Pri-mirna and use thereof

Abstract

Provided are a pri-miRNA, and a pre-miRNA or miRNA molecule processed therefrom. Also provided is a delivery system for the pri-miRNA, pre-miRNA or miRNA molecule, such as an exosome, and a pharmaceutical composition containing same. Also provided is a use of the pri-miRNA, pre-miRNA or miRNA molecule in disease treatment and drug preparation.

Description

Primary-miRNA and its applications

[0001] This application claims priority to Chinese patent application No. 202311646805.9, filed on December 1, 2023, entitled “Primary-miRNA and Its Applications,” the entire contents of which are incorporated herein by reference. Technical Field

[0002] The present invention relates to the fields of molecular biology and medicine. Specifically, the present invention relates to precursor miRNA and miRNA molecules, their delivery systems and their applications in disease treatment. Background Art

[0003] MicroRNA (or miRNA or miR) is little, non-coding, single-stranded ribonucleic acid molecule (RNA), and it is often the length of 19-25 nucleotides. More than 1000 kinds of microRNAs have been identified in mammalian genomes. Ripe miRNA mainly combines the 3 ' untranslated region (3 '-UTR) of target messenger RNA (mRNA) by partially or completely pairing with the complementary sequence of target mRNA, thereby promoting the degradation of target mRNA at the post-transcriptional level, and in some cases, suppressing the initiation of translation. MiRNA plays a key role in many key biological processes (such as the regulation of cell cycle and growth, apoptosis, cell proliferation and tissue development).

[0004] MiRNA genes are typically transcribed as primary transcripts of miRNAs - primary microRNAs (i.e., primary-miRNAs, pri-miRNAs).Primary-miRNAs are cleaved into miRNA precursors (i.e., precursor-miRNAs, pre-miRNAs), which are further processed to produce mature and functional miRNAs.

[0005] There is still a need in the art for improved constructs containing primary-miRNA, precursor-miRNA and mature microRNA with higher specificity and fewer off-target effects, as well as suitable delivery systems to safely, accurately and efficiently deliver artificial miRNA or siRNA to target tissues.

[0006] Parkinson's disease is a common neurodegenerative disorder that affects 2% of people over the age of 60. Although some clinical approaches have been used to alleviate Parkinson's disease symptoms and improve motor function in Parkinson's patients, there is currently no treatment that can halt or reverse the degenerative process of Parkinson's disease.

[0007] Parkinson's disease is categorized as either familial or sporadic, with the majority of patients (approximately 90%) experiencing sporadic Parkinson's disease. LRRK2 mutations are the most common genetic cause of Parkinson's disease, accounting for 5-13% of familial Parkinson's disease and 1-5% of sporadic forms. The LRRK2 gene encodes a 2,527-amino acid protein containing multiple functional domains. The most common mutations in LRRK2 are concentrated in the GTPase domain (R1441C / G / H) and the kinase domain (G2019S and I2020T). The high enzyme activity of these mutants is associated with many of the pathogenic features of Parkinson's disease, including dopaminergic neuron death, abnormal protein aggregation, impaired mitochondrial function, inflammation, and oxidative damage. On the other hand, researchers have also found that the kinase activity of wild-type LRRK2 is abnormally increased in substantia nigra dopaminergic neurons in some Parkinson's patients. Therefore, LRRK2 is a promising therapeutic target for the disease.

[0008] There is also a need in the art for better RNA-based therapeutic or preventive methods and drugs that can be used to treat or prevent Parkinson's disease. Summary of the Invention

[0009] The invention provides polynucleotides that work as microRNA (or miRNA or miR) or siRNA, which are used to regulate the level or amount of (increase or decrease) target gene mRNA. Polynucleotides provided by the invention are included in precursor molecules processed in the cell before regulating. Regulatory polynucleotides or their processed forms can be encoded in plasmids, vectors, genomes or other nucleic acid expression vectors for delivery to cells.

[0010] The polynucleotides provided by the present invention include primary microRNA (pri-miRNA or pri-miR) or precursor microRNA (pre-miRNA or pre-miR), which are processed within the cell to produce highly specific artificial microRNA or siRNA.

[0011] The term "microRNA (or miRNA or miR)" herein refers to a non-coding RNA of 19-25 nucleotides in length that binds to the 3'UTR of a nucleic acid molecule and downregulates gene expression (either by reducing nucleic acid molecule stability or by inhibiting translation). The regulatory polynucleotides of the present invention may comprise one or more microRNA sequences, microRNA seeds, or artificial microRNAs, e.g., sequences that function as microRNAs.

[0012] The term "pri-miRNA" as used herein refers to primary microRNA. Pri-miRNA is the primary transcript of a miRNA gene. The term "pre-miRNA" refers to precursor microRNA. Pre-miRNAs are approximately 70 bases long and are produced in the cell nucleus after cleavage of the pri-miRNA by Drosha. Pre-miRNAs are exported to the cytoplasm by exportin 5, where they are processed by the nuclease Dicer to form mature miRNAs.

[0013] The term "siRNA" herein refers to small interfering RNA, which is sometimes also called short interfering RNA or silencing RNA. It is a type of double-stranded RNA, typically 17-24 base pairs in length. It interferes with the expression of a specific gene by degrading mRNA with a nucleotide sequence complementary to the siRNA antisense strand (also known as the guide strand) to prevent translation.

[0014] The polynucleotides provided by the present invention can efficiently deliver exogenous nucleotide sequences to exosomes, specifically inhibit target genes in target cells after the exosomes reach the target cells, and can minimize side effects caused by off-target effects.

