Compositions and methods for multimodal immune activation and delivery
Polymeric RNA macromolecules are engineered to precisely pattern PRR agonists, addressing the limitations of current immunotherapies and vaccines by achieving robust, multimodal innate immune activation and targeted delivery.
Patent Information
- Application Number
- PCT/US2024/057453
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-11-30
- Filing Date
- 2024-11-26
- Publication Date
- 2025-06-05
AI Technical Summary
Current cancer immunotherapies and infectious disease vaccines face challenges in generating robust, long-lasting immune responses due to limitations in activating the innate immune system effectively, with many synthetic innate immune agonists showing insufficient potency or excessive toxicity.
Development of polymeric RNA macromolecules that act as multifunctional agonists and molecular scaffolds, precisely patterning and multivalent presentation of pattern recognition receptor (PRR) agonists to activate multiple innate immune pathways and facilitate targeted self-delivery.
The polymeric RNA scaffolds achieve multimodal innate immune activation, enabling precise modulation of disease-specific immune responses, and demonstrate therapeutic efficacy in preclinical models.
Smart Images

Figure US2024057453_05062025_PF_FP_ABST
Abstract
Description
[0001]Attorney Docket No. UM-42619.601 COMPOSITIONS AND METHODS FOR MULTIMODAL IMMUNE ACTIVATION AND DELIVERY CROSS-REFERENCE TO RELATED APPLICATIONS The present application claims priority to U.S. Provisional Application No.63 / 604458, filed November 30, 2023, which is incorporated herein by reference in its entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with government support under EB035261 awarded by the National Institutes of Health. The government has certain rights in the invention. SEQUENCE LISTING The text of the computer readable sequence listing filed herewith, titled “UM_42619_601_SequenceListing.xml””, created November 25, 2024, having a file size of 8,953 bytes, is hereby incorporated by reference in its entirety. FIELD OF THE INVENTION The invention provides therapeutic comprising polymeric macromolecules, wherein each of the polymeric macromolecules comprise a plurality of connected pattern recognition receptor (PRR) agonists, wherein each of the PRR agonists comprise an RNA molecule capable of activating a specific PRR. Specifically, the pattern of PRR agonists is designed to recapitulate a distinct portion of one or more PRR agonist signatures of one or more pathogens. The plurality of PRR agonists are formulated together in a manner enabling combined presentation in a mammalian subject so as to modulate an immune response. BACKGROUND OF THE INVENTION Despite remarkable successes of cancer immunotherapies such as immune checkpoint blockade in the last decade, clinical benefit remains limited to a small fraction of patients. Vaccines provide promising strategies for augmenting immunotherapies and training the immune system to recognize and attack tumor cells. The development of effective vaccines is also critical for many infectious diseases, which remain a major cause of morbidity and mortality among infants, children, and elderly individuals. The generation of a robust, long- lasting immune response against infectious diseases or cancer is a critical challenge in designing Attorney Docket No. UM-42619.601 effective vaccines and cancer immunotherapies. Such effective immune responses require viral, bacterial, or tumor antigens to be internalized by antigen-presenting cells (APCs) for priming cellular and humoral immune responses. Activation of the innate immune system is crucial in mediating these responses. The innate immune system has evolved sense and respond to complex combinations of pathogen-associated molecular patterns, via pattern recognition receptors (PRRs) such as toll-like receptors (TLRs) and retinoic acid-inducible gene I (RIG-I). Towards this end, many synthetic innate immune agonists that activate specific PRRs have been developed as vaccine adjuvants for cancer and infectious diseases. However, only a handful of adjuvants are currently clinically approved for use in vaccines or with cancer immunotherapies, often due to insufficient potencies or excessive toxicities. The rational design of innate immune agonists that can generate durable and safe immune responses remains a crucial unmet need in vaccine development, particularly for subunit vaccines that typically require adjuvants, due to knowledge and technological gaps: (1) poor mechanistic understanding of how agonists and their combinations mediate different immune responses; and (2) a scarcity of robust, modular agonist platforms that can precisely tune immune response profiles. The present invention