Fusion protein consisting of a fragment of il-6r and the fc fragment of igg4

The fusion protein IL-6R-hFc, combining a fragment of the IL-6R protein with the Fc fragment of human IgG4, addresses the limitations of current IL-6 inhibitor therapies by effectively blocking IL-6 signaling and offering improved safety and convenience for treating inflammatory and autoimmune diseases.

WO2025116768A1PCT designated stage expired Publication Date: 2025-06-05OBSHCHESTVO S OGRANICHENNOJ OTVETSTVENNOSTYU PALMIRA BIOFARMA
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/RU2023/000378
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-29
Filing Date
2023-11-30
Publication Date
2025-06-05

AI Technical Summary

Technical Problem

Current therapies for inflammatory and autoimmune diseases mediated by IL-6 dysregulation are limited by high costs, invasive administration routes, high immunogenicity, and complications, necessitating the development of new IL-6 inhibitors with improved safety and convenience.

Method used

The creation of a fusion protein, IL-6R-hFc, comprising a fragment of the human IL-6R protein (amino acids 20-361 with the D358A substitution) fused with the constant part of the heavy chain (Fc fragment) of human IgG4, which acts as an antagonist to block IL-6 signaling pathways.

Benefits of technology

The IL-6R-hFc fusion protein effectively blocks IL-6 signaling, providing a safe and convenient therapeutic option for inflammatory and autoimmune diseases by minimizing immunogenicity and improving pharmacokinetic properties, thus reducing the risk of inflammatory reactions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000016_0000
    Figure 00000016_0000
Patent Text Reader

Abstract

The present invention relates to the field of biomolecular pharmacology, biotechnology and genetic engineering and describes nucleic acid molecules and novel recombinant IL-6R(D358A)-hFc polypeptides encoded thereby, said recombinant polypeptides being human IL-6 antagonists capable of effectively blocking IL-6 signalling (pro-inflammatory response). The obtained recombinant proteins can be used in the treatment and mitigation of inflammatory and autoimmune diseases mediated by dysregulation of IL-6 signalling.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] FUSION PROTEIN CONSISTING OF IL-6R FRAGMENT AND IGG4 FC FRAGMENT

[0002] Field of technology

[0003] The invention relates to the field of biomolecular pharmacology, biotechnology and genetic engineering and concerns nucleic acid molecules and new soluble proteins encoded by them - functional antagonists of human IL-6, capable of blocking the proinflammatory response, as well as a method for obtaining them. The invention is based on the use of the IL-6R (lnterleukin-6 receptor) protein receptor, as part of a trap receptor molecule.

[0004] State of the art

[0005] Cytokines comprise a class of proteins that mediate inflammation and modulate immunity. One group of cytokines, the interleukins, are so named because they were thought to mediate signaling between white blood cells (hence the name interleukins) (Dinarello, 2011). Cytokines play a critical role in the development of many inflammatory diseases (Feldmann, 2008).

[0006] Chronic inflammation underlies a wide range of autoimmune and inflammatory diseases that result in systemic organ damage (e.g., systemic lupus erythematosus) or targeted organ damage (e.g., rheumatoid arthritis, inflammatory bowel disease, type 1 diabetes, and asthma) (Feldmann, 2008). Before the discovery of tumor necrosis factor-a (TNFa)-inhibiting therapies, anti-inflammatory agents included a wide range of immunosuppressants and non-steroidal anti-inflammatory drugs (NSAIDs). Although these therapeutic agents are often effective in suppressing immune responses, they are often associated with undesirable side effects, and a significant proportion of patients do not respond to treatment with such drugs (Feldmann, 2008; Kaur, Bansal et al. 2020). For these reasons, the search for drugs with new mechanisms of action is urgent.

[0007] Inflammation is a natural defense mechanism of the body that involves the migration of leukocytes to damaged tissues to destroy the inflammatory trigger or lesion. Infectious and allergic triggers cause an initial phase of acute inflammation, which is thought to have a limited beneficial effect. But ongoing acute inflammation leads to chronic inflammation, which leads to tissue damage. Acute inflammation is characterized by the infiltration of neutrophilic cells followed by monocytic cells, whereas chronic inflammation is characterized by the presence of mononuclear cells such as macrophages and lymphocytes at the site of inflammation (Melnicoff, Horan et al., 1989). In addition to the recruitment of these cells to the site of inflammation, various cytokines are also produced during inflammatory processes.They act synergistically and have overlapping activities that may be mediated by their receptors and translated into intracellular signaling pathways. These cytokines mainly include interleukin-6 (IL-6), interleukin-1β(IL-1|3), tumor necrosis factor-α (TNF-α), interferon-γ (IFN-γ), and transforming growth factor-β (TGF-β), which stimulate the production of acute phase proteins (APP) (Kushner, 1993).

