEQ ID NOs: 21, and an immunoglobulin light chain, comprising the amino acid sequence set forth in SEQ ID NO: 25. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) .

[0111] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprises an immunoglobulin heavy chain, comprising the amino acid sequence set forth in SEQ ID NOs: 23, and an immunoglobulin light chain, comprising the amino acid sequence set forth in SEQ ID NO: 25. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) .

[0112] In certain aspects, the present disclosure provides an isolated binding polypeptide comprising an HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 27, an HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 28, an HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 29, an LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 30, an LCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 31, and an LCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 32. In some embodiments, the isolated binding polypeptide is an antibody or antigen-binding fragment thereof that specifically binds to canine programmed death protein 1 (PD-1) . In some embodiments, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 33. In some embodiments, the antibody or antigen-binding fragment thereof comprises a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 35. In some embodiments, the antibody or antigen-binding fragment thereof comprises an immunoglobulin heavy chain, comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 39. In some embodiments, the antibody or antigen-binding fragment thereof comprises an immunoglobulin light chain, comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 41.

[0113] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 33; and a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 35. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) .

[0114] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 33; and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 35. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) .

[0115] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprises an immunoglobulin heavy chain, comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 39, and an immunoglobulin light chain, comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 41. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) .

[0116] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprises an immunoglobulin heavy chain, comprising the amino acid sequence set forth in SEQ ID NO: 39, and an immunoglobulin light chain, comprising the amino acid sequence set forth in SEQ ID NO: 41. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) .

[0117] In certain aspects, the present disclosure provides an isolated binding polypeptide comprising an HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 43, an HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 44, an HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 45, an LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 46, an LCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 47, and an LCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 48. In some embodiments, the isolated binding polypeptide is an antibody or antigen-binding fragment thereof that specifically binds to canine programmed death protein 1 (PD-1) . In some embodiments, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 49. In some embodiments, the antibody or antigen-binding fragment thereof comprises a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 51. In some embodiments, the antibody or antigen-binding fragment thereof comprises an immunoglobulin heavy chain, comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 55. In some embodiments, the antibody or antigen-binding fragment thereof comprises an immunoglobulin light chain, comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 57.

[0118] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 49; and a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 51. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) .

[0119] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 49; and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 51. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) .

[0120] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprises an immunoglobulin heavy chain, comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 55, and an immunoglobulin light chain, comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NO: 57. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) .

[0121] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof comprises an immunoglobulin heavy chain, comprising the amino acid sequence set forth in SEQ ID NO: 55, and an immunoglobulin light chain, comprising the amino acid sequence set forth in SEQ ID NO: 57. In some cases, the antibody or antigen-binding fragment thereof specifically binds to canine programmed death protein 1 (PD-1) .

[0122] Tolerable variations of the complementarity determining regions (CDR) sequences will be known to those of skill in the art. For example, in some embodiments, the isolated binding polypeptide comprises a complementarity determining region (HCDR or LCDR) that comprises an amino acid sequence that has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%sequence identity to any of the amino acid sequences set forth in SEQ ID NOs: 1, 2, 3, 4, 5, 6, 27, 28, 29, 30, 31, 32, 43, 44, 45, 46, 47, or 48. in some embodiments the isolated binding polypeptide comprises a complementarity determining region (HCDR or LCDR) that comprises an amino acid sequence that has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%sequence identity to any of the amino acid sequences set forth in SEQ ID NOs: 1, 2, 3, 4, 5, or 6. In some embodiments, the isolated binding polypeptide comprises a complementarity determining region (HCDR or LCDR) that comprises an amino acid sequence that has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%sequence identity to any of the amino acid sequences set forth in SEQ ID NOs: 27, 28, 29, 30, 31, or 32. In some embodiments, the isolated binding polypeptide comprises a complementarity determining region (HCDR or LCDR) that comprises an amino acid sequence that has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%sequence identity to any of the amino acid sequences set forth in SEQ ID NOs: 43, 44, 45, 46, 47, or 48. In some embodiments, the isolated binding polypeptide is an antibody or antigen-binding fragment thereof that specifically binds to canine programmed death protein 1 (PD-1) .

[0123] In some embodiments, the isolated binding polypeptide binds a programmed death protein 1 (PD-1) , for example, canine PD-1. In some embodiments, the binding polypeptide comprises an antibody or an antigen-binding fragment thereof. In some embodiments, the antibody or antigen-binding fragment thereof is an IgG, an IgM, an IgE, an IgA, or an IgD molecule. In some embodiments, the antibody or antigen-binding fragment thereof is derived from an IgG, an IgM, an IgE, an IgA, or an IgD molecule. In some embodiments, the antigen-binding fragment is selected from the group consisting of a full-length antibody, a Fab, a single-chain variable fragment (scFv) , a single-domain antibody, sc (Fv) 2, dsFv, Fab, Fab', (Fab') 2 and a diabody. In further embodiments, the antibody is a full-length antibody. In yet further embodiments, the antibody or antigen-binding fragment is a canine or caninized antibody or antigen-binding fragment thereof. In some embodiments, the antibody or antigen-binding fragment is a canine antibody or an antigen-binding fragment thereof. In some embodiments, the antibody or antigen-binding fragment is a canine antibody. In some embodiments, the antibody or antigen-binding fragment is a canine IgG4 antibody. In some embodiments, the antibody or antigen-binding fragment is an scFv. In some embodiments, the antibody or antigen-binding fragment is a canine or caninized scFv. In some embodiments, the antibody or antigen-binding fragment is a canine scFv. In some embodiments, the specific binding of antibody or antigen-binding fragment thereof to cPD-1 disrupts the interaction of cPD-1 and a ligand of cPD-1 (e.g., canine programmed death-ligand 1) . In some embodiments, the specific binding of antibody or antigen-binding fragment thereof to cPD-1 inhibits the interaction of cPD-1 and a ligand of cPD-1 (e.g., canine programmed death-ligand 1) . In some embodiments, the specific binding of antibody or antigen-binding fragment thereof to cPD-1 inhibits a signaling pathway activated by interaction of cPD-1 and a ligand of cPD-1 (e.g., canine programmed death-ligand 1) . In some embodiments, the specific binding of antibody or antigen-binding fragment thereof to cPD-1 inhibits cPD-1 signaling pathway.

[0124] In certain embodiments, the binding polypeptide comprises a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%identity to the amino acid sequence of the heavy chain variable region set forth in SEQ ID NOs: 7, 9, 33, or 49. In certain embodiments, the binding polypeptide comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NOs: 7, 9, 33, or 49. In certain embodiments, the binding polypeptide comprises a heavy chain variable region consisting of the amino acid sequences set forth in SEQ ID NO: 7, 9, 33, or 49.

[0125] In certain embodiments, the binding polypeptide comprises a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%identity to the amino acid sequence set forth in SEQ ID NOs: 11, 35, or 51. In certain embodiments, the binding polypeptide comprises a light chain variable region comprising an amino acid sequence set forth in SEQ ID NOs: 11, 35, or 51. In certain embodiments, the binding polypeptide comprises a light chain variable region comprising an amino acid sequence set forth in SEQ ID NOs: 11, 35, or 51.

[0126] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7 or 9 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 11.

[0127] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 33 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 35.

[0128] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 49 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 51.

[0129] In certain embodiments, the present disclosure includes an antibody that binds to the same epitope on canine PD-1 as an antibody of the present disclosure (i.e., antibodies that have the ability to cross-compete for binding to canine PD-1 with any of the antibodies of the present disclosure) . In a preferred embodiment, the reference antibody for cross-competition studies can be one of the antibodies described herein (e.g., P3C6mut3.1, P3C6mut3.2, P4B1, or A6 in Table 1 and Example 1) . For example, Biacore analysis, ELISA assays or flow cytometry can be used to demonstrate cross-competition with the antibodies of the current present disclosure. The ability of a test antibody to inhibit the binding of, for example, P3C6mut3.1 or P3C6mut3.2, to cPD-1 demonstrates that the test antibody can compete with P3C6mut3.1 or P3C6mut3.2 for binding to cPD-1 and thus is considered to bind to the same epitope of PD-1 as P3C6mut3.1 or P3C6mut3.2.

[0130] An antibody of the present disclosure can be prepared using an antibody having one or more of the VH and / or VL sequences or any fragments thereof disclosed herein as a starting material to engineer a modified antibody, which modified antibody can have altered properties as compared with the starting antibody. An antibody can be engineered by modifying one or more amino acids within one or both variable regions (i.e., VH and / or VL) , for example within one or more CDR regions and / or within one or more framework regions. Additionally or alternatively, an antibody can be engineered by modifying residues within the constant region (s) , for example to alter the effector function (s) of the antibody.

[0131] Also provided is a single-chain variable fragment (scFv) specifically binds to canine programmed death protein 1 (PD-1) . In some cases, the scFv comprises an antigen-binding domain. In some cases, the specific binding of antibody or antigen-binding fragment thereof to cPD-1 disrupts the interaction of cPD-1 and a ligand of cPD-1 (e.g., canine programmed death-ligand 1) .

[0132] As used herein, the term “single-chain variable fragment” or “scFv” is a fusion protein of the variable regions of the heavy (VH) and light chains (VL) of an immunoglobulin (e.g., mouse, canine, or human) covalently linked to form a VH: VL heterodimer. The heavy (VH) and light chains (VL) are either joined directly or joined by a peptide-encoding linker, which connects the N-terminus of the VH with the C-terminus of the VL, or the C-terminus of the VH with the N-terminus of the VL. In some embodiments, the antigen binding domain (e.g., PD-1 binding domain) comprises an scFv having the configuration from N-terminus to C-terminus, VH –linker –VL. In some embodiments, the antigen binding domain comprises an scFv having the configuration from N-terminus to C-terminus, VL –linker –VH. Those of skill in the art would be able to select the appropriate configuration for use in the present disclosure.

[0133] The linker is usually rich in glycine for flexibility, as well as serine or threonine for solubility. The linker can link the heavy chain variable region and the light chain variable region of the extracellular antigen-binding domain. Non-limiting examples of linkers are disclosed in Shen et al., Anal. Chem. 80 (6) : 1910-1917 (2008) and WO 2014 / 087010, the contents of which are hereby incorporated by reference in their entireties. Various linker sequences are known in the art, including, without limitation, glycine serine (GS) linkers such as (GS) n, (GSGGS) n (SEQ ID NO: 65) , (GGGS) n (SEQ ID NO: 66) , and (GGGGS) n (SEQ ID NO: 67) , where n represents an integer of at least 1. Exemplary linker sequences can comprise amino acid sequences including, without limitation, GGSG (SEQ ID NO: 68) , GGSGG (SEQ ID NO: 69) , GSGSG (SEQ ID NO: 70) , GSGGG (SEQ ID NO: 71) , GGGSG (SEQ ID NO: 72) , GSSSG (SEQ ID NO: 73) , GGGGS (SEQ ID NO: 74) , GGGGSGGGGSGGGGS (SEQ ID NO: 75) , GGGSSRSSSSGGGGSGGGG (SEQ ID NO: 76) and the like. Those of skill in the art would be able to select the appropriate linker sequence for use in the present disclosure. In one embodiment, an scFv of the present disclosure comprises a heavy chain variable region (VH) and a light chain variable region (VL) , wherein the VH and VL are connected by the linker sequence having the amino acid sequence GGGSSRSSSSGGGGSGGGG (SEQ ID NO: 76) , which can be encoded by the nucleic acid sequence GGCGGTGGTTCCTCTAGATCTTCCTCCTCTGGTGGCGGTGGCTCGGGCGGTGGTGGG (SEQ ID NO: 77) in which an arginine residue, R, is present as a result of including a nucleotide sequence for the restriction endonuclease Xba I. The presence of restriction sites in the linker along with those flanking an scFv construct will be recognized by those skilled in the art to be useful for performing heavy chain / light chain “swapping” experiments for antibody optimization, if desired.

[0134] Despite removal of the constant regions and the introduction of a linker, scFv proteins retain the specificity of the original immunoglobulin. Single chain Fv polypeptide antibodies can be expressed from a nucleic acid comprising VH-and VL-encoding sequences as described by Huston et al. (Proc. Nat. Acad. Sci. USA, 85: 5879-5883, 1988) . See, also, U.S. Patent Nos. 5,091,513, 5,132,405 and 4,956,778; and U.S. Patent Publication Nos. 20050196754 and 20050196754. Antagonistic scFvs having inhibitory activity have been described (see, e.g., Zhao et al., Hyrbidoma (Larchmt) 2008 27 (6) : 455-51; Peter et al., J Cachexia Sarcopenia Muscle 2012 August 12; Shieh et al., J Imunol 2009 183 (4) : 2277-85; Giomarelli et al., Thromb Haemost 2007 97 (6) : 955-63; Fife eta., J Clin Invst 2006 116 (8) : 2252-61; Brocks et al., Immunotechnology 1997 3 (3) : 173-84; Moosmayer et al., Ther Immunol 1995 2 (10: 31-40) . Agonistic scFvs having stimulatory activity have been described (see, e.g., Peter et al., J Bioi Chem 2003 25278 (38) : 36740-7; Xie et al., Nat Biotech 1997 15 (8) : 768-71; Ledbetter et al., Crit Rev Immunol 1997 17 (5-6) : 427-55; Ho et al., BioChim Biophys Acta 2003 1638 (3) : 257-66) .