addresses these needs. SUMMARY The generation of a robust disease-specific immune response is a critical challenge in cancer immunotherapies, many of which provide clinical benefit in only a fraction of patients despite remarkable successes, and in infectious disease vaccines. Harnessing the innate immune system, which has evolved to sense and respond to complex combinations of pathogen- associated molecular patterns, is highly promising for augmenting cancer immunotherapies and infectious disease vaccines. While many synthetic innate immune agonists that activate pattern recognition receptors (PRRs) have been developed as vaccine adjuvants, only a handful of adjuvants have been clinically approved. Generation of a durable immune response faces key barriers: (1) many current PRR agonist-based adjuvants rely on a single agonist, poorly recapitulating natural pathogen recognition by the innate immune system; (2) while mounting evidence shows that combining PRR agonists can promote synergistic activation, control and understanding of the combinatorial effects and spatial modulation of multiple agonists remain inadequate; and (3) further exacerbating these gaps is a scarcity of platforms for precisely tuning combinations and spatial arrangements of innate immune agonists. To address these knowledge and technological gaps, polymeric RNA macromolecules were engineered as both a multifunctional agonist and a molecularly defined scaffold to sculpt the immune response via (1) Attorney Docket No. UM-42619.601 precise spatial patterning and multivalency of PRR agonists; (2) combinatorial control of innate immune signaling pathways; and (3) targeted self-delivery. The polymeric RNA molecules consist of many repeating sequences, comprising double- and single-stranded RNA regions that can activate specific PRRs and also be hybridized with complementary DNA strands linked to additional innate immune agonists. Experiments described herein resulted in the constrution of polyRNA scaffolds patterned with TLR9 agonists (CpG DNA oligos) and cGAS agonists (dsDNA oligos) that are capable of activating multiple PRRs for multimodal innate immune activation. The polyRNA can additionally be used as a scaffold for templating its own delivery biomolecules such as sugar- and lipid-based moieties that can protect the RNA from nuclease degradation and promote target cell uptake and / or endosomal escape. As an example, the natural immune cell-targeting abilities of fungal wall polysaccharides is exploited to create a bioinspired, “all-in-one” synthetic glyco- RNA that can target and activate antigen-presenting cells. The highly modular RNA scaffolding platform can potentially enable (1) fundamental studies of how combinations of innate immune agonists and their spatial arrangements function at the molecular, cellular, and organismal levels; and (2) precise modulation of disease-specific immune responses for applications in cancer and infectious diseases. Additional experiments demonstrated in vivo therapeutic efficacy of such polymeric RNA scaffolds. Accordingly, the present invention provides therapeutic comprising polymeric macromolecules, wherein each of the polymeric macromolecules comprise a plurality of connected pattern recognition receptor (PRR) agonists, wherein each of the PRR agonists comprise an RNA molecule capable of activating a specific PRR. Specifically, the pattern of PRR agonists is designed to recapitulate a distinct portion of one or more PRR agonist signatures of one or more pathogens. The plurality of PRR agonists are formulated together in a manner enabling combined presentation in a mammalian subject so as to modulate an immune response. In certain aspects, the invention provides compositions comprising one or more polymeric macromolecules, wherein each of the polymeric macromolecules comprise a plurality of connected pattern recognition receptor (PRR) agonists, wherein each of the polymeric macromolecules include at least two different PRR agonists, wherein each of the PRR agonists comprise a nucleic acid molecule capable of activating a specific PRR. In some aspects, the plurality of connected PRR agonists are formulated together for combined presentation following administration to a mammalian subject. Attorney Docket No. UM-42619.601 In some aspects, the plurality of connected PRR agonists are arranged to recapitulate a distinct portion of one or more PRR agonist signatures of one or more pathogens. In some aspects, a specific PRR agonist within the plurality of connected PRR agonists is present two or more times. In some aspects, the present two or more times is between 2 and 1,000,000 times. In some aspects, two or more different PRR agonists within the plurality of connected PRR agonists are each independently present two or more times. In some aspects, the present two or more times is between 2 and 1,000,000 times. In some aspects, at least one of the PRR agonists comprises a hairpin loop within the nucleic acid molecule. In some aspects, at least one of the PRR agonists comprises single stranded RNA (ssRNA) and / or single stranded DNA (ssDNA) within the nucleic acid molecule. In some aspects, the ssRNA and / or ssDNA within the nucleic acid molecule is between 4 and 1000 bases. In some aspects, the percentage of guanine / uracil bases within the ssRNA is between 0 and 100% (e.g., 0, 1, 2, 3, 4, 5, 10, 15, 20, 25, 27, 30, 35, 40, 50, 55, 70, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100%). In some aspects, at least one of the PRR agonists comprises double stranded RNA (dsRNA) and / or double stranded DNA (dsDNA) within the nucleic acid molecule. In some aspects, the dsRNA and / or dsDNA within the nucleic acid molecule is between 1 and 500 base pairs. In some aspects, at least one of the PRR agonists comprises a 5’-triphosphate moiety within the nucleic acid molecule. In some aspects, at least one of the PRR agonists comprises a stem moiety within the nucleic acid molecule. In some aspects, the plurality of connected PRR agonists are arranged in a linear one-by- one manner. In some aspects, each PRR agonist within the series of linearly connected PRR agonists is successively positioned in a linear one-by-one manner. In some aspects, the plurality of connected PRR agonists are arranged in a non-linear manner. In some aspects, the plurality of PRR agonists is between 2 and 10,000 PRR agonists; or the plurality of PRR agonists is between 2 and 1,000 PRR agonists; or the plurality of PRR agonists is between 2 and 100 PRR agonists; or the plurality of PRR agonists is between 2 and 10 PRR agonists. In some aspects, the number of different PRR agonists within each polymeric macromolecule is between 2 and 10,000; or the number of different PRR agonists within each Attorney Docket No. UM-42619.601 polymeric macromolecule is between 2 and 1,000; or the number of different PRR agonists within each polymeric macromolecule is between 2 and 100; or the number of different PRR agonists within each polymeric macromolecule is between 2 and 10. In some aspects, the plurality of PRR agonists is selected from 3 PRR agonists, 4 PRR agonists, 5 PRR agonists, 6 PRR agonists, 7 PRR agonists, 8 PRR agonists, 9 PRR agonists, 10 PRR agonists, 11 PRR agonists, 12 PRR agonists, 13 PRR agonists, 14 PRR agonists, 15 PRR agonists, 16 PRR agonists, 17 PRR agonists, 18 PRR agonists, 19 PRR agonists, 20 PRR agonists, 25 PRR agonists, and 50 PRR agonists. In some aspects, the plurality of different PRR agonists within each polymeric macromolecule is selected from 3 PRR agonists, 4 PRR agonists, 5 PRR agonists, 6 PRR agonists, 7 PRR agonists, 8 PRR agonists, 9 PRR agonists, 10 PRR agonists, 11 PRR agonists, 12 PRR agonists, 13 PRR agonists, 14 PRR agonists, 15 PRR agonists, 16 PRR agonists, 17 PRR agonists, 18 PRR agonists, 19 PRR agonists, 20 PRR agonists, 25 PRR agonists, and 50 PRR agonists. In some aspects, at least one of the polymeric macromolecules and / or the composition further comprise a targeting moiety. In some aspects, at least one of the polymeric macromolecules is associated with (e.g., complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed) a targeting moiety. In some aspects, the composition is associated with (e.g., complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed) a targeting moiety. In some aspects, the targeting moiety is selected from: vitamins, ligands, amines, peptide fragments, antibodies, aptamers, a transferrin, an antibody or fragment thereof, sialyl Lewis X antigen, lipoids, lipids (including cationic, neutral, and steroidal lipids, virosomes, and liposomes), fungal wall polysaccharides, hyaluronic acid, mannan, mannose derivatives, glucose derivatives, cell specific lectins, galaptin, galectin, lactosylceramide, a steroid derivative, an RGD sequence, EGF, EGF-binding peptide, urokinase receptor binding peptide, a thrombospondin-derived peptide, an albumin derivative and / or a molecule derived from combinatorial chemistry. In some aspects, the targeting moiety is selected from: sialic acid, 9-N- (4H-thieno[3,2-c]chromene-2-carbamoyl)-Neu5Acα2-3Ga1β-4G1cNAc (TCCNeu5Ac), folic acid, methotrexate, folate, galactose residue, lactose, low density lipoprotein (LDL), ovalbumin (OVA), lactobionic acid, mannan, mannose, mannose-rich glycoconjugates, mannosylated poly(L-lysine) (MPL), zymosan and other β-glucans, glucan, poly-guanine, and apoB protein fragment. In some aspects, at least one of the polymeric macromolecules further comprise a fungal wall polysaccharide moiety, wherein the fungal wall polysaccharide moiety is conjugated with Attorney Docket No. UM-42619.601 the polymeric macromolecule, wherein the fungal wall polysaccharide moiety is mannan or mannose; and / or the composition further comprises a fungal wall polysaccharide moiety, wherein the fungal wall polysaccharide moiety is mannan or mannose. In some aspects, at least one of the polymeric macromolecules further comprise one or more of mannan, mannose, β-glucan, N-acetylgalactosamine, polysaccharide A1, hyaluronic acid, a-galactosylceramide, cholesterol, and α-tocopherol succinate; and / or the composition further comprises one or more of mannan, mannose, β-glucan, N-acetylgalactosamine, polysaccharide A1, hyaluronic acid, a-galactosylceramide, cholesterol, and α-tocopherol succinate. In some aspects, the composition is associated with a liposome moiety, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed; and / or the polymeric macromolecule is associated with a liposome moiety, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed. In some aspects, each of the plurality of PRRs and PRR agonists is independently selected from: TLR2 and TLR2 agonists, TLR3 and TLR3 agonists, TLR4 and TLR4 agonists, TLR5 and TLR5 agonists, TLR7 / 8 and TLR7 / 8 agonists, TLR9 and TLR9 agonists, NOD1 and NOD1 agonists, NOD2 and NOD2 agonists, TLR2 / NOD2 and TLR2 / NOD2 agonists, NOD1 / NOD2 and NOD1 / NOD2 agonists, RIG1 / MDA5 and RIG1 / MDA5 agonists, DAI and DAI agonists, LRRFIP1 and LRRFIP1 agonists, AIM2 and AIM2 agonists, RIG1 and RIG1 agonists, Dectin-1 and Dectin-1 agonists, Mincle and Mincle agonists, STING and STING agonists, Attorney Docket No. UM-42619.601 MDA5 and MDA5 agonists, LGP2 and LGP2 agonists, DDX41 and DDX41 agonists, DHX9 and DHX9 agonists, DDX3 and DDX3 agonists, DDX36 and DDX36 agonists, DDX-1-DDX-21-DDX36 and DDX-1-DDX-21-DDX36 agonists, DDX60 and DDX60 agonists, KU70 and KU70 agonists, cGAS and cGAS agonists, NLRP3 and NLRP3 agonists, IFI16 and IFI16 agonists, LRRFIP1 and LRRFIP1 agonists, DAI and DAI agonists, CDS and CDS agonists, RLR and RLR agonists, CLR and CLR agonists, IFIT1 and IFIT1 agonists, IFIT2 and IFIT2 agonists, IFIT3 and IFIT3 agonists, and IFIT5 and IFIT5 agonists. In some aspects, the plurality of PRR agonists within at least one of the polymeric macromolecules comprises: one or more RIG-1 agonists, one or more TLR7 / 8 agonists, one or more TLR9 agonists, and one or more TLR3 agonists. In some aspects, one or more of the PRR agonists comprise a hairpin loop. In some aspects, one or more of the RIG-1 agonists comprise a 5’-triphosphate moiety. In some aspects, one or more of the TLR7 / 8 agonists comprise ssRNA. In some aspects, one or more of the TLR7 / 8 agonists comprise ssRNA having a guanine / uracil percentage between 0 and 100. In some aspects, one or more of the TLR3 agonists comprise dsRNA. In some aspects, one or more of the TLR9 agonists comprise ssDNA. In some aspects, one or more of the RIG1 agonists comprise dsRNA or ssRNA. In some aspects, the composition is capable of stimulating and / or modulating an innate immune response in a mammalian subject upon administration to the mammalian subject. In some aspects, one or more of the polymeric macromolecules further comprise one or more portions of nucleic acid molecules not characterized as a PRR agonist. Attorney Docket No. UM-42619.601 In some aspects, the composition is used to elicit an immune response to a vaccine application. In some aspects, the composition is capable of stimulating an innate immune response in at least one cancer cell upon administration to the subject, wherein the mammalian subject is suffering from cancer. In some aspects, stimulating an innate immune response comprises stimulating an innate cytokine response mediated through cytokines, wherein the innate cytokine response is mediated through type 1 interferon. In some aspects, the composition is further associated with an antigen, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed; and / or the polymeric macromolecule is further associated with an antigen, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed. In some aspects, the antigen is selected from the group consisting of alpha-actinin-4, Bcr-Abl fusion protein, Casp-8, beta-catenin, cdc27, cdk4, cdkn2a, coa-1, dek-can fusion protein, EF2, ETV6-AML1 fusion protein, LDLR-fucosyltransferaseAS fusion protein, HLA- A2, HLA-A11, hsp70-2, KIAAO205, Mart2, Mum-1, 2, and 3, neo-PAP, myosin class I, OS-9, pml-RARα fusion protein, PTPRK, K-ras, N-ras, Triosephosphate isomeras, Bage-1, Gage 3,4,5,6,7, GnTV, Herv-K-mel, Lage-1, Mage-A1,2,3,4,6,10,12, Mage-C2, NA-88, NY-Eso- 1 / Lage-2, SP17, SSX-2, and TRP2-Int2, MelanA (MART-I), gp100 (Pmel 17), tyrosinase, TRP- 1, TRP-2, MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, p15(58), CEA, RAGE, NY-ESO (LAGS), SCP-1, Hom / Mel-40, PRAME, p53, H-Ras, HER-2 / neu, BCR-ABL, E2A-PRL, H4- RET, IGH-IGK, MYL-RAR, Epstein Barr virus antigens, EBNA, human papillomavirus (HPV) antigens E6 and E7, TSP-180, MAGE-4, MAGE-5, MAGE-6, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, TAG-72-4, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, β-Catenin, CDK4, Mum-1, p16, TAGE, PSMA, PSCA, CT7, telomerase, 43-9F, 5T4, 791Tgp72, α-fetoprotein, 13HCG, BCA225, BTAA, CA 125, CA 15-3 (CA 27.29\BCAA), CA 195, CA 242, CA-50, CAM43, CD68\KP1, CO-029, FGF-5, G250, Ga733 (EpCAM), human EGFR protein or its fragments, such as human EGFR residues 306–325 (SCVRACGADSYEMEEDGVRK (SEQ ID NO: 1)) and residues 897–915 (VWSYGVTVWELMTFGSKPY (SEQ ID NO: 2)), HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB\70K, NY-CO-1, RCAS1, SDCCAG16, TA-90 (Mac-2 binding protein\cyclophilin C-associated protein), TAAL6, TAG72, TLP, TPS, WT1 (and WT1- derivaed peptide sequences: WT1126–134 (RMFP NAPYL (SEQ ID NO: 3)), WT1122–140 (SGQARMFPNAPYLPSCLES (SEQ ID NO: 4)), and WT1122–144 (SGQARMFPNAPYLPSCLESQPTI (SEQ ID NO: 5)), MUC1 (and MUC1-derived peptides and glycopeptides such as RPAPGS (SEQ ID NO: 6), PPAHGVT (SEQ ID NO: 7), and PDTRP Attorney Docket No. UM-42619.601 (SEQ ID NO: 8))), LMP2, EGFRvIII, Idiotype, GD2, Ras mutant, p53 mutant, Proteinase3 (PR1), Survivin, hTERT, Sarcoma translocation breakpoints, EphA2, EphA4, LMW-PTP, PAP, ML-IAP, AFP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, ALK, Androgen receptor, Cyclin B1, Polysialic acid, MYCN, RhoC, TRP-2, GD3, Fucosyl GM1, Mesothelin, sLe(animal), CYP1B1, PLAC1, GM3, BORIS, Tn, GloboH, NY-BR-1, RGS5, SART3, STn, Carbonic anhydrase IX, PAX5, OY-TES1, Sperm protein 17, LCK, HMWMAA, AKAP-4, XAGE 1, B7H3, Legumain, Tie 2, Page4, VEGFR2, MAD-CT-1, FAP, PDGFR- alpha, PDGFR-β, MAD-CT-2, Fos-related antigen 1, ERBB2, Folate receptor 1 (FOLR1 or FBP), IDH1, IDO, LY6K, fms-related tyro- sine kinase 1 (FLT1, best known as VEGFR1), KDR, PADRE, TA-CIN (recombinant HPV16 L2E7E6), SOX2, neoantigens, and aldehyde dehydrogenase. In some aspects, the antigen is derived from a self-antigen. In some aspects, the antigen is conjugated to the outer surface of the composition; and / or the antigen is conjugated to the polymeric macromolecule. In some aspects, the composition is associated with an adjuvant, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed; and / or the polymeric macromolecule is associated with an adjuvant, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed. In some aspects, the adjuvant is selected from the group consisting of CPG, polyIC, poly-ICLC, 1018 ISS, aluminum salts (for example, aluminum hydroxide, aluminum phosphate), Amplivax, BCG, CP-870,893, CpG7909, CyaA, dSLIM, Cytokines (such as GM- CSF, IL-2, IFN-a, Flt-3L), IC30, IC31, Imiquimod, ImuFact IMP321, IS Patch, ISS, ISCOMATRIX, Juvlmmune, LipoVac, MF59, monophosphoryl lipid A, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, Montanide ISA-51, OK-432, OM-174, OM-197-MP- EC, ONTAK, PepTel.RTM, vector system, PLGA microparticles, imiquimod, resiquimod, gardiquimod, 3M-052, SRL172, Virosomes and other Virus-like particles, YF-17D, VEGF trap, beta-glucan, Pam3Cys, Aquila's QS21 stimulon, vadimezan, AsA404 (DMXAA), 3M MEDI9197, glucopyranosyl lipid adjuvant (GLA), GLA-SE, CD1d ligands (such as C20:2, OCH, AH04-2, α-galatosylceramide, α-C-galatosylceramide,α-mannosylceramide, α- fructosylceramide, β-galatosylceramide, β-mannosylceramide), STING agonists (e.g. cyclic dinucleotides, including Cyclic [G(3’,5’)pA(3’,5’)p], Cyclic [G(2’,5’)pA(3’,5’)p], Cyclic [G(2’,5’)pA(2’,5’)p], Cyclic diadenylate monophosphate, Cyclic diguanylate monophosphate), CL401, CL413, CL429, Flagellin, RC529, E6020, imidazoquinoline-based small molecule TLR- 7 / 8a (including its lipidated analogues), virosomes, AS01, AS02, AS03, AS04, AS15, IC31, Attorney Docket No. UM-42619.601 CAF01, ISCOM, Cytokines (such as GM-CSF, IL-2, IFN-a, Flt-3L), bacterial toxins (such as CT, and LT), any derivative of an adjuvant, and any combination of adjuvant. In some aspects, the composition is associated with a nanoparticle, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed; and / or the polymeric macromolecule is associated with a nanoparticle, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed. In some aspects, the nanoparticle is selected from the group consisting of sHDL nanoparticles, metal-polyhistidine-DOPE@liposome, metal-polyhistidine-PEG, 4arm-PEG- polyhistidine-metal hydrogels, sHDL-polyhistidine, fullerenes, endohedral metallofullerenes buckyballs, trimetallic nitride templated endohedral metallofullerenes, single-walled and mutli- walled carbon nanotubes, branched and dendritic carbon nanotubes, gold nanorods, silver nanorods, single-walled and multi-walled boron / nitrate nanotubes, carbon nanotube peapods, carbon nanohorns, carbon nanohorn peapods, liposomes, nanoshells, dendrimers, any nanostructures, microstructures, or their derivatives formed using layer-by-layer processes, self- assembly processes, or polyelectrolytes, microparticles, quantum dots, superparamagnetic nanoparticles, nanorods, cellulose nanoparticles, glass and polymer micro- and nano-spheres, biodegradable PLGA micro- and nano-spheres, gold nanoparticles, silver nanoparticles, carbon nanoparticles, iron nanoparticles, modified micelles, and metal-organic framework (MOF) coordination polymer (CP). In some aspects, the composition is associated with one or more of a nanoparticle, a liposome, a dendrimer, a micelle, a nanoemulsion, a nanosuspension, a niosome, a nanocapsule, a magnetic nanoparticle, a lipoprotein-based carrier, andor a lipoplex nanoparticle; wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed; and / or the polymeric macromolecule is associated with one or more of a nanoparticle, a liposome, a dendrimer, a micelle, a nanoemulsion, a nanosuspension, a niosome, a nanocapsule, a magnetic nanoparticle, a lipoprotein-based carrier, andor a lipoplex nanoparticle; wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed. Certain aspects of the invention provide methods for treating or preventing an immune dysregulation in a mammalian subject comprising administering to the mammalian subject a composition of claim 1, wherein the administering results in stimulating and / or modulating an innate immune response in the mammalian subject. Attorney Docket No. UM-42619.601 In some aspects, the mammalian subject is suffering from a disease or condition characterized by the immune dysregulation. In some aspects, the disease or condition is a cancer, an infectious disease, an autoimmune disorder, and / or an inflammatory disorder. In some aspects, the cancer is selected from the group consisting of breast, brain, thyroid, prostate, colorectal, pancreas, cervix, stomach, endometrium, liver, bladder, ovary, testis, head and neck, skin, mesothelial lining white blood cells, esophagus, muscle, connective tissue, lung, adrenal gland, kidney, bone or testicle cancer, and metastasis thereof. In some aspects, the disease or condition is one or more disease or condition selected from: Acne vulgaris; Acute disseminated encephalomyelitis; Acute hemorrhagicleukoencephalitis; Addison's Disease; Agammaglobulinemia; Allergies; Alopecia areata; Alzheimer's; Amyotrophic Lateral Sclerosis; autoimmune anaemia, hemolytic anaemia; pernicious anaemia; Ankylosing spondylitis; Anti-GBM / TBM Nephritis; Antiphospholipid syndrome; Antisynthetase syndrome; Arteritis, temporal (also known as “giant cell arteritis”); Arthritis, juvenile; Arthritis, psoriatic; Arthritis, reactive (Reiter's syndrome, rea); Arthritis, rheumatoid; Asthma; Atherosclerosis; Atopic allergy; Atopic dermatitis; Autoimmune enteropathy; Autoimmune aplastic anemia; Balo disease / Balo concentric sclerosis; Bartter syndrome; Bechets Syndrome; Berger's disease; Bickerstaff's encephalitis; Blau syndrome; Bronchitis, chronic; Bullous pemphigoid; Bursitis; Cardiomyopathy, autoimmune; Castleman's disease; Celiac disease; Chronic fatigue syndrome; Chronic inflammatory demyelinating polyneuropathy; Chronic recurrent multifocal osteomyelitis; Churg-Strauss syndrome; Cicatricialpemphigoid; Cirrhosis, primary biliary Cogan syndrome; Cold agglutinin disease; Colitis; Complement component 2 deficiency; Connective tissue disease, mixed; Connective tissue disease, undifferentiated COPD (chronic obstructive lung disease); Cranial arteritis; CREST syndrome; Cryoglobulinemia; Cushing's Syndrome; Cutaneous leukocytoclasticangiitis; Cystitis, interstitial; Dacryadenitis; Dego's disease; Dercum's disease; Dermatitis; Dermatitis herpetiformis; Dermatitis, autoimmune progesterone; Dermatomyositis; Diabetes; Diabetes insipidus, nephrogenic; Diabetes mellitus type 1; Diffuse cutaneous systemic sclerosis; Discoid lupus erythematosus; Diverticulitis; Dressler's syndrome; Dysmenorrhea (menstrual cramps / pain); Eczema; Endometriosis; Enthesitis-related arthritis; Eosinophilic fasciitis; Eosinophilic gastroenteritis; Epidermolysisbullosaacquisita; Erythema nodosum, Essential mixed cryoglobulinemia; Evan's syndrome; Fibrodysplasiaossificansprogressiva; Fibromyalgia; Fibrosingaveolitis; Gastritis, atrophic; Gastrointestinal pemphigoid; Giant cell arteritis; Glomerulonephritis; Goodpasture's syndrome; Gout, acute; Gout, arthritic; Graves' disease; Guillain-Barré syndrome (GBS); Haemolytic anaemia; Hashimoto's encephalitis; Hashimoto's Attorney Docket No. UM-42619.601 thyroiditis; Hemolyticanemia, autoimmune; Henoch-Schonleinpurpura; Hepatitis, autoimmune; Hepatitis, viral; Herpes gestationis; Hypogammaglobulinemia; Idiopathic Inflammatory Demyelinating Diseases; Idiopathic pulmonary fibrosis; Iga nephropathy; Ileus (bowel obstruction); Inclusion body myositis; Inflammatory bowel disease, Crohn's disease; Inflammatory bowel disease, ulcerative colitis; Inflammatory demyelinating polyneuopathy; Inner ear disease, autoimmune; Interstitial cystitis; Irritable bowel syndrome (IBS); Juvenile idiopathic arthritis; Juvenile rheumatoid arthritis; Kawasaki's Disease; Kidney stones Lambert- Eaton myasthenic syndrome; Leukocytoclasticvasculitis; Lichen planus; Lichen sclerosus; Linear iga disease (LAD); Lou Gehrig's disease (Also Amyotrophic lateral sclerosis); Lupoid hepatitis; Lupus; Lupus erythematous; Lymphoproliferative syndrome, autoimmune; Majeed syndrome; Meniere's disease; Meningitis; Microscopic polyangiitis; Miller-Fisher syndrome; Morphea; Mucha-Habermann disease; Multiple sclerosis; Multiple sclerosis; Myasthenia gravis; Myositis; Myositis, inclusion body; Nephritis; Nephrotic syndrome; Neuromyelitisoptica (Also Devic's Disease); Neuromyotonia; Neutropenia; Neutropenia caused by a myelosuppressive chemotherapy; Occular cicatricial pemphigoid; Ocular inflammation (acute and chronic non- bacterial inflammation of the anterior part of the eyes); Opsoclonus myoclonus syndrome; Ord thyroiditis; Osteoarthritis; Paget's disease of bone; Palindromic rheumatism; Pancreatitis, autoimmune; PANDAS (pediatric autoimmune neuropsychiatric disorders associated with streptococcus); Paraneoplastic cerebellar degeneration; Parkinson's; Paroxysmal nocturnal hemoglobinuria (PNH); Parry Romberg syndrome; Pars planitis; Parsonnage-Turner syndrome; Pelvic inflammatory disease; Pemphigus; Pemphigus vulgaris; Pericarditis, non-rheumatic; Peripheral neuropathy, autoimmune; Perivenous encephalomyelitis; POEMS syndrome; Polyarteritisnodosa; Polychondritis, relapsing Polyendocrine syndrome, autoimmune; Polymyalgia rheumatica; Polymyalgia rheumatica; Polymyositis; Primary sclerosing cholangitis; Progressive inflammatory neuropathy; Prostatitis, chronic Pseudogout; Psoriasis; Psoriasis; Pure red cell aplasia; Pyodermagangrenosum; Rasmussen's encephalitis; Raynaud phenomenon; Reiter's syndrome; Restless leg syndrome; Retinopathy of prematurity; Retroperitoneal fibrosis; Rheumatoid fever; Rhinitis, allergic; Sarcoidosis; Schmidt syndrome; Schnitzler syndrome; Scleritis; Scleroderma; Sclerosis, systemic; Sjogren's syndrome; Spondyloarthropathy; Still's disease; Subacute bacterial endocarditis (SBE); Susac's syndrome; Sweet's syndrome; Sydenham chorea; Sympathetic ophthalmia; Takayasu's arteritis; Temporomandibular joint disorder (TMJD or TMD), or TMJ syndrome; Thrombocytopenic purpura, autoimmune; Thrombocytopenic purpura, idiopathic Tolosa-Hunt syndrome; Transplant rejection; Transverse myelitis; Attorney Docket No. UM-42619.601 Undifferentiated spondyloarthropathy; Urticaria; Uveitis, autoimmune; Valvular disease, non- rheumatic; Vasculitis; Vitiligo, and Wegener's granulomatosis. In some aspects, the cancer is one or more selected from bladder cancer, brain cancer, breast cancer, cervical cancer, ovarian cancer, colo-rectal cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, nasopharangeal cancer, pancreatic cancer, prostate cancer, skin cancer, stomach cancer, gastric cancer, head and neck cancer, testicular cancer, melanoma, acute myelogenous leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia, T cell lymphocytic leukemia, and B cell lymphomas, and uterine cancer. In some aspects, the autoimmune disorder is selected from Systemic lupus erythematosus, Aicardi–Goutières syndrome, Acute pancreatitis Age-dependent macular degeneration, Alcoholic liver disease, Liver fibrosis, Metastasis, Myocardial infarction, Nonalcoholic steatohepatitis (NASH), Parkinson’s disease, Polyarthritis / fetal and neonatal anemia, Sepsis, inflammatory bowel disease, and multiple sclerosis. In some aspects, the composition is administered in an amount effective to modulate an adaptive immune response in the mammalian subject. In some aspects, administration of the composition is intracutaneous, subcutaneous, intravenous, intraperitoneal, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, transdermal, transtracheal, subcuticular, intraarticular, intratumoral, subcapsular, subarachnoidal, intraspinal, intrasternal, oral, sublingual, buccal, rectal, vaginal, nasal or ocular, or by infusion, inhalation, or nebulization. In some aspects, the administration site is the skin or subcutaneous tissue. In some aspects, the administration site is enteric. In some aspects, the administration site is non-enteric. In some aspects, the administration site is the respiratory tract. In some aspects, the composition is formulated for systemic distribution of the PRR agonists following administration. In some aspects, the composition is administered in a plurality of doses over a dosage duration, and the dosage duration is at least two weeks. In some aspects, the doses are administered subcutaneously every day, or every other day. In some aspects, the mammalian subject is a human patient. In some aspects, the human patient is immunosuppressed or immunocompromised. In some aspects, the human patient is a geriatric patient. In some aspects, the human patient is a pediatric patient. In some aspects, the methods further comprise co-administering one or more additional therapeutic agents. Attorney Docket No. UM-42619.601 In some aspects, the additional therapeutic agent is selected from the group consisting of disease-modifying antirheumatic drugs (e.g., leflunomide, methotrexate, sulfasalazine, hydroxychloroquine), biologic agents (e.g., rituximab, infliximab, etanercept, adalimumab, golimumab), nonsteroidal anti-inflammatory drugs (e.g., ibuprofen, celecoxib, ketoprofen, naproxen, piroxicam, diclofenac), analgesics (e.g., acetaminophen, tramadol), immunomodulators (e.g., anakinra, abatacept), glucocorticoids (e.g., prednisone, methylprednisone), TNF-α inhibitors (e.g., adalimumab, certolizumab pegol, etanercept, golimumab, infliximab), IL-1 inhibitors, and metalloprotease inhibitors. In some aspects, the therapeutic agents include, but are not limited to, infliximab, adalimumab, etanercept, parenteral gold or oral gold. In some aspects, the additional therapeutic agent is selected from the group consisting of aldesleukin, altretamine, amifostine, asparaginase, bleomycin, capecitabine, carboplatin, carmustine, cladribine, cisapride, cisplatin, cyclophosphamide, cytarabine, dacarbazine (DTIC), dactinomycin, docetaxel, doxorubicin, dronabinol, epoetin alpha, etoposide, filgrastim, fludarabine, fluorouracil, gemcitabine, granisetron, hydroxyurea, idarubicin, ifosfamide, interferon alpha, irinotecan, lansoprazole, levamisole, leucovorin, megestrol, mesna, methotrexate, metoclopramide, mitomycin, mitotane, mitoxantrone, omeprazole, ondansetron, paclitaxel (TAXOL), pilocarpine, prochloroperazine, rituximab, tamoxifen, taxol, topotecan hydrochloride, trastuzumab, vinblastine, vincristine and vinorelbine tartrate. Certain aspects of the invention provide compositions comprising a DNA molecule encoding one or more polymeric macromolecules as described herein. In some aspects, the DNA molecule is a circular DNA molecule. In some aspects, rolling circle transcription of the circular DNA molecule with an RNA polymerase results in generation of one or more polymeric macromolecules encoded by the circular DNA molecule. In some aspects, the RNA polymerase is T7 RNA polymerase. Certain aspects of the invention provide methods comprising transcribing a circular DNA molecule encoding one or more polymeric macromolecules as described herein, wherein the circular DNA molecule is transcribed with rolling circle transcription with an RNA polymerase, wherein the transcribing results in generation of one or more polymeric macromolecules encoded by the circular DNA molecule. In some aspects, the RNA polymerase is a T7 RNA polymerase. Additional aspects will be apparent to persons skilled in the relevant art based on the teachings contained herein. Attorney Docket No. UM-42619.601 BRIEF DESCRIPTION OF THE DRAWINGS FIG.1: Schematic illustration of an “all-in-one” glyco-polymeric RNA as a multifunctional agonist and molecular scaffold to induce antitumor immunity. FIG.2A-C: (A) PolyRNA synthesized by rolling circle transcription. (B) In vitro TLR3 and TLR7 activation in reporter cell lines by polyRNA or poly(I:C), complexed with biodegradable polymers. (C) Overall survival in an ID8Trp53- / - ovarian cancer mouse model treated intraperitoneally by polyRNA or poly(I:C) complexes. *p<0.05, **p<0.01, ****p<0.0001, log-rank (Mantel-Cox) test. FIG.3: A schematic showing a polymeric macromolecule having a RIG-1 PRR agonist, a TLR7 / 8 PRR agonist, TLR9 PRR agonist, and a TLR3 PRR agonist. hTLR3, hTLR7, hTLR8, and hRIG-1 activation data is further provided. FIG.4 shows the formation of hybrids (polyRNA, DNA comb, polyRNA-DNA comb); mTLR9 activaiton by T19:D12-CpG; RAW-Dual NF-kB activation by T19:D12-CpG; and RAW-dual IRF activation by T19:D12-CpG FIG.5 shows ionizable lipids (DLin-MC3-DMA (MC3)) (OF-C4-Deg-Lin (C4)); MW distribution of polyRNAs (T19 polyRNA; T51 polyRNA; and T52 polyRNA); MC3 LNPs (IRF activation); and MC3 vs. C4 (activation). FIG.6A-D demonstrates in vivo therapeutic efficacy of polymeric RNA scaffolds. (A) CT26 colorectal tumor-bearing mice were treated with polyRNA (T52), polyRNA:CpG DNA hybrids (T52:D15-CpG), and benchmark controls via intratumoral injection. T52:D15-CpG and T51:D15ctl-CpG represent polyRNA hybridized with CpG combs and mismatched CpG DNA controls. (B-D) