Method for producing virus-like particles of cowpea mosaic virus and use thereof

Abstract

The present invention relates to a method for producing virus-like particles (VLPs) of Cowpea mosaic virus (CPMV) and a use thereof. The CPMV VLPs produced using the method were found to collect target RNA and thus have the effect of allowing RNA to be safely maintained for a long period of time even when stored in a refrigerator. Accordingly, the excellent RNA preservation properties are expected to be positively applied to mRNA vaccine development research.

Description

Method for producing virus-like particles of black-eyed pea mosaic virus and their use

[0001] This patent application claims priority to Republic of Korea Patent Application No. 10-2023-0169336, filed with the Korean Intellectual Property Office on November 29, 2023, the disclosure of which is incorporated herein by reference.

[0002] The present invention was made under the support of the Ministry of Science and ICT under the project identification number 1465038506 and project number HV22C0159000023. The research management specialized institution of the project is the Korea Health Industry Development Institute, the research project name is "Clinical support for mRNA vaccines responding to new variant infectious diseases", the research project name is "Development of production technology for mRNA vaccines responding to Zika virus", the main institution is Sogang University Industry-Academic Cooperation Foundation, and the research period is 2023.01.01 ~ 2023.12.31.

[0003] The present invention relates to a method for producing virus-like particles (VLPs) of cowpea mosaic virus (CPMV) using a plant and to the use thereof, and more particularly, to a technology for producing CPMV VLPs using a plant and capturing and long-term refrigerated storage of target RNA using the same.

[0004] Recently, there has been a rise in global pandemics, including outbreaks of new, high-risk infectious diseases with high mortality rates. One of the most notable examples is the Zika virus (ZIKV), which was first identified in 1947 in rhesus macaques in the Zika Forest in Uganda and thus received its name. It is known to be transmitted by the Aedes aegypti or Aedes albopitus mosquitoes.

[0005] Zika virus belongs to the Flavivirus family, along with dengue virus, chikungunya virus, and Japanese encephalitis virus, and possesses a single-stranded, positive-stranded RNA genome. The Zika virus RNA genome encodes structural proteins, including capsid, envelope (E), and membrane (M) proteins, as well as nonstructural proteins, including proteases and replication machinery. The virus is protected from the external environment by expressed envelope and membrane proteins. These envelope and membrane proteins play a crucial role in binding to and uptake by human cells, and its precursor membrane-envelope (prME) is a key target for vaccine development.

[0006] Currently, attenuated and inactivated vaccines are primarily used to prevent Zika virus infection. However, traditional attenuated live or inactivated vaccines require the cultivation of newly discovered pathogens, requiring a culturing process for potentially dangerous new pathogens. Furthermore, imperfect attenuation poses the risk of secondary infections. Therefore, to overcome these side effects and concerns, research into mRNA vaccines is actively underway worldwide.

[0007] mRNA-based vaccines are primarily composed of mRNA encoding antigen proteins, which is synthesized in vitro and then encapsulated in lipid nanoparticles (LNPs), which act as cellular delivery vehicles. This method allows for rapid vaccine production, facilitating rapid vaccine development against emerging pathogens such as the COVID-19 virus (Severe acute respiratory syndrome coronavirus 2; SARS-CoV-2), and is suitable for responding to pathogens with rapid mutation rates. Despite the advantages of mRNA vaccines, such as productivity and rapidity, the structural instability of RNA and its vulnerability to RNases during mRNA development pose challenges during development and storage. While cryogenic storage conditions are used to minimize these issues, this can lead to challenges such as difficulties in vaccine distribution, increased costs, and uncertainty about the maintenance of efficacy.

[0008] Meanwhile, virus-like particles (VLPs) are nanoparticles composed of viral structural proteins that resemble the structure of a virus but primarily lack the genetic material that allows them to infect the host. Recent research has been developing methods to utilize these VLPs, or lipid nanoparticles (LNPs), to encapsulate target RNA, serving as cellular delivery vehicles or protecting it from the external environment. As understanding of the RNA packaging of cowpea mosaic virus (CPMV) has increased, it has been confirmed that it exhibits a very high level of RNA selectivity. Research is gradually expanding on this process to produce VLPs in plants or encapsulate target RNA. This, in turn, necessitates the development of mRNA vaccines that can be safely maintained for long periods of time, even under refrigeration, to address challenges in vaccine distribution.