[0008] Interleukin-6 (IL-6) is a pleiotropic proinflammatory cytokine that actively participates in inflammatory and immunomodulatory mechanisms. Dysregulation of IL-6 is associated with chronic inflammation and multifactorial autoimmune disorders. It stimulates the production of so-called acute phase proteins, acts as an agent of B-lymphocyte maturation, stimulates the synthesis and secretion of various immunoglobulins and induces T-cell proliferation. IL-6 not only causes acute phase reactions, but also leads to the development of specific cellular and humoral immune responses by influencing the final stage of B-cell differentiation, immunoglobulin secretion and T-cell activation. Thus, IL-6 is an important modulator of the transition from the acute to the chronic phase of inflammation (Kaplanski, Marin et al., 2003). IL-6 exerts its biological role through a hexameric complex consisting of IL-6 itself, its receptor IL-6R, and glycoprotein 130 (IL-6 / IL-6R / gp130).This complex, in turn, activates various signaling mechanisms (classical and trans-signaling) to perform various biochemical functions. Interestingly, neither IL-6 nor IL-6R show significant affinity for gp130 (Rose-John, 2012, Zunke and Rose-John, 2017). The IL-6 and IL-6R complex has a high affinity for gp130. While gp130 is present on all cells of the body, IL-6R is predominantly expressed on hepatocytes and some leukocytes. However, IL-6R can be cleaved from the cell membrane by the proteolytic action of ADAM17, resulting in the formation of the soluble fragment of the IL-6R receptor (slL-6R) (Riethmueller et al., 2017). Interestingly, sIL-6R can bind IL-6 ligand, and the IL-6 and SIL-6R complex can bind to gp130 on cells that do not express IL-6R (Rose-John, 2012; Zunke and Rose-John, 2017).These cells, which would otherwise be insensitive to IL-6, are sensitized by the interaction of the IL-6 / sIL-6R complex with DR130. This pathway is called the IL-6 trans-signaling pathway (Zunke and Rose-John, 2017). The trans-signaling mechanism is known to activate various pathological pathways, such as JAK / STAT3, Ras / MAPK, PI3K-PKB / Akt, as well as the regulation of CD4+ T cells and VEGF levels. An imbalance in this regulation can ultimately lead to a wide range of different abnormalities, including various immunoinflammatory conditions and cancers.

[0009] A single nucleotide polymorphism (rs2228145) in the IL-6R gene is known from the literature, which results in an amino acid substitution of aspartic acid 358 to alanine 358 (D358A) near the cleavage site of IL-6R by the metalloprotease ADAM17 (Zunke and Rose-John, 2017). It is known that the D358A substitution leads to more efficient cleavage of IL-6R by metalloproteases and, consequently, to an increase in SIL-6R levels by approximately 50% (Garbers et al, 2014). Several genetic studies have found that the minor allele of rs2228145, resulting in the D358A substitution, provides protection against coronary heart disease, rheumatoid arthritis, other inflammatory diseases, and type 2 diabetes (Sarwar et al., 2012, Ferreira et al., 2013, lnterleukin-6 Receptor Mendelian Randomisation Analysis (IL6R MR) Consortium., 2012).Although the mechanism of action of this allele remains to be fully elucidated, these results have been explained by the buffering activity of SIL-6R towards IL-6 binding (Calabrese et al., 2014).

[0010] The involvement of IL-6 in the pathophysiology of diseases such as multiple sclerosis, Alzheimer's disease, rheumatoid arthritis (RA), Castleman disease (CD), inflammatory bowel disease and Crohn's disease makes it one of the most important targets for therapy. IL-6 is also a major cytokine in the tumor microenvironment and is known to be dysregulated in cancer. It is overexpressed in almost all tumor types such as breast cancer, prostate cancer, ovarian carcinoma, pancreatic cancer, lung cancer, renal cell carcinoma, cervical cancer and multiple myeloma. IL-6 activates the JAK / STAT3, Ras / MAPK, and PI3K-PKB / Akt signaling pathways, which in turn regulate many gene products that induce cell proliferation, differentiation, apoptosis, angiogenesis, and metastasis (Kaur, Bansal et al, 2020).Clinical studies using anti-IL-6 monoclonal antibodies (mAbs, BE-8 or CNTO 328) in patients with multiple myeloma, renal cell carcinoma and B-lymphoproliferative disorders have shown the efficacy of these monoclonal antibodies in all patients. Thus, it is believed that IL-6 suppression therapy may be useful in the treatment of early-stage cancer (Unver and McAllister, 2018).