[0015] In one aspect of the present invention, a primary microRNA, namely, pri-miRNA, is provided, wherein the pri-miRNA comprises an RNA sequence targeting a target mRNA and a stem-loop structure.

[0016] Specifically, in one aspect of the present invention, a pri-miRNA is provided, wherein the pri-miRNA has the following structure:

[0017] Wherein, “|” indicates base pairing (complete complementarity or almost complete complementarity), (A1A2…A a-1 A a ) is the first RNA sequence; (B b B b-1 ...B2B1) is the second RNA sequence, (A1A2...A a-1 A a ) and (B b B b-1 ...B2B1) fully complementary or substantially fully complementary, wherein a and b are each independently an integer from about 15 to 29, preferably an integer from about 18 to 22;

[0018] [M1M2…M m-1 M m ] is the 5' flanking structure sequence; [N n N n-1...N2N1] is a 3' end flanking structure sequence, wherein m and n are each independently an integer of about 25-50, preferably, m <n;

[0019] The separation sequence that forms the stem-loop structure is called the C stem-loop.

[0020] wherein c is an integer of about 10-30, preferably an integer of about 16-20.

[0021] The pri-miRNA provided by the present invention undergoes biological processing (in vivo, in tissues or cells, etc.) (hereinafter referred to as "processing") to produce pre-miRNA and then miRNA, and finally produces an RNA sequence that targets the target mRNA. In the present invention, the 5' end flanking structure sequence [M1M2...M m-1 M m ] and the first RNA sequence (A1A2…A a-1 A a ) is also called the 5' arm, in which the first RNA sequence (A1A2...A a-1 A a ) is called 5' arm RNA sequence or 5' arm miRNA. Correspondingly, the 3' end flanking structure sequence [N n N n-1 ...N2N1] and the second RNA sequence (B b B b-1 ...B2B1) is also called the 3' arm, in which the second RNA sequence (B b B b-1 ...B2B1) is called a 3' arm RNA sequence or 3' arm miRNA. The pre-miRNA provided by the present invention comprises an RNA sequence that targets the target mRNA, which can be positioned or located on the 5' arm or 3' arm of the stem-loop structure of the regulatory polynucleotide, i.e., the first miRNA sequence or the second miRNA sequence. The pre-miRNA provided by the present invention can produce one or two single-stranded mature miRNAs. Based on the processing from the 5' end arm and the 3' end arm of the precursor, the corresponding first miRNA sequence (A1A2...A a-1 A a ) can be called miRNA-5p, corresponding to the second miRNA sequence (B b B b-1 ...B2B1) can be referred to as miRNA-3p.

[0022] miRNA can be substantially complementary to at least a portion of the sequence of the mRNA encoding the gene. "Substantially complementary" means that the nucleotide sequences are sufficiently complementary to interact in a predictable manner, such as forming a secondary structure. Typically, two "substantially complementary" nucleotide sequences have at least 70% of their nucleotides complementary to each other; preferably, at least 80% of their nucleotides are complementary; more preferably, at least 90% of their nucleotides are complementary; further preferably, at least 95% of their nucleotides are complementary; such as 98%, 99% or 100%. Functionally, miRNA interferes with the post-transcriptional degradation of the mRNA of a specific gene expressing the complementary nucleotide sequence, thereby preventing translation.

[0023] In one aspect of the present invention, the length of miRNA is 15-29 nucleotide (nt), preferably 18-22nt, such as 18nt, 19nt, 20nt, 21nt, 22nt. A large number of experiments have shown that the length of RNA sequence is less than 18nt, particularly less than 15nt, and this RNA sequence is mostly invalid, can not play a role, and the length of RNA sequence is greater than 22nt, particularly greater than 25nt, then not only the cost of circuit is greatly improved, and effect is also not better than the RNA sequence that length is 18-22nt, poor economic benefit. Therefore, the length of miRNA sequence is 15-25nt, particularly 18-22nt, best effect.

[0024] In one aspect of the present invention, the miRNAs obtained after biological processing of the pri-miRNA provided by the present invention, which are the first miRNA sequence or the second miRNA sequence, are both active, that is, the 5' arm miRNA or the 3' arm miRNA is both active.

[0025] In one aspect of the present invention, the pri-miRNA provided herein, after biological processing, substantially only produces miRNAs having the sequence of the first miRNA sequence or the second miRNA sequence, while the other RNA sequence does not form or barely forms a miRNA. In one embodiment of the present invention, the miRNA having the sequence of the first miRNA sequence produced after in vivo processing of the pri-miRNA provided herein is active, i.e., the 5' arm miRNA is active, while the miRNA having the sequence of the second miRNA sequence is barely produced, i.e., the 3' arm miRNA is inactive or barely active.

[0026] In the present invention, it is advantageous to provide pri-miRNAs with high guide strand activity and low passenger strand activity.

[0027] In one aspect of the present invention, the amount of the almost unformed miRNA obtained after biological processing of the pri-miRNA provided by the present invention accounts for less than 40% of the total miRNA obtained after processing of the pri-miRNA, preferably less than 10%, more preferably less than 5%, for example less than or equal to 1%.

[0028] In one aspect of the present invention, the pri-miRNA provided by the present invention, after biological processing, essentially only obtains the miRNA sequence of the first miRNA sequence or the second miRNA sequence, and the mRNA or protein target knockdown (KD) achieved is at least greater than about 50%, 75%, 90%, 95%, or reaches 99%.

[0029] In one aspect of the present invention, the pri-miRNA provided by the present invention, which is hardly formed into miRNA after biological processing, achieves a knockdown of mRNA or protein target of less than about 40%, 10%, 5%, or close to 0.

[0030] In one aspect of the present invention, the pri-miRNA provided by the present invention, after biological processing, substantially only obtains miRNAs having the first miRNA sequence or the second miRNA sequence without producing off-target effects.

[0031] In one aspect of the present invention, the second miRNA sequence (B b B b-1 ...B2B1) and the first miRNA sequence (A1A2...A a-1 A a ) are fully complementary.

[0032] In one aspect of the present invention, the second miRNA sequence (B b B b-1 ...B2B1) and the first miRNA sequence (A1A2...A a-1 A a ) are substantially complementary, but have several unpaired regions of nucleotides. In one embodiment of the present invention, a is greater than b, preferably a is 1-3 greater than b, more preferably 1 or 2 greater, i.e., the first miRNA sequence of the 5' arm (A1A2...A a-1 A a ) than the second miRNA sequence of the 3' arm (B b B b-1 ...B2B1) has more nucleotides, for example, 1-3 more nucleotides, preferably 1 or 2 more nucleotides. In one embodiment of the present invention, the first miRNA sequence (A1A2...A a-1 A a) and the second miRNA sequence (B b B b-1 ...B2B1) unpaired bases or regions (regions formed by two or three consecutive unpaired bases) form bubble structures: that is, the (A1A2...A a-1 A a ) and (B b B b-1 ...B2B1) is located in the first RNA sequence (A1A2...A a-1 A a ) and the second RNA sequence (B b B b-1 ...B2B1) is located in the middle of the stem formed by the first miRNA sequence (A1A2...A a-1 A a ) and the second miRNA sequence (B b B b-1 ...B2B1) Unpaired bases are non-adjacent bases.

[0033] In one embodiment of the present invention, A a C or G.

[0034] In one aspect of the present invention, the first RNA sequence or the second RNA sequence in the pri-miRNA provided therein is an RNA sequence that is complementary or substantially complementary to an RNA sequence that inhibits expression of a target gene, and the target inhibitory genes include EGFR gene, KRAS gene, VEGFR gene, mTOR gene, TNF-α gene, integrin-α gene, B7 gene, TGF-β1 gene, H2-K gene, H2-D gene, H2-L gene, HLA gene, GDF15 gene, miRNA-21, miRNA-214, TNC gene, PTP1B gene, mHTT gene, LRRK2 gene and α-synuclein gene.

[0035] In one embodiment of the present invention, the target inhibitory gene of the pri-miRNA provided therein is the LRRK2 gene.

[0036] In one embodiment of the present invention, the first RNA sequence (A1A2...A a-1 A a ) is selected from the group consisting of the following nucleic acid sequences:

[0037] In one embodiment of the present invention, the first RNA sequence (A1A2...A a-1 A a ) and the second miRNA sequence (Bb B b-1 ...B2B1) is selected from the following nucleic acid sequence group:

[0038] The polynucleotides provided by the present invention, such as the aforementioned pri-miRNA, comprise modular elements or sequence motifs assembled according to a set of rules that result in highly specific target recognition and a high 5' arm miRNA / 3' arm miRNA ratio. The modules or sequence motifs of these RNAs, particularly pri-miRNAs, include double-stranded regions, flanking regions, loops, and non-Watson-Crick wobble GU pairs (abbreviated as "wobble pairs" or "GU pairs"). Studies have found that accurate recognition of RNA helices (A-type or B-type) by RBPs to form stable RNA-protein complexes may depend on non-Watson-Crick wobble GU pairs observed in naturally occurring pri-miRNAs. Studies on the three-dimensional structure of large RNA-protein complexes have found that wobble GU pairs are key structural elements that distort the RNA deep groove to allow the natural folding of RNA and are recognized by RBPs. The modules or sequence motifs of these RNAs, particularly pre-miRNAs, form RNA secondary or tertiary structures including loops, protrusions, mismatches, wobbles, and / or combinations thereof.

[0039] In one embodiment of the present invention, the C stem loop of the pri-miRNA is closely related to the first miRNA sequence (A1A2...A a-1 A a ) and the second miRNA sequence (B b B b-1 ...B2B1) are complementary or non-Watson-Crick wobble GU pairs (abbreviated as "wobble pairs" or "GU pairs"). In another embodiment of the present invention, the C stem loop is adjacent to the first miRNA sequence (A1A2...A a-1 A a ) and the second miRNA sequence (B b B b-1 ...B2B1) form a stem where 1-2 adjacent base pairs are wobble pairs (GU).

[0040] In one embodiment of the present invention, the sequence of the C stem-loop is selected from:

[0041] TTTTTGCCTCCAACTGA (SEQ ID NO: 39);

[0042] GTTTTGGCCTCTGACTGAC (SEQ ID NO: 40);

[0043] GTTTTGGCCACTGACTGAC (SEQ ID NO: 59);

[0044] TTTTTGGCCTCTGACTGAA (SEQ ID NO: 60).

[0045] In the present invention, the [M1M2…M m-1 M m ] is the 5' flanking structure sequence; [N n N n-1 ...N2N1] is the 3' end flanking structure sequence, [M1M2...M m-1 M m ] and [N n N n-1 ...N2N1] forms a stem or stem-loop structure. The stem-loop secondary structure comprises one or more base pair mismatches in the stem. These mismatched base pairs create an unpaired region within the stem. In some embodiments, the mismatched region can be 1 to 5 nucleotides in length, for example, 1, 2, 3, 4, or 5 nucleotides in length.

[0046] In one aspect of the present invention, in the pri-miRNA provided by the present invention, the 5' end flanking structure sequence [M1M2...M m-1 M m ] and the 3' flanking structure sequence [N n N n-1 ...N2N1] forms a stem that is closely related to the first RNA sequence (A1A2...A a-1 A a ) and the second RNA sequence (B b B b-1 ...B2B1) formed by the adjacent position of the stem of base pairs.