[0135] In certain embodiments, the antigen-binding domain of the scFv comprises a heavy chain variable region that comprises three heavy chain complementarity determining regions (HCDRs) and a light chain variable region that comprises three light chain complementarity determining regions (LCDRs) . HCDR1 comprises the amino acid sequence (SEQ ID NOs: 1, 27, or 43) , and / or HCDR2 comprises the amino acid sequence (SEQ ID NOs: 2, 28, or 44) , and / or HCDR3 comprises the amino acid sequence (SEQ ID NO: 3, 29, or 45) and / or LCDR1 comprises the amino acid sequence (SEQ ID NOs: 4, 30, or 46) , and / or LCDR2 comprises the amino acid sequence (SEQ ID NO: 5, 31, or 47) , and / or LCDR3 comprises the amino acid sequence (SEQ ID NO: 6, 32, or 48) . The heavy chain variable region and the light chain variable region are connected by a linker.

[0136] Also provided is a single-chain variable fragment (scFv) comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NOs: 7, 9, 33, or 49 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 11, 35, or 51. The heavy chain variable region and the light chain variable region are connected by a linker.

[0137] In another aspect, a single chain variable fragment (scFv) comprising an amino acid sequence set forth in SEQ ID NOs: 13, 15, 17, 37, or 53, is provided. In another aspect, a single chain variable fragment (scFv) consisting of an amino acid sequence set forth in SEQ ID NOs: 13, 15, 17, 37, or 53, is provided.

[0138] Tolerable variations of the scFv sequences will be known to those of skill in the art. For example, in some embodiments the scFv comprises an amino acid sequence that has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%sequence identity to any of the amino acid sequences set forth in SEQ ID NOs: 13, 15, 17, 37, or 53.

[0139] In another aspect, a full-length antibody comprising a heavy chain comprising an amino acid sequence set forth in SEQ ID NOs: 19, 21, 23, 39, 55, or 70-75 and a light chain comprising an amino acid sequence set forth in SEQ ID NOs: 25, 41, or 57 is provided. In another aspect, a full-length antibody consisting of a heavy chain comprising an amino acid sequence set forth in SEQ ID NOs: 19, 21, 23, 39, 55, or 70-75 and a light chain comprising an amino acid sequence set forth in SEQ ID NOs: 25, 41, or 57 is provided.

[0140] Tolerable variations of the full-length antibody sequences will be known to those of skill in the art. For example, in some embodiments the antibody comprises a heavy chain comprising an amino acid sequence that has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%sequence identity to any of the amino acid sequences set forth in SEQ ID NOs: 19, 21, 23, 39, 55, or 70-75 and a light chain comprising an amino acid sequence that has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%sequence identity to any of the amino acid sequences set forth in SEQ ID NOs: 25, 41, or 57.

[0141] In certain embodiments, the full-length heavy chains or light chains of the antibodies or antigen-binding fragments thereof of the present disclosure further comprise a leader sequence. In certain embodiments, the leader sequences comprise the amino acid sequence set forth in SEQ ID NO: 60. In certain embodiments, the leader sequence is encoded by the nucleotide sequence set forth in SEQ ID NO: 59.

[0142] In certain embodiments, the full-length heavy chains of the antibodies or antigen-binding fragments thereof of the present disclosure further comprise a linker and HA or hemagglutinin-tag on the carboxy terminus of the polypeptide. In certain embodiments, the heavy chain linker and HA tag comprise the amino acid sequence set forth in SEQ ID NO: 62. In certain embodiments, the heavy chain linker and HA tag are encoded by a nucleotide sequence set forth in SEQ ID NO: 61.

[0143] In certain embodiments, the scFvs of the present disclosure further comprises an IgG fragment and 6x HIS or histidine –hemagglutinin tag on the carboxy terminus of the polypeptide. In certain embodiments, the scFv IgG fragment –6x HIS –hemagglutinin tag comprises the amino acid sequence set forth in SEQ ID NO: 64. In certain embodiments, the scFv IgG fragment –6x HIS –hemagglutinin tag is encoded by a nucleic acid sequence set forth in SEQ ID NO: 63.

[0144] In certain embodiments, antibodies or antigen binding fragments disclosed herein include any of those disclosed in International Publication Number WO2023108138 A1 , which is herein incorporated by reference in its entirety.

[0145] In another aspect, provided herein is an antibody comprising a Fc region of canine IgG subclass IgGA, IgGB, IgGC, or IgGD, and a hinge region of canine IgG subclass IgGA, IgGB, IgGC, or IgGD, wherein the Fc region and the hinge region are of different canine IgG subclasses. In certain embodiments, the antibody is a full-length antibody. In certain embodiments, the antibody comprises a CH1 region, where in the CH1 region and the hinge region are of the same canine IgG subclass.

[0146] In certain embodiments, the Fc region is of canine IgG subclass IgGA. In certain embodiments, the Fc region is of canine IgG subclass IgGB. In certain embodiments, the Fc region is of canine IgG subclass IgGC. In certain embodiments, the Fc region is of canine IgG subclass IgGD. In certain embodiments, the Fc region has at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%, or 100%identity to the amino acid sequence of a natural Fc region of canine IgG subclass IgGA, IgGB, IgGC, or IgGD. A natural Fc region of canine IgG subclass IgGA, IgGB, IgGC, or IgGD is known to a person of ordinary skill in the art.

[0147] In certain embodiments, the hinge region is of canine IgG subclass IgGA. In certain embodiments, the hinge region is of canine IgG subclass IgGB. In certain embodiments, the hinge region is of canine IgG subclass IgGC. In certain embodiments, the hinge region is of canine IgG subclass IgGD. In certain embodiments, the hinge region has at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%, or 100%identity to the amino acid sequence of a natural hinge region of canine IgG subclass IgGA, IgGB, IgGC, or IgGD. A natural Hinge region of canine IgG subclass IgGA, IgGB, IgGC, or IgGD is known to a person of ordinary skill in the art.

[0148] In certain embodiments, the antibody comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%, or 100%identity to the amino acid sequence of SEQ ID NO: 66. In certain embodiments, the antibody comprises an amino acid sequence having at least 80%identity to the amino acid sequence of SEQ ID NO: 66. In certain embodiments, the antibody comprises an amino acid sequence having at least 85%identity to the amino acid sequence of SEQ ID NO: 66. In certain embodiments, the antibody comprises an amino acid sequence having at least 90%identity to the amino acid sequence of SEQ ID NO: 66. In certain embodiments, the antibody comprises an amino acid sequence having at least 95%identity to the amino acid sequence of SEQ ID NO: 66. In certain embodiments, the antibody comprises an amino acid sequence having at least 96%identity to the amino acid sequence of SEQ ID NO: 66. In certain embodiments, the antibody comprises an amino acid sequence having at least 97%identity to the amino acid sequence of SEQ ID NO: 66. In certain embodiments, the antibody comprises an amino acid sequence having at least 98%identity to the amino acid sequence of SEQ ID NO: 66. In certain embodiments, the antibody comprises an amino acid sequence having at least 99%identity to the amino acid sequence of SEQ ID NO: 66. In certain embodiments, the antibody comprises an amino acid sequence having 100%identity to the amino acid sequence of SEQ ID NO: 66.

[0149] In certain embodiments, the antibody comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%, or 100%identity to the amino acid sequence of SEQ ID NO: 67. In certain embodiments, the antibody comprises an amino acid sequence having at least 80%identity to the amino acid sequence of SEQ ID NO: 67. In certain embodiments, the antibody comprises an amino acid sequence having at least 85%identity to the amino acid sequence of SEQ ID NO: 67. In certain embodiments, the antibody comprises an amino acid sequence having at least 90%identity to the amino acid sequence of SEQ ID NO: 67. In certain embodiments, the antibody comprises an amino acid sequence having at least 95%identity to the amino acid sequence of SEQ ID NO: 67. In certain embodiments, the antibody comprises an amino acid sequence having at least 96%identity to the amino acid sequence of SEQ ID NO: 67. In certain embodiments, the antibody comprises an amino acid sequence having at least 97%identity to the amino acid sequence of SEQ ID NO: 67. In certain embodiments, the antibody comprises an amino acid sequence having at least 98%identity to the amino acid sequence of SEQ ID NO: 67. In certain embodiments, the antibody comprises an amino acid sequence having at least 99%identity to the amino acid sequence of SEQ ID NO: 67. In certain embodiments, the antibody comprises an amino acid sequence having 100%identity to the amino acid sequence of SEQ ID NO: 67.

[0150] In certain embodiments, the antibody comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%, or 100%identity to the amino acid sequence of SEQ ID NO: 68. In certain embodiments, the antibody comprises an amino acid sequence having at least 80%identity to the amino acid sequence of SEQ ID NO: 68. In certain embodiments, the antibody comprises an amino acid sequence having at least 85%identity to the amino acid sequence of SEQ ID NO: 68. In certain embodiments, the antibody comprises an amino acid sequence having at least 90%identity to the amino acid sequence of SEQ ID NO: 68. In certain embodiments, the antibody comprises an amino acid sequence having at least 95%identity to the amino acid sequence of SEQ ID NO: 68. In certain embodiments, the antibody comprises an amino acid sequence having at least 96%identity to the amino acid sequence of SEQ ID NO: 68. In certain embodiments, the antibody comprises an amino acid sequence having at least 97%identity to the amino acid sequence of SEQ ID NO: 68. In certain embodiments, the antibody comprises an amino acid sequence having at least 98%identity to the amino acid sequence of SEQ ID NO: 68. In certain embodiments, the antibody comprises an amino acid sequence having at least 99%identity to the amino acid sequence of SEQ ID NO: 68. In certain embodiments, the antibody comprises an amino acid sequence having 100%identity to the amino acid sequence of SEQ ID NO: 68.

[0151] In certain embodiments, the antibody comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99%, or 100%identity to the amino acid sequence of SEQ ID NO: 69. In certain embodiments, the antibody comprises an amino acid sequence having at least 80%identity to the amino acid sequence of SEQ ID NO: 69. In certain embodiments, the antibody comprises an amino acid sequence having at least 85%identity to the amino acid sequence of SEQ ID NO: 69. In certain embodiments, the antibody comprises an amino acid sequence having at least 90%identity to the amino acid sequence of SEQ ID NO: 69. In certain embodiments, the antibody comprises an amino acid sequence having at least 95%identity to the amino acid sequence of SEQ ID NO: 69. In certain embodiments, the antibody comprises an amino acid sequence having at least 96%identity to the amino acid sequence of SEQ ID NO: 69. In certain embodiments, the antibody comprises an amino acid sequence having at least 97%identity to the amino acid sequence of SEQ ID NO: 69. In certain embodiments, the antibody comprises an amino acid sequence having at least 98%identity to the amino acid sequence of SEQ ID NO: 69. In certain embodiments, the antibody comprises an amino acid sequence having at least 99%identity to the amino acid sequence of SEQ ID NO: 69. In certain embodiments, the antibody comprises an amino acid sequence having 100%identity to the amino acid sequence of SEQ ID NO: 69.

[0152] In certain embodiments, the antibody is a canine or caninized antibody that binds to a canine antigen. In certain embodiments, the antibody binds to canine programmed death protein 1 (cPD-1) . In certain embodiments, the antibody binding to cPD-1 is comprises any of the any of the CDRs, VHs, or VLs disclosed hererin. In certain embodiments, the antibody comprises: an immunoglobulin heavy chain comprising a heavy chain complementarity determining region 1 (HCDR1) comprising the amino acid sequence set forth in SEQ ID NOs: 1, 27, or 43, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NOs: 2, 28, or 44, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NOs: 3, 29, or 45, and an immunoglobulin light chain comprising a light chain complementarity determining region 1 (LCDR1) comprising the amino acid sequence set forth in SEQ ID NOs: 4, 30, or 46, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NOs: 5, 31, or 47, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NOs: 6, 32, or 48.

[0153] In certain embodiments, the antibody comprises an immunoglobulin heavy chain comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%identity to the amino acid sequence set forth in SEQ ID NOs: 19, 21, 23, 39, 55, or 70-75. In certain embodiments, the antibody comprises an immunoglobulin light chain comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%identity to the amino acid sequence set forth in SEQ ID NOs: 25, 41, or 57.

[0154] In certain embodiments, the antibody comprises an immunoglobulin heavy chain comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%or 100%identity to the amino acid sequence of set forth in SEQ ID NOs: 70, and an immunoglobulin light chain comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%or 100%identity to the amino acid sequence set forth in SEQ ID NO:25.

[0155] In certain embodiments, the antibody comprises an amino acid mutation AA at the C-terminus of the hinge region relative to the natural hinge region. In certain embodiments, the antibody lacks the ability to mediate antibody dependent cell-mediated cytotoxicity (ADCC) or has reduced ability to mediate ADCC relative to a reference antibody having substantially the same sequence except without the AA mutation at the C-terminus of the hinge region. In some embodiments, an antibody described herein does not induce anti-drug antibodies when administered to a subject (e.g., a canine) . In some embodiments, after administering an antibody described herein to a subject, accelerated elimination of the antibody by an anti-drug antibody is not observed. Table 1: Sequences used in the present disclosure

[0156] Nucleic Acids and Expression Vectors

[0157] The present disclosure provides an isolated nucleic acid encoding a polypeptide. The nucleic acid of the present disclosure can comprise a polynucleotide sequence encoding any one of the binding polypeptides, scFv, antibodies or any fragments thereof disclosed herein.