[0009] Accordingly, the present inventors sought to develop a method for producing virus-like particles (VLPs) of cowpea mosaic virus (CPMV). As a result, they produced CPMV VLPs using plants and confirmed that they could capture target RNA, enabling long-term, safe preservation of RNA even under refrigeration, thereby completing the present invention.

[0010] Accordingly, the purpose of the present invention is to provide a CPMV 5' UTR comprising a base sequence represented by sequence number 1,

[0011] CPMV 3' UTR consisting of the base sequence represented by sequence number 2, and

[0012] Target RNA sequence inserted between the CPMV 5' UTR and CPMV 3' UTR

[0013] To provide a recombinant vector containing .

[0014] Another object of the present invention is to provide a microorganism transformed with the recombinant vector.

[0015] Another object of the present invention is to provide a transformed plant transformed by the microorganism.

[0016] Another object of the present invention is to provide a method for producing virus-like particles (VLPs), comprising the following steps:

[0017] A recombinant vector production step for producing a recombinant vector comprising a CPMV (Cowpea mosaic virus) 5' UTR consisting of a base sequence represented by sequence number 1, a CPMV 3' UTR consisting of a base sequence represented by sequence number 2, and a target RNA sequence inserted between the CPMV 5' UTR and CPMV 3' UTR;

[0018] An infiltration step of infiltrating a plant with a microorganism transformed with the recombinant vector; and

[0019] A purification step for purifying virus-like particles produced from the above plant.

[0020] The present invention relates to a method for producing virus-like particles (VLPs) of cowpea mosaic virus (CPMV) using a plant and to the use thereof, and CPMV VLPs according to the present invention exhibit excellent effects in long-term refrigerated storage of target RNA.

[0021] The present inventors produced CPMV VLPs that capture target RNA using plants, and confirmed the excellent effect of safely maintaining the captured RNA for a long period of time even when stored in a refrigerator.

[0022] More specifically, in the present invention, for the purpose of safely maintaining RNA even during refrigerated storage by entrapping the target mRNA within CPMV VLPs, RNA encoding prME (Precursor membrane-envelope), a major antigenic substance of Zika virus (ZIKV), was used as the target mRNA. Taking advantage of the characteristic of CPMV that protects the genetic materials RNA-1 and RNA-2 from the external environment by wrapping them inside the virus particle, in the present invention, the ZIKV prME gene was introduced between the CPMV 5' and 3'UTR (untranslated region) of a plant expression vector, and then transformed into Agrobacteria (LBA4404), and co-infiltrated into tobacco leaves together with Agrobacteria carrying the VP60 and RNA-1 genes. The generated VLPs were extracted and purified, and the formation and structure of VLPs were confirmed using a transmission electron microscope (TEM), and RNA was extracted and identified from them, thereby proving that the RNA of the target ZIKV prME exists within the VLPs. In addition, by removing CPMV VLPs that do not contain the target RNA through additional purification, the concentration of target RNA-carrying VLPs could be increased, and the RNA present within the VLPs was confirmed to be stable for at least 3 months under refrigerated conditions. Through these results, the inventors of the present invention revealed that CPMV VLPs can be used for Zika virus mRNA capture and long-term storage.

[0023] Hereinafter, the present invention will be described in more detail.

[0024] One aspect of the present invention comprises a CPMV 5' UTR comprising a base sequence represented by SEQ ID NO: 1,

[0025] CPMV 3' UTR consisting of the base sequence represented by sequence number 2, and

[0026] Target RNA sequence inserted between the CPMV 5' UTR and CPMV 3' UTR

[0027] It is a recombinant vector containing .