[0011] AHTH-IL-6 monoclonal antibodies are used to treat various immunoinflammatory diseases that are resistant to conventional drugs. Tocilizumab (human 3HTH-IL-6R antibody) and siltuximab (IL-6 inhibitor) are approved monoclonal antibodies that are used to treat CD, RA, and systemic juvenile idiopathic arthritis (Yoshizaki, Murayama et al, 2018). Tocilizumab is a humanized anti-IL-6R monoclonal antibody approved by the FDA for the treatment of RA and systemic juvenile idiopathic arthritis. It is also approved in Japan for the treatment of CD and is currently undergoing phase 2 studies to evaluate its efficacy in relapsing polychondritis.Clinical studies of anti-IL-6 monoclonal antibodies such as sirukumab (CNTO136), olokizumab (CP6038), PF-423691, siltuximab (CNTO328), elsilimomab (BE-8), clazakizumab (BMS945429), sarilumab (REGN88) and MEDI5117 are in different stages of clinical trials to establish their efficacy and safety in various disease states. Many studies have shown that these monoclonal antibodies exhibit beneficial therapeutic effects in IL-6-mediated disease states. Some of these monoclonal antibodies have also achieved tremendous commercial success, but their major limitations remain high cost, invasive route of administration, high immunogenicity, and a range of other complications that complicate their use in many cases. Therefore, there is a need to develop new IL-6 inhibitors with low antigenicity and patient convenience.Several synthetic and naturally occurring molecules have been reported in the literature as IL-6 inhibitors. They act by interfering with various pathways involved in IL-6 production and signal transduction pathways (Kaur, Bansal et al., 2020).

[0012] Fc-fusion proteins have proven themselves as therapeutic and prophylactic agents. Proteins obtained using this technology have an effector part associated with the Fc domain, which significantly extends the half-life of proteins in blood plasma, which prolongs their therapeutic activity, and also leads to slower renal clearance for larger molecules. In addition, the molecules have fairly low immunogenicity, since their constituent parts are natural proteins of the human body. At the same time, such molecules have significant therapeutic potential, since they are able to bind the necessary ligands and, thus, block signal transduction chains. Recently, active development of therapeutic agents based on Fc-fusion proteins has been underway (see, for example, RU2689522, 28.05.2019; WO2023063842, 20.04.2023 (RU2787060)).

[0013] The aim of the invention is to develop effective IL-6 antagonists based on Fc-fusion protein technology.

[0014] The essence of the invention

[0015] The objective of the present invention is to expand the arsenal of technical means for treating and preventing the development of inflammatory and autoimmune diseases mediated by dysregulation of IL-6 signal transmission. In particular, the objective concerns the production of polypeptide drugs - antagonists of the pathological IL-6 signal pathway, possessing high affinity for this interleukin; the objective also concerns the development of nucleotide sequences encoding such polypeptides and being the expression basis for their production.

[0016] The solution to the set problem is carried out by creating a fusion protein IL-6R-hFc, which is an antagonist of IL-6, the structure of which includes human IL-6R, represented by amino acids 20-361, corresponding to the natural sequence of IL-6R, carrying the D358A substitution, as well as the constant part of the heavy chain (Fc fragment) of human IgG4. In this case, the Fc fragment of human IgG4 is attached to the fragment of the IL-6R protein from the C-terminus directly or via a linker sequence. In some particular embodiments of the invention, the linker peptide is a RS dipeptide.

[0017] In some embodiments of the invention, the human IgG4 Fc region is represented by the amino acid sequence SEQ ID NO: 3.

[0018] In some embodiments of the invention, the fusion protein further comprises a signal sequence located at the N-terminus of the fusion protein. In particular embodiments of the invention, the signal sequence is presented in the sequence SEQ ID NO: 4.

[0019] In some particular embodiments of the invention, the fusion protein has an amino acid sequence represented by SEQ ID NO: 2:

[0020] MYRMQLLSCIALSLALVTNS LAPRRCPAQEVARGVLTSLP GDSVTLTTCPGVEPEDNATVH WVLRKPAAGSHPSRWAGMGR RLLLRSVQLHDSGNYSCYRA GRPAGTVHLLVDVPPEEPQL SCFRKSPLSNWCEWGPRST PSLTTKAVLLVRKFQNSPAE DFQEPCQYSQESQKFSCQLA VPEGDSSFYIVSMCVASSVG SKFSKTQTFQGCGILQPDPP ANITVTAVARNPRWLSVTWQ DPHSWNSSFYRLRFELRYRA ERSKTFTTWMVKDLQHHCVI HDAWSGLRHWQLRAQEEFG QGEWSEWSPEAMGTPWTESR SPPAENEVSTPMQALTTNKD DDNILFRDSANATSLPVQAS SSRSPPCPSCPAPEFLGGPS VFLFPPKPKDTLMISRTPEV TCVWDVSQEDPEVQFNWYV DGVEVHNAKTKPREEQFNST YRWSVLTVLHQDWLNGKEY KCKVSNKGLPSSIEKTISKA KGQPREPQVYTLPPSQEEMT KNQVSLTCLVKGFYPSDIAV EWESNGQPENNYKTTPPVLD SDGSFFLYSRLTVDKSRWQE GNVFSCSVMHEALHNHYTQK SLSLSPGK

[0021] The task at hand is also solved by creating an isolated nucleic acid molecule encoding such a fusion protein.

[0022] In some particular embodiments of the invention, the nucleic acid molecule has the sequence SEQ ID NO: 5.

[0023] The said task is also solved by creating an expression vector carrying a nucleotide sequence corresponding to the sequence of an isolated nucleic acid molecule encoding such a fusion protein, under the control of regulatory elements necessary for the expression of this nucleotide sequence in a host cell; as well as by creating a host cell comprising the expression vector described in the present application, ensuring the efficient production of such a fusion protein using the above-mentioned nucleic acid molecule. In some embodiments of the invention, such cells are mammalian cells (in some particular embodiments of the invention, Chinese hamster ovary (CHO) cells).

[0024] The solution to the stated problem can be achieved by using the above-mentioned fusion protein for treating a wide range of inflammatory conditions and autoimmune diseases. The result of the invention is the creation of an IL-6 inhibitor, which is achieved by using a fragment of IL-6R (D358A) in the fusion protein IL-6R-hFc, which is a decoy receptor aimed at binding IL-6 and reducing the pathological activation of IL-6 pathways. The IL-6R (D358A)-hFc protein can be administered to a patient in a therapeutically effective amount, preferably as part of a pharmaceutical composition.

[0025] The following technical results are achieved by implementing the invention:

[0026] - a variant of a therapeutic agent based on the fusion (hybrid) protein IL-6R(D358A)-hFc has been created, containing the functional part of IL-6R, represented by a fragment of the extracellular domain corresponding to positions 20-361 of the sequence SEQ ID NO: 1 with the substitution D358A, fused with the constant part (Fc-domain) of human immunoglobulin IgG4, and capable of blocking the transmission of the IL-6 signal (proinflammatory response), and nucleotide sequences encoding such fusion proteins and serving as the expression basis for their production have been developed;

[0027] - the developed recombinant polypeptide has a high degree of safety for therapeutic use, the basis of which is the features of its design, namely: minimal effector function for antibody-dependent cellular cytotoxicity (ADCC) and the absence of complement-dependent cytotoxicity (CDC), due to the use of the constant part of human immunoglobulin IgG4 isotype;

[0028] - the recombinant polypeptide also has potentially improved pharmacokinetic properties due to the inclusion in the fusion protein of only part of the extracellular domain (aa 20-361 instead of aa 20-365) (and also, additionally, in some preferred embodiments of the invention, due to the presence of a fragment of the hinge region of PPCPSCP), which allows the extracellular domain of the IL-6R protein and the Fc domain included in the molecule to act independently of each other due to the provision of flexibility in this region. Brief description of the drawings

[0029] Fig. 1. Scheme of an expression vector containing the nucleotide sequence of SEQ ID NO: 5, encoding a fusion protein having the amino acid sequence of SEQ ID NO: 2.

[0030] Definitions and terms

[0031] The following terms and definitions are used in this document unless otherwise explicitly stated. References to techniques used in describing this invention refer to well-known techniques, including variations of these techniques and their replacement by equivalent techniques known to those skilled in the art.

[0032] In the documents of this invention, the terms "includes", "including", etc., as well as "contains", "comprising", etc. are interpreted to mean "includes, among other things" (or "contains, among other things"). These terms are not intended to be interpreted as "consists only of".

[0033] The terms "polypeptide," "protein," and "peptide" are used interchangeably herein and all refer to a polymer of amino acid residues. These terms may also be used interchangeably herein to refer to the final product resulting from expression of a nucleic acid sequence in a host cell.

