Nucleic acid constructs comprising apomictic genes of eragrostis curvula and methods related thereto
By introducing a nucleic acid construct with apomictic genes from Eragrostis curvula into non-apomictic plants via Agrobacterium-mediated transformation, the challenge of converting non-apomictic plants into apomictic ones is addressed, offering potential benefits in maintaining hybrid vigor and seed production uniformity.
Patent Information
- Application Number
- PCT/IB2024/062008
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-01
- Filing Date
- 2024-11-28
- Publication Date
- 2025-06-05
AI Technical Summary
Current methods lack a practical approach to transform non-apomictic plants into apomictic plants using apomictic genes from Eragrostis curvula.
A nucleic acid construct comprising a coding sequence for apomictic traits from Eragrostis curvula is introduced into non-apomictic plants using Agrobacterium-mediated transformation.
The method enables the expression of apomictic traits in non-apomictic plants, potentially maintaining hybrid vigor over generations and increasing seed production uniformity.
Smart Images

Figure 00000053_0000 
Figure 00000056_0000 
Figure 00000057_0000
Abstract
Description
[0001]NUCLEIC ACID CONSTRUCTS COMPRISING APOMICTIC GENES OF Eragrostis curvula AND METHODS RELATED THERETO TECHNICAL FIELD OF THE INVENTION The present invention relates to nucleic acid constructs comprising a coding sequence for apomictic traits of Eragrostis curvula, and their use for transforming non-apomictic plants. BACKGROUND Unlike the genetically diverse progeny produced by sexual reproduction in flowering plants, the asexual reproductive process of apomixis results in seeds containing maternal clones (Nogler, 1984). Apomixis is widely distributed among angiosperms (Ozias-Akins and van Dijk, 2007) and its emergence is thought to have required a deregulation of both the genetic and epigenetic components of female reproduction in sexual ancestors (Grimanelli, 2012). Apomixis is common in polyploid grasses, and poorly represented in crop species of economic interest. If apomixis could be incorporated into crop plants, its impact in agriculture could be enormous because apomixis promises to maintain hybrid vigor in the progenies over generations. Carballo et al., 2021 disclose a method to identify apomixis-related genes in Eragrostis curvula by analyzing differential methylation status in certain regions of the E. curvula genome, as well as RNA levels identified by RNA-seq. In particular, the following genes are mentioned: BPM1, BPM2, IDM1, ROS1, ROS4, FARS, and miR-156. Additionally, different genes comprised in the identified regions are summarized in a supplementary table S6, indicating the methylation status (methylated-demethylated) and RNA-seq condition (up-regulated-down-regulated). Among them, several homologous genes are identified in Oryza sativa and Arabidopsis thaliana. On the other hand, patent applications WO 2007 / 066214 A2, CN 103849635 A and CN 112779283 A disclose different constructs from apomictic genes. Patent application WO 2007 / 066214 A2 discloses the use of the DYAD gene and its product to confer apomictic characteristics in a plant, as well as to generate triploid plants and maintain heterosis of a plant across generations. Additionally, the application also discloses and exemplifies the generation of an expression cassette for producing unreduced female gametophytes and apomictic seeds. The application exemplifies the use of Agrobacterium tumefaciens as a transforming agent of Arabidopsis thaliana by incorporating the DYAD gene from Boechera holboellii. Patent application CN 103849635 A discloses an expression vector and a method of introducing a Pingy sweet tea MhSERK4 gene into an apple plant. In particular, the transformation of a tobacco plant with an expression vector pBI121 comprising the MhSERK4 gene in the open reading frame of said vector (vector pBI121-MhSERK4) is exemplified. Examples include the method of obtaining the gene by reverse transcription of RNA extracted from the plant and amplification of the MhSERK4 transcript. The application exemplifies the introduction of the vector into Agrobacterium EHA105. The patent application CN 112779283 A is directed to a nucleic acid construct comprising three expression cassettes (E1, E2, E3). In particular, the expression cassette E2 comprises a gene for autogenic development of an embryo and the cassette E3 comprises genes necessary to induce mitosis instead of meiosis (MiMe). Nucleic acid application, including preparation of apomictic lines, is disclosed. Also included is a method of growing a transgenic plant comprising the introduction of a recombinant nucleic acid or vector into a plant to obtain a transgenic plant. The document discloses that the apomixis method allows obtaining seed clones with fixed heterosis. In particular, the paper exemplifies the transformation of a rice plant with a p76C expression vector containing the embryonic autonomous gene BBM1 to induce parthenogenesis. The transforming agent used was Agrobacterium EHA105. SUMMARY OF THE INVENTION Despite being known in the art the use of apomictic genes for transforming plants and being known some apomictic genes from Eragrostis curvula, there’s still a need for a method for transforming non-apomictic plants into apomictic plants through the introduction of E. curvula genes into said plants. In this sense, it is a first aspect of the present invention to provide a nucleic acid construct comprising a coding sequence for an apomictic trait, wherein said coding sequence is extracted from Eragrostis curvula. In an embodiment, the coding sequence comprises a polynucleotide sequence that can be amplified by two primers with nucleotide sequences selected from any of SEQ ID NO: 9-53. In a particularly preferred embodiment, the coding sequence comprises a polynucleotide sequence of any one of SEQ ID NO: 1-8. In an embodiment, the nucleic acid construct of the first aspect of the present invention enables the expression of an apomictic trait in a plant of interest, preferably a plant that does not naturally express apomictic traits, more preferably a corn plant that does not naturally express apomictic traits. In a preferred embodiment, said plant is selected from the genus Arabidopsis, Hordeum, Oryza, Zea or Triticum. More preferably, a plant selected from Arabidopsis sp., Hordeum vulgare, Oryza sativa, Zea mays, or Triticum aestivum. It is a second aspect of the present invention to provide a method for transforming a non- apomictic plant or plant cell into an apomictic plant or plant cell, comprising introducing a nucleic acid construct of the first aspect of the present invention into said non-apomictic plant or plant cell. In an embodiment, the method of the second aspect of the present invention comprises using an Agrobacterium-mediated transformation. In an embodiment, the method of the second aspect of the present invention comprises transforming a plant selected from the genus Arabidopsis, Hordeum, Oryza, Zea or Triticum. More preferably, a plant selected from Arabidopsis sp., Hordeum vulgare, Oryza sativa, Zea mays, or Triticum aestivum. In an embodiment, the method of the second aspect of the present invention comprises a step of confirmation of the transformation of a plant or plant cell. A third aspect of the present invention is to provide a method for obtaining a transgenic, apomictic plant comprising the steps of: (i) providing a non-apomictic plant or plant cell of interest, (ii) transforming a plant or plant cell of step (i) with a nucleic acid construct of the first aspect of the present invention, and (iii) growing the transformed plant or plant cell. In an embodiment, the plant or plant cell of interest is selected from the genus Arabidopsis, Hordeum, Oryza, Zea or Triticum. More preferably, a plant selected from Arabidopsis sp., Hordeum vulgare, Oryza sativa, Zea mays, or Triticum aestivum. In an embodiment, the method of the third aspect of the present invention comprises a step of confirmation of the transformation of a plant or plant cell, before or after the growth of said transformed plant or plant cell. A fourth aspect of the present invention is to provide a plant or plant cell that comprises a nucleic acid construct of the first aspect of the present invention. In an embodiment, the plant or plant cell can be obtained by a method of the second aspect of the present invention. In an embodiment, the plant or plant cell can be obtained by a method of the third aspect of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1. Syntenic relationships between the Eragrostis curvula cv Don Walter assembled scaffolds (Y axis) and the cv Victoria assembled contigs (X axis). Figure 2. Cytoembryological analysis of the hybrids from the mapping population OTA- S X Don Walter. The percentage of sexual pistils identified in each individual of the mapping population is shown. Figure 3. Eragrostis curvula genomic region (red) delimited by the markers linked to apomixis and containing the EcAPO1 and EcAPO2 genes. Figure 4. Syntenic analysis between Eragrostis curvula cv Don Walter chromosome containing the apomictic region and the diploid sexual cv Victoria. Figure 5. Stages of reproductive development of Eragrostis curvula used for RNA extraction for microarray hybridization. A) Histological section of a pistil showing the archersporial stage. Figure 6. Agarose gels showing the amplification products obtained using genomic DNA from 14 genotypes of E. curvula. The combinations of EcAPO-based primers used primers used were: a.1) EcAPO1_F1 / EcAPO1_R1; a.2) EcAPO1_F2 / EcAPO1_R2; a.3) EcAPO1_F3 / EcAPO1_R3; b.1) EcAPO2_F5 / EcAPO2_R5; b.2 EcAPO2_F3 / EcAPO2_R3; b3) EcAPO2_F4 / EcAPO2_R5. Figure 7. Agarose gels showing the amplification products obtained using genomic DNA from several individuals of the Eragrostis curvula mapping population constructed by crossing OTA-S and Don Walter using a) EcAPO1 and; b) EcAPO2 -based primers. Figure 8A. Distribution of the top 6 BLAST hits on 3 subject sequences. Figure 8B. Alignment of the four EcAPO2 variants. Figure 9. In situ hybridization images of apomictic (A and B) and sexual (C and D) ovaries. Hybridizations were performed using the antisense probe for EcAPO1. Figure 10. qPCR assay showing expression of EcAPO1, 2, 3 and 4 genes in several transgenic lines. Each gene is shown in a different color. The relative expression in the Y axis is shown in a log2scale. Figure 11. Gametophyte development in EcAPO mutant lines. A, mature ES in a WT ovule. B, supernumerary nuclei in mutant ovule. C, ES arrest at FG1 stage. D, mutant ES containing cells with somatic identity (traqueids). E, FM in a WT ovule. F-G, mutant ovules showing more than one persistent FM. H, anther of mutant plant showing pollen grains (pg). ES, embryo sac. FM, functional megaspore. Arrows indicate nuclei positions. Figure 12. Post-fertilization ovule development of EcAPO mutant plants. A, pistil of a mutant line showing developmental delay (triangles) and early arrests (asterisks). B-H, DIC images showing seed development at 24 HAF (B-E) and 48 HAF (F-H). B and F, WT ovules. C-E and G-H, ovules of EcAPO mutant lines showing the embryo (arrow) development arrested at pre-globular stage and uncellularized endosperm. C and G-H, overgrowth in the endosperm cyst (ec). D-E and H, ectopic and unpolarized cysts growing towards the embryo position. HAF, hours after fertilization. Figure 13. Flower development in WT (A), and EcAPO transgenic plants (B-K), showing homeotic transformations (B-F) and indeterminate development (F-K). I to K, pistils observed using DIC microscopy. Figure 14. Seed size measurements in WT (A) and EcAPO mutant lines (B-D). E, Box- plot diagram for seed size showing significant differences between WT and EcAPO mutant lines. *p<0.0001, t test with Welch’s correction. Figure 15. Twenty-eight (28) old days seedlings showing a higher rate of growth in EcAPO mutants. A. WT plants; B. EcAPO_x5 plants; C. Seedling size. *p=0.0008, t test. Figure 16. Chromosome counting in a WT (A) and EcAPO mutant (B) backgrounds. Arabidopsis WT diploid cells contain 10 chromosomes (2n=2x=10). Figure B shows areas of stronger staining corresponding to the nuclei with up to 20 chromosomes. Root cells were treated and observed by using Feulgen’s stain. Figure 17. qPCR assay showing gene expression in EcAPO_1 plants (205). The relative expression in the Y axis is shown in a log2scale. Figure 18.35 old days plants at flowering stage. A, WT plant. B-D, EcAPO transgenic plants. C and D, plants without flowering. DETAILED DESCRIPTION OF THE INVENTION The invention will be described in further detail below, with reference to the accompanying figures and exemplary embodiments below. Any technical terminology used herein shall be understood by the common definition utilized in the art and / or by those skilled in the art, unless otherwise explicitly stated or inferred by context. Each and every embodiment of the objects, methods, and / or aspects of the present invention resulting from the combination of particular embodiments described herein are to be considered as falling within the scope of the present invention. It is a first aspect the present invention to provide a nucleic acid construct comprising a coding sequence for an apomictic trait, wherein said coding sequence is extracted from Eragrostis curvula. As used herein, the term “nucleic acid construct” refers to a polynucleotide sequence or arrangement of DNA or RNA that is specifically designed to introduce a specific polynucleotide sequence, for example a coding sequence or a gene into a plant. A nucleic acid construct may contain regulatory elements like promoters and terminators, in addition to the coding sequence or gene of interest. Nucleic acid constructs may facilitate the controlled insertion and / or expression of a particular coding sequence. Examples of nucleic acid constructs are expression vectors or cassettes. As used herein, the term “coding sequence” refers to a polynucleotide sequence that, when translated, results in a polypeptide, protein, or protein fragment of interest having a physiological function or that is totally or partially responsible for the development of a particular trait, for example, an apomictic trait. A coding sequence may be obtained by any technique known in the art and readily available to a person skilled in the art. As used herein the term “apomictic trait” refers to a phenotypical characteristic or feature in plant that is associated with apomixis, or that is responsible for the phenomenon of apomixis. An apomictic trait, in this sense, is usually controlled by one or more apomictic genes or coding sequences which results in