[0028] In the present invention, the target RNA sequence may be derived from Zika virus (ZIKV), and the target RNA sequence derived from ZIKV may encode prME (precursor membrane-envelope), but is not limited thereto.

[0029] In the present invention, the target RNA sequence may be composed of a base sequence represented by sequence number 3.

[0030] Another aspect of the present invention is a microorganism transformed with the recombinant vector.

[0031] In the present invention, the microorganism may be a strain of the genus Agrobacterium, but is not limited thereto.

[0032] The above Agrobacterium genus strain may be, but is not limited to, Agrobacterium tumefaciens.

[0033] Another aspect of the present invention is a transgenic plant transformed by the above microorganism.

[0034] In the present invention, the plant may be at least one monocotyledonous or dicotyledonous plant selected from the group consisting of tobacco, Arabidopsis thaliana, corn, lettuce, potato, rice, alfalfa, tomato, soybean, carrot, and safflower.

[0035] Another aspect of the present invention is a virus-like particle produced by the transgenic plant.

[0036] Another aspect of the present invention is a method for producing a virus-like particle, comprising the following steps:

[0037] A recombinant vector production step for producing a recombinant vector comprising a CPMV 5' UTR consisting of a base sequence represented by sequence number 1, a CPMV 3' UTR consisting of a base sequence represented by sequence number 2, and a target RNA sequence inserted between the CPMV 5' UTR and the CPMV 3' UTR;

[0038] An infiltration step of infiltrating a plant with a microorganism transformed with the recombinant vector; and

[0039] A purification step for purifying virus-like particles produced from the above plant.

[0040] In the present invention, the recombinant vector preparation step may be performed by additionally including a gene insertion step of inserting a target RNA gene between the CPMV 5' UTR and CPMV 3' UTR.

[0041] In the present invention, the target RNA sequence may be derived from ZIKV, and the target RNA sequence derived from ZIKV may encode prME, but is not limited thereto.

[0042] In the present invention, the target RNA sequence may be composed of a base sequence represented by sequence number 3.

[0043] In the present invention, the microorganism may be a strain of the genus Agrobacterium, but is not limited thereto.

[0044] The above Agrobacterium strain may be, but is not limited to, Agrobacterium tumefaciens.

[0045] In the present invention, the plant may be at least one monocotyledonous or dicotyledonous plant selected from the group consisting of tobacco, Arabidopsis thaliana, corn, lettuce, potato, rice, alfalfa, tomato, soybean, carrot, and safflower.

[0046] In the present invention, the infiltration step may be to additionally infiltrate a plant with a microorganism transformed with a recombinant vector containing a gene encoding the VP60 protein of CPMV or a microorganism transformed with a recombinant vector containing an RNA-1 gene.

[0047] The term "VP60 protein" in this specification refers to the precursor coat protein of CPMV, which is encoded by the RNA-2 gene and is used as a shell for capsid formation of CPMV.

[0048] The term “RNA-1 gene” in this specification refers to the replication machinery used for CPMV capsid formation.

[0049] In the present invention, the final concentration of a microorganism transformed with a recombinant vector including a gene encoding the Zika virus (ZIKV) prME (precursor membrane-envelope), a microorganism transformed with a recombinant vector including a gene encoding the VP60 protein of CPMV, and a microorganism transformed with a recombinant vector including an RNA-1 gene in the infiltration solution at the infiltration step may have an absorbance of 0.1 to 0.6 at a wavelength of 600 nm.

[0050] The absorbance at the wavelength of 600 nm may preferably be from 0.1 to 0.5, or from 0.1 to 0.4, for example, from 0.1 to 0.3, but is not limited thereto.

[0051] In the present invention, the infiltration step may be performed by mixing and infiltrating a microorganism transformed with a recombinant vector including a gene encoding the Zika virus (ZIKV) prME (precursor membrane-envelope), a microorganism transformed with a recombinant vector including a gene encoding the VP60 protein of CPMV, and a microorganism transformed with a recombinant vector including an RNA-1 gene at a volume ratio of 1:1:1 to 2:1:1.