[0034] By "fusion protein" ("hybrid protein", "recombinant protein", "fusion polypeptide", "recombinant polypeptide", "hybrid construct") is meant a construct of two or more parts of a polypeptide nature, covalently linked to each other, formed as a result of the expression of a recombinant DNA molecule in which the coding regions of two or more different genes or their fragments are connected to each other in one reading frame.

[0035] The term "isolated" has its generally accepted meaning, known to a person of ordinary skill in the art, and when used in relation to an isolated nucleic acid or an isolated polypeptide, is used without limitation to denote a nucleic acid or polypeptide that, due to man, exists separately from its native environment and is therefore not a product of nature. An isolated nucleic acid or polypeptide may exist in purified form or may exist in a non-native environment, such as, for example, a host cell.

[0036] The term "synonymous substitution" refers to a nucleotide sequence having a nucleotide sequence that may differ from a reference nucleic acid sequence by one or more substitutions that do not result in a change in the amino acid sequence of the protein encoded by the nucleic acid molecule. Since the genetic code is "degenerate", i.e. triplets of different nucleotide sequences may encode the same amino acid, synonymous substitutions in the nucleotide sequence do not result in a change in the amino acid sequence of the protein.

[0037] The term "decoy ligand" refers to hybrid proteins consisting of the extracellular domain of the molecule (receptor) and the Fc domain of immunoglobulin. The extracellular domain of the receptor is responsible for target binding, and the Fc domain performs dimerization of the hybrid protein. The latter is necessary to increase the binding efficiency and ensure greater stability of the high-molecular complex. In the context of the present invention, the "decoy receptor" consists of a functional fragment of the human IL-6R protein (D358A) and the constant part of the human IgG4 heavy chain.

[0038] The term “treatment” means to cure, slow, halt, or reverse the progression of a disease or disorder. As used herein, “treatment” also means to alleviate the symptoms associated with the disease or disorder.

[0039] The term "prophylaxis", "prevention", "preventive therapy" covers the elimination of risk factors, as well as preventive treatment of subclinical stages of the disease in humans, aimed at reducing the likelihood of the clinical stages of the disease. Patients for preventive therapy are selected based on factors that, based on known data, entail an increased risk of developing clinical stages of the disease compared to the general population. Preventive therapy includes a) primary prevention and b) secondary prevention. Primary prevention is defined as preventive treatment in patients who have not yet reached the clinical stage of the disease. Secondary prevention is the prevention of recurrence of the same or a similar clinical state of the disease.

[0040] The term risk reduction refers to therapy that reduces the incidence of clinical disease. Examples of risk reduction include primary and secondary disease prevention.

[0041] By "therapeutically / prophylactically effective amount (therapeutic dose)" is meant the amount of the medicinal product administered to the patient, at which the expected therapeutic (prophylactic) effect will most likely manifest. The exact required amount may vary from subject to subject depending on numerous factors, such as the severity of the disease, age, body weight, general condition of the body, combined treatment with other drugs, etc. The administration of the medicinal product according to the invention to the subject in need of treatment and / or prevention of the disease or condition is carried out in a dose sufficient to achieve the therapeutic effect.When carrying out treatment and / or prevention, the administration can be carried out either once or several times a day, more often in the form of a course of administration over a period of time sufficient to achieve a therapeutic effect (from several days to a week, several weeks and up to months), while the courses of administration of the medicinal product can be carried out repeatedly. In particular, in moderate forms of the disease, the single dose, frequency and / or duration of administration of the medicinal product according to the invention can be increased. Preferably, the fusion protein according to the invention is administered to the patient as part of a pharmaceutical composition including, in addition to the active component, pharmaceutically acceptable carriers and / or fillers.

[0042] Unless otherwise defined, technical and scientific terms in this application have the standard meanings generally accepted in the scientific and technical literature.

[0043] The numbers of the nucleotide and amino acid sequences referred to in this application correspond to the number in the Sequence Listing (SEQ ID NO) according to Standard ST.26, which is part of this description of the invention. In the event of discrepancies in the structure of the sequences between the mention in the text of the description and the corresponding sequence in the Sequence Listing according to Standard ST.26, the data given in the text of the description shall prevail.

[0044] Detailed description of the invention

[0045] The present invention provides DNA constructs encoding fusion proteins (recombinant polypeptides) - IL-6 antagonists that block the proinflammatory response induced by IL-6.

[0046] In particular, the invention relates to nucleotide constructs encoding polypeptides containing IL-6R(D358A) fused with the constant part (Fc domain) of human immunoglobulin IgG4, IL-6R(D358A)-hFc.

[0047] The natural sequence of the human IL-6R protein consists of 468 amino acids (aa) (SEQ ID NO: 1). The native protein consists of a signal peptide (aa 1-19 of SEQ ID NO: 1), an extracellular domain (aa 20-365 of SEQ ID NO: 1), a transmembrane domain (aa 366-386 of SEQ ID NO: 1), and a cytoplasmic domain (aa 387-468 of SEQ ID NO: 1).

[0048] According to the invention, the fusion protein - IL-6 antagonist, contains a fragment of the extracellular domain of the IL-6R protein, represented by an amino acid sequence corresponding to positions 20-361 of the sequence SEQ ID NO: 1 with the substitution D358A (Asp358Ala). Therapeutic blockers of IL-6 (mainly antibodies) are already known for the treatment of some autoimmune diseases, but systemic blockade inevitably neutralizes the protective functions of this cytokine against infections. The proposed IL-6 antagonists, represented by the fusion proteins of the invention, take into account the features of the molecular signaling mechanisms in target cells and differences in the function of IL-6 depending on the types of cells producing it. The presence of a substitution corresponding to the D358A mutation in the recombinant protein is capable of providing an anti-inflammatory response, potentially mediated through the specific interaction with dr130 or due to the buffering activity of IL-6R(D358A)-hFc in relation to IL-6 binding.

[0049] Due to the constant part of the heavy chain (Fc fragment) of the human IgG4 isotype included in the recombinant protein, the developed hybrid constructs have only minimal effector function of antibody-dependent cellular cytotoxicity and do not have complement-dependent cytotoxicity, which reduces the possible risk of inflammatory reactions and sensitization when using a therapeutic agent based on the fusion (hybrid) protein IL-6R (D358A) -hFc.

[0050] Another advantage of the recombinant protein of the invention is the structure of the hinge region: the inclusion of only a part of the extracellular domain (aa 20-361 instead of aa 20-365) in the fusion protein made it possible to exclude from the region bordering the hinge region amino acids that lead to unstructuredness and a decrease in the solubility of the protein molecule as a whole. Simultaneous inclusion in the design of a fragment of the hinge region PPCPSCP of the constant part of the human IgG4 heavy chain, represented by aa 1-7 of SEQ ID NO: 3, makes it possible to provide the necessary rotation and rigidity without excessive unstructuredness. Thus, due to the design features, the recombinant polypeptide of the invention has potentially improved pharmacokinetic properties due to the fact that the extracellular domain of the IL-6R protein and the Fc domain included in the molecule can act independently of each other due to increased flexibility in this region.

[0051] Within the framework of the present invention, in the process of developing new polypeptide drugs - inhibitors of the action of IL-6, the sequence corresponding to the functional part of IL-6R was cloned and fused in one reading frame with the sequence encoding the constant part of the human IgG4 heavy chain by means of a linker sequence. The fusion protein IL-6R(D358A)-hFc according to the invention may also optionally contain a signal sequence, which may include any sequence known to a skilled person in the field of controlling the secretion of a polypeptide or protein from a cell, and include natural or synthetic sequences. Typically, the signal sequence is located at the N-terminus of the fusion protein according to the present invention. In particular embodiments of the invention, the signal sequence is represented by SEQ ID NO: 4.

[0052] The fusion protein (recombinant polypeptide) which is the subject of the present invention can be obtained as follows.

[0053] Soluble recombinant IL-6 antagonist polypeptides are produced by expressing nucleotide sequences encoding them in eukaryotic cell lines, followed by purification of the synthesized recombinant proteins using affinity, ion exchange or hydrophobic chromatography, used individually or in various combinations with each other, as well as using other methods for purifying proteins. The corresponding nucleotide sequences are obtained by combining DNA regions encoding selected IL-6R domains bearing the D358A substitution with a DNA sequence encoding the Fc fragment of human IgG4. In some particular embodiments of the invention, nucleic acid molecules encoding such IL-6 antagonist polypeptides have a nucleotide sequence corresponding to SEQ ID N0: 5.

[0054] The said problem is also solved by creating an expression vector containing the given nucleic acid molecule under the control of regulatory elements necessary for the expression of the given nucleic acid in a host cell. In preferred embodiments of the invention, the host cell containing such an expression vector can be Chinese hamster ovary cells CHO (for example, cell lines CH0-K1 or CHO DG44), adapted for the production of therapeutic proteins. In the present invention, the expression vector is preferably selected for the expression of heterologous sequences in mammalian cells, but in some embodiments of the invention, the expression vector can be selected for expression in other systems, such as, for example, insect cells, yeast or bacterial cells.Accordingly, each expression vector has its own set of regulatory elements that allow expression of a heterologous sequence (product) in a host cell, such as promoters and / or enhancers, Kozak sequences, polyA sequences and other regulatory sequences. It may also have sequences encoding leader (signal) peptides that ensure secretion of recombinant polypeptides into the extracellular environment. Termination of protein synthesis from a given isolated nucleic acid sequence is determined by adding one or more stop codons to it from the 3'-end in one reading frame.

[0055] After transfection of the vector into the cells of the eukaryotic cell line, the recombinant polypeptide is synthesized and secreted into the culture serum-free medium. The resulting recombinant polypeptide is purified from the medium using, as a rule, affinity chromatography for protein-A or protein-G, but other methods of protein purification can also be used.

[0056] The following examples are provided for the purpose of disclosing the characteristics of the present invention and should not be construed as limiting the scope of the invention in any way.

[0057] Example 1. Construction of plasmids

[0058] To construct plasmids with the claimed nucleotide sequences, the sequence encoding the human IL-1 RA protein obtained from plasmid RG221874 (OriGene, IL-6R, Human Tagged ORF clone) was used. The sequence encoding IL-6R was used for cloning. The following primers were selected for cloning the region corresponding to amino acids 20-361 for SEQ ID NO: 2:

[0059] IL-6R_F: TTAGAATTCGCTGGCCCCAAGGCGCTGC (SEQ ID N0:6)

[0060] IL-6R_R: TATAGATCTTGAAGAAGAAGCTTGCACTGGGAGG (SEQ ID N0:7)

[0061] PCR was performed under the following conditions: 98°C 1 min, 30 cycles (98°C 10 sec, 65°C 10 sec, 72°C 2 min), 72°C 5 min. Reaction components: polymerase - Phusion (Thermo), buffer containing Mg2+ for Phusion polymerase (Thermo), 10 pmol of each primer and 0.25 mM nucleotide triphosphate mixture (Thermo). Amplification was performed using the RG221874 sequence (Origene). After PCR: PCR product was purified using the GeneJet PCR purification kit (Fermentas). Concentration and compliance with the predicted molecular weight were checked using gel electrophoresis in 1% agarose (TAE buffer). The obtained PCR products were used for further construction.

[0062] The pFUSE-hlgG4e-Fc2 vector (InvivoGen) was used for cloning the target sequences. It allows obtaining sequences fused with the Fc domain of lgG4 and studying their properties. The EcoRI (IL-6R_F) restriction site was included in one of the primers, and the Bglll (IL-6R_R) restriction site was included in the other, which after amplification and restriction allowed obtaining a DNA fragment with sticky EcoRI, Bglll ends. The vector and PCR product were treated with EcoRI (Thermo) and Bglll (Thermo) restriction enzymes for 1 hour at 37°C, then purified using the GeneJet PCR purification kit (Fermentas) and ligated using 1 U (IU) of ligase (Thermo) according to the manufacturer's protocol. The ligation mixture was used to transform competent E. coli XL1-Blue cells and plated on LB medium containing zeocin.

[0063] The dishes were incubated overnight in a thermostat at 37°C. The next day, 20 colonies from each ligation mixture were tested for the presence of the desired insert by diluting a portion of the colony in 20 μl of water and boiling for 5 minutes. After cooling, the mixture was spun down and 1 μl was used as a template in the PCR reaction. PCR was performed using Taq DNA polymerase (Fermentas) and PROMF2 and FC primers. The presence of the insert was tested after electrophoresis of the PCR products. Plasmid DNA was isolated from two colonies containing the insert, the lengths of the restriction fragments were verified using restriction endonucleases EcoRI and Hindlll, and sequenced using PROMF2 and FC primers on an Applied Biosystems 3500 sequencer according to the manufacturer's instructions, using PROMF2 (forward) and FC (reverse) primers.

[0064] PROMF2: GCCTGACCCTGCTTGCTCAACT (SEQ ID N0: 8)

[0065] FC: CTCACGTCCACCACCACGCA (SEQ ID NO: 9)

[0066] The resulting constructed plasmid containing the target nucleotide sequences is shown in Fig. 1 .

[0067] Example 2. Production of a hybrid protein

[0068] To produce the hybrid protein, CHO cells were transiently transfected with a constructed plasmid encoding the hybrid protein.

[0069] The CHO cell line was cultured in Dynamis medium supplemented with Glutamax (6 mM), Antidumping reagent B (0.5%) and zeocin (500 μg / ml). Cultivation was carried out in a Multitron Cell shaker-CO2 incubator (Infors, Switzerland) in an atmosphere of 5% CO2 at a temperature of 37 °C and a relative humidity of 95% in 125 ml Ernlenmeyer flasks (Corning, USA) (stirring 120 rpm).

[0070] For transfection of CHO cells, ultrapure ("transfection grade") plasmid DNA was isolated using the EndoFree Plasmid MaxiKit (Qiagen) according to the manufacturer's protocol. Linearization of the constructed plasmid was performed using the Notl site (Thermo). For transfection, 20 μg of linearized plasmid were added to 100 μl of cell suspension at a concentration of 5x107 cells / ml. Electroporation was performed according to the protocol: 3 pulses of 1130 V with a duration of 20 ms.

[0071] Selection of transfected cells began 48 hours after transfection by adding the antibiotic zeocin at a concentration of 500 μg / ml and continued during further passages.

[0072] Protein production was analyzed by standard SDS-PAGE. The secreted fusion protein was visualized using rabbit antibodies against the human Fc domain (Jackson Immunoresearch, USA). The target protein IL-6R(D358A)-hFc was also purified from the culture fluid by FPLC chromatography on a HiTrap ProteinA HP column (Cytiva) and assessed by gel electrophoresis. Cultivation of these pools confirmed the production of IL-6R(D358A)-hFc fusion polypeptides and their secretion in the culture fluid.Thus, as a result of the conducted studies, a nucleotide sequence encoding the IL-6R(D358A)-hFc fusion protein was developed and is the expression basis for its production, and a fusion protein IL-6R(D358A)-hFc was obtained, containing a fragment of the IL-6R(D358A) extracellular domain fused with the constant part (Fc-domain) of human immunoglobulin IgG4, capable of effectively blocking IL-6, which can be used in the therapy and prevention of the development of inflammatory and autoimmune diseases. This invention has a number of improved properties compared to analogues and therefore expands the range of available candidates for the treatment and prevention of development (reduction of the risk of development) of inflammatory and autoimmune diseases, especially coronary heart disease, rheumatoid arthritis, type 2 diabetes, in the pathogenesis of which IL-6 is involved.

[0073] Although the invention has been described with reference to the disclosed embodiments, it will be apparent to those skilled in the art that the specific experiments described in detail are provided merely for the purpose of illustrating the present invention and should not be considered as limiting the scope of the invention in any way. It will be understood that various modifications can be made without departing from the spirit of the present invention.

Claims

Invention formula 1. A fusion protein - an IL-6 antagonist, containing a fragment of the extracellular domain of the IL-6R protein, represented by an amino acid sequence corresponding to positions 20-361 of the sequence SEQ ID NO: 1 with the D358A substitution, and the Fc fragment of human IgG4, attached to the fragment of the IL-6R protein from the C-terminus without a linker or via a linker sequence.

2. The fusion protein according to claim 1, wherein the Fc fragment of human IgG4 is represented by the amino acid sequence SEQ ID NO:

3.

3. The fusion protein according to any one of paragraphs 1-2, in which the Fc fragment of human IgG4 is connected to a fragment of the IL-6R protein via a linker peptide RS.

4. The fusion protein according to any one of paragraphs 1-3, additionally comprising a signal sequence localized at the N-terminus of the fusion protein.

5. The fusion protein according to claim 4, wherein the signal sequence is represented by SEQ ID NO:

4.

6. The fusion protein according to claim 1, having the amino acid sequence SEQ ID NO:

2.

7. An isolated nucleic acid molecule encoding a fusion protein according to any one of paragraphs 1-6.

8. An isolated nucleic acid molecule according to claim 7, having the sequence SEQ ID NO:

5.

9. An expression vector containing a nucleic acid sequence according to any of paragraphs 7-8 under the control of regulatory elements necessary for its expression in a host cell.

10. A cell capable of expressing the fusion protein according to any of paragraphs 1-6, which is not a human embryonic cell and is transfected with the expression vector according to paragraph 9.

11. The cell according to claim 10, which is a Chinese hamster ovary (CHO) cell.

Citation Information

Patent Citations

  • Fused proteins il-7

    RU2369616C2

  • Peptide immunogens targeting interleukin 6 (il-6) and compositions thereof for immunotherapy of diseases affected by impaired il-6 regulation

    RU2780161C1

  • Receptor based antagonists and methods of making and using

    US7927583B2

  • Il-6 binding proteins

    WO2007009018A2