the ability of a plant to produce seed via apomixis, i.e., without the need of fertilization. This can lead to an offspring that is genetically identical to the parent. An apomictic trait comprises at least one characteristic associated with apomixis, including at least one, some or all the steps observed in the apomictic reproduction. An apomictic trait includes any microscopical or molecular characteristics associated with apomixis, including the presence of proteins, factors or markers associated with said traits. Apomictic traits may show up during the early development or floral development. Apomictic traits comprise at least one of the following: FG1 arrest, somatic identity in ES cells, Multiple FM, Presence of extra nuclei in ES / Egg-apparatus, Embryo-proper arrest, Non-cellularized endosperm / atypical cyst(s), indeterminancy or Hometic transformations. As used here, the term "plant" includes whole plants, plant organs (e.g., leaves, stems, flowers, roots, etc.), seeds and plant cells and progeny of same. The range of plants suitable for the method of the invention comprises the higher plants that can undergo transformation techniques, including angiosperms (monocotyledonous and dicotyledonous plants) and gymnosperms. It further comprises plants of diverse ploidy levels, including haploid, diploid, triploid, tetraploid, and other polyploid plants. The nucleic acid construct of the first aspect of the present invention enables the expression of an apomictic trait in a plant of interest, preferably a plant that does not naturally express apomictic traits, more preferably a crop plant that does not naturally express apomictic traits. In a preferred embodiment, the nucleic acid construct of the first aspect of the present invention enables the expression of an apomictic trait in a plant selected from the genus Arabidopsis, Hordeum, Oryza, Zea or Triticum. More preferably, a plant selected from Arabidopsis sp., Hordeum vulgare, Oryza sativa, Zea mays, or Triticum aestivum. In another embodiment, the nucleic acid construct comprises a coding sequence comprising a polynucleotide sequence that can be amplified by any two primers selected from SEQ ID NO: 9-53. More particularly, the coding sequence comprises a polynucleotide sequence that can be amplified by any two primers selected from a) SEQ ID NO: 9-14, or b) SEQ ID NO: 15-39, or c) SEQ ID NO: 40-45, or d) SEQ ID NO: 46-51, or e) SEQ ID NO: 52-53. As a person skilled in the art would appreciate, if the coding sequence can be amplified by using primers selected from SEQ ID NO: 9-53 it means that said coding sequence comprises two sequences that are complementary to those primers. Thus, in another embodiment, the coding sequence comprises at least two polynucleotide sequences that are complementary to any two primers selected from SEQ ID NO: 9-53. More particularly, the coding sequence comprises at least two polynucleotide sequences that are complementary to any two primers selected from a) SEQ ID NO: 9-14, or b) SEQ ID NO: 15-39, or c) SEQ ID NO: 40-45, or d) SEQ ID NO: 46-51, or e) SEQ ID NO: 52-53. In a preferred embodiment, the coding sequence is selected from any one of SEQ ID NO: 1-8. As evidenced by the Examples presented herein, the sequences of SEQ ID NO: 1-8 present the following elements in common: ^ These can be obtained by a differential expression assay via microarray, ^ These coding sequences are present only in the apomictic genotypes of Eragrostis, The sequences referred herein as EcAPO1, EcAPO2_1, EcAPO2_2, EcAPO2_3, EcAPO2_4, and EcAPO5 can be found within the apomixis conditioning region. Meanwhile, the sequences of EcAPO3 and EcAPO4 are found in a block outside this conditioning region. Among the aforementioned sequences, the sequences of SEQ ID NO: 2-5 (corresponding to the genes referred to throughout this description as EcAPO2_1, EcAPO2_2, EcAPO2_3 and EcAPO2_4, respectively), form a subgroup sharing the following nucleotide common regions (Fig.8B): - Common region 1 GGGCCTCGATGGCCGCCTCCCCGCCGCGCAGCCATCACCGGGACGACGACTTYC CTCGCTGCCTCAAGCKTYGMGCGTCCCCSTTCCACTCGTCCGACTCCGAGATTGA CCACCGCCGCAGATCGAGGGCCTTCGCGCCGGTCGCCAACAGCCGCCGCAGAT CTAGGGCCTCCCCGTCCGTCCCCAACCGCCGCCGTGGCCGCGACCCTGAGGGC TGTTCCATGCTCAGCGGGTATGCCAGCGACCCTTCCCGGCGCTTTAGGGTCCCCG ACAGGGAGGAGGATGGGGACCTCAGGCGGAGGCGTGCTAGGGTTGACAAACWG AGGGAGGATGGTCGCCGGCTGATGCGCTCCAG - (SEQ ID NO: 120) - Common region 2 GAGTCCTGAGAAGAGGGAGCCGTTGTCACTGCTGCCGTATAACTCTGGGYGTACT GGTGGGAACTACWCCTCATCTTTCCGCAAGCTTCAGATAAGGCTGAAGCTGGAGG ACAAGGCAAGCCCGGAGTACCAGCGGGTTAGCTGGGATGCACTCGAGAAGCGCA TCAATGGGTTAACTAACAAGGTGAATGTGACAAATATTAAGGATATTGCGCGGGAGC TCTTTGCTCAGAACCTTGTTCGTGGGCGTGGGCTATTCTGCCAATCGTGCATCAAG TCACAGGCAGCCTCACCTGGATTGACTGATGTGTTWACTGCACTTGTTGCGGTTG TGAACGCCAAATTCCCGGAGATTGGGCGGTTGCTTCTTGTTCGAGTTGTGCTCCA GCTCAAGAGAGCTTATCAGGGAAAGGACATGGCCCAGCTTCCCTCGYTAACTAAG TTTGTAGCACACTTGGTTAATCAGRCCGTGGTCCATGAGCTTCTAGCGAGGCAGCT TCTTACTGTACTTCTTGAGAAACCAACTGATGATAGTGTTGAGCTTGCAGTAGMATT TGTCAAAGAATGTGGGGCAATTCTGCAACGCTCATCTCCTCAAGGACTTCATGCTA TTTTTGAAAGATTTRAAGTCRTACGTCATGAAGTGARATTAGGCAAGCGTKYGCAGT TTCTTATTGAAGGYCTTTTTGYGATCAGAAAAGCTAATTTTGAGGGRTTTCCAACCA TCCGCCCAGAGTTAGRTCTTGTGGAGCAGGGCAGCCAGTTTACTCATGAGATATCC CTTGAAGACATGCTAGAACCTGAGATCAATCTAGATGTTTTCAGTGCAAACCCAAAT TTCATTGAAGATGAGAAGGCTTATGAGAACCTAATGAGAAGCATTCCGGGACCWGA ATCTCGTGAGGATGATGGAGAATCTGATAAAGAGCAGATGGATATGAGGGATCTTAT TAATCTTAGAAGGACCATGTATTTGACTATTATATCCAGTGTTCATTTTGAAGAAGCT GGTCTTATGAAAATTGATGTGAAKCCTGGTCAAGAGATGGACCTATGCCTTATGATT CTTGAGTGTTGCTGTCAAGAGAAAACCTACCTACATAGTTATGGGCTGTTAGCACAA A - (SEQ ID NO: 121) - Common region 3 GCATCGTCTCGATATTTYATAAAAGTTCTATTTCAGGAACTATCAGAGCATCTTGGCA TAGGCCAACTTAATGAGAGATTGAAAGWTCTAAATATGCAAGGCTCATTTGAGGTC ATCCTTCCGAAGGATCATCCAAAAAAACTTGAGGATCTCCAGTAAATTCTTCACAGC CATCAGTCTTGGGGGTATCRAAGAGAGTATGGGTGGGGACGTGCCACTCCTTGTA ATGCGGCAGCACAAGCCTGCATCATCTGKGTTCAAGACTGGTTCGAAAGCTTTTG GCTYAGGATCTCGTGAGTTCTGA - (SEQ ID NO: 122) In the sequences of SEQ ID NOs: 120-122 provided above, K represents T or G; R represents G or A; Y represents T or C; W represents A or T; M represents C or A; and S represents C or G. Correspondingly, in another embodiment of the present invention, the nucleic acid construct comprises a coding sequence for an apomictic trait comprising at least one nucleotide sequence selected from SEQ ID NO: 120-122. Preferably, said coding sequence comprises all three nucleotide sequences as set forth in SEQ ID NO: 120-122. More preferably, the nucleic acid construct comprises a coding sequence for an apomictic trait with a nucleotide sequence as set forth in any of SEQ ID NOs: 2-5. As shown herein, a person skilled in the art can appreciate that the primers herein can be used to amplify a coding sequence responsible for an apomictic trait. More particularly, - The primers of SEQ ID NOs: 9-14 can be used to amplify the coding sequence EcAPO1 of SEQ ID NO: 1, - the primers of SEQ ID NOs: 15-39 can be used to amplify any of the following variants of the coding sequence EcAPO2: EcAPO2_1 of SEQ ID NO: 2, EcAPO2_2 of SEQ ID NO: 3, EcAPO2_3 of SEQ ID NO: 4, and the EcAPO2_4 of SEQ ID NO: 5, - the primers of SEQ ID NOs: 40-45 can be used to amplify the coding sequence EcAPO3 of SEQ ID NO: 6, - the primers of SEQ ID NO: 46-51 can be used to amplify the coding sequence EcAPO4 of SEQ ID NO: 7, - the primers of SEQ ID NO: 52-53 can be used to amplify the coding sequence EcAPO5 of SEQ ID NO: 8. As used herein, the coding sequence EcAPO2 without any further description shall be understood as any of the EcAPO2 variant sequences EcAPO2_1, EcAPO2_2, EcAPO2_3, or EcAPO2_4, unless otherwise stated or inferred by context. The extraction of a coding sequence from Eragrostis curvula may be performed by any technique known in the state of the art, for example amplification with specific primers, cloning and sequencing or, alternatively, identification in silico by RNA-Seq. In a preferred embodiment, the coding sequences obtained from E. curvula for an apomictic trait may be obtained by extraction and retrotranscription of the mRNA product of the transcription of E. curvula apomictic genes. As shown in the Examples provided herein, the construction of the nucleic acid construct of the present invention can be done by cloning a coding sequence obtained from E. curvula for an apomictic trait into a proper vector or expression cassete. In a preferred embodiment, said cloning can be done by using at least two primers selected from SEQ ID NOs: 64-87. In an embodiment, the nucleic acid construct of the present invention comprises a vector or an expression cassette selected from GoldenBraid 2.0, pAtWUS, pAtSPL, pAtKNU, pNOS, tAtACTII, tAtUBQ3, t35S, or tNOS. In a preferred embodiment, the nucleic acid construct of the present invention comprises a) a coding sequence in any of its embodiments, and b) a vector or an expression cassette in any of its embodiments. In a particularly preferred embodiment, the nucleic acid construct of the present invention comprises a) a coding sequence selected from SEQ ID NO: 1-8, and b) a vector or an expression cassette selected from GoldenBraid 2.0, pAtWUS, pAtSPL, pAtKNU, pNOS, tAtACTII, tAtUBQ3, t35S, or tNOS. In a particularly preferred embodiment, the nucleic acid construct comprises the Expression cassettes as shown in Table 9 of the present specification. As evidenced by the Examples and descriptions provided herein, the nucleic acid construct of the present invention comprises coding sequences that have never been described in the prior art and, furthermore, a person skilled in the art would not find obvious that these particular sequences from E. curvula would result in an efficient introduction and development of an apomictic trait in a non-apomictic plant since such technical effect is not suggested nor disclosed in documents of the prior art. Additionally, through the examples presented herein the inventors point out that, as the number of introgressed EcAPO genes increased, the number of phenotypes observed and their penetrance also increased, suggesting a possible synergic effect between these genes, further supporting the inventiveness of the different aspects of the present invention. It is a second aspect of the present invention to provide a method for transforming a non- apomictic plant or plant cell into an apomictic plant or plant cell, comprising introducing a nucleic acid construct of the first aspect of the present invention into said non-apomictic plant or plant cell. As used herein, the term “transforming” refers to the process of introducing a foreign nucleic acid, preferably a coding sequence with promoter and termination signals, or a gene, into a target organism, for example, a plant or plant cell. Said foreign nucleic acid may be introduced on their own, or as part of an expression system, for example an expression cassette or vector. The transformation may result in a transient or permanent expression of the foreign nucleic acid in the target organism, preferably a permanent expression and it can involve the introduction of the foreign gene into the genome, i.e. a chromosome, of the target organism. The term “foreign” when referring to a nucleic acid, refers to a nucleic acid that cannot be found naturally as part of the genetic material of a specific plant or plant cell, or a nucleic acid that is not naturally expressed in a specific plant or plant cell. In particular, the term “transforming a non-apomictic plant into an apomictic plant” refers to the application of the process of transformation, as previously defined, in a plant or plant cell wherein the introduction of a foreign nucleic acid results in the expression of an apomictic trait, as previously defined, in a plant or plant cell that doesn’t have or doesn’t express an apomictic trait. The introduction of the nucleic acid construct of the first aspect of the present invention into said non-apomictic plant or plant cell may be done by any means known to a person skilled in the art and that are readily available. Although, in a preferred embodiment, the method for transforming a plant of the present invention comprises using an Agrobacterium-mediated transformation, more preferably an Agrobacterium tumefaciencs-mediated transformation,for example, by floral dip. In an embodiment, the method of the second aspect of the present invention comprises transforming a plant selected from the genus Arabidopsis, Hordeum, Oryza, Zea or Triticum. More preferably, a plant selected from Arabidopsis sp., Hordeum vulgare, Oryza sativa, Zea mays, or Triticum aestivum. In another embodiment, the method of the second aspect of the present invention comprises a nucleic acid construct comprising a coding sequence comprising a polynucleotide sequence that can be amplified by any two primers selected from SEQ ID NO: 9-53, more particularly, a coding sequence comprising a polynucleotide sequence that can be amplified by any two primers selected from f) SEQ ID NO: 9-14, or g) SEQ ID NO: 15-39, or h) SEQ ID NO: 40-45, or i) SEQ ID NO: 46-51, or j) SEQ ID NO: 52-53. In another embodiment, the method of the second aspect of the present invention comprises a coding sequence comprising at least two polynucleotide sequences that are complementary to any two primers selected from SEQ ID NO: 9-53. More particularly, the coding sequence comprises at least two polynucleotide sequences that are complementary to any two primers selected from f) SEQ ID NO: 9-14, or g) SEQ ID NO: 15-39, or h) SEQ ID NO: 40-45, or i) SEQ ID NO: 46-51, or j) SEQ ID NO: 52-53. In a preferred embodiment, the method of the second aspect of the present invention comprises a coding sequence is selected from any one of SEQ ID NO: 1-8. In an embodiment, the method of the second aspect of the present invention comprises a nucleic acid construct comprising a vector or an expression cassette selected from GoldenBraid 2.0, pAtWUS, pAtSPL, pAtKNU, pNOS, tAtACTII, tAtUBQ3, t35S, or tNOS. In a preferred embodiment, the method of the second aspect of the present invention comprises a nucleic acid construct of the present invention comprises c) a coding sequence in any of its embodiments, and d) a vector or an expression cassette in any of its embodiments. In a particularly preferred embodiment, the method of the second aspect of the present invention comprises a nucleic acid construct of the present invention comprises c) a coding sequence selected from SEQ ID NO: 1-8, and d) a vector or an expression cassette selected from GoldenBraid 2.0, pAtWUS, pAtSPL, pAtKNU, pNOS, tAtACTII, tAtUBQ3, t35S, or tNOS. In a particularly preferred embodiment, the method of the second aspect of the present invention comprises an Expression cassette as shown in Table 9 of the present spcefication. In an embodiment, the method of the second aspect of the present invention further