[0052] The microorganism transformed with a recombinant vector containing a gene encoding the VP60 protein of the CPMV may be mixed at a volume ratio of 0.5 to 1 times that of the microorganism transformed with a recombinant vector containing a gene encoding the ZIKV prME.

[0053] The above volume ratio may be, but is not limited to, a volume ratio of 0.5 to 0.9, 0.5 to 0.8, 0.5 to 0.7, 0.5 to 0.6, 0.6 to 1, 0.6 to 0.9, 0.6 to 0.8, 0.6 to 0.7, 0.7 to 1, 0.7 to 0.9, 0.7 to 0.8 or 0.8 to 1, for example, a volume ratio of 0.8 to 0.9.

[0054] The microorganism transformed with the recombinant vector containing the above RNA-1 gene may be mixed at a volume ratio of 0.5 to 1 times that of the microorganism transformed with the recombinant vector containing the gene encoding the ZIKV prME.

[0055] The above volume ratio may be, but is not limited to, a volume ratio of 0.5 to 0.9, 0.5 to 0.8, 0.5 to 0.7, 0.5 to 0.6, 0.6 to 1, 0.6 to 0.9, 0.6 to 0.8, 0.6 to 0.7, 0.7 to 1, 0.7 to 0.9, 0.7 to 0.8 or 0.8 to 1, for example, a volume ratio of 0.8 to 0.9.

[0056] A microorganism transformed with a recombinant vector containing a gene encoding the ZIKV prME, a microorganism transformed with a recombinant vector containing a gene encoding the VP60 protein of CPMV, and a microorganism transformed with a recombinant vector containing an RNA-1 gene may be mixed and infiltrated, preferably at a volume ratio of 1:1:1.

[0057] In the present invention, the manufacturing method may be performed by additionally including a concentration step of subjecting the virus-like particles obtained in the purification step to cesium chloride gradient ultracentrifugation.

[0058] The present invention relates to a method for producing virus-like particles (VLPs) of cowpea mosaic virus (CPMV) using plants and to the use thereof. CPMV VLPs produced using the method were found to be effective in safely preserving RNA for long periods of time even when stored in a refrigerator by capturing target RNA. Through this, it is expected that the excellent RNA preservation properties can be positively utilized in mRNA vaccine development research.

[0059] FIG. 1 is a diagram showing the structure of an expression vector for encapsulating target RNA in virus-like particles (VLPs) according to one embodiment of the present invention. The abbreviations used in FIG. 1 have the following meanings: RB (Right border of T-DNA), LB (Left border of T-DNA), 35S (CaMV 35S promoter), CPMV 5'UTR (5'UTR of CPMV RNA-2), CPMV 3'UTR (3'UTR of CPMV RNA-2), ZIKA prME (precursor coat protein of Zika virus), nos (terminator of nopalin synthase), P19 (suppressor of silencing).

[0060] Figure 2a is a photograph showing purified VLPs according to one embodiment of the present invention confirmed through SDS-PAGE (Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis).

[0061] Figure 2b is a photograph showing the size of RNA extracted from purified VLPs according to one embodiment of the present invention confirmed through electrophoresis.

[0062] Figure 2c is a photograph showing the results of reverse transcription PCR and identification using RNA extracted from purified VLPs according to one embodiment of the present invention.

[0063] Figure 3a is a graph showing the quantification of the amount of protein contained in each fraction fractionated using cesium chloride concentration gradient ultracentrifugation according to one embodiment of the present invention.

[0064] FIG. 3b is a photograph showing RNA extracted from predicted samples and confirmed through electrophoresis to isolate VLPs carrying target RNA according to one embodiment of the present invention.

[0065] FIG. 4 is a photograph showing the structure of VLPs observed using a transmission electron microscope (TEM) according to one embodiment of the present invention.

[0066] FIG. 5 is an electrophoresis photograph comparing the state of target RNA in refrigerated and frozen VLPs according to one embodiment of the present invention.