[0047] In one aspect of the present invention, in the pri-miRNA provided by the present invention, the 5' end flanking structure sequence [M1M2...M m-1 M m ] and 3' flanking structure sequence [N n N n-1 ...N2N1] sequences are each independently or simultaneously identical to the corresponding structural sequence of mammalian (preferably human) pri-miRNA (preferably pri-miR155, whose sequence is such as SEQ ID NO: 20) greater than 80%, preferably greater than 90%, preferably greater than 95%, and preferably 100%.

[0048] In one embodiment of the present invention, the 5' end flanking structure sequence [M1M2...M m-1 Mm ] is selected from:

[0049] CTGAAGGCTTGCTGTGAGCTGTATGCTG (SEQ ID NO: 61);

[0050] CTGAAGGCTTGCTGTAGGCTGTATGCTG (SEQ ID NO: 62);

[0051] TGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO: 63);

[0052] TGGAGGCTTGCTTTGGGCTGTATGCTG (SEQ ID NO: 64).

[0053] In one embodiment of the present invention, the 3' flanking structure sequence [N n N n-1 ...N2N1] is selected from:

[0054] In one embodiment of the present invention, the 5' end flanking structure sequence [M1M2...M m-1 M m ] and the 3' end flanking structure sequence [N n N n-1 ...N2N1] is selected from the group consisting of:

[0055] In one aspect of the present invention, the C stem-loop of the pri-miRNA provided herein has a sequence capable of forming base pairs, thereby forming a stem-loop structure as shown below:

[0056] wherein x is an integer of about 4-5, preferably 4; and y is an integer of about 1-3, preferably 2.

[0057] In one embodiment of the present invention, the C x C x+1 C x+y For UUG.

[0058] In one embodiment of the present invention, the nucleotide sequence of the C-stem-loop in the pri-miRNA provided therein is TTTTTGCCTCCAACTGA (SEQ ID NO: 39).

[0059] In one embodiment of the present invention, the 5' end flanking structure sequence [M1M2...M m-1 M m] is selected from:

[0060] CTGAAGGCTTGCTGTGAGCTGTATGCTG (SEQ ID NO: 61);

[0061] CTGAAGGCTTGCTGTAGGCTGTATGCTG (SEQ ID NO: 62).

[0062] In one embodiment of the present invention, the 3' flanking structure sequence [N n N n-1 ...N2N1] is selected from:

[0063] GTGTATGATGCTCGTTATCAGCATTCACAT (SEQ ID NO: 65);

[0064] GTGTATGATGCCTGTTACTAGCATTCACAT (SEQ ID NO: 66).

[0065] In one embodiment of the present invention, the 5' end flanking structure sequence [M1M2...M m-1 M m ] and the 3' end flanking structure sequence [N n N n-1 ...N2N1] is selected from the group consisting of:

[0066] In one embodiment of the present invention, the nucleotide sequence of the first miRNA sequence is shown in any one of SEQ ID NO: 21 to SEQ ID NO: 32.

[0067] In one embodiment of the present invention, the pri-miRNA is a nucleic acid molecule having a nucleotide sequence as shown in any one of SEQ ID NO: 1 to SEQ ID NO: 12.

[0068] In one aspect of the present invention, the 5' end flanking structure sequence [M1M2...M m-1 M m ] and the 3' end flanking structure sequence [N n N n-1 ...N2N1] has 2-3 stem structures formed by complementary or substantially complementary sequences, and 1-2 bubble structures are formed by non-complementary or missing nucleotides between the complementary sequences. In one embodiment of the present invention, the 3' end flanking structure sequence [N n N n-1…N2N1] than the 5' flanking structure sequence [M1M2…M m-1 M m ]A fragment with an additional 10-20 nucleotides at the 3' end.

[0069] In one embodiment of the present invention, the 5' end flanking structure sequence [M1M2...M m-1 M m ] is selected from:

[0070] In one embodiment of the present invention, the 3' flanking structure sequence [N n N n-1 ...N2N1] is selected from:

[0071] In one embodiment of the present invention, the 5' end flanking structure sequence [M1M2...M m-1 M m ] and the 3' end flanking structure sequence [N n N n-1 ...N2N1] is selected from the group consisting of:

[0072] In one embodiment of the present invention, the sequence of the C stem-loop is selected from:

[0073] In one embodiment of the present invention, the nucleotide sequence of the first miRNA sequence is shown in any one of SEQ ID NO: 33 to SEQ ID NO: 38. Preferably, the nucleotide sequence of the first miRNA sequence is shown in SEQ ID NO: 35.

[0074] In one embodiment of the present invention, the pri-miRNA is a nucleic acid molecule having a nucleotide sequence as shown in any one of SEQ ID NO: 13 to SEQ ID NO: 19, preferably, it is a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID NO: 15.

[0075] In one aspect of the present invention, a pre-miRNA is provided, which has the following structure:

[0076] Among them, “|” represents base pairing, (A1A2…A a-1 A a ) is the first RNA sequence; (B b B b-1 ...B2B1) is the second RNA sequence, (A1A2...A a-1 A a ) and (Bb B b-1 ...B2B1) completely complementary or substantially completely complementary;

[0077] The separating sequence that forms the stem-loop structure is called the C stem-loop.

[0078] Among them (A1A2…A a-1 A a )、(B b B b-1 ...B2B1) and the C stem-loop are as described above.

[0079] In one aspect of the present invention, the pre-miRNA provided by the present invention is processed from the pri-miRNA of the present invention described above.