[0158] One aspect of the present disclosure includes an isolated nucleic acid or nucleic acids encoding any of the antibody disclosed herein. Tolerable variations of the nucleic acid sequences will be known to those of skill in the art.

[0159] In certain embodiments, a nucleic acid of the present disclosure comprises a first polynucleotide sequence and a second polynucleotide sequence. The first and second polynucleotide sequence can be connected by a linker. For example, in certain embodiments the heavy chain variable region and the light chain variable region of an scFv are connected by a linker. In certain embodiments, the nucleic acid comprises from 5’ to 3’ the first polynucleotide sequence, the linker, and the second polynucleotide sequence. In certain embodiments, the nucleic acid comprises from 5’ to 3’ the second polynucleotide sequence, the linker, and the first polynucleotide sequence.

[0160] Another aspect of the present disclosure provides a vector comprising any one of the isolated nucleic acids disclosed herein. In certain embodiments, the vector is selected from the group consisting of a DNA vector, an RNA vector, a plasmid, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, and a retroviral vector. In certain embodiments, the vector is an expression vector.

[0161] Also provided is a host cell comprising any of the vectors or nucleic acids disclosed herein. The host cell can be of eukaryotic, prokaryotic, mammalian, or bacterial origin. Non-limiting examples of cells that can be used to express the disclosed herein include Human embryonic kidney (HEK) cell lines (e.g., HEK293) , Chinese hamster ovary (CHO) cell lines, Baby hamster kidney (BHK) cell lines, COS cell lines, Madin Darby canine kidney (MDCK) cell line, and HeLa cell lines. In some cases, the host cell is a Chinese Hamster Ovary cell.

[0162] A method of producing an antibody (e.g., an antibody that binds to canine PD-1) is also provided herein, wherein the method comprises culturing the host cell. In some embodiments, the method further comprises incubating the host cell in a cell culture medium under conditions sufficient to allow expression and secretion of the antibody described herein.

[0163] In some embodiments, a nucleic acid of the present disclosure can be operably linked to a transcriptional control element, e.g., a promoter, and enhancer, etc. Suitable promoter and enhancer elements are known to those of skill in the art.

[0164] In certain embodiments, the nucleic acid is in operable linkage with a promoter. In certain embodiments, the promoter is a phosphoglycerate kinase-1 (PGK) promoter.

[0165] For expression in a bacterial cell, suitable promoters include, but are not limited to, lacI, lacZ, T3, T7, gpt, lambda P and trc. For expression in a eukaryotic cell, suitable promoters include, but are not limited to, light and / or heavy chain immunoglobulin gene promoter and enhancer elements; cytomegalovirus immediate early promoter; herpes simplex virus thymidine kinase promoter; early and late SV40 promoters; promoter present in long terminal repeats from a retrovirus; mouse metallothionein-I promoter; and various art-known tissue specific promoters. Suitable reversible promoters, including reversible inducible promoters are known in the art. Such reversible promoters can be isolated and derived from many organisms, e.g., eukaryotes and prokaryotes. Modification of reversible promoters derived from a first organism for use in a second organism, e.g., a first prokaryote and a second a eukaryote, a first eukaryote and a second a prokaryote, etc., is well known in the art. Such reversible promoters, and systems based on such reversible promoters but also comprising additional control proteins, include, but are not limited to, alcohol regulated promoters (e.g., alcohol dehydrogenase I (alcA) gene promoter, promoters responsive to alcohol transactivator proteins (A1cR) , etc. ) , tetracycline regulated promoters, (e.g., promoter systems including TetActivators, TetON, TetOFF, etc. ) , steroid regulated promoters (e.g., rat glucocorticoid receptor promoter systems, human estrogen receptor promoter systems, retinoid promoter systems, thyroid promoter systems, ecdysone promoter systems, mifepristone promoter systems, etc. ) , metal regulated promoters (e.g., metallothionein promoter systems, etc. ) , pathogenesis-related regulated promoters (e.g., salicylic acid regulated promoters, ethylene regulated promoters, benzothiadiazole regulated promoters, etc. ) , temperature regulated promoters (e.g., heat shock inducible promoters (e.g., HSP-70, HSP-90, soybean heat shock promoter, etc. ) , light regulated promoters, synthetic inducible promoters, and the like.

[0166] For expression in a yeast cell, a suitable promoter is a constitutive promoter such as an ADH1 promoter, a PGK1 promoter, an ENO promoter, a PYK1 promoter and the like; or a regulatable promoter such as a GAL1 promoter, a GAL10 promoter, an ADH2 promoter, a PHOS promoter, a CUP1 promoter, a GALT promoter, a MET25 promoter, a MET3 promoter, a CYC1 promoter, a HIS3 promoter, an ADH1 promoter, a PGK promoter, a GAPDH promoter, an ADC1 promoter, a TRP1 promoter, a URA3 promoter, a LEU2 promoter, an ENO promoter, a TP1 promoter, and AOX1 (e.g., for use in Pichia) . Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art. Suitable promoters for use in prokaryotic host cells include, but are not limited to, a bacteriophage T7 RNA polymerase promoter; a trp promoter; a lac operon promoter; a hybrid promoter, e.g., a lac / tac hybrid promoter, a tac / trc hybrid promoter, a trp / lac promoter, a T7 / lac promoter; a trc promoter; a tac promoter, and the like; an araBAD promoter; in vivo regulated promoters, such as an ssaG promoter or a related promoter (see, e.g., U.S. Patent Publication No. 20040131637) , a pagC promoter (Pulkkinen and Miller, J. Bacteriol. (1991) 173 (1) : 86-93; Alpuche-Aranda et al., Proc. Natl. Acad. Sci. USA (1992) 89 (21) : 10079-83) , a nirB promoter (Harborne et al. Mol. Micro. (1992) 6: 2805-2813) , and the like (see, e.g., Dunstan et al., Infect. Immun. (1999) 67: 5133-5141; McKelvie et al., Vaccine (2004) 22: 3243-3255; and Chatfield et al., Biotechnol. (1992) 10: 888-892) ; a sigma70 promoter, e.g., a consensus sigma70 promoter (see, e.g., GenBank Accession Nos. AX798980, AX798961, and AX798183) ; a stationary phase promoter, e.g., a dps promoter, an spv promoter, and the like; a promoter derived from the pathogenicity island SPI-2 (see, e.g., WO96 / 17951) ; an actA promoter (see, e.g., Shetron-Rama et al., Infect. Immun. (2002) 70: 1087-1096) ; an rpsM promoter (see, e.g., Valdivia and Falkow Mol. Microbiol. (1996) . 22: 367) ; a tet promoter (see, e.g., Hillen, W. and Wissmann, A. (1989) In Saenger, W. and Heinemann, U. (eds) , Topics in Molecular and Structural Biology, Protein--Nucleic Acid Interaction. Macmillan, London, UK, Vol. 10, pp. 143-162) ; an SP6 promoter (see, e.g., Melton et al., Nucl. Acids Res. (1984) 12: 7035) ; and the like. Suitable strong promoters for use in prokaryotes such as Escherichia coli include, but are not limited to Trc, Tac, T5, T7, and PLambda. Non-limiting examples of operators for use in bacterial host cells include a lactose promoter operator (LacI repressor protein changes conformation when contacted with lactose, thereby preventing the Lad repressor protein from binding to the operator) , a tryptophan promoter operator (when complexed with tryptophan, TrpR repressor protein has a conformation that binds the operator; in the absence of tryptophan, the TrpR repressor protein has a conformation that does not bind to the operator) , and a tac promoter operator (see, e.g., deBoer et al., Proc. Natl. Acad. Sci. U.S. A. (1983) 80: 21-25) .

[0167] Other examples of suitable promoters include the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operatively linked thereto. Other constitutive promoter sequences can also be used, including, but not limited to a simian virus 40 (SV40) early promoter, a mouse mammary tumor virus (MMTV) or human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, a MoMuLV promoter, an avian leukemia virus promoter, an Epstein-Barr virus immediate early promoter, a Rous sarcoma virus promoter, the EF-1 alpha promoter, as well as human gene promoters such as, but not limited to, an actin promoter, a myosin promoter, a hemoglobin promoter, and a creatine kinase promoter. Further, the present disclosure should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the present disclosure. The use of an inducible promoter provides a molecular switch capable of turning on expression of the polynucleotide sequence which it is operatively linked when such expression is desired or turning off the expression when expression is not desired. Examples of inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter.

[0168] In some embodiments, the locus or construct or transgene containing the suitable promoter is irreversibly switched through the induction of an inducible system. Suitable systems for induction of an irreversible switch are well known in the art, e.g., induction of an irreversible switch can make use of a Cre-lox-mediated recombination (see, e.g., Fuhrmann-Benzakein, et al., Proc. Natl. Acad. Sci. USA (2000) 28: e99, the present disclosure of which is incorporated herein by reference) . Any suitable combination of recombinase, endonuclease, ligase, recombination sites, etc. known to the art can be used in generating an irreversibly switchable promoter. Methods, mechanisms, and requirements for performing site-specific recombination, described elsewhere herein, find use in generating irreversibly switched promoters and are well known in the art, see, e.g., Grindley et al. Annual Review of Biochemistry (2006) 567-605; and Tropp, Molecular Biology (2012) (Jones &Bartlett Publishers, Sudbury, Mass. ) , the present disclosures of which are incorporated herein by reference.

[0169] A nucleic acid of the present disclosure can be present within an expression vector and / or a cloning vector. An expression vector can include a selectable marker, an origin of replication, and other features that provide for replication and / or maintenance of the vector. Suitable expression vectors include, e.g., plasmids, viral vectors, and the like. Large numbers of suitable vectors and promoters are known to those of skill in the art; many are commercially available for generating a subject recombinant construct. The following vectors are provided by way of example and should not be construed in anyway as limiting: Bacterial: pBs, phagescript, PsiX174, pBluescript SK, pBs KS, pNH8a, pNH16a, pNH18a, pNH46a (Stratagene, La Jolla, Calif., USA) ; pTrc99A, pKK223-3, pKK233-3, pDR540, and pRIT5 (Pharmacia, Uppsala, Sweden) . Eukaryotic: pWLneo, pSV2cat, pOG44, PXR1, pSG (Stratagene) pSVK3, pBPV, pMSG and pSVL (Pharmacia) .

[0170] Expression vectors generally have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences encoding heterologous proteins. A selectable marker operative in the expression host can be present. Suitable expression vectors include, but are not limited to, viral vectors (e.g., viral vectors based on vaccinia virus; poliovirus; adenovirus (see, e.g., Li et al., Invest. Opthalmol. Vis. Sci. (1994) 35: 2543-2549; Borras et al., Gene Ther. (1999) 6: 515-524; Li and Davidson, Proc. Natl. Acad. Sci. USA (1995) 92: 7700-7704; Sakamoto et al., H. Gene Ther. (1999) 5: 1088-1097; WO 94 / 12649, WO 93 / 03769; WO 93 / 19191; WO 94 / 28938; WO 95 / 11984 and WO 95 / 00655) ; adeno-associated virus (see, e.g., Ali et al., Hum. Gene Ther. (1998) 9: 81-86, Flannery et al., Proc. Natl. Acad. Sci. USA (1997) 94: 6916-6921; Bennett et al., Invest. Opthalmol. Vis. Sci. (1997) 38: 2857-2863; Jomary et al., Gene Ther. (1997) 4: 683 690, Rolling et al., Hum. Gene Ther. (1999) 10: 641-648; Ali et al., Hum. Mol. Genet. (1996) 5: 591-594; Srivastava in WO 93 / 09239, Samulski et al., J. Vir. (1989) 63: 3822-3828; Mendelson et al., Virol. (1988) 166: 154-165; and Flotte et al., Proc. Natl. Acad. Sci. USA (1993) 90: 10613-10617) ; SV40; herpes simplex virus; human immunodeficiency virus (see, e.g., Miyoshi et al., Proc. Natl. Acad. Sci. USA (1997) 94: 10319-23; Takahashi et al., J. Virol. (1999) 73: 7812-7816) ; a retroviral vector (e.g., Murine Leukemia Virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus) ; and the like.

[0171] Additional expression vectors suitable for use are, e.g., without limitation, a lentivirus vector, a gamma retrovirus vector, a foamy virus vector, an adeno-associated virus vector, an adenovirus vector, a pox virus vector, a herpes virus vector, an engineered hybrid virus vector, a transposon mediated vector, and the like. Viral vector technology is well known in the art and is described, for example, in Sambrook et al., 2012, Molecular Cloning: A Laboratory Manual, volumes 1-4, Cold Spring Harbor Press, NY) , and in other virology and molecular biology manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses.

[0172] In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers, (e.g., WO 01 / 96584; WO 01 / 29058; and U.S. Pat. No. 6,326,193) .