[0067] The present invention relates to a recombinant vector comprising a CPMV (Cowpea mosaic virus) 5' UTR comprising a base sequence represented by SEQ ID NO: 1; a CPMV 3' UTR comprising a base sequence represented by SEQ ID NO: 2; and a target RNA sequence inserted between the CPMV 5' UTR and CPMV 3' UTR.

[0068] Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are only intended to illustrate the present invention, and the scope of the present invention is not limited by these examples.

[0069] Throughout this specification, "%" used to indicate the concentration of a particular substance is (wt / wt)% for solid / solid, (wt / vol)% for solid / liquid, and (vol / vol)% for liquid / liquid, unless otherwise stated.

[0070]

[0071] Example 1: Construction of an expression vector

[0072] The protein gene encoding the precursor membrane-envelope (prME) of Zika virus (ZIKV), which is the target gene, has the 5'UTR, 3'UTR, and 100 poly A tail of human hemoglobin subunit beta-1 (HBB-1), and was inserted into the pEAQ vector having the 5' and 3'UTR of cowpea mosaic virus (CPMV) RNA-2 to construct the pEAQ-nonHT-ZIKV_prME vector (Fig. 1).

[0073] The pHREAC-VP60 vector and pEAQ-RNA1-Int vector, which express the VP60 protein and RNA-1 machinery of CPMV, respectively, were generously provided by Professor George Lomonosoff of the John Innes Centre, UK. The pHREAC-VP60 vector has the following vector structure in the following order: RB (Right border of T-DNA), 35S (CaMV 35S promoter), 5S0 (synthetic 5'UTR), CPMV VP60 (Precursor capsid Protein VP60), CPMV 3'UTR (3'UTR of CPMV RNA-2), nos (terminator of nopalin synthase), 35S (CaMV 35S promoter), P19 (suppressor of silencing), nos, and LB (Left border of T-DNA). The pEAQ-RNA1-Int vector has the vector structure in the following order: RB, 35S, CPMV 5'UTR (5'UTR of CPMV RNA-2), CPMV RNA-1 (CPMV Viral replication machinery), CPMV 3'UTR, nos, 35S, P19, nos, and LB. Each of these vectors was transformed into Agrobacterium tumefaciens LBA4404 and used in subsequent experiments.

[0074]

[0075] Sequence number name sequence list (5'-> 3') Remarks 1CPMV 5' UTRtattaaaatcttaataggttttgataaaagcgaacgtggggaaacccgaaccaaaccttcttctaaactctctctcatctctcttaaagcaaacttctctcttgtctttcttgcatgagcgatctt caacgttgtcagatcgtgcttcggcaccagtacaatgttttctttcactgaagcgaaatcaaagatctctttgtggacacgtagtgcggcgccattaaataacgtgtacttgtcctattcttgtcggtg tggtcttgggaaaagaaagcttgctggaggctgctgttcagccccatacattacttgttacgattctgctgactttcggcgggtgcaatatctctacttctgcttgacgaggtattgttgcctgtactt ctttcttcttcttcttgctgattggttctataagaaatctagtattttctttgaaacagagttttcccgtggttttcgaacttggagaaagattgttaagcttctgtatattctgcccaaattc2CPMV 3' UTRttaactctggtttcattaaattttctttagtttgaatttactgttattcggtgtgcatttctatgtttggtgagcggttttctgtgctcagagtgtgtttattttatgtaatttaattttcttgtgagctcctgtttagcaggtcgtcccttcagcaaggacacaaaaagattttaattttaatttatt

[0076]

[0077] Example 2: Expression of target protein and formation of VLPs

[0078] For the formation of target VLPs, each Agrobacterium carrying the expression vectors of CPMV VP60, RNA-1 and ZIKV prME, manufactured according to the above Example 1, was cultured in LB (lysogeny broth) liquid medium at 28°C and 200 rpm for about 24 hours, and then the final strain concentration was OD 600 It was diluted in infiltration buffer (10 mM MES, 10 mM MgCl2, pH 5.6, 100 μM acetosyringone) at a volume ratio of 1:1:1 to make it 0.2. Using this, tobacco plants (Nicotiana benthamiana) cultured for about 4 weeks after germination were infiltrated using a needle-less syringe, and cultured for 5 to 7 days in a greenhouse with 16 hours of light and 8 hours of dark conditions repeated under temperature conditions of 23 to 25°C.