[0080] In one aspect of the present invention, an RNA molecule is provided, the structure of which is:

[0081] 5'(A1 A2…A a-1 A a )3' or 5'[(B1 B2…B b-1 B b )3'.

[0082] Among them (A1A2…A a-1 A a ) and (B b B b-1 …B2B1) as described above.

[0083] In one aspect of the present invention, the RNA molecule is processed from the pri-miRNA or pre-miRNA of the present invention as described above.

[0084] In one aspect, the present invention also provides siRNA. siRNA, also known as short interfering RNA or silencing RNA, is a double-stranded RNA molecule, typically 20-29 base pairs in length, with each strand extending two nucleotides beyond the other end. The corresponding siRNA can be processed from the aforementioned pri-miRNA or pre-RNA provided herein.

[0085] In one aspect of the present invention, a vector is provided, comprising a sequence encoding the aforementioned pri-miRNA, pre-miRNA or RNA molecule of the present invention. In another aspect of the present invention, the vector is an expression vector. The sequence encoding the pri-miRNA, pre-miRNA or RNA molecule of the present invention can be located downstream of a promoter of the vector (for example, but not limited to, CMV, U6, CBA or CBA promoter with SV40 intron). In addition, the sequence encoding the pri-miRNA, pre-miRNA or RNA molecule of the present invention can be located upstream of a polyadenylation sequence.

[0086] In one embodiment of the present invention, the vector is a plasmid. In one embodiment of the present invention, after administration to a mammal, the plasmid can be enriched in tissues (including: liver, lungs, gastrointestinal tract, mammary gland, kidney, brain, spleen, lymph, thyroid, reproductive organs, blood cells or lymphocytes, particularly liver), transcribe and / or express the RNA fragment of the present invention, and the RNA fragment is encapsulated in exosomes in the cells of the tissue.

[0087] In one embodiment of the present invention, the vector is a viral vector. For example, it can be a baculovirus expression vector, an adenovirus vector, a retrovirus vector, a herpes virus vector, or a lentivirus vector. In one embodiment of the present invention, the vector is an adenovirus vector. Preferably, the adenovirus is adenovirus-associated virus type 5, adenovirus-associated virus type 8, or adenovirus-associated virus type 9. More preferably, the adenovirus is adenovirus-associated virus type 5.

[0088] In one embodiment of the present invention, after being administered to a mammal, the plasmid or viral vector is enriched and expressed in the liver, and its product is largely encapsulated in exosomes.

[0089] In one aspect of the present invention, a cell comprising a pri-miRNA, pre-miRNA, or RNA molecule of the present invention as described above is provided. The cell comprising the pri-miRNA, pre-miRNA, or RNA molecule of the present invention can be obtained by transfecting the cell with a plasmid or viral vector comprising a sequence encoding the pri-miRNA, pre-miRNA, or RNA molecule of the present invention. Transfection of cells with a nucleic acid construct can be performed using a variety of methods. These methods include, but are not limited to, cationic lipid transfection, electroporation, viral transfection, and calcium phosphate transfection.

[0090] In one aspect of the present invention, exosomes are provided that contain RNA that inhibits gene expression, wherein the RNA is a pri-miRNA, pre-miRNA, or RNA molecule of the present invention as described above. In one embodiment of the present invention, the exosomes are derived from human tissues or cells. The tissues include the liver, lungs, gastrointestinal tract, breast, kidneys, brain, spleen, lymph nodes, thyroid gland, reproductive organs, blood cells, or lymphocytes. In one embodiment of the present invention, the exosomes are derived from the liver or liver cells.

[0091] The exosomes of the present invention can be purified using known exosome purification techniques. For example, exosomes can be purified by tangential flow filtration (TFF) or ultracentrifugation, for example, at 100,000 x g for 1-2 hours. Alternative or additional purification methods can be used, such as antibody-based methods, for example, immunoprecipitation using specific antibodies, magnetic bead purification, resin-based purification. The exosomes can then be quantified and characterized.

[0092] The pri-miRNA, pre-miRNA, or RNA provided by the present invention can inhibit specific target genes in different tissues and treat related diseases. For example, siRNA targeting the REGFR gene, siRNA targeting the TNC gene, or a combination of the two can be used to treat glioblastoma; siRNA targeting the PTP1B gene can be used to treat obesity; siRNA targeting the mHTT gene can be used to treat Huntington's disease; siRNA targeting the LRRK2 gene can be used to treat Parkinson's disease; siRNA targeting the EGFR gene can be used to treat diseases such as lung cancer induced by overexpression or mutation of the EGFR gene; siRNA targeting the TNF-α gene, siRNA targeting the integrin-α gene, siRNA targeting the B7 gene, or any combination of the three can be used to treat colitis or colon cancer.

[0093] In one aspect of the present invention, a pharmaceutical composition is provided, comprising the nucleic acid, vector, or exosome as described above, and further comprising a pharmaceutically acceptable carrier or excipient for delivering the nucleic acid, vector, or exosome to a subject.

[0094] The administration of the drug includes oral administration, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection. That is, the drug can be administered orally, inhaled, subcutaneously, intramuscularly, or intravenously. The dosage form of the drug can be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes, etc. After administration to mammals, the plasmid or viral vector in the drug is enriched in tissues (including: liver, lungs, gastrointestinal tract, mammary glands, kidneys, brain, spleen, lymph, thyroid, reproductive organs, blood cells or lymphocytes, especially liver), and its expressed products are encapsulated in large quantities in exosomes in the cells of the tissue and delivered to the target tissue, exerting a therapeutic effect.

[0095] The pharmaceutical composition can be used to treat various diseases, including tumors, acute and chronic infectious diseases or other acute and chronic diseases. The acute and chronic infectious diseases include: viral influenza, viral hepatitis, AIDS, SARS, bacterial diseases (such as tuberculosis, bacterial pneumonia), and other acute and chronic infectious diseases caused by various pathogenic microorganisms. The other acute and chronic diseases include: respiratory system diseases, immune system diseases, blood and hematopoietic system diseases, circulatory system diseases such as cardiovascular and cerebrovascular diseases, endocrine system metabolic diseases, digestive system diseases, nervous system diseases, urinary system diseases, reproductive system diseases and locomotor system diseases. For example, the disease is cancer, pulmonary fibrosis, colitis, obesity, cardiovascular disease caused by obesity, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease or graft-versus-host disease.

[0096] In one aspect, the present invention provides a method for treating a disease, comprising administering a nucleic acid, vector, or exosome as described above to a subject. The disease includes a tumor, an acute or chronic infectious disease, or other acute or chronic disease. In another aspect, the present invention also provides the use of a nucleic acid, vector, or exosome as described above in the preparation of a medicament for treating a disease.

[0097] It is understood by those skilled in the art that the actual dosage to be administered will vary depending on a variety of factors, such as the vector, the target cell or tissue, the general condition of the subject to be treated, the degree of transformation / modification sought, the route of administration, the mode of administration, the type of transformation / modification sought, etc. DETAILED DESCRIPTION

[0098] The essential content and beneficial effects of the present invention will be further illustrated below with reference to examples, which are only used to illustrate the present invention rather than to limit the present invention.

[0099] Example 1 Materials and Methods

[0100] Table 1 Cells, materials and kits:

[0101] Example 2 Nucleic acid synthesis and plasmid preparation

[0102] 1. Jiangsu Jinweizhi Biotechnology Co., Ltd. was commissioned to synthesize the nucleic acid fragments listed in Table 2 below.

[0103] Table 2 Sequences and structures of pri-miRNA fragments

[0104] The first miRNA sequence and the second miRNA sequence carried by the 5' arm and the 3' arm of each pri-miRNA fragment are shown in Table 3 below.

[0105] Table 3 5' and 3' miRNA sequences of pri-miRNA fragments

[0106] 2. Construction of a plasmid containing the above pri-miRNA fragment and expressing the contained miRNA

[0107] The above pri-miRNA fragments were inserted into pcDNA6.2-EmGFP-mir9 vectors to prepare LRRK2_miRNA plasmids. The obtained plasmids were named LRRK2-1 to LRRK2-19.

[0108] Example 3 Cell and exosome preparation and analysis

[0109] The plasmid prepared in Example 2 was transfected into HEK293T cells, and the exosomes in the cell culture medium were observed. Nanoparticle tracking analysis (NTA) showed that the number of exosomes secreted by each group was similar, with a similar size distribution, with a peak value between 128-131 nm. Transmission electron microscopy (TEM) confirmed that the purified exosomes exhibited a typical round vesicle morphology and were of the correct size. In addition, the enrichment of specific exon markers (CD63, TSG101, and CD9) was only detected in the purified exosomes, but not in the cell culture medium. Exosomal RNA was extracted for miRNAseq to analyze the miRNA composition.

[0110] The results are shown in Table 4 below

[0111] Table 4 miRNA composition detection

[0112] Example 4 miRNA Activity

[0113] 1. Reporter gene detection of miRNA relative activity

[0114] The miRNA target (LRRK2 gene) sequence was inserted into the pmirGLO vector (Promega) to prepare LRRK2_pmirGLO, and the resulting plasmid was named LRRK_pmirGLO.

[0115] The pmirGLO vector (Promega) can simultaneously express firefly luciferase and Renilla luciferase. The pri-miRNA fragment with the target sequence of the LRRK2 gene listed in Table 2 was inserted into the 3'UTR downstream of the firefly luciferase gene in the pmirGLO vector to construct LRRK2_pmirGLO, which was used to detect the activity of miRNA targeting LRRK2.

[0116] 293T cells (Cell Bank, Chinese Academy of Sciences) were plated in 96-well white plates at a density of 20,000 cells per well overnight. 20 ul of optiMEM, 100 ng of LRRK2_pmirGLO plasmid, 300 ng of miRNA plasmid, 0.8 uL of Lipofectamin 3000 (Thermo Fisher), and 0.8 uL of P3000 (Thermo Fisher) were mixed and incubated at room temperature for 10 minutes. The transfection complex was added to the 96-well plate cells. After 24 hours, the reporter gene substrate (Promega) was added to detect the luminescence signal value, and the relative activity of miRNA was calculated by the Firefly / Renilla ratio.

[0117] The results are shown in Table 5 below

[0118] Table 5 Reporter gene activity detection

[0119] 2. Changes in LRRK2 mRNA and protein levels

[0120] 293T cells were plated in 6-well white plates at a cell density of 1.2E6 cells per well overnight. 2.5 μg of miRNA plasmid was transfected into the 293T cells using Lipofectamin 3000 according to the manufacturer's instructions, and the cells were harvested 48 hours later.

[0121] Cellular mRNA was extracted and qPCR was used to detect changes in LRRK2 mRNA. RNA was extracted using a total RNA extraction kit (UE) according to the instructions, reverse transcription was performed using a reverse transcription reagent (Takara), and qPCR was performed using LRRK2 / GAPDH / β-acti primers. The primer sequences are as follows:

[0122] Western blotting was used to detect changes in cellular LRRK2 protein. A portion of the cells was lysed using RIPA (Biyuntian), and the total protein concentration was measured using the BCA method (Adamas Life). BSA standards were diluted, and 20 μL of sample or standard was added to each well. 200 μL of reaction reagent was added, and the cells were incubated at 37°C for 30 minutes. The OD value was measured using a 562m microplate reader (Thermo Fisher), and the total protein concentration of the samples was calculated based on the standard curve.