comprises constructing a nucleic acid construct of the present invention by cloning a coding sequence extracted from Eragrostis curvula for an apomictic trait in a vector or expression cassette, prior to the transformation of the plant. In a preferred embodiment, said cloning can be done by using at least two primers selected from SEQ ID NOs: 64- 87. A third aspect of the present invention is to provide a method for obtaining a transgenic, apomictic plant comprising the steps of: (i) providing a non-apomictic plant or plant cell of interest, (ii) transforming a plant or plant cell of the step (i) with a nucleic acid construct of the first aspect of the present invention, and (iii) growing the transformed plant or plant cell. In an embodiment, the plant or plant cell of interest of step (i) is selected from the genus Arabidopsis, Hordeum, Oryza, Zea or Triticum. More preferably, a plant selected from Arabidopsis sp., Hordeum vulgare, Oryza sativa, Zea mays, or Triticum aestivum. In an embodiment, the step (ii) comprises using a method for transforming a non- apomictic plant or plant cell into an apomictic plant or plant cell of the second aspect of the present invention, in any one of its embodiments. The step (iii) may be performed by any means available to a person skilled in the art that ensures the correct development of the plant and the apomictic trait. These includes, but is not limited to, growth in a plantation field, or a greenhouse, or a laboratory, under natural or artificial conditions. It may further comprise the use of artificial growth enhancers, for example, by using fertilizers or hormones. In an embodiment, the method of the second aspect of the present invention, and / or the method of the third aspect of the present invention comprise a step of confirmation of the transformation of a plant or plant cell. Preferably, wherein said step of confirmation comprises any of the following: - detecting a coding sequence or gene of interest by means of hybridization probes, for example, a hybridization probe selected from any one of SEQ ID NO: 54-63; or - amplifying the apomictic coding sequence from DNA by PCR, for example, by using primers selected from SEQ ID NO: 9-53; or - amplifying the apomictic coding sequence from RNA by RT-PCR, for example, by using primers selected from SEQ ID NO: 9-53; or - studying the expression of the coding sequence of interest by qRT-PCR, by using primers selected from SEQ ID NO: 112-119, or - observing the pistils at different floral development stages; or - analyzing the ploidy level of a plant. In an embodiment, said confirmation may be performed before or after the growth of said transformed plant or plant cell. A fourth aspect of the present invention is to provide a transgenic plant or plant cell transformed with a nucleic acid construct of the first aspect of the present invention, comprising a coding sequence for an apomictic trait, wherein said coding sequence is extracted from Eragrostis curvula In a preferred embodiment, the transgenic plant or plant cell of the fourth aspect of the present invention is a crop plant, from the genus Hordeum, Oryza, Zea or Triticum. More preferably, a plant selected from Hordeum vulgare, Oryza sativa, Zea mays, or Triticum aestivum. Preferably, the plant or plant cell is a product of the method of the second aspect of the present invention in any of its embodiments. Preferably, the plant or plant cell is a product of the method of the third aspect of the present invention in any of its embodiments. EXAMPLES The following examples are meant to be exemplary embodiments of the different objects, methods and / or aspects of the present invention. They are not intended to limit the scope of the present invention in any way. EXAMPLE 1: Identification of genomic regions and genes involved in apomixis expression in E. curvula EXAMPLE 1.1: The genomic region associated / linked to apomixis The genome of two E. curvula cultivars, Don Walter and Victoria, were sequenced and assembled at chromosome scale. The facultative allotetraploid cv Don Walter was sequenced using a combination of Chromium 10X, Oxford nanopore long reads and Omni-C technologies. This genome assembly contains the 10 E. curvula chromosomes and the metrics resulting from this assembly are shown in Table 1. The diploid sexual cv Victoria was sequenced using PacBio, Chicago and Hi-C technologies. This genome contains seven complete chromosomes and the remaining three are splitted into two fragments. The syntenic analysis between these two genomes showed that they are well conserved, however, some chromosome rearrangements were detected (Figure 1). Metrics Don Walter assembly Victoria assembly Length 1,171 Mb 602 Mb Scaffolds 3,037 1,143 N50 74 Mb 43 Mb BUSCO C:96.6% C:96.4% Repetitive elements 48% 28.7% Genes 133,619 56,469 Table 1. Metrics of Victoria and Don Walter genome assemblies. Aiming at the identification of the genomic region carrying the apomixis locus and its inheritance, a mapping population consisting of 61 individuals was constructed from the cross between the sexual maternal OTA-S (2n = 4X = 40, PI 574506, USDA, USA) and the facultative apomictic pollen donor cv Don Walter INTA (2n = 4X = 40). Identification of hybrids was performed by using RAPDs and AFLP markers through the identification of paternal markers. The phenotyping was conducted by cytoembryological analysis of panicles collected during anthesis, according to Meier et al., (2011). A plant was classified as apomictic if at least one apomictic pistil was observed (Savidan, 2000). Phenotypic characterization of the 61 F1 hybrids by cytoembryological analysis (Figure 2) yielded a 1:1 ratio of apomictic vs. sexual plants (34:27, X2= 0.37), which agrees with the model of inheritance of a single dominant genetic factor (Zappacosta et al., 2019). The F1 population was used to construct the first saturated linkage map at tetraploid level of E. curvula using both traditional (AFLP and SSR) and high-throughput molecular markers (GBS-SNPs). Thus, four markers linked to apomixis were found in the linkage group 3 of Don Walter map. The inventors also identified putative regulatory regions affecting the expressivity of this trait and syntenic relationships with genomes of other grass species. The identification of the genomic region linked to apomixis in the genome assembly was performed by mapping the candidate genes and the apomixis linked markers (Figure 3). The synteny of the region delimited by these markers was analyzed deeply in order to assess the differences between the sexual and the apomictic genomes. This analysis showed poor synteny between a region of 17 to 29 Mb in the Don Walter genome and 23 to 29 Mb in the Victoria one (Figure 4). Out of the 1,412 annotated genes located on the Don Walter region only 259 (19%) found an orthologous one in the diploid accession. Out of the 1,153 (81%) genes without orthology with the diploid genome, 411 have a significant counterpart in the UniProt database based on the Blastp alignment. This region was also found to be enriched in repetitive elements, since the whole genome repetitive elements coverage was 48% and the region linked to apomixis was covered by 60%. EXAMPLE 2: Identification of genes involved in apomixis expression in E. curvula EXAMPLE 2.1: Microarray Design (id 072215) A customized Agilent array was designed with 1,000 k probes from a floral E. curvula reference transcriptome and ESTs. A SurePrint G31x1M array format (Agilent) was used. Sequences used for the design of 60-mer oligonucleotide probes, hereafter referred as CUST, were assembled ad hoc from previously deposited 454 Raw Reads sequences in the Sequence Reads Archive database (SRA) at NCBI as BioProject 358210 and Expressed sequence tag database (dbEST) (Nº EH183417 to EH195711). A customized microarray was created using eArray, a free Agilent web-based application that enables the creation of custom microarray designs and oligo libraries (https: / / earray.chem.agilent.com / earray / ). For probes design, the Base Composition Methodology option was employed, and no linker sequences were used. Probes were designed for each sequence. A total of 970,000 probes were obtained from the eArray and were used for the creation of the 1x1M array format. Slides with printed arrays were ordered directly to Agilent Technologies (Santa Clara, CA, USA). EXAMPLE 2.2: Microdissections and RNA Extraction Near 20-30 archesporial-CMM pistils plus stamens (Figure 5) were microdissected from spikelets from a collection of E. curvula genotypes, including apomictic and sexual individuals of different ploidy levels (2x or 4x) (Table 2). Then, the dissected samples were ground to a fine powder in liquid nitrogen, and the total RNA was extracted using a commercial RNA purification kit (Macherey-Nagel) according to the manufacturer’s instructions. RNA was resuspended in 100 μl diethylpyrocarbonate (DEPC)-treated water and quantified using the cyanine dye RiboGreen® (Molecular Probes, Eugene, OR, USA), against an appropriate standard curve. RNA quality was checked with a RNA 6000 Pico LabChip using the Agilent 2100 Bioanalyzer instrument (Agilent, USA). EXAMPLE 2.3: Microarray Design Hybridization Eight independent hybridizations were performed with one-color Cy3 labelled samples from four apomictic and four sexual E. curvula genotypes (Table 2). Data preprocessing and analyses were performed using the GeneSpring software v.14.5. Platform quality was verified by Agilent spike-in controls. Normalization procedures consisted of percentile shift 75, background correction, median as baseline and reproductive mode as parameter. Individual probes from the array were considered to be differentially hybridized under the log2 transformed Fold Change data > 1 and p-values > 0.01 using unpaired t-test and multiple Benjamini-Hochberg correction. Apomicts Sexuals Tanganyika (USDA, accession PI 234217) OTA-S (USDA, accession PI 574506) (4x) (4x) Don Walter (INTA) (4x) 920 (USDA, accession PI 299920) (2x) Ermelo (USDA, accession PI 232986) (4x) 214 (USDA, accession PI 208214) (2x) Morpa (USDA, accession PI 591632) (4x) Victoria (UNS) (2x) Table 2. Eragrostis curvula genotypes used in the microarray hybridization experiments. Ploidy level is indicated between parentheses. USDA: United States Department of Agriculture, INTA: Instituto Nacional de Tecnología Agropecuaria, UNS: Universidad Nacional del Sur. EXAMPLE 2.4: Microarray hybridization and sequencing analyses. The analyses of the microarray hybridization with RNA extracted from pistils-stamens of four sexual and four apomictic genotypes of E. curvula (Table 2), using the software GeneSpring, revealed that 13860-mer sequences were differentially hybridized between apomictic and sexual samples. The analysis of the hybridized microarray led to 365 CUST that were differentially hybridized according to the reproductive mode. The BLAST analysis of these sequences against E. curvula transcriptome databases revealed that 70 CUST matched to a transcript annotated as an hypothetical protein and hereafter called EcAPO1; 7 CUST matched to a transcript called EcAPO2 , annotated as Pre-mRNA-splicing factor CWC22 homolog (compared to Zea mays PWZ46383; Score: 699 bits(1803); Expect: 0.0; Identities: 69%; Positives: 78%; Gaps: 5%); 17 CUST matched to a transcript annotated as Cyclin-2A-1 (compared to Oryza brachyantha XP_006664043; Score: 601 bits(1550); Expect: 0.0; Identities: 67%; Positives: 78%; Gaps: 1%), named EcAPO3; and 2 CUST matched to a transcript referred as EcAPO4, annotated as F-box protein (compared to Setaria italica XP_004962938.3; Score: 250 bits; Expect: 3e-77; Identities: 58%; Positives: 69%; Gaps: 6%). Then, there were identified cases of 1 CUST matching with a single isotig and / or alignments that do not meet the criteria to be considered a valid match. All these findings were not considered in further studies. The four transcripts were considered candidates to be involved in apomictic expression pathways (apomeiosis), and thus several strategies were followed looking forward to demonstrating this hypothesis. Another candidate, EcAPO5 was identified through BLAST search in the genome sequence of E. curvula cv. Tanganyika. EXAMPLE 2.5: Candidate Gene Cloning and Sequence Analysis The five candidate genes were subjected to a deep analysis. Initially, PCR primers were designed based on the transcripts’ sequences (isotigs) (Table 3) and PCR amplifications were conducted using genomic DNA from a wide variety of E. curvula genotypes (Table 4), with different reproductive modes and / or ploidy levels. To carry out this procedure, genomic DNA was extracted from fresh leaf tissue following a protocol based on cetyltrimethylammonium bromide (CTAB), as in Garbus et al. (2017). PCR amplifications were conducted using a MyCycler BioradTMcycler. Each PCR reaction consisted on 1 μl of 10 mM dNTPs mix, 2.5 μl of 10× reaction buffer, 0.5 μl of each forward and reverse primers (100 pmol / μl), 0.30 μl of DNA polymerase Taq Pegasus©(5 U / µl) and 2 μl of template genomic DNA (30 ng / μl), in a final reaction volume of 25 μl. The PCR reaction profile was: initial DNA denaturation at 94ºC for 3 min, followed by 40 cycles at 94ºC for 30 s, 30 s at the optimal annealing temperature for each primer pair, and 72ºC for 30 s. The third step consisted of a final extension of 5 min at 72ºC. The annealing temperatures for each primer pair were set as the lower melting temperature of both primers. Amplicons were analyzed by electrophoresis in agarose gel (1%), and visualized using ethidium bromide. SEQ ID NO Primer name Sequence (5´- 3´) 9 EcAPO1_F1 TCCCTCAACCCTACCGATAA 10 EcAPO1_R1 AACACCCGTAAGAGCGAATC 11 EcAPO1_F2 TGCTTCGCTCGATGAACTTA 12 EcAPO1_R2 GCACGGATGTTGCTGATTG 13 EcAPO1_F3 GCGTCTGTGTCGTCTCTTAC 14 EcAPO1_R3 TTGATCTCGCAGGGTGTTG 15 EcAPO2_F1 CTCACCTGGATTGACTGATG 16 EcAPO2_R1 CCTGCTCCACAAGATCTAAC 17 EcAPO2_F2 GCGTGTGCAGTTTCTTATTG 18 EcAPO2_R2 GCCAAGATGCTCTGATAGTT 19 EcAPO2_F3 GTCACTGCTGCCGTATAAC 20 EcAPO2_R3 ACTGCAAGCTCAACACTATC 21 EcAPO2_F4 ATGGGCTGTTAGCACAAAGG 22 EcAPO2_R4 TCGAGACGATGCTGTCAAAC 23 EcAPO2_R5 ACATGCACACGCAATACA 24 EcAPO2_F6 ACCAAACCTCCTCTAGCC 25 EcAPO2_R6 TCCAGCTTCAGCCTTATCT 26 EcAPO2_Fa_1 GCAATTCTGCAACGCTCATC 27 EcAPO2_Fa_R3 GATAGTGTTGAGCTTGCAGT 28 EcAPO2_F5 GGCATAGGCCAACTTAATGA 29 EcAPO2_Ra_1 GCACACGCTTGCCTAATTTC 30 EcAPO2_Fb_1 CAAGCGTGTGCAGTTTCTTATT 31 EcAPO2_Fb_2 GAAATTAGGCAAGCGTGTGC 32 EcAPO2_Rb_3 CTTGACCAGGATTCACATCAATTT 33 EcAPO2_Rb_5 GTCCATCTCTTGACCAGGATTC 34 EcAPO2_Fc_1 CTGAATCTCGTGAGGATGATGG 35 EcAPO2_Fc_3 CGTGAGGATGATGGAGAATCTG 36 EcAPO2_Rc_1 ACATGCCATGGGAGTGTATC 37 EcAPO2_Rc_3 TCGAGACGATGCTGTCAAAC 38 EcAPO2_66F_B ACCGGGACGACGACTTTC 39 EcAPO2_66R_B TTGGGTGATCCCTCTCATCATC 40 EcAPO3_F1 CAGGTAAGCCACACCTTCATAC 41 EcAPO3_R1 CGGCACAGGCTACTTCTAATG 42 EcAPO3_F2 TCAAAGTCACCTCCACAAGATAG 43 EcAPO3_R2 GGACATGAGAGGCATCCTTATT 44 EcAPO3_F3 ACCGCAACAATCCAATCAATAAG 45 EcAPO3_R3 CGAAGGGCTGTGAATGAGAA 46 EcAPO4_F1 GTTCGATTACCTCGTCGTCAA 47 EcAPO4_R1 CTCCAAGTCTTCCCATCAACA 48 EcAPO4_F2 CTACGCGAACGAGAATGTCTTA 49 EcAPO4_R2 TTGATGATCCTCCAAGTCTTCC 50 EcAPO4_F3 ACTCGCCGCTTCATCAAC 51 EcAPO4_R3 AATGGCTCCAAGCTCCTTTC 52 EcAPO5_F1 GGTGTTTTCGTGGTTGTCTG 53 EcAPO5_R1 CCTCATGTACGATAGTCTGCG Table 3. Primers designed based on the sequences of two of the candidate transcripts of Eragrostis curvula. Abbreviated name Genotype Ploidy Reproductive mode 1 PI299920 USDA 2X Sexual 2 PI208214 USDA 2X Sexual 3 PI299919 USDA 2X Sexual 4 PI219928 USDA 2X Sexual 5 OTA-S USDA 4X Sexual 6 Victoria UNS 2X Sexual 7 Tanganyika USDA 4X Apomictic 8 Don Walter USDA 4X Apomictic 9 Ermelo USDA 4X Apomictic 10 Morpa USDA 4X Apomictic 11 Don Pablo INTA 7X Apomictic 12 Tanganyika INTA 4X Apomictic 12 TUNS9355 UNS 6X Apomictic 14 Don Luis UNS 6X Apomictic Table 4. Eragrostis curvula genotypes assayed to amplify the candidate transcripts indicating seed origin (USDA: United States Department of Agriculture, INTA: Instituto Nacional de Tecnología Agropecuaria, UNS: Universidad Nacional del Sur), ploidy level and reproductive mode EXAMPLE 2.6: Characterization of the candidate transcripts and analysis of its relationship with apomixis Several primer pairs were initially designed based on the sequences of all the transcripts under study (Table 3). Primer specificity was carefully checked, and they were used to amplify E. curvula DNA from a wide variety of germplasm (Table 4). Amplification products of the expected size were obtained, and noticeably, they were only observed in the apomictic genotypes, for all studied transcripts (Figure 6). Moreover, when several primer combinations of transcripts #1 and #2 were used in DNA from hybrid individuals from the mapping population obtained by crossing the sexual parental OTA-S (4x) as female and the apomictic parental Don Walter (4x) as pollen donor, amplification products were observed in plants classified as apomictic according to cytoembryological analysis, whereas the amplification was absent in plants classified as sexuals (Figure 7 and Table 5). Thus, our results strongly suggest that these transcripts constitute a marker that segregates with the character apomixis (Figure 4). a) b) Reproductive Reproductive Line Description Line Description mode mode Marker Marker 1 1 100bp 100bp 2 Parental Apomictic 2 Negative 3 Hybrid02 Apomictic 3 Parental Apomictic 4 Hybrid08 Apomictic 4 Parental Sexual 5 Hybrid030 Apomictic 5 Hybrid02 Apomictic 6 Hybrid031 Apomictic 6 Hybrid08 Apomictic 7 Hybrid032 Apomictic 7 Hybrid09 Apomictic 8 Hybrid111 Apomictic 8 Hybrid012 Sexual 9 Hybrid191 Apomictic 9 Hybrid016 Sexual 10 Hybrid194 Apomictic 10 Hybrid017 Apomictic 11 Hybrid197 Apomictic 11 Hybrid020 Sexual 12 Hybrid198 Apomictic 12 Hybrid021 Sexual 13 Parental Sexual 13 Hybrid024 Apomictic 14 Hybrid025 Sexual 14 Hybrid025 Sexual 15 Hybrid028 Sexual 15 Hybrid028 Sexual 16 Hybrid033 Sexual 16 Hybrid030 Apomictic 17 Hybrid034 Sexual 17 Hybrid031 Apomictic 18 Hybrid039 Sexual 18 Hybrid032 Apomictic 19 Hybrid119 Sexual 19 Hybrid033 Sexual 20 Hybrid128 Sexual 21 Hybrid140 Sexual 22 Hybrid158 Sexual 23 Hybrid174 Sexual 24 Negative Table 5. Eragrostis curvula genotypes analyzed in Figure 7, for: a) EcAPO1; and b) EcAPO2. Both transcripts were amplified from cDNA obtained from the apomictic inflorescences and not from the sexual ones. For EcAPO2, three different spliced transcripts, EcAPO2_1 of SEQ ID NO: 2, EcAPO2_2 of SEQ ID NO: 3, and EcAPO2_3 of SEQ ID NO: 4, that contained ORF were sequenced (Figure 8A, Figure 8B)., An additional transcript, EcAPO2_4 of SEQ ID NO: 5, was predicted bioinformatically from E. curvula genome. (Figure 8B) Next studies were oriented to test the expression profiles of all transcripts and the possible differential expression of alternative spliced forms between apomictic and sexual genotypes. Thus, the availability of natural sexual and apomictic tetraploid genotypes of E. curvula, a particular feature of this experimental system, allowed the obtention of a reference transcriptome suitable for transcriptomic comparisons. Hybridization assays of a transcriptome-based microarray revealed the existence of four genes linked to apomixis expression, which were observed only in apomictic genotypes. The expression of EcAPO1, 2, 3, 4 and 5 was also assessed in the apomictic cultivars Bahiense, Tanganyika INTA, T-355-UNS and in the sexual Victoria using a RNA-seq approach (Table 6). In this way, RNA was extracted from spikelets and sequenced using Illumina 2x150 reads. Differential expression analysis reveals that all the genes were differentially expressed in the apomictic cultivar and that there is no expression in the sexual Victoria. T. T. T. BHS BHS BHS TUNS TUNS TUNS Vic Vic Vic Chromosome INTA INTA INTA 1 2 3 1 2 3 1 2 3 1 2 3 EcAPO1 ScA7Agc_1012 661 684 924 757 994 629 870 661 882 0 0 0 EcAPO3 ScA7Agc_1012 10 11 11 16 17 17 13 10 25 0 0 0 EcAPO5 ScA7Agc_1012 357 347 622 342 421 343 251 281 310 1 0 0 EcAPO4 ScA7Agc_189 166 142 227 98 115 189 265 284 268 0 0 0 EcAPO2 ScA7Agc_189 322 415 713 507 574 547 548 644 392 0 0 0 Table 6: Expression matrix of the EcAPO genes. The numbers show the mapped reads against each transcript. Values for the 3 replicates are shown of the genotypes Bahiense (BHS), Tanganyika USDA (TUNS), Tanganyika INTA (T.INTA) and Victoria (Vic). EXAMPLE 2.7: Tissue in situ hybridization (ISH) To investigate the tissue specificity of the expression of these genes, in situ hybridization (ISH) was undertaken on developing floral tissues of E. curvula sexual and apomictic genotypes. Although several probes were designed to recognize different variants of the EcAPO variants (Table 7), in situ hybridization experiments were performed for EcAPO1. Tissue targets for hybridization were inflorescences of sexual and apomictic genotypes containing flowers at different developmental stages. Hybridizations were performed following the protocol described by Dusi (2001) with minor modifications. Inflorescences were fixed in 4% paraformaldehyde / 0.25% glutaraldehyde in 0.01 M phosphate buffer pH 7.2, dehydrated in an ethanol series and embedded in paraffin. Specimens were cut into 7 µm thin sections and placed onto positively charged slides. Paraffin was removed using a xylol series. T7 and SP6 promoter sequences were included as a 5’-tail on different primer pairs used for amplifying both sense and anti-sense probes (Table 7). Probes were labelled by using the Roche Dig RNA Labelling kit, following the manufacturers’ instructions. Hybridization was carried out overnight in a humid chamber at 42°C, in buffer containing 10 mM Tris–HCl pH 7.5, 300 mM NaCl, 50% formamide (deionized), 1 mM EDTA pH 8, Denhart, 10% dextransulphate, 600 ng / ml total RNA and 60 ng of the corresponding probe. Detection was performed following the instructions of the Roche Dig Detection kit, using anti DIG AP and NBT / BCIP as substrates. SEQ ID NO Primer name Sequence 5’ to 3’ 54 EcAPO1-sp6AAAGGGATTTAGGTGACACTATAGAAGCGTCTGTGTCGTCTCTTAC55 EcAPO1-t7AAAGGGTAATACGACTCACTATAGGGGCACGGATGTTGCTGATTG56 EcAPO2_1-Sp6 AAAGGGATTTAGGTGACACTATAGAACAAGCGTGTGCAGTTTCTTATT 57 EcAPO2_1-t7 AAAGGGTAATACGACTCACTATAGGGCCCTGCTCCACAAGATCTAAC 58 EcAPO2_2-Sp6AAAGGGTAATACGACTCACTATAGGGCCCTGCTCCACAAGATCTAAC59 EcAPO2_2-t7 AAAGGGTAATACGACTCACTATAGGGCACCTCCTCCAAATCTCATCAC 60 EcAPO2_3-Sp6 AAAGGGATTTAGGTGACACTATAGAAATGGGCTGTTAGCACAAAGG 61 EcAPO2_3-t7AAAGGGTAATACGACTCACTATAGGGTCTCGTGACAATGAACTGTTGAATA62 EcAPO4-sp6AAAGGGATTTAGGTGACACTATAGAAACTCATCTTTCCTTGCCACAG63 EcAPO4-t7 AAAGGGTAATACGACTCACTATAGGGAGAGTCCATTTTCCACGGTTC Table 7. Primer sequences used to generate the hybridization probes. Promoter sequences SP6 or T7 are shown in bold. A detectable hybridization signal related to EcAPO1 was evidenced in all developmental stages in apomictic flowers (Figure 9 A-B). On the contrary, no significant signal was detected in sexual flowers (Figure 9 C-D). Signal was confined to the nucellus, megaspore mother cell, and functional megaspore before anthesis, to the nucellus, egg cells, and polar nuclei at anthesis (Figure 9). No hybridization signals were detected with the antisense probe in the same organs and tissues of the sexual genotype. EXAMPLE 3: Engineering an expression system to trigger apomixis in Arabidopsis thaliana EXAMPLE 3.1: E. curvula RNA extraction and cDNA first strand synthesis RNA of E. curvula was obtained using the Promega SV Total RNA Isolation System©. Up to 60 mg of inflorescence tissue was separated, precipitated and bound using the spin baskets containing a silica membrane. Following, RNA was treated with RNase-Free DNase I and eluted with Nuclease-Free water. The quality and quantity of the RNA were assessed in the DeNovix DS-11 Spectrophotometer. First strand cDNA synthesis was performed using the NEB M-MuLV Reverse Transcriptase©following manufacturers' instructions. EXAMPLE 3.2: A. thaliana DNA and RNA extraction Total RNA was extracted from A. thaliana inflorescences, using the TRIzolTMReagent and procedural guidelines provided by InvitrogenTM. Briefly, samples were collected in liquid nitrogen and grinded immediately using a pestle and mortar. Up to 100 mg of the powder obtained was transferred to an RNase free 1.5 mL tube previously cooled in liquid nitrogen and 1 mL of TRIzolTMwas added. Once the aqueous phase containing the RNA was isolated, the interphase and organic phase were set-aside for subsequent isolation of the DNA. The quality and quantity of nucleic acids were assessed using the DeNovix DS-11 Spectrophotometer. A cDNA first strand synthesis was performed from RNA using the NEB M-MuLV Reverse Transcriptase©following manufacturers’ instructions. EXAMPLE 3.3: Sequences capture The NEB Q5 High-Fidelity DNA Polymerase (New England Biolabs) was used following the manufacturers’ protocol to obtain both promoters (regulatory regions) and coding sequences (CDSs) by PCR. The 5' regulatory regions from At5g14010 (KNUCKLES), At2g17950 (WUSCHEL), At4g09960 (SEEDSTICK), At4g27330 (SPOROCYTELESS) genes were amplified from wild-type A. thaliana genomic DNA using the primers listed in Table 8. Annotations of all genes were downloaded from The Arabidopsis Data Resource (TAIR) (www.arabidopsis.org). The coding sequences (CDS) of EcAPO genes EcAPO1, EcAPO2, EcAPO3, EcAPO4, EcAPO5 were obtained from cDNA of the apomictic E. curvula cultivar Tanganyika using primers depicted in Table 8. SEQ ID Primer name Sequence 5’ to 3’ NO 64 pSPLplusFw1GCTCGTCTCTCTCGGGAGTGCTTTCG65 pSPLplusRv1GCTCGTCTCTAGTCAAGTGACGTTGAAAAAAATGC66 pSPLplusFw2CGTCGTCTCTGACTTACACCCACTAATATTGAC67 pSPLplusRv2GCTCGTCTCTCTCAATGGTGATGATGATCTTC68 pKNUplusFwGCTCGTCTCTCTCGGGAGTTGTGTGTG69 pKNUplusRvGCTCGTCTCGCTCAATGGGAGAGGTTCTTAAGC70 pWUSplusFwGCTCGTCTCGCTCGGGAGAGTTTGGTGAC71 pWUSplusRvGCTCGTCTCTCTCAATGGGTGTGTTTGATTC72 pSTKplusFwGCTCGTCTCACTCGGGAGCCAACGA73 pSTKplusRvGCTCGTCTCGCTCAATGGTCTGGAGAGAC74 EcAPO1.GB2.FwGCTCGTCTCTCTCGCCATCGTAACCCTAGTCCCAAG75 EcAPO1.GB2.RvGCTCGTCTCTCTCAAAGCAGCCTGACAAGCACAGAT76 EcAPO5.GB2_FwGCTCGTCTCTCTCGCCATCGCCCTCTTCTCTCCATG77 EcAPO5.GB2_RvGCTCGTCTCTCTCAAAGCACGCATACAGAACGCTAC78 EcAPO2_1.GB2.FwGCTCCGTCTCCCTCGCCATACCAAACCTCCTCTAGCC79 EcAPO2_1.GB2.RvGCTACGTCTCTCTCAAAGCTCAGAACTCACGAGATCCT80 EcAPO3.GB2.FwGCTCGTCTCTCTCGCCATTCGATTTCAGGCTTACATGG81 EcAPO3.GB2.RvGCTCGTCTCTCTCAAAGCGGTATCATCATCAGCTCGT82 EcAPO4.GB2.Fw1GCTCGTCTCTCTCGCCATGATGGACAAGCTCACCG83 EcAPO4.GB2.Fw2GCTCGTCTCCACCTGTGTCTCCAGGCACTG EcAPO4.GB2.Rv1GCTCGTCTCCAGGTAAAGCGTCGGAGGGACCTEcAPO4.GB2.Fw3GCTCGTCTCAAGCAAGACTTGGTTTCGACCCTGCTGTCTCCTCTCGCTTCCATG EcAPO4.GB2.Rv2GCTCGTCTCTTGCTGTCTCCACTTTGTTGGAAACCCACGEcAPO4.GB2.Rv3GCTCGTCTCTCTCAAAGCCGTGCTGTGCTATable 8. Primers used during GB2 cloning. EXAMPLE 4.4: Cloning into expression vectors All amplified sequences were modified at the 5' end by adding restriction sites for the type IIS enzymes Esp3I and BsaI, a required step for cloning in GoldenBraid 2.0 (GB2.0) vectors (Sarrion-Perdigones et al., 2013). If it was needed, domestication was made to remove internal restriction sites for those enzymes. GB2.0 vectors were kindly provided by Dr. Diego Orzáez (Plant Genomics and Biotechnology Lab, Polytechnic University of Valencia, Spain) and were used in the successive steps of assembly and cloning following the author's protocol (Sarrion-Perdigones et al., 2013). Firstly, each module containing either a promoter or coding sequence was cloned into a vector called pUPD2. Next, the basic TUs or expression cassettes were assembled into the pDGBα vectors. These vectors subsequently allowed the generation of transgenic lines carrying one to five of the EcAPO genes (Table 9). The final expressing vectors included either the transcriptional fusion pNOS:nptII:tNOS or pNOS:hph:tNOS in order to confer kanamycin or hygromycin B resistance to transgenic plants. Transgenes introgressed in A. thaliana Name In-plant resistance EcAPO expression cassette cassette EcAPO_1 pAtWUS:EcAPO1:tAtACTII pNOS:nptII:tNOS EcAPO_2 pAtSPL:EcAPO2:tAtUBQ3 pNOS:nptII:tNOS EcAPO_3 pAtKNU:EcAPO3:tNOS pNOS:hph:tNOS EcAPO_4 pAtSPL:EcAPO4:t35S pNOS:hph:tNOS EcAPO_5 pAtWUS:EcAPO5:tAtACTII pNOS:nptII:tNOS EcAPO_1- pAtWUS:EcAPO1:tAtACTII pNOS:nptII:tNOS 2 pAtSPL:EcAPO2:tAtUBQ3 EcAPO_1- pAtWUS:EcAPO1:tAtACTII pNOS:nptII:tNOS 3 pAtSPL:EcAPO3:tAtUBQ3 EcAPO_1- pAtWUS:EcAPO1:tAtACTII pAtSPL:EcAPO4:t35S pNOS:nptII:tNOS 4 EcAPO_1- pAtWUS:EcAPO1:tAtACTII pNOS:nptII:tNOS 5 pAtSPL:EcAPO5:tAtUBQ3 pAtWUS:EcAPO1:tAtACTII EcAPO_x3 pNOS:nptII:tNOS pAtSPL:EcAPO2:tAtUBQ3 pAtKNU:EcAPO3:tNOS pAtWUS:EcAPO1:tAtACTII EcAPO_x4 pAtSPL:EcAPO2:tAtUBQ3 pAtKNU:EcAPO3:tNOS pNOS:nptII:tNOS pAtSTK:EcAPO4:t35S pAtWUS:EcAPO1:tAtACTII EcAPO_x5 pAtSPL:EcAPO2:tAtUBQ3 pAtKNU:EcAPO3:tNOS pNOS:nptII:tNOS pAtSTK:EcAPO4:T35s pAtWUS:EcAPO5:tAtACTII Table 9. Detail of the EcAPO expression cassettes constructed. More than 10 EcAPO transgenic lines of A. thaliana were obtained for each cassette. nptII and hph genes confer plant resistance to Kanamycin and Hygromycin B, respectively. E. coli and Agrobacterium tumefaciens strains and growth conditions The Escherichia coli DH5α strain was used for cloning into GB2.0 vectors, and Agrobacterium tumefaciens strain GV3101 was used for stable transformation of A. thaliana plants. Both strains were grown in Luria-Bertani (LB) medium under agitation (250 rpm) at 37°C and 28°C, respectively. As required, chloramphenicol (25μg / mL-1), ampicillin (50 μg / mL-1), kanamycin (50 μg / mL-1), and spectinomycin (100 μg / mL-1) were used for E. coli selection. Rifampicin (50 μg / mL-1) and gentamicin (25 μg / mL-1) were also used for A. tumefaciens selection. 5-Bromo-4-chloro-3-indolyl-β-D-galactopyranoside acid (X-gal; 40 μg / mL-1) and isopropylthio-β galactoside (IPTG; 0.5 mM) were used on LB agar plates for the white / blue selection of clones. Arabidopsis thaliana stable transformation The floral dip method was used to generate transgenic lines of A. thaliana (Clough and Bent, 1998). All lines were generated in a Columbia-0 (Col-0) ecotype background. A minimum of 10 lines were obtained for each expression cassette containing the EcAPO genes. Transgenic plants were grown in plates with Murashige y Skoog (MS) medium (Murashige and Skoog, 1962) and either kanamycin (50 μg / mL-1) or Hygromycin B (25 μg / mL-1) as selective agent. Plant growth conditions Arabidopsis thaliana ecotype Columbia-0 and mutant lines were grown at a constant temperature of 22°C, under 16 / 8 h day / night photoperiod (with a fluence rate of 115 ± 10 μmol s-1m-2). The seeds' surfaces were sterilized in 50% (V / V) of water / sodium hypochlorite solution at 6% plus SDS 0,1% (Sodium Dodecyl Sulfate), washed four times with sterile water, and plated on MS medium. Seeds were stratified at 10°C for 48 h and then placed at 22°C, 16 h light, 8 h dark. Three to four weeks later, seedlings were transferred to pots with soil. Morphological and Histological Analyses Pistils at different floral developmental stages were dissected on a slide and cleared overnight in Hoyer’s solution (chloral hydrate, water and glycerol). Ovules and early seeds were observed on a Leica DM2500 LED microscope using DIC optics (Differential Interference Contrast). Images were captured on a Leica MC 170 HD camera using the Leica Application Suite (LAS) EZ software. Image J software was used for seedling and seed measurements (Schneider et al., 2012). Graphs and statistics were performed using GraphPad Prism version 8.3.0 for Windows. Ploidy level measurements For chromosome counting, roots were obtained from 15-day-old seedlings grown on agar plates with MS medium and the corresponding antibiotic as a selective agent. Prior to the fixation process in Carnoy's solution (ethanol:acetic acid; 3:1; v:v), the roots were immersed and incubated for 1 hour at 4°C in 2 mM hydroxyquinoline. The Feulgen technique was used for chromosome staining. Briefly, fixed roots were treated for 10 min with 1N HCl in a water bath at 60°C. Afterwards, the roots were transferred into Schiff’s reagent at room temperature for 2 hours (until the tissue stains deep purple), and then squashed onto a slide. DNA content was established by the flow cytometry service from The Northeastern Botanical Institute (IBONE-CONICET, Argentina). In brief, seedlings were grown on agar plates and grouped in a series of four to collect the tissue. Harvested leaves were immersed into a PBS buffer at 4°C and chopped using a new razor blade. Afterwards, the mixture was passed through a 30 μm cell strainer and collected in a 5mL tube. The samples were incubated for 5 min in 300 nM of DAPI solution, protected from light. After washing 3-times with a PBS buffer, the data was collected using a CyFlow Space equipment and analyzed with the Partec FloMax Software (Version 2.4d). qPCR assays cDNA from inflorescences of A. thaliana Wild Type (WT) and transgenic lines was used for qRT-PCR experiments. The qPCRs were performed in the Bio-rad CFX96™ System using the real-time PCR reagent SsoAdvanced Universal SYBR Green Supermix. Data was processed in the Bio-rad CFX Maestro software. The robustness of values obtained and the reaction efficiency were evaluated using the LinRegPCR software (Ruijter et al, 2009). All primers used are depicted in Table 10. Values were normalized using EF1α and TUA4 reference genes. Relative expression was calculated using WT plants as a control. Between 3 to 5 biological replicates were used for each genotype studied. SEQ ID NO Primer name Sequence 5’ to 3’ 88 TUA4 qFw AACCTACACCAACCTCAACC 89 TUA4 qRv GTGGATTCTTGGGTATGGGAC 90 EF1α qFw GGAGGTTTTGAGGCTGGTATC 91 EF1α qRv CCTAGCCTTGGAGTATTTGGG 92 MET1 qFw TGAACAGCACAGAATCCTTACA 93 MET1 qRv CTGCCTGTGCTTGTGATTTATG 94 DRM1 qFw CAGCACAACTGATCGCTACA 95 DRM1 qRv GAAGAGTGACAGGACGTTGATT 96 CMT3 qFw CCCACAACCAGGTGATCATT 97 CMT3 qRv TGGGCCAAAGAGTTTGTAGTC 98 ARF5 qFw AGAGTGATGTTCTGCTTGTAGG 99 ARF5 qRv GCTTCATCCCTTCTTCACTCA 100 SPL qFw GAGGAGCCAAGGTTTCCTTTAT 101 SPL qRv CTCCATTGGTCCCGTATGATTT 102 WUS qFw CCCTATGCACGGTGAAGAT 103 WUS qRv TTCAGACGTAGCTCAAGAGAAG 104 DME qFw GAGTCCAGTCTCAAACCCATC 105 DME qRv CTCCGTTGAAAGACCTCTGAATA 106 DRM2 qFw AGCCAGATGAGATGGAGAGTA 107 DRM2 qRv CGCCACAGTATCAACCTGAA 108 CMT2 qFw CTTTGGTACCAGGATACGTCTTT 109 CMT2 qRv TGGCATGTTGGGACTGTTAG 110 KYP qFw GTTCAGTGCGTCCTGAGTT 111 KYP qRv GCGCATATCCATAGTCGTAAGT 112 EcAPO_1 qFw CTTCGCTCGATGAACTTAGGAG 113 EcAPO_1 qRv CAGCCTTCGACTTTCCACC 114 EcAPO_2 qFw CCTCACCTGGATTGACTGATG 115 EcAPO_2 qRw GTCCTTTCCCTGATAAGCTCTC 116 EcAPO_3 qFw TCAGCATCCGCAGTCTTTC 117 EcAPO_3 qRw CCATAAGACGCACACACAAATC 118 EcAPO_4 qFw GCGATCTACTCATCCGAGAAAG 119 EcAPO_4 qRw CCATTGACAAAGACGCTCCTA Table 10. Primers used for qPCR assays. EXAMPLE 5: Expression analysis of EcAPO genes The expression profile for EcAPO genes was analyzed in all the lines by qPCR, confirming the presence of EcAPO transcripts in the transgenic plants and the efficiency of the expression system used (Figure 10). Transgenic plants phenotyping An important number of transgenic lines showed abnormalities during the reproductive stages (Table 11). These included alterations in the gametophytic development, such as loss in the viability of the embryo sac (ES), changes in cell identity within the ES, and an atypical number or distribution of ES nuclei. In addition, abnormal phenotypes were detected during floral development in lines carrying at least three of the EcAPO genes. Among the latter phenotypes, an indeterminate development and homeotic transformations were found. Tables 11 and 12 show a detail of each phenotype observed and its occurrence in the transgenic lines. Phenotypes during early development Phenotypes during Abnormal EcAPO lines Abnormal ES flower embryo development development development Prese nce Non- Som of Emb cellular Introgr Trans FG atic extra ryo- ized Homeoti Mult essed genic 1 ident nuclei prop endos Indeterm c iple Casset Line arr ity in in er perm / inancy transfor FM te N° est ES ES / E arres atypica mations cells gg- t l appar cyst(s) atus EcAPO 22 ✔ _1 EcAPO 25 ✔ ✔ ✔ _1 EcAPO 27 ✔ _1 EcAPO 12 ✔ _1-3 EcAPO 1 ✔ _1-4 EcAPO 3 ✔ ✔ _1-4 EcAPO 5 ✔ _1-4 EcAPO 1 ✔ _1-5 EcAPO 2 ✔ ✔ _1-5 EcAPO 4 ✔ ✔ _1-5 EcAPO 1 ✔ ✔ ✔ ✔ _X3 EcAPO 2 ✔ _X3 EcAPO 4 ✔ ✔ ✔ _X3 EcAPO 6 ✔ _X3 EcAPO 1 ✔ ✔ ✔ ✔ _X4 EcAPO 2 ✔ ✔ ✔ ✔ ✔ _X4 EcAPO 4 ✔ ✔ _X4 EcAPO 6 ✔ ✔ _X4 EcAPO 8 ✔ ✔ ✔ _X4 EcAPO 9 ✔ _X4 EcAPO 10 ✔ _X4 EcAPO 13 ✔ _X4 EcAPO 4 ✔ _X5 EcAPO 8 ✔ ✔ _X5 EcAPO 10 ✔ ✔ _X5 TOTAL 25a4b5b7b6b5b10b6b5b Table 11. Phenotypes observed in EcAPO transgenic lines. Only those lines that showed phenotypes are listed. Checked boxes (✔) indicate the presence of the given phenotype in each transgenic line studied.aTotal of EcAPO transgenic lines presenting phenotypes.bTotal lines showing each phenotype. For frequency values related to the observed phenotypes see Table 12. EcAPO Line Homeotic Total ovules ES arrest Embryo cassette phenotypes analyzed (%) arrest (%) (pistils) EcAPO_x3 1 no 275 (6) 24 (8.7) 42 (15.3) EcAPO_x3 2 no 316 (7) 6 (1.9) 57 (18.0) EcAPO_x3 4 no 306 (6) 17 (5.5) 37 (12.1) EcAPO_x4 1 no 487 (10) 52 (10.7) 78 (17.9) EcAPO_x4 2 no 396 (8) 21 (5.3) 60 (15.1) EcAPO_x4 6 yes 312 (6) 84 (26.9) 17 (5.5) EcAPO_x5 4 yes 284 (7) 191 (67.2) 11 (3.9) EcAPO_x5 10 yes 399 (8) 224 (56.1) 13 (3.2) Table 12. Number of ovules with arrested development in EcAPO T1 lines. Reference: WT ES arrest 2.7%; WT embryo arrest 0.6%. n=330. Remarkably, as the number of introgressed EcAPO genes increased, the number of phenotypes observed and their penetrance also increased. It suggests a possible synergic or additive effect between these genes. Gametophyte and embryo phenotypes in EcAPO lines EcAPO mutants at flowering showed a high level of ovule arrests, at both early and late developmental stages. The higher rate of early abortions was observed in those lines with homeotic phenotypes hindering the assessment of phenotypes at early developmental stages (Table 11). Besides such abortions linked to homeotic transformations, arrests were also observed in EcAPO mutant lines without homeotic phenotypes (Table 12). This prompted us to analyze mutant ovules at gametophytic (Figure 11) and embryo stages (Figure 12) by DIC microscopy. In Arabidopsis, the female germline initiates with the differentiation of the megaspore mother cell (MMC) in the ovule primordium (Drews and Koltunow, 2011). After meiosis, the MMC will lead to a functional megaspore (FM) at the chalazal end, which in turn will develop the embryo sac (ES) through mitosis. The mature ES consists of eight nuclei and seven cells: two gametic cells; the egg and the central cells, along with five accessory cells; two synergids and three antipodal cells (Figure 11A). Remarkably, in EcAPO transgenic plants there were observed ESs with a higher number of nuclei than WT plants and with atypical positions, mainly affecting the gametic cell zone (Figure 11B). Also, mutant ESs arrested at the FG1 stage (Christensen et al., 1997) or containing cells with somatic identity could be observed (Figure 11C-D). In addition, it was noticed a deregulation in the integument growth during the ovule or seed development (not shown). In mutant ovules, during the MMC and FM specification, it was frequently observed more than one persistent cell (Figure 11F-G). Although the mitotic or meiotic origin of these extra cells is currently unknown, its presence could explain the supernumerary nuclei observed. Following, after fertilization the inventors found embryos with a developmental delay at the pre-globular stage (Figure 12A-B). In addition, these early seeds frequently showed an uncellularized endosperm and an overgrowth in the endosperm cyst (Figure 12C, G- H). Occasionally, a depolarized cyst development and the appearance of ectopic cysts were observed (Figure 12D, E). Floral phenotypes in EcAPO lines A. thaliana has a hermaphrodite flower compound with 4 concentric whorls. Starting from the outermost, the 1stwhorl is occupied by 4 sepals, followed by the 2ndwhorl with 4 petals. The 3rdwhorl contains 6 stamens and the 4thwhorl develops 2 carpels in the floral meristem center (FMC) that fuse to form the pistil (Figure 13A). In transgenic EcAPO plants abnormal developmental patterns in flowers were observed, similar to those described for homeotic apetala2 and superman mutants (Komaki et al., 1988; Bowman et al., 1989; Kunst et al., 1989). Thus, the homeotic transformations found in EcAPO lines emulated double mutants ap2 sup (Huang and Ma, 1997), showing absence of petals, production of carpeloid sepals (i.e sepals presenting marginal ovules and apices with stigmatic tissue), a reduction in the stamen number, carpel-stamen fusions (chimeric organs), and loss of determinacy in reproductive whorls (Figure 13B-G). The indeterminate development in the innermost whorl occasionally leads to the formation of multilocular pistils (Figure 13G). The APETALA2 (AP2) gene is required during the normal 1st(sepals) and 2nd(petals) whorl development, and the cadastral gene SUPERMAN (SUP) sets the boundaries between whorls 3 (stamens) and 4 (carpels) (Bowman et al., 1989). Both genes AP2 and SUP, contribute to the correct allocation and function of AGAMOUS (AG), the master regulator during reproductive organ formation (Bowman et al., 1989). While AP2 restricts the AG expression to the inner 3 and 4 whorls, SUP insulates AG in the 4thwhorl allowing specific control of carpel identity and floral meristem determinacy (Coen and Meyerowitz, 1991) (Sakai et al., 1995). Another gene closely related to SUP, KNUCKLES (KNU), is expressed at the carpel-placenta boundary (Sun et al., 2009), and knu mutants also produce indeterminate phenotypes with ectopic stamens and carpels arising inside the 4thwhorl (Payne et al., 2004), a phenotype also frequently observed in EcAPO lines (Figure 13H-K). All the mentioned phenotypes suggest that the expression of EcAPO genes could interfere with the expression or function of AP2, AG, SUP and / or KNU. The determinate development is controlled in the FMC by the CLAVATA (CLV)- WUSCHEL (WUS) pathway (Bowman et al., 1991, Sun et al., 2009; Sun and Ito, 2015). It was demonstrated that AG and SUP are able to modulate this pathway by independent ways (Prunet et al., 2017, Uemura et al., 2018). While KNU represents a key link in the feedback regulation of WUS by AG (Sun et al., 2009), sup phenotypes were observed in CLV-deficient mutants, suggesting a relation between SUP and CLV pathways (Diévart et al., 2003, Trotochaud et al., 1999). Nonetheless, it was also suggested that SUP could regulate WUS at least partially in a CLV-independent way (Breuil-Broyer et al., 2016). Finally, it was also proposed that AP2 could directly repress WUS (Nowak et al., 2022). In this way, the probable low activity of AP2, SUP and / or KNU genes in EcAPO flowers, could determine not only homeotic transformations but also trigger an accumulation of WUS that in turn would be responsible for the indeterminate phenotypes. Moreover, an excess of WUS in EcAPO flowers could contribute to some of the homeotic phenotypes, since it was determined that an ectopic expression of WUS in the 3rdwhorl results in a higher AG activity and carpeloid stamens (Lenhard et al., 2001, Lohmann et al., 2001), a phenotype observed in EcAPO flowers (Figure 13E). A similar deregulation of AG in sepals could generate the ap2-like phenotypes observed in EcAPO mutants. In addition, a WUS accumulation also results in larger meristems (Fletcher et al., 1999), a characteristic phenotype of clv mutants and also observed in EcAPO_1 lines (not shown). Finally, it was reported that WUS accumulation in the ovule primordium leads to several rounds of mitosis in the MMC before meiosis, resulting in the development of extra ESs and a supernumerary nuclei phenotype (Zhao et al., 2017), resembling those phenotypes observed in EcAPO ESs (Figure 11B). Ploidy level analysis The sup-like phenotypes found in EcAPO mutants are related with those classified as superwoman mutants (clark-kent, fon, car, -eA31, lol) (Jacobsen and Meyerowitz, 1997; Huang and Ma, 1997; Rohde et al., 1999, Breuil-Broyer et al., 2016; Bondada et al., 2020). Notably, these mutants are determined by different DNA methylation patterns on the SUP gene sequence. In addition, almost all gemetophytes phenotypes found in EcAPO mutant plants have been previously described in maize mutants with a downregulated DNA methylation pathway (Garcia-Aguilar et al., 2010). Remarkably, those maize mutants are able to recreate both diplosporic and aposporic developments, producing non-reduced gametes and extra ESs, respectively (Garcia-Aguilar et al., 2010). The non-reduced gametes could be easily recognized because of their larger size. Regarding, the inventors were able to observe pollen grains with different sizes in EcAPO plants (Figure 11H). It suggests that the expression of EcAPO genes could be able to modify either directly or indirectly the normal epigenetic landscape in mutant plants. Considering the link between EcAPO genes and the diplospory function in E. curvula, the A. thaliana transgenic plants were able to recreate a diplosporic development. Without parthenogenesis this event would result in polyploid plants. In fact, as in EcAPO mutants, there were observed ap2-like and sup-like phenotypes in polyploid plants (Comai, 2000; Madlung et al., 2002, Bondada 2022). Moreover, the endosperm phenotypes found in EcAPO mutants are described in triploid seeds with an increased paternal genome dosage (Scott et al., 1998). Since the variation in seed size correlates with changes in the ratio of maternal to paternal genomes (Scott et al., 1998), the inventors recorded the individual seed sizes for EcAPO lines. Consistently, the inventors observed mutant seeds with either volume increase or decrease, as described for triploid plants with an excess of paternal or maternal dose, respectively (Figure 14). Furthermore, triploid plants with a double paternal genomic dosage show a higher rate of growth at the seedling stage (Fort et al., 2016), a feature observed in EcAPO mutant plants (Figure 15). Following, the inventores determined the chromosome number in root cells of EcAPO plants finding evidence of polyploidization (Figure 16). The cells and its respective nuclei were bigger than normal size and the chromosome counting reached values between 15 and 20, strongly suggesting the emergence of triploid and tetraploid plants among the mutant lines. The above results further supports the potential of the EcAPO genes to establish a partial apomictic pathway in unrelated sexual plants. Expression analysis Given that both floral and gametophyte phenotypes found in EcAPO mutant plants could be associated with DNA methylation changes, the inventors first analyzed the transcript level in our mutants for those genes involved in the DNA methylation pathways. Figure 17 shows a summary of the expression profile obtained by qPCR analysis for EcAPO1 transgenic plants. The inventors found the downregulation of almost all genes involved in epigenetic mechanisms, including DNA methylation, post-translational histone modifications and the RdDM pathway. In concordance with Garcia-Aguilar et al. (2010), the inventors observed a comparable deregulation of DRM1, DRM2 and DDM1 genes, as those described for diplosporous Tripsacum and Boechera plants. Moreover, even though our mutants did not show variations in CMT3 transcript levels, the inventors observed reduced transcription for KYP, a gene that determines the normal function of CMT3 in the CHG methylation process (Johnson et al., 2002; Lindroth et al., 2004). Importantly, the inventors also detected lower expression for MET1 and CMT2, the main methyltransferases in Arabidopsis involved in the maintenance of CG and CHH methylation of the DNA, respectively. Plant DNA methylation occurs in CG, CHG and CHH contexts (where H = A, T or C), and each context is maintained by the activity of the methyltransferases MET1, CMT3 and CMT2, respectively. These enzymes act preferentially in constitutive heterochromatin and depend strongly on DDM1 to maintain transposable elements (TEs) silenced over these regions (Akinmusola et al., 2023). Thus, DDM1 is a key regulator of DNA methylation in heterochromatin and Arabidopsis ddm1 mutants display many pleiotropic phenotypes, including homeotic phenotypes (Jacobsen et al., 1997; Jacobsen et al., 2000). Furthermore, it has been reported that a moderate or severe reduction of global genomic methylation in Arabidopsis leads to ap2 or sup phenotypes, respectively (Finnegan 1996; Ronemus 1996). Thus, the results stated above could explain not only the abnormal ESs observed in the EcAPO mutants but also the most frequent homeotic-linked phenotypes. In addition, the inventors found in transgenic EcAPO plants a downregulation of DME, a gene which encodes for a DNA-glycosylase specifically expressed in companion cells during gametophyte development (Hsieh et al., 2009; Ibarra et al., 2012). DME demethylates small, AT-rich euchromatic TEs in companion cells (vegetative cell and central cell), thus generating sRNAs which in turn can silence those TEs in gametes (Slotkin et al., 2009; Ibarra et al., 2012), and immunizing them against TE activation. Also, DME preferentially demethylate gene-adjacent sequences and allow the establishment of the imprinting in the endosperm (Bauer et al., 2011). Of note, the overall downregulation of the epigenetic machinery in EcAPO plants must involve a massive activation of TEs. In addition, the DME downregulation in transgenic EcAPO plants suggests that imprinting could be missing. In accordance, the loss of imprinting in the FWA gene, otherwise dependent on DME activity (Kinoshita et al., 2004), determines a late flowering phenotype (Soppe et al., 2000), as seen in EcAPO mutant plants (Figure 18). Finally, the inventors identified in EcAPO1 lines the downregulation of SPL and WUS (Figure 17), both genes with essential functions in germ line specification in Arabidopsis (Yang et al., 1999; Groß-hardt et al., 2002). Also, the inventors detected a lower expression of ARF5, a gene required for sexual ovule development (Cucinotta et al., 2021), and involved in cell polarity through the orientation of the auxin efflux carrier PIN1 (Bhatia et al., 2016). These results suggest that the normal sexual pathway could be at least partially abolished or altered in EcAPO plants. References Adams S, Vinkenoog R, Spielman M, Dickinson HG, Scott RJ, 2000. Parent-of-origin effects on seed development in Arabidopsis thaliana require DNA methylation. Development 127, 2493-502. Akinmusola RY, Wilkins CA, Doughty J. DDM1-Mediated TE Silencing in Plants. Plants (Basel). 2023 Jan 18;12(3):437. doi: 10.3390 / plants12030437. PMID: 36771522; PMCID: PMC9919755. Albertini E, Porceddu A, Ferranti F, Reale L, Bacarccia G, Romano B, et al. Apospory and parthenogenesis may be uncoupled in Poa pratensis: a cytological investigation. Sex Plant Reprod.2001;14: 213-17. Bauer MJ, Fischer RL. Genome demethylation and imprinting in the endosperm. Curr Opin Plant Biol. 2011 Apr;14(2):162-7. doi: 10.1016 / j.pbi.2011.02.006. Epub 2011 Mar 23. PMID: 21435940; PMCID: PMC3082360. Bemer M, Grossniklaus U, 2012. Dynamic regulation of Polycomb group activity during plant development. Curr Opin Plant Biol 15, 523-9. Bennett MD. Nuclear DNA content and minimum generation time in herbaceous plants. Proc. R. Soc. Lond., B, Biol. Sci.1972; 181.1063: 109-135. Bhatia N, Bozorg B, Larsson A, Ohno C, Jönsson H, Heisler MG. Auxin Acts through MONOPTEROS to Regulate Plant Cell Polarity and Pattern Phyllotaxis. Curr Biol.2016 Dec 5;26(23):3202-3208. doi: 10.1016 / j.cub.2016.09.044. Epub 2016 Nov 3. PMID: 27818174; PMCID: PMC5154752. Bicknell, R. A. & Koltunow, A. M. Understanding apomixis: recent advances and remaining conundrums. Plant Cell 16, S228-S245 (2004). Bondada R, Somasundaram S, Marimuthu MP, Badarudeen MA, Puthiyaveedu VK, Maruthachalam R, 2020. Natural epialleles of Arabidopsis SUPERMAN display superwoman phenotypes. Communications Biology 3, 772. Bowman JL, Sakai H, Jack T, Weigel D, Mayer U, Meyerowitz EM, 1992. SUPERMAN, a regulator of floral homeotic genes in Arabidopsis. Development 114, 599-615. Bowman JL, Smyth DR, Meyerowitz EM, 1989. Genes directing flower development in Arabidopsis. Plant Cell 1, 37-52. Bowman JL, Smyth DR, Meyerowitz EM, 1991. Genetic interactions among floral homeotic genes of Arabidopsis. Development 112, 1-20. Breuil-Broyer S, Trehin C, Morel P, et al., 2016. Analysis of the Arabidopsis superman allelic series and the interactions with other genes demonstrate developmental robustness and joint specification of male-female boundary, flower meristem termination and carpel compartmentalization. Ann Bot 117, 905-23. Carman JG. Asynchronous expression of duplicate genes in angiosperms may cause apomixis, bispory, tetraspory, and polyembryony. Biol J Linnean Soc.1997; 6: 1:51-94. Catanach AS, Erasmuson SK, Podivinsky E, Jordan BR, Bicknell R. Deletion mapping of genetic regions associated with apomixis in Hieracium. Proc Natl Acad Sci USA. 2006;103.49: 18650-5. Cervigni GD, Paniego N, Díaz M, Selva JP, Zappacosta D, Zanazzi D, et al. Expressed sequence tag analysis and development of gene associated markers in a near-isogenic plant system of Eragrostis curvula. Plant Mol Biol.2008;67(1-2): 1-10. Chaudhury AM, Ming L, Miller C, Craig S, Dennis ES, Peacock J, 1997. Fertilization- independent seed development in Arabidopsis thaliana. Plant Biology 94, 4223-8. Chen X, 2004. A microRNA as a translational repressor of APETALA2 in Arabidopsis flower development. Science 303, 2022-5. Christensen CA, King EJ, Jordan JR, Drews GN, 1997. Megagametogenesis in Arabidopsis wild type and the Gf mutant. Sex Plant Reprod 10, 49-64. Clough S., and Bent A. (1998) Floral dip: a simplified method for Agrobacterium- mediated transformation of Arabidopsis thaliana. Plant Journal.16, 735-743. Coen ES, Meyerowitz EM, 1991. The war of the whorls: genetic interactions controlling flower development. Nature 353, 31-7. Comai L, Tyagi AP, Winter K, et al., 2000. Phenotypic instability and rapid gene silencing in newly formed arabidopsis allotetraploids. Plant Cell 12, 1551-68. Conner JA, Gunawan G, Ozias-Akins P. Recombination within the apospory specific genomic region leads to the uncoupling of apomixis components in Cenchrus ciliaris. Planta.2013; 238.1: 51-63. Covas G, Cairnie A. Introducción del pasto llorón en la Argentina. In: Fernandez O, Brevedan RE, Gargajo A, editors. El Pasto llorón: su biología y manejo. Bahía Blanca, Argentina: CERZOS; 1991. p 1–6. Crane C. Classification of Apomictic Mechanisms. In: Savidan Y, Carman JG, Dresselhaus T, editors. Flowering of Apomixis: From Mechanisms to Genetic Engineering. Mexico City: CIMMYT; 2001. p.168-211. Cucinotta M, Cavalleri A, Guazzotti A, Astori C, Manrique S, Bombarely A, Oliveto S, Biffo S, Weijers D, Kater MM, Colombo L. Alternative Splicing Generates a MONOPTEROS Isoform Required for Ovule Development. Curr Biol.2021 Feb 22;31(4):892-899.e3. doi: 10.1016 / j.cub.2020.11.026. Epub 2020 Dec 3. PMID: 33275890. Diévart A, Dalal M, Tax FE, et al., 2003. CLAVATA1 dominant-negative alleles reveal functional overlap between multiple receptor kinases that regulate meristem and organ development. Plant Cell 15, 1198-211. Drews GN, Koltunow AM, 2011b. The Female Gametophyte. Arabidopsis Book 9, e0155. Dusi D (2001) Patterns of RNA distribution during embryo sac development in sexual and apomictic plants of Brachiaria decumbens. In: Apomixis in Brachiaria decumbens Stapf. Doctoral thesis, Wageningen University, Department of Plant Sciences, pp 71–96 Finnegan EJ, Peacock WJ, Dennis ES. Reduced DNA methylation in Arabidopsis thaliana results in abnormal plant development. Proc Natl Acad Sci U S A. 1996 Aug 6;93(16):8449-54. doi: 10.1073 / pnas.93.16.8449. PMID: 8710891; PMCID: PMC38691. Fletcher JC, Brand U, Running MP, Simon R, Meyerowitz EM, 1999. Signaling of cell fate decisions by CLAVATA3 in Arabidopsis shoot meristems. Science 283, 1911-4. Fort A, Ryder P, Mckeown PC, et al., 2016. Disaggregating polyploidy, parental genome dosage and hybridity contributions to heterosis in Arabidopsis thaliana. New Phytol 209, 590-9. Garbus I, Romero J, Selva JP, Pasten MC, Chinestra C, Carballo J, Zappacosta D, Echenique V. De novo transcriptome sequencing and assembly from apomictic and sexual Eragrostis curvula genotypes. PLOSONE. In press García-Aguilar M, Michaud, C., Leblanc, O. & Grimanelli, D. , 2010. Inactivation of a DNA methylation pathway in maize reproductive organs results in apomixis-like phenotypes.. Plant Cell 22, 3249–67. Goodrich J, Puangsomlee P, Martin M, Long D, Meyerowitz EM, Coupland G, 1997. A Polycomb-group gene regulates homeotic gene expression in Arabidopsis. Nature 386, 44-51. Grimanelli, D. Epigenetic regulation of reproductive development and the emergence of apomixis in angiosperms. Curr Opin Plant Biol 15, 57-62 (2012). Gross-Hardt R, Lenhard M, Laux T. WUSCHEL signaling functions in interregional communication during Arabidopsis ovule development. Genes Dev. 2002 May 1;16(9):1129-38. doi: 10.1101 / gad.225202. PMID: 12000795; PMCID: PMC186242. Hartley, J. L., Temple, G. F., and Brasch, M. A. (2000) DNA Cloning Using in vitro Site- Specific Recombination. Genome Research.10, 1788-1795. Hsieh TF, Ibarra CA, Silva P, Zemach A, Eshed-Williams L, Fischer RL, Zilberman D. Genome-wide demethylation of Arabidopsis endosperm. Science. 2009 Jun 12;324(5933):1451-4. doi: 10.1126 / science.1172417. PMID: 19520962; PMCID: PMC4044190. Huang H, Ma H, 1997. FON1, an Arabidopsis gene that terminates floral meristem activity and controls flower organ number. Plant Cell 9, 115-34. Ibarra CA, Feng X, Schoft VK, Hsieh TF, Uzawa R, Rodrigues JA, Zemach A, Chumak N, Machlicova A, Nishimura T, Rojas D, Fischer RL, Tamaru H, Zilberman D. Active DNA demethylation in plant companion cells reinforces transposon methylation in gametes. Science. 2012 Sep 14;337(6100):1360-1364. doi: 10.1126 / science.1224839. PMID: 22984074; PMCID: PMC4034762. Ikeda Y, Kobayashi Y, Yamaguchi A, Abe M, Araki T, 2007. Molecular basis of late- flowering phenotype caused by dominant epi-alleles of the FWA locus in Arabidopsis. Plant Cell Physiol 48, 205-20. Jacobsen SE, Meyerowitz EM, 1997. Hypermethylated SUPERMAN epigenetic alleles in arabidopsis. Science 277, 1100-3. Jacobsen SE, Sakai H, Finnegan EJ, Cao X, Meyerowitz EM. Ectopic hypermethylation of flower-specific genes in Arabidopsis. Curr Biol. 2000 Feb 24;10(4):179-86. doi: 10.1016 / s0960-9822(00)00324-9. PMID: 10704409. Johnson L, Cao X, Jacobsen S. Interplay between two epigenetic marks. DNA methylation and histone H3 lysine 9 methylation. Curr Biol.2002 Aug 20;12(16):1360-7. doi: 10.1016 / s0960-9822(02)00976-4. PMID: 12194816. Katz A, Oliva M, Mosquna A, Hakim O, Ohad N, 2004. FIE and CURLY LEAF polycomb proteins interact in the regulation of homeobox gene expression during sporophyte development. Plant J 37, 707-19. Kinoshita T, Miura A, Choi Y, et al., 2004. One-way control of FWA imprinting in Arabidopsis endosperm by DNA methylation. Science 303, 521-3. Komaki MK, Okada K, Nishino E, Shimura Y, 1988. Isolation and characterization of novel mutants of Arabidopsis thaliana defective in flower development. Development 104, 195-203. Krogan NT, Hogan K, Long JA, 2012. APETALA2 negatively regulates multiple floral organ identity genes in Arabidopsis by recruiting the co-repressor TOPLESS and the histone deacetylase HDA19. Development 139, 4180-90. Kunst L, Klenz JE, Martinez-Zapater J, Haughn GW, 1989. AP2 Gene Determines the Identity of Perianth Organs in Flowers of Arabidopsis thaliana. Plant Cell 1, 1195-208. Lenhard M, Bohnert A, Jürgens G, Laux T, 2001. Termination of stem cell maintenance in Arabidopsis floral meristems by interactions between WUSCHEL and AGAMOUS. Cell 105, 805-14. Lindroth AM, Shultis D, Jasencakova Z, Fuchs J, Johnson L, Schubert D, Patnaik D, Pradhan S, Goodrich J, Schubert I, Jenuwein T, Khorasanizadeh S, Jacobsen SE. Dual histone H3 methylation marks at lysines 9 and 27 required for interaction with CHROMOMETHYLASE3. EMBO J. 2004 Oct 27;23(21):4286-96. doi: 10.1038 / sj.emboj.7600430. Epub 2004 Sep 30. Erratum in: EMBO J. 2011 May 4;30(9):1874. PMID: 15457214; PMCID: PMC524394. Lohmann JU, Hong RL, Hobe M, et al., 2001. A molecular link between stem cell regulation and floral patterning in Arabidopsis. Cell 105, 793-803. Lora J, Yang X, Tucker MR, 2019. Establishing a framework for female germline initiation in the plant ovule. J Exp Bot 70, 2937-49. Madlung A, Masuelli RW, Watson B, Reynolds SH, Davison J, Comai L, 2002. Remodeling of DNA methylation and phenotypic and transcriptional changes in synthetic Arabidopsis allotetraploids. Plant Physiol 129, 733-46. Mozgova I, Köhler C, Hennig L, 2015. Keeping the gate closed: functions of the polycomb repressive complex PRC2 in development. Plant J 83, 121-32. Murashige T, Skoog F, 1962. A Revised Medium for Rapid Growth and Bio Assays with Tobacco Tissue Cultures. Physiologia Plantarum 15, 473-97. Nogler, G. Gametophytic apomixis in Embryology of Angiosperms (ed. Johri, B. M.) 475- 518 (Springer, 1984). Nowak K, Morończyk J, Grzyb M, Szczygieł-Sommer A, Gaj MD, 2022. miR172 Regulates WUS during Somatic Embryogenesis in Arabidopsis via AP2. Cells 11. Noyes RD, Rieseberg LH. Two independent loci control agamospermy (Apomixis) in the triploid flowering plant Erigeron annuus. Genetics.2000;155.1: 379-390. Ohad N, Margossian L, Hsu Y-C, Williams C, Reppetti P, Fisher RL, 1996. A mutation that allows endosperm development without fertilization. Plant Biology 93, 5319-24. Ozias-Akins, P. & van Dijk, P. Mendelian genetics of apomixis in plants. Annu Rev Genet 41, 509-537 (2007). Payne T, Johnson, S. D.,Koltunow, A. M. , 2004. KNUCKLES (KNU) encodes a C2H2 zinc-finger protein that regulates development of basal pattern elements of the Arabidopsis gynoecium. Development 131, 3737-49. Pinyopich A, Ditta GS, Savidge B, et al., 2003. Assessing the redundancy of MADS-box genes during carpel and ovule development. Nature 424, 85-8. Prunet N, Yang W, Das P, Meyerowitz EM, Jack TP, 2017. SUPERMAN prevents class B gene expression and promotes stem cell termination in the fourth whorl of Arabidopsis thaliana flowers. Proc Natl Acad Sci U S A 114, 7166-71. Rohde A, Grunau C, De Beck L, Van Montagu M, Rosenthal A, Boerjan W, 1999. Carpel, a new Arabidopsis epi-mutant of the SUPERMAN gene: phenotypic analysis and DNA methylation status. Plant Cell Physiol 40, 961-72. Ronemus MJ, Galbiati M, Ticknor C, Chen J, Dellaporta SL. Demethylation-induced developmental pleiotropy in Arabidopsis. Science. 1996 Aug 2;273(5275):654-7. doi: 10.1126 / science.273.5275.654. PMID: 8662558. Rounsley SD, Ditta GS, Yanofsky MF, 1995. Diverse roles for MADS box genes in Arabidopsis development. Plant Cell 7, 1259-69. Ruijter JM, Ramakers C, Hoogaars WM, et al., 2009. Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic acids research 37, e45. Sakai H, Medrano LJ, Meyerowitz EM, 1995. Role of SUPERMAN in maintaining Arabidopsis floral whorl boundaries. Nature 378, 199-203. Sarrion-Perdigones A, Marta Vazquez-Vilar, Jorge Palací, Bas Castelijns, Javier Forment, Peio Ziarsolo, José Blanca, Antonio Granell, Diego Orzaez, 2013. GoldenBraid 2.0: A Comprehensive DNA Assembly Framework for Plant Synthetic Biology. Plant Physiol.162, 1618-31. Schallau A, Arzenton F, Johnston A, Hähnel U, Koszegi D, Blattner FR, et al. Identification and genetic analysis of the APOSPORY locus in Hypericum perforatum L. Plant Journal. 2010; 62.5: 773-784. Schneider CA, Rasband WS, Eliceiri KW, 2012. NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9, 671-5. Scott RJ, Spielman M, Bailey J, Dickinson HG, 1998. Parent-of-origin effects on seed development in Arabidopsis thaliana. Development 125, 3329-41. Slotkin RK, Vaughn M, Borges F, Tanurdzić M, Becker JD, Feijó JA, Martienssen RA. Epigenetic reprogramming and small RNA silencing of transposable elements in pollen. Cell. 2009 Feb 6;136(3):461-72. doi: 10.1016 / j.cell.2008.12.038. PMID: 19203581; PMCID: PMC2661848. Soppe WJ, Jacobsen SE, Alonso-Blanco C, et al., 2000. The late flowering phenotype of fwa mutants is caused by gain-of-function epigenetic alleles of a homeodomain gene. Mol Cell 6, 791-802. Sørensen MB, Chaudhury AM, Robert H, Bancharel E, Berger F, 2001. Polycomb group genes control pattern formation in plant seed. Curr Biol 11, 277-81. Sun B, Ito T, 2015. Regulation of floral stem cell termination in Arabidopsis. Front Plant Sci 6, 17. Sun B, Xu Y, Ng KH, Ito T, 2009. A timing mechanism for stem cell maintenance and differentiation in the Arabidopsis floral meristem. Genes Dev 23, 1791-804. Trotochaud AE, Hao T, Wu G, Yang Z, Clark SE, 1999. The CLAVATA1 receptor-like kinase requires CLAVATA3 for its assembly into a signaling complex that includes KAPP and a Rho-related protein. Plant Cell 11, 393-406. Uemura A, Yamaguchi N, Xu Y, et al., 2018. Regulation of floral meristem activity through the interaction of AGAMOUS, SUPERMAN, and CLAVATA3 in Arabidopsis. Plant Reprod 31, 89-105. Van Dijk PJ, Tas IC, Falque M, Bakx-Schotman T. Crosses between sexual and apomictic dandelions (Taraxacum). II. The breakdown of apomixis. Heredity.1999; 83.6: 715-721. Voigt P, Rethman N, Poverene M. Lovegrasses. In: Moser LE, Burson BL, LE, editors. Warm-Season (C4) Grass. Madison: American Society of Agronomy; 2004. p. 1027- 1056.Voigt PW, Bashaw EC. Facultative apomixis in Eragrostis curvula. Crop Sci. 1976;16: 803-6. Voigt PW. Discovery of sexuality in Eragrostis curvula (Schrad.) Nees. Crop Sci.1971; 11: 424-425. Watson L, Dallwitz MJ. The grass genera of the world. Oxfordshire: CAB international; 1992. Yang WC, Ye D, Xu J, Sundaresan V. The SPOROCYTELESS gene of Arabidopsis is required for initiation of sporogenesis and encodes a novel nuclear protein. Genes Dev. 1999 Aug 15;13(16):2108-17. doi: 10.1101 / gad.13.16.2108. PMID: 10465788; PMCID: PMC316961. Zappacosta D C, Ochogavía A C, Rodrigo J M, Romero J R, Meier M S, Garbus I, et al. Increased apomixis expression concurrent with genetic and epigenetic variation in a newly synthesized Eragrostis curvula polyploid. Scientific Reports.2014; 4: 4423. Zhao XA, Bramsiepe J, Van Durme M, et al., 2017. RETINOBLASTOMA RELATED1 mediates germline entry in Arabidopsis. Science 356, eaaf6532. LIST OF SEQUENCES SEQ Description Sequence ID NO 1 EcAPO1ATGGAAGGGGTCCCTCGAGTTGCTTCGCTCGATGAACTTAGGAGACTCGTGGCTGAGAATCAGCCTGGCAACCAAAGCATCCAGGTGAGGTCAGTAGTGC TACGAGAGGCCCTGGCTATGTTCGACGCCCTCCGCTCCGTCGAGACGGCG CACCGGTGGAAAGTCGAAGGCTGCCAACGCGTCTGTGTCGTCTCTTACCT CGACCGGACGCTAAGCGTCGTCGAAAGCGTCGCTGCTCCAAGGCTCTCCC TCAACCCTACCGATAACCTTGCAATCAGCAACATCCGTGCCTTTGCCGAC CAGGTTCGTAGCCTGGCTCGCAGGGTCGGCGGCTCTGTCCGGGAGCCGAC CGAGGCGCTCAGTGACCGCCTCGACCAGTTGGCTACTGCAGCTGAGGGAC GCGTGCTCGACCCCAACGCGATTGAGCAGTTGCGTGCTGATATCAACACC CTGCGAGATCAAGCTGTTCATCTCGATCAGCCGCCGGAGCCGGAAGTGCC GGCACTTTCTTTCGATGAGTATTATTGA 2 EcAPO2_1GGGCCTCGATGGCCGCCTCCCCGCCGCGCAGCCATCACCGGGACGACGACTTTCCTCGCTGCCTCAAGCTTTGCGCGTCCCCCTTCCACTCGTCCGACTC CGAGATTGACCACCGCCGCAGATCGAGGGCCTTCGCGCCGGTCGCCAACA GCCGCCGCAGATCTAGGGCCTCCCCGTCCGTCCCCAACCGCCGCCGTGGC CGCGACCCTGAGGGCTGTTCCATGCTCAGCGGGTATGCCAGCGACCCTTC CCGGCGCTTTAGGGTCCCCGACAGGGAGGAGGATGGGGACCTCAGGCGGA GGCGTGCTAGGGTTGACAAACTGAGGGAGGATGGTCGCCGGCTGATGCGC TCCAGGCCTCCGGATGATGAGAGGGATCACCCAAGCGGCAAGCACTACCG GGATAGCGACGGCCGCCGCCGTCGCTGGAGCCCCTTGTTGGATGCGGGAC CATGCCTGGACCGCTGCCACAGCCGCCAGCCCACCAGTGATGAGATTTGG AGGAGGTGGGATGACCGCAGGAACAGGGGAGATGACCGTGATGAGCGCGG AAGGAGTCCTGAGAAGAGGGAGCCGTTGTCACTGCTGCCGTATAACTCTG GGTGTACTGGTGGGAACTACACCTCATCTTTCCGCAAGCTTCAGATAAGG CTGAAGCTGGAGGACAAGGCAAGCCCGGAGTACCAGCGGGTTAGCTGGGA TGCACTCGAGAAGCGCATCAATGGGTTAACTAACAAGGTGAATGTGACAA ATATTAAGGATATTGCGCGGGAGCTCTTTGCTCAGAACCTTGTTCGTGGG CGTGGGCTATTCTGCCAATCGTGCATCAAGTCACAGGCAGCCTCACCTGG ATTGACTGATGTGTTTACTGCACTTGTTGCGGTTGTGAACGCCAAATTCC CGGAGATTGGGCGGTTGCTTCTTGTTCGAGTTGTGCTCCAGCTCAAGAGA GCTTATCAGGGAAAGGACATGGCCCAGCTTCCCTCGTTAACTAAGTTTGT AGCACACTTGGTTAATCAGACCGTGGTCCATGAGCTTCTAGCGAGGCAGC TTCTTACTGTACTTCTTGAGAAACCAACTGATGATAGTGTTGAGCTTGCA GTAGCATTTGTCAAAGAATGTGGGGCAATTCTGCAACGCTCATCTCCTCA AGGACTTCATGCTATTTTTGAAAGATTTAAAGTCATACGTCATGAAGTGA AATTAGGCAAGCGTGTGCAGTTTCTTATTGAAGGCCTTTTTGCGATCAGA AAAGCTAATTTTGAGGGGTTTCCAACCATCCGCCCAGAGTTAGATCTTGT GGAGCAGGGCAGCCAGTTTACTCATGAGATATCCCTTGAAGACATGCTAG AACCTGAGATCAATCTAGATGTTTTCAGTGCAAACCCAAATTTCATTGAA GATGAGAAGGCTTATGAGAACCTAATGAGAAGCATTCCGGGACCTGAATC TCGTGAGGATGATGGAGAATCTGATAAAGAGCAGATGGATATGAGGGATC TTATTAATCTTAGAAGGACCATGTATTTGACTATTATATCCAGTGTTCAT TTTGAAGAAGCTGGTCTTATGAAAATTGATGTGAAGCCTGGTCAAGAGAT GGACCTATGCCTTATGATTCTTGAGTGTTGCTGTCAAGAGAAAACCTACC TACATAGTTATGGGCTGTTAGCACAAAGGTATTGCATGATGAACAGAGCG TACCAAGAGAACTTCAAGAAATGTTTTGTTCAACAATATTCAACAGTTCA TTGTCACGAGACATATAAGTTGAGTAATGTTGCCAAGTTTTTTGCACATC TGTTTGTGACTGATACACTCCCATGGCATGTTTTGGGATGCATGCGTTTG ACAAACGATGGTTTGACAGCATCGTCTCGATATTTTATAAAAGTTCTATT TCAGGAACTATCAGAGCATCTTGGCATAGGCCAACTTAATGAGAGATTGA AAGATCTAAATATGCAAGGCTCATTTGAGGTCATCCTTCCGAAGGATCAT CCAAAAAACTTGAGGATCTCCAGTAAATTCTTCACAGCCATCAGTCTTGG GGGTATCGAAGAGAGTATGGGTGGGGACGTGCCACTCCTTGTAATGCGGC AGCACAAGCCTGCATCATCTGTGTTCAAGACTGGTTCGAAAGCTTTTGGC TTAGGATCTCGTGAGTTCTGAGTGAGAAGAACACCAACTGTGGTTACTGG GGGTTGCATTGGCACCTCCGGTTTTGGTCAGAAAAAGTTAGACCATCCTG TATTGCGTGTGCATGT EcAPO2_2ACCAAACCTCCTCTAGCCCGGGCCTCGATGGCCGCCTCCCCGCCGCGCAGCCATCACCGGGACGACGACTTCCCTCGCTGCCTCAAGCGTCGAGCGTCCC CGTTCCACTCGTCCGACTCCGAGATTGACCACCGCCGCAGATCGAGGGCC TTCGCGCCGGTCGCCAACAGCCGCCGCAGATCTAGGGCCTCCCCGTCCGT CCCCAACCGCCGCCGTGGCCGCGACCCTGAGGGCTGTTCCATGCTCAGCG GGTATGCCAGCGACCCTTCCCGGCGCTTTAGGGTCCCCGACAGGGAGGAG GATGGGGACCTCAGGCGGAGGCGTGCTAGGGTTGACAAACAGAGGGAGGA TGGTCGCCGGCTGATGCGCTCCAGGAGTCCTGAGAAGAGGGAGCCGTTGT CACTGCTGCCGTATAACTCTGGGCGTACTGGTGGGAACTACTCCTCATCT TTCCGCAAGCTTCAGATAAGGCTGAAGCTGGAGGACAAGGCAAGCCCGGA GTACCAGCGGGTTAGCTGGGATGCACTCGAGAAGCGCATCAATGGGTTAA CTAACAAGGTGAATGTGACAAATATTAAGGATATTGCGCGGGAGCTCTTT GCTCAGAACCTTGTTCGTGGGCGTGGGCTATTCTGCCAATCGTGCATCAA GTCACAGGCAGCCTCACCTGGATTGACTGATGTGTTAACTGCACTTGTTG CGGTTGTGAACGCCAAATTCCCGGAGATTGGGCGGTTGCTTCTTGTTCGA GTTGTGCTCCAGCTCAAGAGAGCTTATCAGGGAAAGGACATGGCCCAGCT TCCCTCGCTAACTAAGTTTGTAGCACACTTGGTTAATCAGGCCGTGGTCC ATGAGCTTCTAGCGAGGCAGCTTCTTACTGTACTTCTTGAGAAACCAACT GATGATAGTGTTGAGCTTGCAGTAGAATTTGTCAAAGAATGTGGGGCAAT TCTGCAACGCTCATCTCCTCAAGGACTTCATGCTATTTTTGAAAGATTTG AAGTCGTACGTCATGAAGTGAGATTAGGCAAGCGTTCGCAGTTTCTTATT GAAGGTCTTTTTGTGATCAGAAAAGCTAATTTTGAGGGATTTCCAACCAT CCGCCCAGAGTTAGGTCTTGTGGAGCAGGGCAGCCAGTTTACTCATGAGA TATCCCTTGAAGACATGCTAGAACCTGAGATCAATCTAGATGTTTTCAGT GCAAACCCAAATTTCATTGAAGATGAGAAGGCTTATGAGAACCTAATGAG AAGCATTCCGGGACCAGAATCTCGTGAGGATGATGGAGAATCTGATAAAG AGCAGATGGATATGAGGGATCTTATTAATCTTAGAAGGACCATGTATTTG ACTATTATATCCAGTGTTCATTTTGAAGAAGCTGGTCTTATGAAAATTGA TGTGAATCCTGGTCAAGAGATGGACCTATGCCTTATGATTCTTGAGTGTT GCTGTCAAGAGAAAACCTACCTACATAGTTATGGGCTGTTAGCACAAAGG TATTGCATGATGAACAGAGCGTACCAAGAGAACTTCAAGAAATGTTTTGT TCAACAATATTCGACAGTTCATTGACATATAAGTTAAGTAATGTTGCCAA GTTTTTTGCACATCTGTTTGTGACTGATACACTCCCATGGCATGTTTTGG GATGCATGCGTTTGACAAACGATGGTTTGACAGCATCGTCTCGATATTTC ATAAAAGTTCTATTTCAGGAACTATCAGAGCATCTTGGCATAGGCCAACT TAATGAGAGATTGAAAGTTCTAAATATGCAAGGCTCATTTGAGGTCATCC TTCCGAAGGATCATCCAAAAAAACTTGAGGATCTCCAGTAAATTCTTCAC AGCCATCAGTCTTGGGGGTATCAAAGAGAGTATGGGTGGGGACGTGCCAC TCCTTGTAATGCGGCAGCACAAGCCTGCATCATCTGGGTTCAAGACTGGT TCGAAAGCTTTTGGCTCAGGATCTCGTGAGTTCTGAGTGAGAAGAACACC AACTGTGGTTACTGGGGGTTGCATTGGCACCTCCGGTTTTGGTCAGAAAA GTTAGACCATCCTGTATTGCGTGTGCATGTAATCACTAGTG EcAPO2_3ACCAAACCTCCTCTAGCCCGGGCCTCGATGGCCGCCTCCCCGCCGCGCAGCCATCACCGGGACGACGACTTCCCTCGCTGCCTCAAGCGTCGAGCGTCCC CGTTCCACTCGTCCGACTCCGAGATTGACCACCGCCGCAGATCGAGGGCC TTCGCGCCGGTCGCCAACAGCCGCCGCAGATCTAGGGCCTCCCCGTCCGT CCCCAACCGCCGCCGTGGCCGCGACCCTGAGGGCTGTTCCATGCTCAGCG GGTATGCCAGCGACCCTTCCCGGCGCTTTAGGGTCCCCGACAGGGAGGAG GATGGGGACCTCAGGCGGAGGCGTGCTAGGGTTGACAAACAGAGGGAGGA TGGTCGCCGGCTGATGCGCTCCAGGAGTCCTGAGAAGAGGGAGCCGTTGT CACTGCTGCCGTATAACTCTGGGCGTACTGGTGGGAACTACTCCTCATCT TTCCGCAAGCTTCAGATAAGGCTGAAGCTGGAGGACAAGGCAAGCCCGGA GTACCAGCGGGTTAGCTGGGATGCACTCGAGAAGCGCATCAATGGGTTAA CTAACAAGGTGAATGTGACAAATATTAAGGATATTGCGCGGGAGCTCTTT GCTCAGAACCTTGTTCGTGGGCGTGGGCTATTCTGCCAATCGTGCATCAA GTCACAGGCAGCCTCACCTGGATTGACTGATGTGTTAACTGCACTTGTTG CGGTTGTGAACGCCAAATTCCCGGAGATTGGGCGGTTGCTTCTTGTTCGA GTTGTGCTCCAGCTCAAGAGAGCTTATCAGGGAAAGGACATGGCCCAGCT TCCCTCGCTAACTAAGTTTGTAGCACACTTGGTTAATCAGGCCGTGGTCC ATGAGCTTCTAGCGAGGCAGCTTCTTACTGTACTTCTTGAGAAACCAACT GATGATAGTGTTGAGCTTGCAGTAGAATTTGTCAAAGAATGTGGGGCAAT TCTGCAACGCTCATCTCCTCAAGGACTTCATGCTATTTTTGAAAGATTTG AAGTCGTACGTCATGAAGTGAGATTAGGCAAGCGTTCGCAGTTTCTTATT GAAGGTCTTTTTGTGATCAGAAAAGCTAATTTTGAGGGATTTCCAACCAT CCGCCCAGAGTTAGGTCTTGTGGAGCAGGGCAGCCAGTTTACTCATGAGA TATCCCTTGAAGACATGCTAGAACCTGAGATCAATCTAGATGTTTTCAGT GCAAACCCAAATTTCATTGAAGATGAGAAGGCTTATGAGAACCTAATGAG AAGCATTCCGGGACCAGAATCTCGTGAGGATGATGGAGAATCTGATAAAG AGCAGATGGATATGAGGGATCTTATTAATCTTAGAAGGACCATGTATTTG ACTATTATATCCAGTGTTCATTTTGAAGAAGCTGGTCTTATGAAAATTGA TGTGAATCCTGGTCAAGAGATGGACCTATGCCTTATGATTCTTGAGTGTT GCTGTCAAGAGAAAACCTACCTACATAGTTATGGGCTGTTAGCACAAAGC ATCGTCTCGATATTTCATAAAAGTTCTATTTCAGGAACTATCAGAGCATC TTGGCATAGGCCAACTTAATGAGAGATTGAAAGTTCTAAATATGCAAGGC TCATTTGAGGTCATCCTTCCGAAGGATCATCCAAAAAAACTTGAGGATCT CCAGTAAATTCTTCACAGCCATCAGTCTTGGGGGTATCAAAGAGAGTATG GGTGGGGACGTGCCACTCCTTGTAATGCGGCAGCACAAGCCTGCATCATC TGGGTTCAAGACTGGTTCGAAAGCTTTTGGCTCAGGATCTCGTGAGTTCT GAGTGAGAAGAACACCAACTGTGGTTACTGGGGGTTGCATTGGCACCTCC GGTTTTGGTCAGAAAAGTTAGACCATCCTGTATTGCGTGTGCATGT EcAPO2_4 ATGCACACCAAACCTCCTCTAGCCCGGGCCTCGATGGCCGCCTCCCCGCC GCGCAGCCATCACCGGGACGACGACTTTCCTCGCTGCCTCAAGCTTTGCG CGTCCCCCTTCCACTCGTCCGACTCCGAGATTGACCACCGCCGCAGATCG AGGGCCTTCGCGCCGGTCGCCAACAGCCGCCGCAGATCTAGGGCCTCCCC GTCCGTCCCCAACCGCCGCCGTGGCCGCGACCCTGAGGGCTGTTCCATGC TCAGCGGGTATGCCAGCGACCCTTCCCGGCGCTTTAGGGTCCCCGACAGG GAGGAGGATGGGGACCTCAGGCGGAGGCGTGCTAGGGTTGACAAACTGAG GGAGGATGGTCGCCGGCTGATGCGCTCCAGGCCTCCGGATGATGAGAGGG ATCACCCAAGCGGCAAGCACTACCGGGATAGCGACGGCCGCCGCCGTCGC TGGAGCCCCTTGTTGGATGCGGGACCATGCCTGGACCGCTGCCACAGCCG CCAGCCCACCAGTGATGAGATTTGGAGGAGGTGGGATGACCGCAGGAACA GGGGAGATGACCGTGATGAGCGCGGAAGGAGTCCTGAGAAGAGGGAGCCG TTGTCACTGCTGCCGTATAACTCTGGGTGTACTGGTGGGAACTACACCTC ATCTTTCCGCAAGCTTCAGATAAGGCTGAAGCTGGAGGACAAGGCAAGCC CGGAGTACCAGCGGGTTAGCTGGGATGCACTCGAGAAGCGCATCAATGGG TTAACTAACAAGGTGAATGTGACAAATATTAAGGATATTGCGCGGGAGCT CTTTGCTCAGAACCTTGTTCGTGGGCGTGGGCTATTCTGCCAATCGTGCA TCAAGTCACAGGCAGCCTCACCTGGATTGACTGATGTGTTTACTGCACTT GTTGCGGTTGTGAACGCCAAATTCCCGGAGATTGGGCGGTTGCTTCTTGT TCGAGTTGTGCTCCAGCTCAAGAGAGCTTATCAGGGAAAGGACATGGCCC AGCTTCCCTCGTTAACTAAGTTTGTAGCACACTTGGTTAATCAGACCGTG GTCCATGAGCTTCTAGCGAGGCAGCTTCTTACTGTACTTCTTGAGAAACC AACTGATGATAGTGTTGAGCTTGCAGTAGCATTTGTCAAAGAATGTGGGG CAATTCTGCAACGCTCATCTCCTCAAGGACTTCATGCTATTTTTGAAAGA TTTAAAGTCATACGTCATGAAGTGAAATTAGGCAAGCGTGTGCAGTTTCT TATTGAAGGCCTTTTTGCGATCAGAAAAGCTAATTTTGAGGGGTTTCCAA CCATCCGCCCAGAGTTAGATCTTGTGGAGCAGGGCAGCCAGTTTACTCAT GAGATATCCCTTGAAGACATGCTAGAACCTGAGATCAATCTAGATGTTTT CAGTGCAAACCCAAATTTCATTGAAGATGAGAAGGCTTATGAGAACCTAA TGAGAAGCATTCCGGGACCTGAATCTCGTGAGGATGATGGAGAATCTGAT AAAGAGCAGATGGATATGAGGGATCTTATTAATCTTAGAAGGACCATGTA TTTGACTATTATATCCAGTGTTCATTTTGAAGAAGCTGGTCTTATGAAAA TTGATGTGAAGCCTGGTCAAGAGATGGACCTATGCCTTATGATTCTTGAG TGTTGCTGTCAAGAGAAAACCTACCTACATAGTTATGGGCTGTTAGCACA AAGGTATTGCATGATGAACAGAGCGTACCAAGAGAACTTCAAGAAATGTT TTGTTCAACAATATTCAACAGTTCATTGTCACGAGACATATAAGTTGAGT AATGTTGCCAAGTTTTTTGCACATCTGTTTGTGACTGATACACTCCCATG GCATGTTTTGGGATGCATGCGTTTGACAAACGATGGTTTGACAGCATCGT CTCGATATTTTATAAAAGTTCTATTTCAGGAACTATCAGAGCATCTTGGC ATAGGCCAACTTAATGAGAGATTGAAAGATCTAAATATGCAAGGCTCATT TGAGGTCATCCTTCCGAAGGATCATCCAAAAAACTTGAGGATCTCCAGTA AATTCTTCACAGCCATCAGTCTTGGGGGTATCGAAGAGAGTATGGGTGGG GACGTGCCACTCCTTGTAATGCGGCAGCACAAGCCTGCATCATCTGTGTT CAAGACTGGTTCGAAAGCTTTTGGCTTAGGATCTCGTGAGTTCTGA EcAPO3ATGCGCCTGCCCTCCGGGTCTCCAAGGTGCCCTGCCTCCGGCCGCCACCTCCCGAATCGATCCATCGGTTCCGGCTTTCGTTTCGCTGAAGTAATTATGC GTCATATTGTCACCTGTGAGCTTGTCAAAGAAGGCATTTTCTTTCGTCTA TCCTTGCTTCTGCACTTGTTTATCTATCAATATCGCGTGATGCCTAATGA TTACTCTAGTTCACCTGTTCAGTTCAACATCGCTTACATGGCTGCAAGAA AGGGTAAACCTGTGCTTATGGCTTGCCAACCACCTTCTGGTCAAATCGTA CGGTCACAAGATGCTGCAAATCGTGCAACTTCAGCGGCGGCTCCTTCTGA ATCACTTCCAGTGAATACTGGCCTAAGGCAGACGGCGAAAGGTAAGACAA AACGAAGGGCTGTGAATGAGAACGCTAGTGCAACAAATGCTGCAACTTCA GCCCCTCAGCCTAAACGGCGCACGGTTCTAAAGGATGTAACCAACTTATG CTATATTAACGCATCCCAAAATTGCACTTCACTAACAAAGTCACAGTTGA GGCCCACCCAAAAGGTTCGACGATCTCTCAGAAAATACGAACAGTGTGCA AAGAAGCTCCCCAAGCCACTTGGTCCTGCTAGTGGAAGTTCATTTATCAA TGACTCCATAAGTGCCAACGAAACACAAAAGGCAGACCTTATGACACAGA AAAAGAATTCCACTATTCTGCTTGGAAAAAAGGTGCCTCCATCTTTACAA AACATTGAACGAAACAGGGACAGTGCTTGTCATGAAGCAATCATTGAGGC AAGAACTGCCAGGGATCAATCCAAACCTGCTAACTCAAAGTCTGGTGATT CTGGTGGTTCAGATATTGTAGATATTGACAAAGACAATGGCAAGCCTCAA ATGTGTGTTTCCTATGTTGCAGAGATATACAGAAATCTAATGGCCTCTGA GGTTATAAGAAGACCTAGATCAAATTATATGGAGGCTTTGCAGCACGACA TCACAAAGGACATGAGAGGCATCCTTATTGATTGGATTGTTGCGGTTTCT GACGAATTTAAGCTCGTGCCAGATACACTTCATCTCACTATAATTCTTAT TGATCGGTTTCTGTCTCAAAAAACTATCCATAGACAGAAATTACAACTTC TTGGGGCAACAAGCATGCTCATTGCCTCAAAATATGAAGAGATATGTGCT CCTACTGTTGATCAATTTTGTTACATGACTGACAATGCATACACAAAGGC TGAGGTGCTGGAAATGGAGTGCCAAGTGCCTAATGTTCTAGGATTCCATT TATCCACTCCAACACCAAAAACATTTGTCAGGAGATTCCTCCGAGCGGCA CAGGCTACTTCTAATGCCCATAATACAACTTTGATTCATTTGGCGAACTA TCTTGTGGAGGTGACTTTGAGTGATTATAGTTTCCTAAAATTTCTACCTT CAGTGGTGTCAGCATCCGCAGTCTTTCTTGCAAGATGGACACTGAACCAG TTTGACGGTCCATGGAACTCAACTCTTGAGCACTACACCCCTTACAAGAG CTCTGATCTTCGGATTTGTGTGTGCGTCTTATGGGAACTTCAGCATAATA TGGGTAACTGCAACCTCAAAACCATACGTGAAAAGTATATGCAACCAAAG TATGAGGGTGTGGCTTACCTGAAATCGCCGCAGCTACCGGAGTCCATCTT CAATTGA EcAPO4ATGGACAAGCTCACCGACGACCTCCTCGTCGAGATCCTCTCGCGCGTGCCGTACAGGTCCCTCCGCCGCTTCACCTGCGTCTCCAGGCACTGGCGCGCCC TCATCGCCCACCCCGACCACCGCCGGAGGCTGCCCCAGACCCTCACCGGC TTCTTCCACCACGCCCCGACTCGCCGCTTCATCAACGTGTCCGGGACCGG GCCCCCGCTCGTCGACCCCTCACTCGCGTTCCTGCCGGACCGGGAGCGCG AGGGCCTCGATCTGCTGGACTGCTGCAACGGCCTCCTCCTCTGCCGCTGC TTCAGGTTCGCCGACCCCAACGAGTTCGATTACCTCGTCGTCAACCCCGC CGCGGAGAAGTGGGTCGCCGTGCCGGCCTCGCGGCGGCACGCGTGGGTTT CCAACAAGGTGGAGACGGCGCGCCTGGGCTTCGACCCGGCCGTCTCCTCG CGCTTCCATGTCTTCGAGTTTCAGCTGCATTGGGTCGAGGATGTGAGTGG CTACGCGAACGAGAATGTCTTAGCCGTGGCGATCTACTCATCCGAGAAAG GAGCTTGGAGCCATTTTCAGCCTGGCTGGAGGTTCACGCTTACCGTGACA AATGATTTTAGGAGCGTCTTTGTCAATGGCATGCTCTATGTGACCACAAC CGAGTGCGTGATCGGGGCGGTGGGTGTTGATGGGAAGACTTGGAGGATCA TCAATTCCCCAAAATGTAAGGACTCATCTTTCCTTGCCACAGCTGCTGGG TTCATTGGCCTGTCCCAGGGGCAGTTGCATTTTGCAGCCACTGATGATAT CGTCTGCAAAAAACTAGCAATCTGGGTATTTGAGGACCGGAACCGTGGAA AATGGACTCTAAAGCACACGGTCAGCTTTGAGCACCTGGTCAGAAGGAAG CATGTCTCATTTGGATTTTATGAATTTATTATTGTTGCTATCCACCCAGA CCGCAATATGGTGTTCTTCGTATTTGGTCATGACAAGACACTAATGTCTT ATGACATGGATAGTGGGAAGGTGAGTATCATTCGCAATCTTGGAAGCAAT TGCAGTGAATATTATTGTATCCCGTATGTTCCCTTGTTTTCTTAG EcAPO5ATGGGTGAGCTTAGGGTCGTTTTGGAGACGCGACCTGGTGTCCACCGAGTTGCGGCAGTCTCGGTGGAGCCACGAGATTCCCTCCTCATGTACGATAGTC TGCGCACTCTCTCGACGGCGTACGGATGGGGGATTGAGGACATCCGTCGC GTCGGCGACCTCTCTTTGCTTGACCGGTGCTTGTCGTCACTCCACACGGT GCTCTCCGTGCCAGACAACCACGAAAACACCAGAGCTATCCCCCTTCTGC ACCAGCATGCCGTTCAGATCAGATCGCTGGGCCGCAGAGTCGGCGGCTCC ATCCGTGTGCCGATGGAGACTCTGCATGATCGTTTGTTGCATATTGTGGT TCCTATCGAGCCACATAATCCAGAAGAAGGCCCTGACCCTGCCCAAGTGG AGATTGGAAGTTTGTTGTTCGATGTGAATGAGTTAAGATCGGCTACAGTT GTCTTCGGGGAGCCGGAACCGGAGCTACCTGCACTTTCATTTGACATCGC CCAGTAG EcAPO1_F1TCCCTCAACCCTACCGATAAEcAPO1_R1AACACCCGTAAGAGCGAATCEcAPO1_F2TGCTTCGCTCGATGAACTTAEcAPO1_R2GCACGGATGTTGCTGATTGEcAPO1_F3GCGTCTGTGTCGTCTCTTACEcAPO1_R3TTGATCTCGCAGGGTGTTGEcAPO2_F1CTCACCTGGATTGACTGATGEcAPO2_R1CCTGCTCCACAAGATCTAACEcAPO2_F2GCGTGTGCAGTTTCTTATTGEcAPO2_R2GCCAAGATGCTCTGATAGTTEcAPO2_F3GTCACTGCTGCCGTATAACEcAPO2_R3ACTGCAAGCTCAACACTATCEcAPO2_F4ATGGGCTGTTAGCACAAAGGEcAPO2_R4TCGAGACGATGCTGTCAAACEcAPO2_R5ACATGCACACGCAATACAEcAPO2_F6ACCAAACCTCCTCTAGCCEcAPO2_R6TCCAGCTTCAGCCTTATCTEcAPO2_Fa_1GCAATTCTGCAACGCTCATC EcAPO2_Fa_R3GATAGTGTTGAGCTTGCAGTEcAPO2_F5GGCATAGGCCAACTTAATGAEcAPO2_Ra_1GCACACGCTTGCCTAATTTCEcAPO2_Fb_1CAAGCGTGTGCAGTTTCTTATTEcAPO2_Fb_2GAAATTAGGCAAGCGTGTGCEcAPO2_Rb_3CTTGACCAGGATTCACATCAATTTEcAPO2_Rb_5GTCCATCTCTTGACCAGGATTCEcAPO2_Fc_1CTGAATCTCGTGAGGATGATGGEcAPO2_Fc_3CGTGAGGATGATGGAGAATCTGEcAPO2_Rc_1ACATGCCATGGGAGTGTATCEcAPO2_Rc_3TCGAGACGATGCTGTCAAACEcAPO2_66F_BACCGGGACGACGACTTTCEcAPO2_66R_BTTGGGTGATCCCTCTCATCATCEcAPO3_F1CAGGTAAGCCACACCTTCATACEcAPO3_R1CGGCACAGGCTACTTCTAATGEcAPO3_F2TCAAAGTCACCTCCACAAGATAGEcAPO3_R2GGACATGAGAGGCATCCTTATTEcAPO3_F3ACCGCAACAATCCAATCAATAAGEcAPO3_R3CGAAGGGCTGTGAATGAGAAEcAPO4_F1GTTCGATTACCTCGTCGTCAAEcAPO4_R1CTCCAAGTCTTCCCATCAACAEcAPO4_F2CTACGCGAACGAGAATGTCTTAEcAPO4_R2TTGATGATCCTCCAAGTCTTCCEcAPO4_F3ACTCGCCGCTTCATCAACEcAPO4_R3AATGGCTCCAAGCTCCTTTCEcAPO5_F1GGTGTTTTCGTGGTTGTCTGEcAPO5_R1CCTCATGTACGATAGTCTGCGEcAPO1-sp6AAAGGGATTTAGGTGACACTATAGAAGCGTCTGTGTCGTCTCTTACEcAPO1-t7AAAGGGTAATACGACTCACTATAGGGGCACGGATGTTGCTGATTGEcAPO2_1-Sp6AAAGGGATTTAGGTGACACTATAGAACAAGCGTGTGCAGTTTCTTATTEcAPO2_1-t7AAAGGGTAATACGACTCACTATAGGGCCCTGCTCCACAAGATCTAACEcAPO2_2-Sp6AAAGGGTAATACGACTCACTATAGGGCCCTGCTCCACAAGATCTAACEcAPO2_2-t7AAAGGGTAATACGACTCACTATAGGGCACCTCCTCCAAATCTCATCACEcAPO2_3-Sp6AAAGGGATTTAGGTGACACTATAGAAATGGGCTGTTAGCACAAAGGEcAPO2_3-t7AAAGGGTAATACGACTCACTATAGGGTCTCGTGACAATGAACTGTTGAATAEcAPO4-sp6AAAGGGATTTAGGTGACACTATAGAAACTCATCTTTCCTTGCCACAGEcAPO4-t7AAAGGGTAATACGACTCACTATAGGGAGAGTCCATTTTCCACGGTTCpSPLplusFw1GCTCGTCTCTCTCGGGAGTGCTTTCGpSPLplusRv1GCTCGTCTCTAGTCAAGTGACGTTGAAAAAAATGCpSPLplusFw2CGTCGTCTCTGACTTACACCCACTAATATTGACpSPLplusRv2GCTCGTCTCTCTCAATGGTGATGATGATCTTCpKNUplusFwGCTCGTCTCTCTCGGGAGTTGTGTGTGpKNUplusRvGCTCGTCTCGCTCAATGGGAGAGGTTCTTAAGCpWUSplusFwGCTCGTCTCGCTCGGGAGAGTTTGGTGACpWUSplusRvGCTCGTCTCTCTCAATGGGTGTGTTTGATTCpSTKplusFwGCTCGTCTCACTCGGGAGCCAACGApSTKplusRvGCTCGTCTCGCTCAATGGTCTGGAGAGACHP1.GB2.FwGCTCGTCTCTCTCGCCATCGTAACCCTAGTCCCAAGHP1.GB2.RvGCTCGTCTCTCTCAAAGCAGCCTGACAAGCACAGATHP2.GB2_FwGCTCGTCTCTCTCGCCATCGCCCTCTTCTCTCCATGHP2.GB2_RvGCTCGTCTCTCTCAAAGCACGCATACAGAACGCTACSPs.GB2.FwGCTCCGTCTCCCTCGCCATACCAAACCTCCTCTAGCCSPs.GB2.RvGCTACGTCTCTCTCAAAGCTCAGAACTCACGAGATCCT ECAPO4.GB2.FwGCTCGTCTCTCTCGCCATTCGATTTCAGGCTTACATGGECAPO4.GB2.RvGCTCGTCTCTCTCAAAGCGGTATCATCATCAGCTCGTECAPO3.GB2.Fw1GCTCGTCTCTCTCGCCATGATGGACAAGCTCACCGECAPO3.GB2.Fw2GCTCGTCTCCACCTGTGTCTCCAGGCACTGECAPO3.GB2.Rv1GCTCGTCTCCAGGTAAAGCGTCGGAGGGACCTECAPO3.GB2.Fw3GCTCGTCTCAAGCAAGACTTGGTTTCGACCCTGCTGTCTCCTCTCGCTTCCATGECAPO3.GB2.Rv2GCTCGTCTCTTGCTGTCTCCACTTTGTTGGAAACCCACGECAPO3.GB2.Rv3GCTCGTCTCTCTCAAAGCCGTGCTGTGCTATUA4 qFwAACCTACACCAACCTCAACCTUA4 qRvGTGGATTCTTGGGTATGGGACEF1α qFwGGAGGTTTTGAGGCTGGTATCEF1α qRvCCTAGCCTTGGAGTATTTGGGMET1 qFwTGAACAGCACAGAATCCTTACAMET1 qRvCTGCCTGTGCTTGTGATTTATGDRM1 qFwCAGCACAACTGATCGCTACADRM1 qRvGAAGAGTGACAGGACGTTGATTCMT3 qFwCCCACAACCAGGTGATCATTCMT3 qRvTGGGCCAAAGAGTTTGTAGTCARF5 qFwAGAGTGATGTTCTGCTTGTAGGARF5 qRvGCTTCATCCCTTCTTCACTCASPL qFwGAGGAGCCAAGGTTTCCTTTATSPL qRvCTCCATTGGTCCCGTATGATTTWUS qFwCCCTATGCACGGTGAAGATWUS qRvTTCAGACGTAGCTCAAGAGAAGDME qFwGAGTCCAGTCTCAAACCCATCDME qRvCTCCGTTGAAAGACCTCTGAATADRM2 qFwAGCCAGATGAGATGGAGAGTADRM2 qRvCGCCACAGTATCAACCTGAACMT2 qFwCTTTGGTACCAGGATACGTCTTTCMT2 qRvTGGCATGTTGGGACTGTTAGKYP qFwGTTCAGTGCGTCCTGAGTTKYP qRvGCGCATATCCATAGTCGTAAGTEcAPO_1 qFwCTTCGCTCGATGAACTTAGGAGEcAPO_1 qRvCAGCCTTCGACTTTCCACCEcAPO_2 qFwCCTCACCTGGATTGACTGATGEcAPO_2 qRwGTCCTTTCCCTGATAAGCTCTCEcAPO_3 qFwTCAGCATCCGCAGTCTTTCEcAPO_3 qRwCCATAAGACGCACACACAAATCEcAPO_4 qFwGCGATCTACTCATCCGAGAAAGEcAPO_4 qRwCCATTGACAAAGACGCTCCTAEcAPO2 common region GGGCCTCGATGGCCGCCTCCCCGCCGCGCAGCCATCACCGGGACGACGA 1 CTTYCCTCGCTGCCTCAAGCKTYGMGCGTCCCCSTTCCACTCGTCCGACTC CGAGATTGACCACCGCCGCAGATCGAGGGCCTTCGCGCCGGTCGCCAACA GCCGCCGCAGATCTAGGGCCTCCCCGTCCGTCCCCAACCGCCGCCGTGGC CGCGACCCTGAGGGCTGTTCCATGCTCAGCGGGTATGCCAGCGACCCTTC CCGGCGCTTTAGGGTCCCCGACAGGGAGGAGGATGGGGACCTCAGGCGG AGGCGTGCTAGGGTTGACAAACWGAGGGAGGATGGTCGCCGGCTGATGC GCTCCAG (K represents T or G; Y represents T or C; W represents A or T; M represents C or A; and S represents C or G) EcAPO2 common region GAGTCCTGAGAAGAGGGAGCCGTTGTCACTGCTGCCGTATAACTCTGGGY 2 GTACTGGTGGGAACTACWCCTCATCTTTCCGCAAGCTTCAGATAAGGCTGA AGCTGGAGGACAAGGCAAGCCCGGAGTACCAGCGGGTTAGCTGGGATGC ACTCGAGAAGCGCATCAATGGGTTAACTAACAAGGTGAATGTGACAAATATT AAGGATATTGCGCGGGAGCTCTTTGCTCAGAACCTTGTTCGTGGGCGTGG GCTATTCTGCCAATCGTGCATCAAGTCACAGGCAGCCTCACCTGGATTGAC TGATGTGTTWACTGCACTTGTTGCGGTTGTGAACGCCAAATTCCCGGAGAT TGGGCGGTTGCTTCTTGTTCGAGTTGTGCTCCAGCTCAAGAGAGCTTATCA GGGAAAGGACATGGCCCAGCTTCCCTCGYTAACTAAGTTTGTAGCACACTT GGTTAATCAGRCCGTGGTCCATGAGCTTCTAGCGAGGCAGCTTCTTACTGT ACTTCTTGAGAAACCAACTGATGATAGTGTTGAGCTTGCAGTAGMATTTGTC AAAGAATGTGGGGCAATTCTGCAACGCTCATCTCCTCAAGGACTTCATGCT ATTTTTGAAAGATTTRAAGTCRTACGTCATGAAGTGARATTAGGCAAGCGTK YGCAGTTTCTTATTGAAGGYCTTTTTGYGATCAGAAAAGCTAATTTTGAGGG RTTTCCAACCATCCGCCCAGAGTTAGRTCTTGTGGAGCAGGGCAGCCAGT TTACTCATGAGATATCCCTTGAAGACATGCTAGAACCTGAGATCAATCTAGA TGTTTTCAGTGCAAACCCAAATTTCATTGAAGATGAGAAGGCTTATGAGAAC CTAATGAGAAGCATTCCGGGACCWGAATCTCGTGAGGATGATGGAGAATCT GATAAAGAGCAGATGGATATGAGGGATCTTATTAATCTTAGAAGGACCATGTA TTTGACTATTATATCCAGTGTTCATTTTGAAGAAGCTGGTCTTATGAAAATTGA TGTGAAKCCTGGTCAAGAGATGGACCTATGCCTTATGATTCTTGAGTGTTGC TGTCAAGAGAAAACCTACCTACATAGTTATGGGCTGTTAGCACAAA (K represents T or G; R represents G or A; Y represents T or C; W represents A or T; and M represents C or A) EcAPO2 common region GCATCGTCTCGATATTTYATAAAAGTTCTATTTCAGGAACTATCAGAGCATCT 3 TGGCATAGGCCAACTTAATGAGAGATTGAAAGWTCTAAATATGCAAGGCTCA TTTGAGGTCATCCTTCCGAAGGATCATCCAAAAAAACTTGAGGATCTCCAGT AAATTCTTCACAGCCATCAGTCTTGGGGGTATCRAAGAGAGTATGGGTGGG GACGTGCCACTCCTTGTAATGCGGCAGCACAAGCCTGCATCATCTGKGTTC AAGACTGGTTCGAAAGCTTTTGGCTYAGGATCTCGTGAGTTCTGA (K represents T or G; R represents G or A; Y represents T or C; and W represents A or T)
Claims
CLAIMS 1) A nucleic acid construct comprising a coding sequence for an apomictic trait, wherein said coding sequence is extracted from Eragrostis curvula. 2) The nucleic acid construct according to claim 1, wherein the coding sequence comprises a polynucleotide sequence that can be amplified by any two primers selected from SEQ ID NO: 9-53. 3) The nucleic acid construct according to claim 1, wherein the coding sequence comprises a polynucleotide sequence of any one of SEQ ID NO: 1-8. 4) The nucleic acid construct according to claim 1, wherein the coding sequence for an apomictic trait comprises at least one nucleotide sequence selected from SEQ ID NO: 120-122. 5) The nucleic acid construct according to claim 4, wherein the coding sequence for an apomictic trait comprises all three nucleotide sequences as set forth in SEQ ID NO: 120-122. 6) The nucleic acid construct of any one of claims 1-5, wherein said nucleic acid construct enables the expression of an apomictic trait in a plant that does not naturally express apomictic traits. 7) The nucleic acid construct of claim 6, wherein the plant is selected from the genus Arabidopsis, Hordeum, Oryza, Zea or Triticum. 8) A method for transforming a non-apomictic plant or plant cell into an apomictic plant or plant cell, comprising introducing a nucleic acid construct of any one of claims 1-7 into said non-apomictic plant or plant cell. 9) The method of claim 8, wherein the method comprises using an Agrobacterium- mediated transformation. 10) The method of claim 8 or 9, wherein the method comprises transforming a plant selected from the genus Arabidopsis, Hordeum, Oryza, Zea or Triticum. 11) The method of any one of claims 8-10, wherein the method further comprises a step of confirmation of the transformation of a plant or plant cell. 12) A method for obtaining a transgenic, apomictic plant comprising the steps of: a) providing a non-apomictic plant or plant cell of interest, b) transforming the plant or plant cell of the step (i) with a nucleic acid construct according to any one of claims 1-7, and c) growing the transformed plant or plant cell. 13) The method of claim 12, wherein the transformation of step b) is done by applying any one of the methods of claims 8-11.14) The method of any one of claims 12-13, wherein the plant or plant cell of step a) is selected from the genus Arabidopsis, Hordeum, Oryza, Zea or Triticum. 15) The method of any one of claims 12-14, wherein the method comprises constructing a nucleic acid construct of any one of claims 1-7 by cloning a coding sequence extracted from Eragrostis curvula for an apomictic trait in a vector or expression cassette, prior to the transformation of the plant. 16) The method of any one of claims 12-15, wherein the method comprises a step of confirmation of the transformation of a plant or plant cell, before or after the step (iii). 17) A transgenic plant or plant cell that comprises a nucleic acid construct according to any one of claims 1-7. 18) The transgenic plant or plant cell of claim 17, wherein said transgenic plant or plant cell is obtained by a method of any one of claims of 8-11. 19) The transgenic plant of claim 17, wherein said transgenic plant is obtained by a method of any one of claims of 12-16.
Citation Information
Patent Citations
Construction method and application of apomixis MhSERK4 gene plant expression vector of Malus hupenensis Rehd
CN103849635A
Nucleic acid molecule, vector, cell, application of nucleic acid molecule, vector and cell, and screening method of plant apomixis clone seeds based on paternal imprinting gene
CN112779283A
Method for improving apomixis efficiency of plants
CN118374537A
Method to Screen Plants for Genetic Elements Inducing Parthenogenesis in Plants
US20130180005A1
Modified promoter of a parthenogenesis gene
US20230383308A1