[0079] As a control, Agrobacterium carrying CPMV VP60 and RNA-1 was used at a final strain concentration of OD 600 It was diluted in the infiltration buffer at a volume ratio of 1:1 to 0.2 and infiltrated using the same method.

[0080]

[0081] Example 3: Extraction, purification, and analysis of VLPs

[0082] Tobacco leaves cultured for 5 to 7 days after infiltration were harvested and crushed after adding 1 M sodium-phosphate buffer (19.5% 0.2 M NaH2PO4 [w / v], 30.5% 0.2 M Na2HPO4 [w / v] in sterile deionized water, pH 7.0) at a ratio of g / 2 ml. The permeate, which passed through a filter (Miracloth, Merck), was centrifuged at 13,000 g for 20 min, and the supernatant obtained therefrom was added with 5X precipitation buffer (20% (w / v) PEG-6000, 1 M NaCl in sodium-phosphate buffer) to make 1X, and the mixture was stirred at 4°C overnight.

[0083] The next day, the precipitate was obtained by centrifugation again at 13,000g for 20 minutes, and the obtained precipitate was resuspended by stirring for more than 2 hours using 0.1 M sodium-phosphate buffer (20 ul per g of starting sample). The resuspended sample was centrifuged again at 27,000g for 20 minutes to obtain the supernatant, and impurities were removed by passing it through a 0.2um filter. The sample was precipitated again by ultracentrifugation at 118,000g at 4℃ for 2 hours and 30 minutes, and the precipitate was resuspended in 0.1 M sodium-phosphate buffer by stirring overnight, and centrifugation at 16,000g for 20 minutes to obtain the supernatant. This process was repeated twice. The purified VLPs obtained through this were confirmed through SDS-PAGE (Fig. 2a), and the VLPs purified from the sample that induced encapsulation of the target ZIKV prME RNA were designated as the experimental group (Z), and the VLPs expressing only VP60 and RNA-1 were designated as the control group (R).

[0084] To remove host RNA or DNA that may be attached to the exterior of VLPs and to remove nucleic acids within non-fully assembled VLPs, RNA obtained from intact VLPs was analyzed using micrococcal nuclease. 1 mg of each of the control and experimental VLPs was incubated with 6,000 Gel Units (3 μl) of micrococcal nuclease (M0247S, New England Biolabs) at 37°C for 20 minutes, followed by heating at 65°C for 10 minutes or more in the presence of ethylenediaminetetraacetic acid (EDTA). After that, after leaving it on ice for 10 minutes, it was mixed with an equal volume of phenol: chloroform: isoamyl alcohol = 1: 1: 1 solution, vortexed, centrifuged, and the supernatant was collected. This process was repeated three times. After that, an equal volume of pure chloroform was added, vortexed, centrifuged, and the supernatant was collected. The RNA in the aqueous solution was precipitated by leaving it overnight at -20℃ in the presence of 2 M lithium chloride. The precipitated RNA was washed using 500 ul of 70% ethanol stored in a refrigerator, reprecipitated by centrifugation, collected, dried, and resuspended using nuclease-free water. As shown in Fig. 2b, this was confirmed through electrophoresis using agarose gel that the RNA in the VLPs showed the target size.

[0085] Each RNA was subjected to reverse transcription PCR using the FP-RT-F1 and FP-RT-R1 primers, and the electrophoresis results for each experimental group, indicated as 1 to 6, are as follows:

[0086] 1. pEAQ-nonHT-ZIKV_prME vector;

[0087] 2. pEAQ-RNA1-Int vector;

[0088] 3. Product of reverse transcription PCR using RNA extracted from the control group (R);

[0089] 4, reverse transcription PCR product using RNA extracted from the experimental group (Z);

[0090] 5, PCR product without reverse transcription reaction using RNA extracted from the control group (R);

[0091] 6. PCR product without reverse transcription reaction using RNA extracted from the experimental group (Z).