[0123] After adding 4X LDS (Thermo Fisher), the samples were heated at 70°C for 10 min, loaded onto an SDS-PAGE gel (Elabscience), and transferred to a membrane. LRRK2 (Abcam) and β-actin (Abcam) antibodies were added for incubation, and LRRK2 and β-actin bands were imaged and graded using a TANON 5200multi imager and software.

[0124] The results are shown in Tables 6 and 7 below.

[0125] Table 6 miRNA activity detection-mRNA target knockdown (KD) effect

[0126] Table 7 miRNA activity detection-protein target knockdown (KD) effect

[0127] The above is an explanation of the present invention and should not be regarded as limiting the present invention. Unless otherwise noted, the practice of the present invention will use the conventional techniques of organic chemistry, polymer chemistry, biotechnology, etc., and it is obvious that in addition to being particularly described in the above description and embodiments, the present invention can also be realized in other ways. Other aspects and improvements within the scope of the present invention will be apparent to those skilled in the art. According to the teachings of the present invention, many changes and variations are feasible, and therefore they are within the scope of the present invention.

Claims

1. A pri-miRNA, wherein the pri-miRNA comprises an RNA sequence targeting a target mRNA and a stem-loop structure, The pri-miRNA has the following structure: in, "|" indicates base pairing, (A1A2…A a-1 A a ) is the first RNA sequence (RNA-5p); (B b B b-1 ...B2B1) is the second RNA sequence (RNA-3p), (A1A2...A a-1 A a ) and (B b B b-1 …B2B1) are fully complementary or substantially fully complementary, wherein a and b are each independently an integer of about 15-29, preferably an integer of about 18-22; [M1M2…M m-1 M m ] is the 5' flanking structure sequence; [N n N n-1 ...N2N1] is a 3'-end flanking structure sequence, wherein m and n are each independently an integer of about 25-50, preferably, m <n; The separation sequence that forms the stem-loop structure is called the C stem-loop. wherein c is an integer of about 10-30, preferably an integer of about 16-20.

2. The pri-miRNA according to claim 1, wherein the first RNA sequence or the second RNA sequence is an RNA sequence that is complementary or substantially complementary to an RNA sequence that inhibits the expression of a target gene, such as EGFR gene, KRAS gene, VEGFR gene, mTOR gene, TNF-α gene, integrin-α gene, B7 gene, TGF-β1 gene, H2-K gene, H2-D gene, H2-L gene, HLA gene, GDF15 gene, miRNA-21, miRNA-214, TNC gene, PTP1B gene, mHTT gene, LRRK2 gene and α-synuclein gene.

3. The pri-miRNA according to claim 1, wherein (A1A2 ... A a-1 A a ) is a nucleotide sequence selected from the group consisting of SEQ ID NOs: 21-38, ATGTAAAATAGCTCGAAGCGC (SEQ ID NO: 21); ACAAACAAGTGACAGAATCAG (SEQ ID NO: 22); AAAGATATCAAACTGGGGTGG (SEQ ID NO: 23); GTATAATTTGGAAGCCTAGGG (SEQ ID NO: 24); AGAAAACAAGTAGCTAGTGGTA (SEQ ID NO: 25); TGAAAATGAAGAAGGACTCCTG (SEQ ID NO: 26); TCTTACTCAACAGATGTTCGTC (SEQ ID NO: 27); TGAATGATGTAGGATCTGCAGC (SEQ ID NO: 28); TCTAAGAGAGTTGACAATGCA (SEQ ID NO: 29); TCAAACAGCACATGTAAAGCT (SEQ ID NO: 30); TCTATCTGTTTTCCTTCCTGGA (SEQ ID NO: 31); NO: 31); ATAAAGGACCAAGCCAAGAAGG (SEQ ID NO: 32); ATCACTTTGAGCAAACACACT (SEQ ID NO: 33); TTTACACTGGCATTATGAACT (SEQ ID NO: 34); ATAAAGGACCAAGCCAAGAAG (SEQ ID NO: 35); TGCAACAGCAACAAAGAGAAT (SEQ ID NO: 36); TCCTAAAGCAGAAATGACCTC (SEQ ID NO: 37); TTAATTTGCACAGAAGTGACC (SEQ ID NO: 38), Preferably, the (A1A2...A a-1 A a ) and (B b B b-1 ...B2B1) is selected from the following nucleic acid sequence group:

4. The pri-miRNA according to claim 1, wherein the C stem loop is (A1A2 ... A a-1 A a ) and (B b B b-1 …B2B1) contains 1-3 complementary base pairs adjacent to the stem, including a non-Watson-Crick wobble GU pair, Preferably, the C stem ring is (A1A2...A a-1 A a ) and (B b B b-1 …B2B1) contains two complementary base pairs at adjacent positions of the stem, for example, C2 and C c-1 is a swing pair (GU).

5. The pri-miRNA according to claim 1, wherein the sequence of the C stem-loop is selected from: TTTTTGCCTCCAACTGA (SEQ ID NO: 39); GTTTTGGCCTCTGACTGAC (SEQ ID NO: 40); GTTTTGGCCACTGACTGAC (SEQ ID NO: 59); TTTTTGGCCTCTGACTGAA (SEQ ID NO: 60).

6. The pri-miRNA according to claim 1, wherein the 5' end flanking structure sequence [M1M2...M m-1 M m ] and the 3' flanking sequence [N n N n-1 ...N2N1] forms a stem that is connected to the first RNA sequence (A1A2...A a-1 A a ) and the second RNA sequence (B b B b-1 …B2B1) formed by the stem of base pairs.