[0173] In some embodiments, an expression vector (e.g., a lentiviral vector) can be used to introduce the nucleic acid into a host cell. Accordingly, an expression vector (e.g., a lentiviral vector) of the present disclosure can comprise a nucleic acid encoding a polypeptide. In some embodiments, the expression vector (e.g., lentiviral vector) will comprise additional elements that will aid in the functional expression of the polypeptide encoded therein. In some embodiments, an expression vector comprising a nucleic acid encoding for a polypeptide further comprises a mammalian promoter. In one embodiment, the vector further comprises an elongation-factor-1-alpha promoter (EF-1α promoter) . Use of an EF-1α promoter can increase the efficiency in expression of downstream transgenes. Physiologic promoters (e.g., an EF-1αpromoter) can be less likely to induce integration mediated genotoxicity and can abrogate the ability of the retroviral vector to transform stem cells. Other physiological promoters suitable for use in a vector (e.g., lentiviral vector) are known to those of skill in the art and can be incorporated into a vector of the present disclosure. In some embodiments, the vector (e.g., lentiviral vector) further comprises a non-requisite cis acting sequence that can improve titers and gene expression. One non-limiting example of a non-requisite cis acting sequence is the central polypurine tract and central termination sequence (cPPT / CTS) which is important for efficient reverse transcription and nuclear import. Other non-requisite cis acting sequences are known to those of skill in the art and can be incorporated into a vector (e.g., lentiviral vector) of the present disclosure. In some embodiments, the vector further comprises a posttranscriptional regulatory element. Posttranscriptional regulatory elements can improve RNA translation, improve transgene expression and stabilize RNA transcripts. One example of a posttranscriptional regulatory element is the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) . Accordingly, in some embodiments a vector for the present disclosure further comprises a WPRE sequence. Various posttranscriptional regulator elements are known to those of skill in the art and can be incorporated into a vector (e.g., lentiviral vector) of the present disclosure. A vector of the present disclosure can further comprise additional elements such as a rev response element (RRE) for RNA transport, packaging sequences, and 5’ and 3’ long terminal repeats (LTRs) . The term “long terminal repeat” or “LTR” refers to domains of base pairs located at the ends of retroviral DNAs which comprise U3, R and U5 regions. LTRs generally provide functions required for the expression of retroviral genes (e.g., promotion, initiation and polyadenylation of gene transcripts) and to viral replication. In one embodiment, a vector (e.g., lentiviral vector) of the present disclosure includes a 3’ U3 deleted LTR. Accordingly, a vector (e.g., lentiviral vector) of the present disclosure can comprise any combination of the elements described herein to enhance the efficiency of functional expression of transgenes. For example, a vector (e.g., lentiviral vector) of the present disclosure can comprise a WPRE sequence, cPPT sequence, RRE sequence, 5’ LTR, 3’ U3 deleted LTR’ in addition to a nucleic acid encoding for a CAR.

[0174] Vectors of the present disclosure can be self-inactivating vectors. As used herein, the term “self-inactivating vector” refers to vectors in which the 3’ LTR enhancer promoter region (U3 region) has been modified (e.g., by deletion or substitution) . A self-inactivating vector can prevent viral transcription beyond the first round of viral replication. Consequently, a self-inactivating vector can be capable of infecting and then integrating into a host genome (e.g., a mammalian genome) only once, and cannot be passed further. Accordingly, self-inactivating vectors can greatly reduce the risk of creating a replication-competent virus.

[0175] In some embodiments, a nucleic acid of the present disclosure can be RNA, e.g., in vitro synthesized RNA. Methods for in vitro synthesis of RNA are known to those of skill in the art; any known method can be used to synthesize RNA comprising a sequence encoding a polypeptide of the present disclosure. Methods for introducing RNA into a host cell are known in the art. See, e.g., Zhao et al. Cancer Res. (2010) 15: 9053. Introducing RNA comprising a nucleotide sequence encoding a polypeptide of the present disclosure into a host cell can be carried out in vitro, ex vivo or in vivo. For example, a host cell (e.g., an NK cell, a cytotoxic T lymphocyte, etc. ) can be electroporated in vitro or ex vivo with RNA comprising a nucleotide sequence encoding a polypeptide of the present disclosure.

[0176] In order to assess the expression of a polypeptide or portions thereof, the expression vector to be introduced into a cell can also contain either a selectable marker gene or a reporter gene, or both, to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors. In some embodiments, the selectable marker can be carried on a separate piece of DNA and used in a co-transfection procedure. Both selectable markers and reporter genes can be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers include, without limitation, antibiotic-resistance genes.

[0177] Reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences. In general, a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a polypeptide whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Expression of the reporter gene is assessed at a suitable time after the DNA has been introduced into the recipient cells. Suitable reporter genes can include, without limitation, genes encoding luciferase, beta-galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene (e.g., Ui-Tei et al., 2000 FEBS Letters 479: 79-82) .

[0178] In some embodiments, a nucleic acid of the present disclosure is provided for the production of a polypeptide as described herein, e.g., in a host cell. In some embodiments, a nucleic acid of the present disclosure provides for amplification of the polypeptide-encoding nucleic acid.

[0179] One advantage of the antibodies disclosed herein is that they have improved yield during manufacturing. The improved manufacturing yield is at least because less half antibody and HC dimer production are generated during manufacturing.

[0180] Methods of Treatment

[0181] In one aspect, the present disclosure provides a method for treating a disease or condition in a subject in need thereof comprising administering to the subject the antibodies, binding polypeptides, and scFvs described herein, or a bispecific molecule, an immunoconjugate, or a composition comprising any one of these. The disease or condition comprises cancer, sepsis or septic shock, or a chronic infection (e.g., viral infections) . The composition can include a pharmaceutical composition and further include a pharmaceutically acceptable carrier. A therapeutically effective amount of the pharmaceutical composition can be administered to the subject (e.g., a dog or canine) .

[0182] In certain embodiments, described herein is the antibodies, binding polypeptides, and scFvs described herein, or a bispecific molecule, an immunoconjugate, or a composition comprising any one of these, for use as a medicament.

[0183] In certain embodiments, described herein is the antibodies, binding polypeptides, and scFvs described herein, or a bispecific molecule, an immunoconjugate, or a composition comprising any one of these, for use as a medicament for the treatment of cancer, sepsis or septic shock, or chronic infection.

[0184] In certain embodiments, described herein is use of the antibodies, binding polypeptides, and scFvs described herein, or a bispecific molecule, an immunoconjugate, or a composition comprising any one of these, for the manufacture of a medicament.

[0185] In certain embodiments, described herein is use of the antibodies, binding polypeptides, and scFvs described herein, or a bispecific molecule, an immunoconjugate, or a composition comprising any one of these, for the manufacture of a medicament for the treatment of cancer, sepsis or septic shock, or chronic infection (e.g., viral infections) .

[0186] Treatment refers to a method that seeks to improve or ameliorate the condition being treated. With respect to cancer, treatment includes, but is not limited to, reduction of tumor volume, reduction in growth of tumor volume, increase in progression-free survival, or overall life expectancy. In certain embodiments, treatment will affect remission of a cancer being treated. In certain embodiments, treatment encompasses use as a prophylactic or maintenance dose intended to prevent reoccurrence or progression of a previously treated cancer or tumor. It is understood by those of skill in the art that not all individuals will respond equally or at all to a treatment that is administered, nevertheless these individuals are considered to be treated.

[0187] In certain embodiments, the cancer is associated with programmed death protein 1 (PD-1) signaling pathway. In certain embodiments, the PD-1 is expressed on an immune cell of the subject. In certain embodiments, the immune cell is a T lymphocyte. In certain embodiments, the immune cell is a tumor-infiltrating lymphocyte. In certain embodiments, a ligand of PD-1, such as PD-L1 or PD-L2 is expressed on a cancer cell of the subject. In certain embodiments, canine programmed death-ligand 1 is over-expressed on a cancer cell of the subject.

[0188] In certain embodiments, the binding polypeptide specifically binds to programmed death protein 1 (PD-1) . In certain embodiments, the binding polypeptide comprises an antibody or an antigen-binding fragment thereof. In certain embodiments, the antigen-binding fragment is selected from the group consisting of a Fab, a single-chain variable fragment (scFv) , a single-domain antibody, sc (Fv) 2, dsFv, Fab, Fab', (Fab') 2 and a diabody. In certain embodiments, the antibody is a full-length antibody. In certain embodiments, the antibody or antigen-binding fragment is a canine antibody or an antigen-binding fragment thereof.

[0189] In certain embodiments, the method further comprises administering one or more additional therapeutics or interventions. There is no limitation on such additional therapeutics or interventions, which can include any therapeutic agents or small molecule drugs that is helpful for treating the subject in need thereof. In some embodiments, the additional therapeutics or interventions are administered with the antibody or antigen-binding fragments thereof or the scfv described herein, or the bispecific molecule or the immunoconjugates comprising these, as a combination therapy. Non-limiting examples of additional therapeutics or interventions include chemotherapy (e.g., asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, and / or vincristine) , radiation therapy, immunotherapy, and other targeted therapy.

[0190] In certain embodiments, the cancer or tumor is a solid cancer or tumor. In certain embodiments, the cancer or tumor is a blood cancer or tumor. In certain embodiments, the cancer or tumor comprises breast, heart, lung, small intestine, colon, spleen, kidney, bladder, head, neck, ovarian, prostate, brain, pancreatic, skin, bone, bone marrow, blood, thymus, uterine, testicular, and liver tumors. In certain embodiments, tumors which can be treated with the antibodies of the present disclosure comprise adenoma, adenocarcinoma, angiosarcoma, astrocytoma, epithelial carcinoma, germinoma, glioblastoma, glioma, hemangioendothelioma, hemangiosarcoma, hematoma, hepatoblastoma, leukemia, lymphoma, medulloblastoma, melanoma, neuroblastoma, osteosarcoma, retinoblastoma, rhabdomyosarcoma, sarcoma and / or teratoma. In certain embodiments, the tumor / cancer is selected from the group of acral lentiginous melanoma, actinic keratosis, adenocarcinoma, adenoid cystic carcinoma, adenomas, adenosarcoma, adenosquamous carcinoma, astrocytic tumors, Bartholin gland carcinoma, basal cell carcinoma, bronchial gland carcinoma, capillary carcinoid, carcinoma, carcinosarcoma, cholangiocarcinoma, chondrosarcoma, cystadenoma, endodermal sinus tumor, endometrial hyperplasia, endometrial stromal sarcoma, endometrioid adenocarcinoma, ependymal sarcoma, Swing's sarcoma, focal nodular hyperplasia, gastronoma, germ line tumors, glioblastoma, glucagonoma, hemangioblastoma, hemangioendothelioma, hemangioma, hepatic adenoma, hepatic adenomatosis, hepatocellular carcinoma, insulinite, intraepithelial neoplasia, intraepithelial squamous cell neoplasia, invasive squamous cell carcinoma, large cell carcinoma, liposarcoma, lung carcinoma, lymphoblastic leukemia, lymphocytic leukemia, leiomyosarcoma, melanoma, malignant melanoma, malignant mesothelial tumor, nerve sheath tumor, medulloblastoma, medulloepithelioma, mesothelioma, mucoepidermoid carcinoma, myeloid leukemia, neuroblastoma, neuroepithelial adenocarcinoma, nodular melanoma, osteosarcoma, ovarian carcinoma, papillary serous adenocarcinoma, pituitary tumors, plasmacytoma, pseudosarcoma, prostate carcinoma, pulmonary blastoma, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, sarcoma, serous carcinoma, squamous cell carcinoma, small cell carcinoma, soft tissue carcinoma, somatostatin secreting tumor, squamous carcinoma, squamous cell carcinoma, undifferentiated carcinoma, uveal melanoma, verrucous carcinoma, vagina / vulva carcinoma, VIPpoma, and Wilm’s tumor. In certain embodiments, the tumor / cancer to be treated with one or more antibodies of the present disclosure comprise brain cancer, head and neck cancer, colorectal carcinoma, acute myeloid leukemia, pre-B-cell acute lymphoblastic leukemia, bladder cancer, astrocytoma, preferably grade II, III or IV astrocytoma, glioblastoma, glioblastoma multiforme, small cell cancer, and non-small cell cancer, preferably non-small cell lung cancer, lung adenocarcinoma, metastatic melanoma, androgen-independent metastatic prostate cancer, androgen-dependent metastatic prostate cancer, prostate adenocarcinoma, and breast cancer, preferably breast ductal cancer, and / or breast carcinoma. In certain embodiments, the cancer treated with the antibodies of this disclosure comprises glioblastoma. In certain embodiments, the cancer treated with one or more antibodies of this disclosure comprises pancreatic cancer. In certain embodiments, the cancer treated with one or more antibodies of this disclosure comprises ovarian cancer. In certain embodiments, the cancer treated with one or more antibodies of this disclosure comprises lung cancer. In certain embodiments, the cancer treated with one or more antibodies of this disclosure comprises prostate cancer. In certain embodiments, the cancer treated with one or more antibodies of this disclosure comprises colon cancer. In certain embodiments, the cancer treated comprises glioblastoma, pancreatic cancer, ovarian cancer, colon cancer, prostate cancer, or lung cancer. In a certain embodiment, the cancer is refractory to other treatment. In a certain embodiment, the cancer treated is relapsed.

[0191] In some embodiments, the cancer comprises a melanoma (e.g., metastatic malignant melanoma) , a prostate cancer (for example hormone refractory prostate adenocarcinoma) , a head and neck cancer (for example, squamous cell carcinoma of the head and neck) , a cervical cancer, a thyroid cancer, a glioblastoma, a glioma, leukemia, a lymphoma (for example, a B cell lymphoma) , an adrenal gland cancer, an AIDS-associated cancer, an alveolar soft part sarcoma, an astrocytic tumor, bone cancer, a brain and spinal cord cancer, a metastatic brain tumor, a carotid body tumor, a chondrosarcoma, a chordoma, a chromophobe renal cell carcinoma, a clear cell carcinoma, cutaneous benign fibrous histiocytoma, a desmoplastic small round cell tumor, an ependymoma, a Ewing's tumor, an extraskeletal myxoid chondrosarcoma, a fibrogenesis imperfecta ossium, a fibrous dysplasia of the bone, a gallbladder or bile duct cancer, a gestational trophoblastic disease, a germ cell tumor, a hematological malignancy, hepatocellular carcinoma, an islet cell tumor, a Kaposi's sarcoma, a kidney cancer, a lipoma / benign lipomatous tumor, a liposarcoma / malignant lipomatous tumor, a medulloblastoma, a meningioma, a Merkel cell carcinoma, a multiple endocrine neoplasia, a multiple myeloma, a myelodysplasia syndrome, a neuroblastoma, a neuroendocrine tumor, a papillary thyroid carcinoma, a parathyroid tumor, a pediatric cancer, a peripheral nerve sheath tumor, a phaeochromocytoma, a pituitary tumor, a prostate cancer, a posterior uveal melanoma, a rare hematologic disorder, a renal metastatic cancer, a rhabdoid tumor, a rhabdomysarcoma, a sarcoma, a soft-tissue sarcoma, a squamous cell cancer, a stomach cancer, a synovial sarcoma, a testicular cancer, a thymic carcinoma, a thymoma, a thyroid metastatic cancer, a uterine cancer, or any combination thereof.

[0192] In some cases, the cancer comprises cervical cancer, lung cancers, liver cancers, ovarian cancers, cancers of the skin including melanoma and squamous cell carcinoma, colon cancer, bladder cancer, breast cancer, kidney cancer, esophageal cancer, stomach cancer, pancreatic cancers, head cancer, and neck cancer.

[0193] Compositions of the present disclosure can be administered in dosages and routes and at times to be determined in appropriate pre-clinical and clinical experimentation and trials. Compositions can be administered multiple times at dosages within these ranges. Administration of the compositions can be combined with other methods useful to treat the desired disease or condition as determined by those of skill in the art. In certain embodiments, the antibodies can be administered to a subject in need thereof by any route suitable for the administration of antibody-containing pharmaceutical compositions, such as, for example, subcutaneous, intraperitoneal, intravenous, intramuscular, intratumoral, or intracerebral, etc. In certain embodiments, the antibodies are administered intravenously. In certain embodiments, the antibodies are administered subcutaneously. In certain embodiments, the antibodies are administered intratumoral. In certain embodiments, the antibodies are administered on a suitable dosage schedule, for example, weekly, twice weekly, monthly, twice monthly, once every two weeks, once every three weeks, or once a month etc. In certain embodiments, the antibodies are administered once every three weeks. The antibodies can be administered in any therapeutically effective amount. In certain embodiments, therapeutically acceptable amount is between about 0.1 mg / kg and about 50 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 1 mg / kg and about 40 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 1 mg / kg and about 20 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 1 mg / kg and about 10 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 5 mg / kg and about 30 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 5 mg / kg and about 20 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 1 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 2 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 3 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 4 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 5 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 6 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 7 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 8 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 9 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 10 mg / kg. Therapeutically effective amounts include amounts sufficient to ameliorate one or more symptoms associated with the disease or affliction to be treated.

[0194] In terms of the present disclosure, prophylactic, palliative, symptomatic and / or curative treatments may represent separate aspects of the disclosure. An anti-cPD-1 antibody or antigen-binding fragments thereof or scFv disclosed herein can be administered parenterally, such as intravenously, such as intramuscularly, such as subcutaneously. Alternatively, an antibody of the present disclosure can be administered via a non-parenteral route, such as orally or topically. An antibody of the invention can be administered prophylactically. An antibody of the present disclosure can be administered therapeutically (on demand) .

[0195] Pharmaceutical Compositions, Kits, and Methods of making the compositions

[0196] Also provided are pharmaceutical composition comprising any one of the binding polypeptides, scFvs, antibodies, or the antigen-binding fragments disclosed herein. Among the compositions are pharmaceutical compositions and formulations for administration, such as for treatment of a disease or disorder. Also provided are therapeutic methods for administering the pharmaceutical compositions to subjects, e.g., canines.

[0197] The pharmaceutical compositions and formulations generally include one or more optional pharmaceutically acceptable carrier or excipient. In some embodiments, the composition includes at least one additional therapeutic agent.

[0198] The term "pharmaceutical formulation" refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered. A "pharmaceutically acceptable carrier" refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject. A pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative. In some aspects, the choice of carrier is determined in part by the particular composition and / or by the method of administration. Accordingly, there are a variety of suitable formulations. For example, the pharmaceutical composition can contain preservatives. Suitable preservatives can include, for example, methylparaben, propylparaben, sodium benzoate, and benzalkonium chloride. In some aspects, a mixture of two or more preservatives is used. The preservative or mixtures thereof are typically present in an amount of about 0.0001%to about 2%by weight of the total composition. Carriers are described, e.g., by Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980) . Pharmaceutically acceptable carriers are generally nontoxic to recipients at the dosages and concentrations employed, and include, but are not limited to: buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol) ; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes) ; and / or non-ionic surfactants such as polyethylene glycol (PEG) .

[0199] Buffering agents in some aspects are included in the compositions. Suitable buffering agents include, for example, citric acid, sodium citrate, phosphoric acid, potassium phosphate, and various other acids and salts. In some aspects, a mixture of two or more buffering agents is used. The buffering agent or mixtures thereof are typically present in an amount of about 0.001%to about 4%by weight of the total composition. Methods for preparing administrable pharmaceutical compositions are known. Exemplary methods are described in more detail in, for example, Remington: The Science and Practice of Pharmacy, Lippincott Williams &Wilkins; 21st ed. (May 1, 2005) .

[0200] The formulations can include aqueous solutions. The formulation or composition can also contain more than one active ingredient useful for the particular indication, disease, or condition being treated with the composition, preferably those with activities complementary to the composition, where the respective activities do not adversely affect one another. Such active ingredients are suitably present in combination in amounts that are effective for the purpose intended. Thus, in some embodiments, the pharmaceutical composition further includes other pharmaceutically active agents or drugs, such as chemotherapeutic agents, e.g., asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, and / or vincristine. The pharmaceutical composition in some embodiments contains the composition in an amount effective to treat or prevent the disease or condition, such as a therapeutically effective or prophylactically effective amount. Therapeutic or prophylactic efficacy in some embodiments is monitored by periodic assessment of treated subjects. The desired dosage can be delivered by a single bolus administration of the composition, by multiple bolus administrations of the composition, or by continuous infusion administration of the composition.

[0201] Formulations include those for oral, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, intranasal, buccal, sublingual, or suppository administration. In some embodiments, the composition is administered parenterally. The term "parenteral, " as used herein, includes intravenous, intramuscular, subcutaneous, rectal, vaginal, and intraperitoneal administration. In some embodiments, the composition is administered to the subject using peripheral systemic delivery by intravenous, intraperitoneal, or subcutaneous injection. Compositions in some embodiments are provided as sterile liquid preparations, e.g., isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which can in some aspects be buffered to a selected pH. Liquid preparations are normally easier to prepare than gels, other viscous compositions, and solid compositions. Additionally, liquid compositions are somewhat more convenient to administer, especially by injection. Viscous compositions, on the other hand, can be formulated within the appropriate viscosity range to provide longer contact periods with specific tissues. Liquid or viscous compositions can comprise carriers, which can be a solvent or dispersing medium containing, for example, water, saline, phosphate buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol) and suitable mixtures thereof.

[0202] Sterile injectable solutions can be prepared by incorporating the composition in a solvent, such as in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose, dextrose, or the like. The compositions can contain auxiliary substances such as wetting, dispersing, or emulsifying agents (e.g., methylcellulose) , pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, and / or colors, depending upon the route of administration and the preparation desired. Standard texts can in some aspects be consulted to prepare suitable preparations.

[0203] Various additives which enhance the stability and sterility of the compositions, including antimicrobial preservatives, antioxidants, chelating agents, and buffers, can be added. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, and sorbic acid. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0204] The formulations to be used for in vivo administration are generally sterile. Sterility can be readily accomplished, e.g., by filtration through sterile filtration membranes.

[0205] The contents of the articles, patents, and patent applications, and all other documents and electronically available information mentioned or cited herein, are hereby incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference. Applicants reserve the right to physically incorporate into this application any and all materials and information from any such articles, patents, patent applications, or other physical and electronic documents.

[0206] In certain embodiments the anti-canine PD-1 antibodies of the current disclosure are included in a pharmaceutical composition comprising one or more pharmaceutically acceptable excipients, carriers, and diluents. Pharmaceutically acceptable excipients, carriers and diluents can be included to increase shelf-life, stability, or the administrability of the antibody. Such compounds include salts, pH buffers, detergents, anti-coagulants, and preservatives. In certain embodiments, the antibodies of the current disclosure are administered suspended in a sterile solution. In certain embodiments, the solution comprises about 0.9%NaCl. In certain embodiments, the solution comprises about 5.0%dextrose. In certain embodiments, the solution further comprises one or more of: buffers, for example, acetate, citrate, histidine, succinate, phosphate, bicarbonate and hydroxymethylaminomethane (Tris) ; surfactants, for example, polysorbate 80 (Tween 80) , polysorbate 20 (Tween 20) , and poloxamer 188; polyol / disaccharide / polysaccharides, for example, glucose, dextrose, mannose, mannitol, sorbitol, sucrose, trehalose, and dextran 40; amino acids, for example, glycine or arginine; antioxidants, for example, ascorbic acid, methionine; or chelating agents, for example, EDTA or EGTA.

[0207] In certain embodiments, the antibodies of the current disclosure can be shipped / stored lyophilized and reconstituted before administration. In certain embodiments, lyophilized antibody formulations comprise a bulking agent such as, mannitol, sorbitol, sucrose, trehalose, dextran 40, or combinations thereof. The lyophilized formulation can be contained in a vial comprised of glass or other suitable non-reactive material. The antibodies when formulated, whether reconstituted or not, can be buffered at a certain pH, generally less than 7.0. In certain embodiments, the pH can be between 4.5 and 7.0, 4.5 and 6.5, 4.5 and 6.0, 4.5 and 5.5, 4.5 and 5.0, or 5.0 and 6.0.

[0208] Also described herein are kits comprising one or more of the antibodies described herein in a suitable container and one or more additional components selected from: instructions for use; a diluent, an excipient, a carrier, and a device for administration.

[0209] In certain embodiments, described herein is a method of making a composition for treating cancer, sepsis or septic shock, or chronic infection (e.g., viral infections) , comprising admixing one or more pharmaceutically acceptable excipients, carriers, or diluents and an antibody of the current disclosure. In certain embodiments, described herein is a method of preparing a cancer treatment for storage or shipping comprising lyophilizing one or more antibodies of the current disclosure.

[0210] While the present disclosure has been described with reference to the specific embodiments thereof, it should be understood by those skilled in the art that various changes can be made, and equivalents can be substituted without departing from the true spirit and scope of the present disclosure. It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the methods described herein can be made using suitable equivalents without departing from the scope of the embodiments disclosed herein. In addition, many modifications can be made to adapt a particular situation, material, composition of matter, process, process step or steps, to the objective, spirit and scope of the present disclosure. All such modifications are intended to be within the scope of the claims appended hereto. Having now described certain embodiments in detail, the same will be more clearly understood by reference to the following examples, which are included for purposes of illustration only and are not intended to be limiting. EXAMPLES

[0211] The present disclosure is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only and are not intended to be limiting unless otherwise specified. Thus, the present disclosure should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein. While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the present disclosure. It should be understood that various alternatives to the embodiments of the present disclosure described herein can be employed in practicing the present disclosure.

[0212] All publications, patent applications, issued patents, and other documents referred to in this specification are herein incorporated by reference as if each individual publication, patent application, issued patent, or other document was specifically and individually indicated to be incorporated by reference in its entirety. Definitions that are contained in text incorporated by reference are excluded to the extent that they contradict definitions in this disclosure.

[0213] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present disclosure and practice the claimed methods. The following working examples, therefore, specifically point out some embodiments of the present disclosure.