[0092] As can be seen in Fig. 2c, it was confirmed that amplification of a band of the expected size occurred only in the plasmid vector (1) carrying ZIKV prME used as a positive control and in RNA (4) extracted from target VLPs, and the amplified DNA was used for sequence analysis together with the FP-RT-F1 primer, proving that it was the gene of the target ZIKV prME. The base sequence of ZIKV prME and the base sequences of the FP-RT-F1 and FP-RT-R1 primers are shown in Table 2 below.

[0093]

[0094] 서열번호명명서열목록 (5'-> 3')비고3ZIKV -RT-F1ATG TGT GAC GCG ACC ATGAG5FP-RT-R1TCC AAC CCA GTT CTT GGC TC

[0095]

[0096] Example 4: Isolation of target VLPs through further purification (concentration) of VLPs

[0097] The VLPs obtained from Example 3 above include a mixture of enveloped VLPs (eVLPs) not containing RNA, VLPs carrying RNA-1 (RNA1-VLPs), and VLPs carrying the target ZIKV prME (ZIKV-VLPs). To obtain only the target VLPs, an additional cesium chloride gradient ultracentrifugation process was performed.

[0098] Here, 2 ml of the sample obtained in the above example was carefully placed on the top layer of 1 M sodium-phosphate buffer solution having cesium chloride concentrations of 42%, 49%, 57%, and 65% (w / v) each of 2.5 ml, and then ultracentrifuged at 278,000 g and 15°C for 24 hours and fractionated into 500 μl each. The amount of protein contained in each fraction was determined by OD 280 Quantification was achieved through value measurement.

[0099] As can be seen in Figures 3a and 3b, RNA was extracted from each of samples 1, 2, 3, and 4 (indicated by arrows in Figure 3a) that were assumed to contain eVLPs, ZIKV-VLPs, a mixed form of ZIKV-VLPs and RNA1-VLPs, and RNA1-VLPs in these fractions, and as a result, it was confirmed that, as predicted, VLPs carrying the target RNA were concentrated in peak 2 (approximately 3.2 kb).

[0100]

[0101] Example 5: Observation of VLPs using a transmission electron microscope

[0102] To observe the structure of the VLPs obtained through the above Example 4, 10 μl of the sample was coated on a carbon-formvar copper grid or a carbon-coated copper grid, washed with distilled water, and stained using a 1% uranyl acetate aqueous solution. Thereafter, the grid was observed using a high-resolution transmission electron microscope (TEM) (JEM-2100F, JEM-4010 / JEOL).

[0103] As can be seen in Fig. 4, CPMV VLPs with a clear shape and a size of approximately 30 nm were observed, and VLPs containing RNA and VLPs without RNA could be distinguished by the presence or absence of staining of the contents.

[0104]

[0105] Example 6: Confirmation of RNA stability in VLPs under refrigerated conditions

[0106] To confirm the stability of target RNA within CPMV VLPs stored under refrigerated conditions, ZIKV-VLPs extracted and concentrated through the above-described process were stored under refrigerated conditions at 4°C for 5 months. The extracted RNA was analyzed by electrophoresis on an agarose gel and compared with RNA stored at -20°C for the same period after extraction.

[0107] As shown in Figure 5, RNA stored refrigerated at 4°C and RNA stored frozen at -20°C exhibited similar concentrations and band intensities, as well as identical sizes. This confirms that target RNA encapsulated in VLPs can be safely maintained for long periods of time even under refrigerated conditions.

[0108]

[0109] Sintering

[0110] As discussed above, the inventors of the present invention have demonstrated that mRNA encoding the target ZIKV prME protein can be produced within tobacco plants using CPMV VLPs, and that these VLPs safely store RNA under refrigerated conditions. Since the production and preservation of mRNA vaccines are performed automatically within tobacco plants, the present invention is free from external factors during the production process, and not only can highly pure target mRNA be obtained, but also, by utilizing high preservation properties, a vaccine bank can be established in preparation for emergencies.