7. The pri-miRNA according to claim 1, wherein the 5' end flanking structure sequence [M1M2...M m-1 M m ] and the 3' flanking structure sequence [N n N n-1 ...N2N1] sequences are each independently or simultaneously more identical to the pri-miRNA (preferably pri-miR155) sequence of a mammal or human (preferably human) at a level greater than 80%, preferably greater than 90%, preferably greater than 95%, and preferably 100%.

8. The pri-miRNA according to claim 1, wherein the 5' end flanking structure sequence [M1M2...M m-1 M m ] and the 3' flanking structure sequence [N n N n-1 ...N2N1] is selected from the group consisting of the following sequences:

9. The pri-miRNA according to claim 1, wherein after in vivo processing, substantially only the miRNA sequence of the first miRNA sequence or the second miRNA sequence is obtained, while the other RNA sequence does not form or hardly forms miRNA, Preferably, after in vivo processing, substantially only the miRNA having the sequence of the first miRNA sequence is obtained.

10. The pri-miRNA according to claim 9, wherein the knockdown (KD) of the mRNA or protein target achieved by the miRNA whose sequence is essentially only the first miRNA sequence or the second miRNA sequence after in vivo processing is at least greater than about 20%, about 50%, 75%, 90%, 95%, or reaches 99%.

11. The pri-miRNA according to claim 1, wherein the C stem-loop has a sequence that can form base pairs, thereby forming a stem-loop structure as shown below wherein x is an integer of about 4-5, preferably 4; y is an integer of about 1-3, preferably 2, More preferably, wherein said C x C x+1 C x+y For UUG, For example, the nucleotide sequence of the C stem-loop is TTTTTGCCTCCAACTGA (SEQ ID NO: 68).

12. The pri-miRNA according to claim 11, wherein the [M1M2...M m-1 M m ] and [N n N n-1 …N2N1] form a basically complementary stem structure, and the mismatched base pairs are in [M1M2…M m-1 M m ] and [N n N n-1 ...N2N1] The number of unpaired mismatch regions produced in the stem formed is 2-4 (preferably 3), and the length of the mismatch region is 1-5 nucleotides (preferably less than 3).

13. The pri-miRNA according to claim 12, wherein the 5' end flanking structure sequence [M1M2...M m-1 M m ] and the 3' end flanking structure sequence [N n N n-1 ...N2N1] is selected from the group consisting of:

14. The pri-miRNA according to claim 1, wherein the [M1M2...M m-1 M m ] and [N n N n-1 ...N2N1] has 2-3 stem structures formed by complementary or substantially complementary sequences, and 1-2 bubble structures formed by non-complementary or missing nucleotides between complementary sequences. Preferably, the 3' end flanking structure sequence [N n N n-1 …N2N1] than the 5' flanking structure sequence [M1M2…M m-1 M m ]A fragment with about 10-20 extra nucleotides at the 3' end.

15. The pri-miRNA according to claim 14, wherein the 5' end flanking structure sequence [M1M2...M m-1 M m ] and the 3' end flanking structure sequence [N n N n-1 ...N2N1] is selected from the group consisting of:

16. The pri-miRNA according to claim 14, wherein the nucleotide sequence of the C stem-loop is selected from: GTTTTGGCCTCTGACTGAC (SEQ ID NO: 40); GTTTTGGCCACTGACTGAC (SEQ ID NO: 59); TTTTTGGCCTCTGACTGAA (SEQ ID NO: 60).

17. A pre-miRNA having the following structure: Where (A1A2…A a-1 A a )、(B b B b-1 ...B2B1) and C stem-loop as defined in any one of claims 1 to 16, Preferably, it is processed from the pri-miRNA according to any one of claims 1-16.

18. An RNA molecule, whose structure is: 5'(A1A2...A a-1 A a )3' or 5'[(B1B2…B b-1 B b )3', Where (A1A2…A a-1 A a ) or (B b B b-1 …B2B1) as defined in any one of claims 1 to 16, Preferably, it is processed from the pri-miRNA according to any one of claims 1 to 16 or the pre-miRNA according to claim 17.

19. A vector comprising a sequence encoding the pri-miRNA according to any one of claims 1 to 16, the pre-miRNA according to claim 17, or the RNA according to claim 18.

20. A cell comprising the pri-miRNA according to any one of claims 1 to 16, the pre-miRNA according to claim 17, the RNA molecule according to claim 18 or the vector according to claim 19, The exosomes in the cells contain the RNA of claim 18.

21. An exosome comprising the RNA according to claim 18.

22. A method for modulating gene activity in a target cell, comprising administering the pri-miRNA of any one of claims 1 to 16, the pre-miRNA of claim 17, the RNA of claim 18 or the vector of claim 19, the cell of claim 20 or the exosome of claim 21.

23. A pharmaceutical composition comprising the pri-miRNA according to any one of claims 1 to 16, the pre-miRNA according to claim 17, the RNA according to claim 18 or the vector according to claim 19, the cell according to claim 20 or the exosome according to claim 21.

24. A method for treating a disease, comprising administering the pri-miRNA according to any one of claims 1 to 16, the pre-miRNA according to claim 17, the RNA according to claim 18, or the vector according to claim 19, the cell according to claim 20, or the exosome according to claim 21, Optionally, the disease is a tumor, an acute or chronic infectious disease or other acute or chronic disease, for example, the disease is cancer, pulmonary fibrosis, colitis, obesity, cardiovascular disease caused by obesity, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease or graft-versus-host disease.

Images