[0214] Example 1: Introduction

[0215] Programmed cell death protein 1 (PD-1 or CD279) is a co-inhibitory checkpoint molecule expressed primarily on the surface of activated T cells, NK cells, and B cells. Interaction of PD-1 with its primary ligand (PD-L1) expressed on macrophages, DCs and other stromal cells inhibits CD4+ and CD8+ T cell effector functions, including proliferation, cytotoxic activity, cytokine secretion, and migration. As such, PD-1: PD-L1 interactions protect the host from over-exuberant immune responses. This important negative regulatory function of the PD-1:PD-L1 interaction is underscored by the development of severe autoimmunity in PD-1 deficient mouse strains. PD-L1 is also expressed on tumor cells, tumor associated macrophages and cancer associated fibroblasts and its expression is strongly up-regulated by inflammatory cytokines including IFN-g and TNF-a produced by T cells. Therefore, activated PD-1+ tumor-specific T cells contribute to the expression of PD-L1 in the tumor microenvironment and this drives tumor-specific T cell exhaustion and significantly impairs anti-tumor immune responses.

[0216] Blockade of the PD-1: PD-L1 interaction with anti-PD-1 or anti-PD-L1 antibodies enhances anti-tumor immunity and has led to an increase in tumor infiltrating lymphocytes (TILs) and impressive clinical responses in a subset of human patients with different tumor histologies including malignant melanoma, non-small cell lung carcinoma and renal cell carcinoma. However, durable clinical responses are only observed in 20-30%of patients treated with anti-PD-1 or anti-PD-L1 antibodies, leading to intense efforts to understand the mechanisms of resistance and to identify correlative biomarkers of response that may streamline patient recruitment to immune checkpoint inhibitor (ICI) monotherapy or investigate alternative therapeutic strategies. Tumor mutational burden (TMB) , IFN-g response signatures, microsatellite instability-high / mis-match repair deficiency (MSI-H / MMRD) and expression of PD-L1 on tumor cells and tumor infiltrating immune cells have shown predictive value in clinical response to anti-PD-1 therapy in different cancer histologies. Strategies that combine anti-PD-1 and anti-PD-L1 mAbs with other ICIs such as anti-CTLA4, anti-TIM-3, anti-TIGIT, and anti-Lag3 antibodies, or with the administration of cancer vaccines, chimeric antigen receptor (CAR) -T cell therapies, radiation, chemotherapy, and small molecule inhibitors to augment anti-tumor activity are under active investigation.

[0217] In veterinary medicine the use of checkpoint inhibitors is in its infancy principally due to the lack of fully canine mAbs with favorable pharmacokinetic / pharmacodynamic properties that can be produced economically at clinical scale. Furthermore, TMB which correlates with clinical response to checkpoint inhibition in some cancer types in humans, is generally lower in canine tumors compared to human tumors and as such, the use of ICI as monotherapies remains to be proven and their use in combination with radiation therapy, chemotherapy, vaccines, genetically engineered immune cells and other immunotherapies may enhance their effectiveness and provide significant clinical benefit.

[0218] Here the development and validation of a fully canine, anti-cPD-1 antibody derived from a canine scFv phage display library is described. The antibody demonstrated favorable in vivo safety, tolerability, and pharmacokinetic profiles and was produced at high yield enabling scale up for clinical use. Development of this antibody now enables investigation of anti-PD-1 therapy to promote anti-tumor immunity in dogs with immune responsive cancers. It also provides an important comparative tool to investigate correlative biomarkers of response and mechanisms of resistance to PD-1 checkpoint inhibition in immune competent pet dogs that may be valuable to inform human clinical trial design.

[0219] Example 2: Results

[0220] Isolation of canine PD-1 specific scFv clones

[0221] Canine anti-cPD-1 scFv’s were isolated from a previously constructed 40-billion member canine IgM / IgG / l / k scFv phage display library built from canine B cell mRNA isolated from discarded splenic material of seven otherwise healthy dogs that had undergone therapeutic splenectomy for benign conditions. Construction of the library used the pComb3X phagemid vector and protocols as described with a set of oligonucleotide primers designed to capture transcripts encoded by all canine immunoglobulin heavy and light chain germline genes as listed in the IMGT database. A total of over 1,000 individual RT / PCR reactions for VH-g, VH-m, Vk, and Vl had been carried out (145 reactions per spleen) and amplification products were recombined using strand-overlap-extension to generate four independent libraries comprising VH-g gene segments paired with all Vk and Vl gene segments and VH-m gene segments paired with all Vk and Vl gene segments. After ligation into pComb3X, electroporations into E. coli were performed to generate over 40 billion independent bacterial transformations. To assure quality of the library, successful amplification of each of the more than 1,000 heavy and light chain cDNA PCRs was confirmed by agarose gel electrophoresis before incorporation into the library. Analysis of dozens of individual scFv clones from the unselected primary library underwent nucleotide sequencing which showed a nearly 100%presence of complete heavy chain / light chain scFv inserts in all clones and which showed distributions of heavy and light chain immunoglobulin gene families and their genes and heavy chain CDR3 lengths similar to those found from the analysis of natural canine immune repertoires. This canine scFv phage display library has been used in several dozen panning campaigns to isolate canine antibodies of therapeutic interest including anti-canine CTLA-4 antibodies. To select phage display library for anti-canine PD-1 (cPD-1) scFv’s , recombinant cPD-1 was directly coated onto wells of a microtiter plate and used as the target antigen. An aliquot of the pooled VH-g / Vk, VH-g / Vl, VH-m / Vk, and VH-m / Vl canine scFv library underwent 4 rounds of solid phase selection ( “panning” ) against the immobilized cPD-1 as previously described. To verify that selected phage contained cPD-1-specific scFv phage particles, polyclonal scFv phage from each round of panning was evaluated by phage ELISA against cPD-1 (Fig. 1) . Marked enrichment of the library for cPD-1 binding scFv-expressing phage was observed at the third round of panning (P3) and increased in the fourth round of panning (P4) . Binding was specific to cPD-1 as binding to irrelevant antigens such as human CD19 target antigen was not observed.

[0222] An initial survey of positive cPD-1 binders was assessed by examining 16 clones from P3 and 16 clones from P4 by evaluating their ability to bind to cPD-1 by monoclonal phage ELISA as previously described. 10 / 16 clones from P3 and 15 / 16 clones from P4 bound to cPD-1 (Fig. 2) . 14 unique clones were identified by nucleotide sequencing from these 25 binders. Six comprised l light chains and 8 comprised k light chains. These 14 clones were produced as soluble scFv fragments and their binding to cPD-1 was assessed in an ELISA by detecting the hemagglutinin tag on their carboxy terminus (Fig. 3, left) . Six soluble scFvs were shown to bind cPD-1 as a function of plate-bound streptavidin-captured biotinylated cPD-1. Following this initial survey to assess positivity rate, a high-throughput screen of 176 clones (88 from P3 and 88 from P4) was performed. This screen identified a further 8 unique scFv clones (data not shown) . Five of these 8 additional clones produced well as soluble scFv, and their ability to specifically bind cPD-1 was confirmed by ELISA (Fig. 3, right) .

[0223] Assessment of blocking capacity of cPD-1 scFv clones

[0224] Based on the results of soluble scFv binding to cPD-1, 9 clones that bound cPD-1 (3-4, 3-8, 3-13, 4-2, 4-9, 4-14, P4B1, P3C6 and P4F3) and 2 clones that showed minimal binding (P4F8 and P4C1) were selected and assessed for their ability to inhibit the interaction of cPD-1 with cPD-L1-Fc. Briefly, biotinylated cPD-1 was incubated with cPD-L1-Fc either alone or in the presence of the cPD1 specific scFv. The cPD-1: cPD-L1-Fc complex was captured onto a streptavidin coated plate and then detected using an anti-Fc antibody. In the absence of cPD-1 specific scFv’s blocking the PD-1: PD-L1 interaction, complex formation and detection would occur. However, in the event that a cPD-1 specific scFv inhibits cPD-1 binding to cPD-L1-Fc, a reduced or complete lack of signal would be the read out in this assay (Fig. 4, Panel A) . With the exception of clones 3-8, 4-2 and 4-9, all clones exhibited a degree of dose-dependent inhibition of PD-1 binding to PD-L1 (Fig. 4, Panel B, and data not shown) . However, only clone P3C6 completely inhibited cPD-1 binding to cPD-L1 at each cPD-L1 concentration used in the assay.

[0225] Selected cPD-1 specific clones bind to cell surface cPD-1

[0226] To determine whether selected cPD-1 clones bind to cPD-1 expressed on the cell surface, the human erythroleukemic cell line K562, previously edited to remove the FcgRII (CD32; KTd32) , was engineered to express cPD-1 using a retroviral vector carrying a puromycin selection cassette (KTd32. cPD-1) , and KTd32. cPD-1 cells were selected in puromycin. Four HA-tagged soluble scFvs that inhibited cPD-1: cPD-L1 binding were incubated with either KTd32 or KTd32. cPD-1 cells, and binding was determined by flow cytometry (Fig. 5) . An anti-MERS scFv and clone 3-7 shown not to bind soluble cPD-1 were included as negative controls. Clone P3C6 was found to strongly bind to KTd32. cPD-1 cells whereas all other clones tested showed much weaker binding or no binding (clone 3-8) . Based on cell binding and PD-1: PD-L1 inhibitory capability, clones P3C6 and P4B1 were selected for re-formatting as full-length canine IgGD (analogous to human IgG4) molecules. IgGD was selected as the IgG subtype on account of its lack of mediating antibody dependent cell-mediated cytotoxicity (ADCC) and complement fixation. Neither of these effector functions are desirable in an anti-PD1 checkpoint inhibitor and the IgGD subtype is consistent with the IgG4 subtype of the anti-PD-1 antibodies that are used in the human clinic (e.g., pembrolizumab and nivolumab) .

[0227] Heavy chain liabilities are responsible for low yield of P3C6

[0228] While P4B1 expressed well as a full length IgGD antibody (0.65 mg / ml) from transient transfection of 293T cells, the yield of P3C6 was negligible. Chain swapping experiments with P4B1 confirmed that this liability was associated with the heavy chain of P3C6 (data not shown) . Analysis of the heavy chains of P4B1 and P3C6 by IMGT revealed that both were likely encoded by the canine IGHV3-38*01 VH gene and had high sequence homology in their framework regions though their CDRs were different, particularly their CDR3s which were of different lengths (Fig. 6, Panel A (top) ) . P4B1 and P3C6 light chains were very different given that one was a lambda isotype (most likely encoded by canine germline gene IGLV3-27*01) and the other kappa (most likely encoded by canine germline gene IGKV3-18*02) , respectively (Fig. 6, Panel A (bottom) ) .

[0229] To test whether expression properties of P4B1 could be conferred to P3C6, we replaced the 11 different framework amino acids in P3C6 with those from P4B1 to create P3C6 mut 3. When paired with the original P3C6 kappa light chain, production was improved, but the antibody no longer bound to PD-1 (data not shown) . Strategic back-mutations of 7 or 6 of the 11 P4B1 framework residues to those of P3C6 were carried out to create P3C6 mut 3.1 and P3C6 mut 3.2, respectively. Paired with the P3C6 kappa light chain, both antibodies produced well (P3C6 mut3.1: 0.38 mg / ml and P3C6 mut3.2: 0.36 mg / ml respectively, MERS 0.44 mg / ml and P4B1 0.6 mg / ml) and regained PD-1 binding properties similar to the original P3C6 full length antibody, including binding to cell surface-expressed cPD-1 by flow cytometry (Fig. 6, Panel B) . Because the one difference between P3C6 mut 3.1 and mut 3.2 heavy chains was mut 3.1’s retention of P3C6’s apparent V23M somatic mutation from germline IGHV3-38 that could conceivably contribute to antigen binding or antibody stability, P3C6 mut 3.1 was selected for further studies.

[0230] SPR analyses

[0231] The affinity and binding kinetics of P3C6mut3.1 IgGD to cPD-1 were determined using surface plasmon resonance (SPR) . With HIS-tagged cPD-1 tethered to a CMS chip coated with an anti-HIS antibody, and P3C6 mut3.1 injected into the flow cell at a constant rate, the on and off rates of P3C6mut3.1 were kon1.31 x 105 M-1 s-1 and koff 1.43 x 10 -4 s-1 (Fig. 9) . The dissociation constant (KD) of P3C6mut3.1 was 1.1nM with a binding half-life of 81 minutes. These binding kinetics are similar to those reported for nivolumab. Thus, P3C6mut3.1 displayed a rapid on-rate and slow off-rate leading to low single-digit nanomolar affinity.

[0232] In vitro functional assessment of P3C6 mut 3.1 on antigen-specific T cell activity

[0233] To determine whether P3C6 mutants were able to reverse the inhibitory effect of PD-1:PD-L1 interaction following antigen-specific T cell activation, canine T cells isolated from a single healthy donor dog, and genetically engineered to express a second generation CD20 targeting chimeric antigen receptor (CD20 CAR-T cells) were labelled with CTV and co-cultured with irradiated K562 target cells engineered to express canine CD20 without canine PD-L1 (K562. cCD20) or with canine PD-L1 (K562. cCD20. cPD-L1) . Expression of cPD-L1 on target K562. cCD20 cells led to inhibition of canine CAR-T cell proliferation as shown by the higher MFI of CTV labelled CAR-T cells co-cultured with K562. cCD20. cPD-L1 (MFI=2879) compared to K562. cCD20 MFI=1763) (Fig. 7, Panel A) . However, in the presence of P3C6mut3.1 IgGD mAb, the inhibitory effect of PD-L1 on CAR-T cell proliferation was reduced (MFI=2344) . Furthermore, expression of the degranulation marker CD107b by canine CAR-T cells following CD20 antigen engagement was reduced by expression of PD-L1 on target K562. cCD20. cPD-L1 cells, however, degranulation was almost completely restored in the presence of P3C6mut3.1 IgGD (Fig. 7, Panel B) . Taken together these data indicate that P3C6mut3.1 can ameliorate the inhibitory effects of PD-1: PD-L1 interaction on canine T cells and suggest that it may have therapeutic value in improving anti-tumor T cell mediated immunity in vivo.

[0234] P3C6mut3.1 identifies cPD-1+ lymphocytes in formalin-fixed, paraffin embedded canine lymphoid tissues

[0235] PD-1 is known to be expressed in tumor infiltrating CD8+ T cells, other tumor-infiltrating immune cells and on tumor cells themselves. However, the exact function of PD-1 on infiltrating immune suppressive cells such as tumor associated macrophages, myeloid cells and T regulatory cells and tumor cells themselves is controversial. To determine the ability of the P3C6 clone to detect cPD-1 in formalin-fixed, paraffin embedded canine tissues, full-length, HA-tagged P3C6mut3.1 IgGD was used in immunohistochemical analysis as described in materials and methods. P3C6mut3.1 was found to intensely stain membranes of individual lymphocytes in the paracortical zone of the lymph node (Fig. 10) , splenic periarteriolar lymphoid sheaths (PALS) , and the interfollicular area of the tonsil. No immunolabeling was observed in the sections incubated with the isotype control antibody or where the primary antibody was omitted. Other non-lymphoid tissues included in the TMA were negative for staining with P3C6mut3.1.

[0236] Antibody Modification and Production for in vivo Canine Studies

[0237] Pilot production: SDS-PAGE analysis of P3C6 mut3.1 revealed the presence of half antibody fragments and heavy chain dimers (Fig. 11) and a titer of 0.46 mg / ml from a small scale, 100ml culture. The sequence of P3C6 mut3.1 was therefore modified with the IgGD hinge region (ESTCKCISPCPVPESL) replaced by the IgGB hinge and two mutations made in the IgGB hinge region (ML to AA) to reduce ADCC (RENGRVPRPPDCPKCPAPEAA) . Mutation of the ML amino acids to AA is bolded.

[0238] Following sequence confirmation, the hinge modified P3C6 mut3.1 (IgGD / B) sequence was transiently transfected into proprietary CHO-K1 cells at a specialised CRO and expressed in 100 mL culture volume shake flasks. Antibody was purified by Protein A chromatography. SDS-PAGE analysis revealed that the hinge modifications resulted in less half antibody and HC dimer production (Fig. 11) and produced an increase in antibody titer (original sequence: 0.46mg / ml; modified sequence: 0.75mg / ml) . Binding of this molecule (IgGD / B) to cPD-1 was confirmed by ELISA (data not shown) .

[0239] Scale up production: PD-1 antibody for in vivo use was produced in a single batch using the same proprietary CHO-K1 cells as for pilot production, by the same CRO provider. CHO-K1 cells were transiently transfected with the modified P3C6 mut3.1 IgGD / B expression construct and a 20L transient production run of the antibody was conducted in shake flasks under appropriate selection pressure. Antibody underwent a one-step purification using protein A chromatography and the resulting material was analyzed for expression / yield (12.53 mg / mL) , endotoxin level (<0.08 EU / mg) , and purity by SEC-HPLC (96.12%) , SDS-PAGE (reducing and non-reducing) , and LC-MS. This material was used for the in vivo safety and PK study described in the main text. Pilot study 1: Pilot study 2: Pilot study 3: Pilot study 4: Pilot study 5:

[0240] In vivo pharmacokinetic assessment

[0241] As P3C6 mut3.1 does not cross react with murine PD-1 (data not shown) pharmacokinetic and biodistribution studies were not performed in mice. To determine safety, tolerability, and pharmacokinetics (PK, drug exposure) of non-GLP P3C6 mut3.1 (IgGD / B) in the target species (dog) , a non-terminal, pilot study was performed in four healthy research beagles. There was no vehicle control group. Two adult, intact males and two adult, intact female dogs were randomly assigned to receive either 2mg / kg (1 male and 1 female) or 10 mg / kg (1 male and 1 female) P3C6 mut3.1 (IgGD / B) (purity 96.12%by SEC-HPLC; endotoxin <0.08 EU / mg) administered by slow intravenous push once every 3 weeks for a total of 2 administrations (day 0 and day 21) . No pre-medications were given prior to either administration of antibody. Dogs were monitored for organ-associated toxicities by observations, physical examinations and hematological and biochemical analyses at the time points indicated in materials and methods. This study was non-terminal and tissue histopathology was not evaluated. No clinical, hematological, or biochemical adverse events or significant changes in body weight were identified in any of the 4 dogs treated with 2 doses of either 2 mg / kg or 10 mg / kg of P3C6mut3.1 (IgGD / B) throughout the 28-day duration of the study (data not shown) .

[0242] Pharmacokinetics analysis revealed biexponential concentration vs. time profiles for both doses of P3C6mut3.1 (IgGD / B) (Fig. 8, Panel A) . Non-compartmental analysis (NCA) was performed to determine individual dog and dose-wise PK parameters (Table I) . There was a trend towards decreasing clearance (CL) , increasing volume of distribution (Vss) , and increasing half-life (t1 / 2) at the 10 mg / kg dose compared to the 2 mg / kg dose. This suggests that P3C6 mut 3.1 (IgGD / B) may have non-linear PK in this dose range, likely due to target-mediated drug disposition (TMDD) as reported for pembrolizumab in human patients. This was supported by the presence of an inflection point between 7 and 20 days with the elimination rate increasing as concentrations decrease. Additionally, dose-normalized PK profiles (Fig. 8, Panel B) showed a lack of superimposition at later time points, further suggesting non-linear PK. Based on these data, the Highest Non-Severely Toxic Dose (HNSTD) tested was 10 mg / kg and the MTD was not defined. The No Observed Adverse Effect Level (NOAEL) was 10 mg / kg. Although anti-drug antibodies (ADA) were not measured in this study, due to a lack of a validated ADA assay, a sharp decline in drug concentrations was not observed after the first or second dose of P3C6mut3.1 and similar drug concentrations were identified in the serum day 28 day (7 days post dose 2) and at day 7 which suggests that ADA isn’ t accelerating antibody elimination on the second dose. Thus, the PK data are consistent with lack of impact of ADA over this time period.

[0243] Example 3: Materials and Methods

[0244] Cells and Cell lines

[0245] Peripheral blood mononuclear cells (PBMCs) were isolated from blood of healthy donor dogs (University of Pennsylvania IACUC#807025) by Ficoll density gradient centrifugation. Cells were washed twice in complete (c) RPMI media containing RPMI 1640 with 2mM L-Glutamine (Corning / Mediatech, 25-005-CV) , 10%heat-inactivated fetal bovine serum (Atlanta Biologicals, S11150) , 10mM HEPES (ThermoFisher Scientific / Gibco, 15630130) , and 100 U / ml penicillin and 100μg / ml streptomycin (ThermoFisher Scientific / Gibco, 15140122) prior to use. Human cell lines (K562 and 293T cells) were grown in (c) RPMI supplemented with 1mM sodium pyruvate (Corning / Mediatech, 25-000-CIR) and 30 μg / mL gentamicin (ThermoFisher Scientific / Gibco 15750060) .

[0246] PD-1 and PD-L1 target cell line generation

[0247] Full length cPD-1 was amplified from cPBMC cDNA by RT-PCR and the resulting 867bp amplicon was cloned into the pMX-puromycin retroviral expression vector (Cell Biolabs Inc., RTV-060) . For cPD-L1, the 870bp full length sequence was synthesized and cloned into the pMX-puromycin retroviral expression vector by Genewiz (South Plainfield, New Jersey) . Retrovirus was generated and used to stably transduce the human erythroleukemic K562 cell line, previously edited using CRISPR / Cas9 to remove FcgRII (KTd32) and reduce non-specific mAb binding, with cPD-1. Transduced cells were selected in 2.5mg / ml of puromycin dihydrochloride (Sigma-Aldrich, P9620) to yield KTd32. cPD-1. Expression of cell surface cPD-1 was confirmed by flow cytometry. For cPD-L1 expressing target cells, K562 expressing canine CD20 (K562. cCD20) were generated as previously described and both wild type K562 cells and K562. cCD20 cells were transduced with cPD-L1 to generate K562. cPD-L1 and K562. cCD20. cPD-L1 cells respectively. K562. cPD-L1 and K562. cCD20. cPD-L1 cells were bulk sorted by flow cytometry based on PD-L1 expression and clones were expanded in supplemented cRPMI as described above.

[0248] scFv phage ELISA

[0249] For ELISAs to detect binding of phage-displayed scFvs, microplate wells were coated with cPD-1protein (Recombinant; His Tag) (Sino Biological, 70109-D08H) and human CD19 (Sino Biological, 11880-H08H) , canine CD19 (Sino Biological, 70079-D08H) or canine IL-13Ra2-Fc (Sino Biological, 11350-H03H) as control antigens as previously described for phage display library panning. Briefly, polyclonal phage from the PEG-concentrated initial phage library (P0) and antigen enriched libraries obtained after each round of panning (P1 through P4) or monoclonal phage prepared from randomly picked phage clones from output plates of the third round (P3) and fourth round (P4) of panning were added to recombinant cPD-1 coated wells. After 1 hour incubation at 37℃, plates were washed with 0.1%Tween 20 in PBS and HRP-conjugated anti-M13 mAb (Sino Biological, 11973-MM05T-H) diluted 1: 5000 in MPBS was added. Plates were washed again, and bound HRP-conjugated secondary antibody was detected with ABTS. OD was read at 405nm after 30 min using a Molecular Devices SpectraMax 340 spectrophotometer.

[0250] Soluble scFv production

[0251] Briefly, the non-suppressor TOP10F’ Chemically Competent E. coli strain (ThermoFisher Scientific / Invitrogen, C303003) was infected with phage clones that were confirmed to bind to streptavidin immobilized, biotinylated avi-tagged cPD-1 soluble protein (Sino Biological, 70109-D27H-B) by phage ELISA. Bacterial colonies were used to start expression cultures that were induced by 0.5 mM IPTG as previously described. Periplasmic extracts were taken from induced cultures and His-tagged scFvs were purified by metal affinity chromatography using Ni-NTA agarose columns as previously described.

[0252] Soluble scFv ELISA

[0253] Streptavidin was coated onto 96 well ELISA plates at 30mg / mL and incubated overnight at 4℃. Wells were blocked with 5%milk / PBST. 0.1-30pmol of biotinylated cPD-1 protein was added to each well and incubated for 1 hour at RT. 0.25 mg / ml of soluble scFvs in PBST were added to each well and incubated for 2 hr at RT. Wells were washed twice and bound scFvs were detected using 0.5mg / mL (1: 2000 dilution) of AP-conjugated anti-HA antibody (Sigma-Aldrich, A5477) . Plates were incubated for 1 hour at RT. Plates were washed again and bound scFvs were detected using Quanti-BlueTM AP colorimetric substrate (InvivoGen, rep-qbs) . Plates were read at 1 hr at OD 650 nm.

[0254] PD-1: PD-L1 ELISA based inhibition assay

[0255] Streptavidin (30mg / ml) was spotted onto ELISA plates and left at 4℃ overnight. Streptavidin was removed and wells were blocked with 5%milk / PBS 0.05%Tween. Soluble biotinylated cPD-1 (3 pmols or 55ng) was incubated with 1.0, 3.0 or 10 pmols cPD-L1-Fc (Sino Biological, 70109-D02H) , either alone or in the presence of selected anti-cPD-1 scFv (70 pmols) or an irrelevant scFv (against Middle Eastern Respiratory virus (MERS) ) for 1 hr on ice prior to being added to the blocked plate and incubated for 2 hr at RT. Plates were washed three times with TBS-Tween and cPD-L1 bound to cPD-1 was detected using an anti-Fc-AP conjugate (1:1000) (Jackson ImmunoResearch, 709-055-098) . After 3 washes with TBS-Tween, Quanti-BlueTM AP colorimetric substrate (InvivoGen) was added for 1 hour prior to spectrophotometric reading at OD 650nm.

[0256] Full length IgG4 mAb generation

[0257] The VH and VL chains of selected scFvs were cloned into separate expression plasmids engineered to express either canine constant light kappa (InvivoGen, pfuse2-dclk) , constant light lambda (InvivoGen, pfuse2-dcll) or constant IgG4 (IgGD) heavy chain domain (InvivoGen, pfuse-dchg4) . Plasmids were transfected into 293T cells, and transformed cells were selected based on antibiotic resistance; lambda and kappa light chains were selected for using blasticidin and plasmids containing the constant IgG4 (IgGD) domain were selected for using zeocin.

[0258] Soluble scFv binding to membrane expressed PD-1.

[0259] KTd32. cPD-1, and KTd32 (WT) cell lines were washed twice in FACS buffer (1%heat-inactivated FBS in 1X PBS with calcium and magnesium) . Cells were blocked with 0.1mg / ml of canine IgG (Jackson ImmunoResearch, 004-000-003) for 10 minutes at RT prior to cell surface labelling with 0.05mg / ml of canine scFv, or 0.5mg / ml canine IgG. After washing, an APC labelled anti-HA. 11 epitope tagged antibody (BioLegend, 901523) and viability dye 7-AAD (BioLegend, 420403) were added, and cells were incubated for 30 min at RT. Following cell surface labelling, cells were washed twice in FACS buffer and acquired on a FACS Canto II flow cytometer (BD Biosciences) , and data was analysed using FlowJo software version X (Treestar, Ashland, OR) .

[0260] Functional assessment of anti-PD-1 antibody on antigen-specific T cell activity

[0261] Canine CAR T cells were generated using a standard retroviral transduction protocol as previously described. Briefly, negatively selected canine T cells were activated with anti-canine CD3 / CD28 magnetic beads in the presence of recombinant human IL-2 (100IU / mL, Thermo Fisher Scientific / Gibco, CTP0021) , IL-7 (10ng / mL, Thermo Fisher Scientific / Gibco, PHC0071) , IL-15 (10ng / mL, Thermo Fisher Scientific / Gibco, PHC9151) and IL-21 (10ng / mL, Thermo Fisher Scientific / Gibco, PHC0211) . Two days later, cells were transduced on retronectin with a MSGV1 retroviral vector (MOI=5) containing a canine CD20-targeted 28z CAR as previously described. After 6 days, T cells were activated through their CAR using the K562-cCD20 cells. Proliferation and degranulation assays were set up 6 days later.

[0262] Proliferation assay

[0263] Canine CAR T cells were labelled with 5mM of cell trace violet (CTV) solution (ThermoFisher Scientific, C34557) in PBS according to manufacturer’s instruction. Cells were washed in PBS and co-cultured with irradiated (10,000Gy) K562 target cell lines described above at an E: T ratio of 1: 1. After 72hrs incubation, cells were harvested, washed in FACS buffer, and labelled with biotinylated rabbit anti-mouse IgG antibody (Jackson ImmunoResearch, 315-065-003) for CAR detection. Cells were washed again twice in FACS buffer and labelled with rat anti-canine CD5 antibody (Clone: YKIX 322.3) , rat anti-canine CD4 (Clone: YKIX302.9) , rat anti-canine CD8 mAb (Clone: YCATE55.9, BioRad, MCA1039GA) and APC-Cy7-conjugated streptavidin (BD Biosciences, 554063) for 30 mins at room temperature. Cells were washed twice in FACS buffer and fixed in 2%paraformaldehyde (Thermo Fisher Scientific, AAJ19943K2) . ) . Cells were acquired on a FACS Canto II flow cytometer (BD Biosciences) , and data was analysed using FlowJo software version 10 (Treestar, Ashland, OR) .

[0264] Degranulation assay

[0265] Canine CAR-T cells were harvested, washed and co-cultured with irradiated target cells at an E: T of 1: 1 in the presence of an anti-CD107b antibody (Clone: AC17, BioRad, MCA2558GA) (0.25mg / mL) , added at the beginning of the co-culture. Either P3C6mut3.1 or anti-MERS antibody was added to the co-culture at a concentration of 20 mg / mL. After 4 hours incubation, cell suspensions were harvested, washed twice in FACS buffer, and labelled with rat anti-canine CD5 (Clone: YKIX 322.3) , rat anti-canine CD4 (Clone: YKIX302.9) and rat anti-canine CD8 mAb (Clone: YCATE55.9) . Following cell surface labelling, cells were washed twice in FACS buffer and fixed in 1%paraformaldehyde. Cells were acquired on a FACS Canto II flow cytometer (BD Biosciences) , and data was analysed using FlowJo software version 10 (Treestar, Ashland, OR) .

[0266] Abbreviations

[0267] ADA: anti-drug antibodies; AE: adverse events; AUCinf: area under the serum concentration vs. time curve extrapolated to time infinity; AUClast: area under the serum concentration vs. time curve from time 0 to 21 days; CAR: chimeric antigen receptor; CL: clearance; Cmax: maximum observed serum concentration; CMS: carboxymethyl surface; cPBMCs: canine peripheral blood mononuclear cells; CTLA4: cytotoxic T lymphocyte antigen 4;CTV: cell trace violet; DCs: dendritic cells; ELISA: enzyme linked immunosorbent assay; FDA: federal drug administration; GLP: good laboratory practice; HA: hemagglutinin; HIS: histidine; HNSTD: highest non severely toxic dose; IACUC: institutional animal care and use committee; ICI: immune checkpoint inhibitor; NCA: non-compartmental analysis; NOAEL: No Observed Adverse Event Level; LAG3: lymphocyte-activation gene 3; MERS: Middle Eastern Respiratory Syndrome; MFI: mean fluorescence intensity; MSI-H / MMRD: microsatellite instability-high / mis-match repair deficiency; MTD: maximum tolerated dose; PALS: periarteriolar lymphoid sheaths; PD-1: programmed cell death protein 1; PD-L1: programmed cell death ligand 1; PK: pharmacokinetics; RO: receptor occupancy; scFv: single chain variable fragment; SDS-PAGE: Sodium dodecyl-sulfate polyacrylamide gel electrophoresis; SEC-HPLC: Size exclusion-high-performance liquid chromatography; t1 / 2: terminal log-linear half-life; TIGIT: T cell immunoreceptor with immunoglobulin and ITIM domain; TILs: tumor infiltrating lymphocytes; TIM-3: T cell immunoglobulin and mucin-domain containing-3; TMB: tumor mutational burden; TMDD: Target Mediated Drug Disposition; VH: variable heavy; VL: variable light;Vss:volume of distribution.

Claims

1.An antibody comprising a Fc region of canine IgG subclass IgGA, IgGB, IgGC, or IgGD, and a hinge region of canine IgG subclass IgGA, IgGB, IgGC, or IgGD, wherein the Fc region and the hinge region are of different canine IgG subclasses.2.The antibody of claim 1, wherein the antibody is a full-length antibody.3.The antibody of claim 1 or 2, wherein the antibody comprises a CH1 region, where in the CH1 region and the hinge region are of the same canine IgG subclass.4.The antibody of any one of claims 1-3, wherein the Fc region is of canine IgG subclass IgGD.5.The antibody of any one of claims 1-4, wherein the hinge region is of canine IgG subclass IgGB.6.The antibody of any one of claims 1-5, wherein the Fc region has at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99%identity to the amino acid sequence of a natural Fc region of canine IgG subclass IgGA, IgGB, IgGC, or IgGD.7.The antibody of any one of claims 1-6, wherein the hinge region has at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99%identity to the amino acid sequence of a natural hinge region of canine IgG subclass IgGA, IgGB, IgGC, or IgGD.8.The antibody of any one of claims 1-7, wherein and / or the hinge region have at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99%identity to the amino acid sequence of SEQ ID NO: 66.9.The antibody of any one of claims 1-8, wherein the antibody comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99%identity to the amino acid sequence of SEQ ID NO: 67.10.The antibody of any one of claims 1-9, wherein the antibody comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99%identity to the amino acid sequence of SEQ ID NO: 68.11.The antibody of any one of claims 1-10, wherein the antibody comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99%identity to the amino acid sequence of SEQ ID NO: 69.12.The antibody of any one of claims 1-11, wherein the antibody is a canine or caninized antibody, and optionally wherein the antibody binds to a canine antigen.13.The antibody of any one of claims 1-12, wherein the antibody binds to canine programmed death protein 1 (cPD-1) .14.The antibody of any one of claims 1-13, wherein the antibody comprises:(a) an immunoglobulin heavy chain comprising a heavy chain complementarity determining region 1 (HCDR1) comprising the amino acid sequence set forth in SEQ ID NOs: 1, 27, or 43, a HCDR2 comprising the amino acid sequence set forth in SEQ ID NOs: 2, 28, or 44, and a HCDR3 comprising the amino acid sequence set forth in SEQ ID NOs: 3, 29, or 45, and(b) an immunoglobulin light chain comprising a light chain complementarity determining region 1 (LCDR1) comprising the amino acid sequence set forth in SEQ ID NOs: 4, 30, or 46, a LCDR2 comprising the amino acid sequence set forth in SEQ ID NOs: 5, 31, or 47, and a LCDR3 comprising the amino acid sequence set forth in SEQ ID NOs: 6, 32, or 48.15.The antibody of any one of claims 1-14, wherein the antibody comprises an immunoglobulin heavy chain comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identity to the amino acid sequence set forth in SEQ ID NOs: 19, 21, 23, 39, 55, or 70-75.16.The antibody of any one of claims 1-15, wherein the antibody comprises an immunoglobulin light chain comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identity to the amino acid sequence set forth in SEQ ID NOs: 25, 41, or 57.17.The antibody of any one of claims 1-16, wherein the antibody comprises:(a) an immunoglobulin heavy chain comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identity to the amino acid sequence set forth in SEQ ID NOs: 70, and(b) an immunoglobulin light chain comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%identity to the amino acid sequence set forth in SEQ ID NO: 25.18.The antibody of any one of claims 1-17, wherein the antibody comprises an amino acid mutation AA at the C-terminus of the hinge region relative to the natural hinge region.19.The antibody of claim 18, wherein the antibody lacks the ability to mediate antibody dependent cell-mediated cytotoxicity (ADCC) or has reduced ability to mediate ADCC relative to a reference antibody having substantially the same sequence except without the AA mutation at the C-terminus of the hinge region.20.An isolated nucleic acid encoding the antibody of any one of claims 1-19.21.A vector comprising the isolated nucleic acid of claim 20.22.A host cell comprising the isolated nucleic acid of claim 20 or the vector of claim 21.23.A pharmaceutical composition comprising the antibody of any one of claims 1-19, and a pharmaceutically acceptable excipient, carrier, or diluent.24.A kit comprising the antibody of any one of claims 1-19 and an instruction for use.25.A method for treating a disease or condition in a subject in need thereof, comprising administering to the subject the antibody of any one of claims 1-19 or the pharmaceutical composition of claim 23.26.The method of claim 25, wherein the disease or condition comprises cancer, sepsis or septic shock, or a chronic infection (optionally viral infections) .27.The method of claim 25 or 26, wherein the subject is canine.28.A method of making the pharmaceutical composition of claim 23, comprising admixing the antibody of any one of claims 1-19 and a pharmaceutically acceptable excipient, carrier, or diluent.29.A method of making a composition for treating cancer, sepsis or septic shock, or chronic infection (e.g., viral infections) , comprising admixing the antibody of any one of claims 1-19 and a pharmaceutically acceptable excipient, carrier, or diluent.30.The method of claim 26 or 29, wherein the cancer comprises a melanoma (e.g., metastatic malignant melanoma) , a prostate cancer (for example hormone refractory prostate adenocarcinoma) , a head and neck cancer (for example, squamous cell carcinoma of the head and neck) , a cervical cancer, a thyroid cancer, a glioblastoma, a glioma, leukemia, a lymphoma (for example, a B cell lymphoma) , an adrenal gland cancer, an AIDS-associated cancer, an alveolar soft part sarcoma, an astrocytic tumor, bone cancer, a brain and spinal cord cancer, a metastatic brain tumor, a carotid body tumor, a chondrosarcoma, a chordoma, a chromophobe renal cell carcinoma, a clear cell carcinoma, cutaneous benign fibrous histiocytoma, a desmoplastic small round cell tumor, an ependymoma, a Ewing's tumor, an extraskeletal myxoid chondrosarcoma, a fibrogenesis imperfecta ossium, a fibrous dysplasia of the bone, a gallbladder or bile duct cancer, a gestational trophoblastic disease, a germ cell tumor, a hematological malignancy, hepatocellular carcinoma, an islet cell tumor, a Kaposi's sarcoma, a kidney cancer, a lipoma / benign lipomatous tumor, a liposarcoma / malignant lipomatous tumor, a medulloblastoma, a meningioma, a Merkel cell carcinoma, a multiple endocrine neoplasia, a multiple myeloma, a myelodysplasia syndrome, a neuroblastoma, a neuroendocrine tumor, a papillary thyroid carcinoma, a parathyroid tumor, a pediatric cancer, a peripheral nerve sheath tumor, a phaeochromocytoma, a pituitary tumor, a prostate cancer, a posterior uveal melanoma, a rare hematologic disorder, a renal metastatic cancer, a rhabdoid tumor, a rhabdomysarcoma, a sarcoma, a soft-tissue sarcoma, a squamous cell cancer, a stomach cancer, a synovial sarcoma, a testicular cancer, a thymic carcinoma, a thymoma, a thyroid metastatic cancer, a uterine cancer, or any combination thereof.31.A method of producing the antibody of any one of claims 1-19 comprising culturing the host cell of claim 22.

Citation Information

Patent Citations

  • Caninized murine anti-canine pd-1 antibodies

    CN105829344A

  • Canine antibody therapeutic for treating cancer

    US20210047412A1

  • Anti-canine PD-1 antibody or Anti-canine PD-l1 antibody

    WO2016006241A1

  • PD-l1 antibodies binding canine PD-l1

    WO2016050721A1

  • Anti-PD-1 antibody and uses thereof

    WO2022124866A1