[0111] The target gene-carrying CPMV VLPs according to the present invention can be used as a direct mRNA delivery vehicle to target cells in addition to the long-term storage target described above, and thus have the potential to be used as a direct vaccine. It is expected that the Zika virus prME RNA-carrying VLPs obtained in the present invention can be positively utilized in mRNA vaccine development research.

[0112]

[0113] The present invention relates to a method for producing virus-like particles (VLPs) of cowpea mosaic virus (CPMV) using plants and to the use thereof. CPMV VLPs produced using the method were found to be effective in safely preserving RNA for long periods of time even when stored in a refrigerator by capturing target RNA. Through this, it is expected that the excellent RNA preservation properties can be positively utilized in mRNA vaccine development research.

Claims

1. CPMV (Cowpea mosaic virus) 5' UTR consisting of the base sequence represented by sequence number 1, CPMV 3' UTR consisting of the base sequence represented by sequence number 2, and Target RNA sequence inserted between the CPMV 5' UTR and CPMV 3' UTR A recombinant vector containing:

2. A recombinant vector according to claim 1, wherein the target RNA sequence encodes Zika virus (ZIKV) prME (precursor membrane-envelope).

3. A recombinant vector in claim 1, wherein the target RNA sequence consists of a base sequence represented by sequence number 3.

4. A microorganism transformed with the recombinant vector of paragraph 1.

5. In paragraph 4, the microorganism is a strain of the genus Agrobacterium.

6. A transformed plant transformed by the microorganism of paragraph 4.

7. A transformed plant according to claim 6, wherein the plant is at least one monocotyledonous or dicotyledonous plant selected from the group consisting of tobacco, Arabidopsis thaliana, corn, lettuce, potato, rice, alfalfa, tomato, soybean, carrot, and safflower.

8. Virus like particles (VLPs) produced by the transformed plant of paragraph 6.

9. A method for producing virus like particles (VLPs), comprising the following steps: A recombinant vector production step for producing a recombinant vector comprising a CPMV (Cowpea mosaic virus) 5' UTR consisting of a base sequence represented by sequence number 1, a CPMV 3' UTR consisting of a base sequence represented by sequence number 2, and a target RNA sequence inserted between the CPMV 5' UTR and the CPMV 3' UTR; An infiltration step of infiltrating a plant with a microorganism transformed with the above recombinant vector; and A purification step for purifying virus-like particles produced from the above plant.

10. A method for producing a virus-like particle according to claim 9, wherein the target RNA sequence encodes Zika virus (ZIKV) prME (precursor membrane-envelope).

11. A method for producing a virus-like particle in claim 9, wherein the target RNA sequence consists of a base sequence represented by sequence number 3.

12. A method for producing a virus-like particle in claim 9, wherein the microorganism is a strain of the genus Agrobacterium.

13. A method for producing a virus-like particle in claim 9, wherein the plant is at least one monocotyledonous or dicotyledonous plant selected from the group consisting of tobacco, Arabidopsis thaliana, corn, lettuce, potato, rice, alfalfa, tomato, soybean, carrot, and safflower.

14. A method for producing a virus-like particle in claim 9, wherein the infiltration step additionally infiltrates a plant with a microorganism transformed with a recombinant vector containing a gene encoding the VP60 protein of CPMV or a microorganism transformed with a recombinant vector containing an RNA-1 gene.

15. A method for producing virus-like particles in claim 14, wherein the infiltration step comprises mixing and infiltrating a microorganism transformed with a recombinant vector including a gene encoding the Zika virus (ZIKV) prME (precursor membrane-envelope), a microorganism transformed with a recombinant vector including a gene encoding the VP60 protein of CPMV, and a microorganism transformed with a recombinant vector including an RNA-1 gene in a volume ratio of 1:1:1 to 2:1:1.

Images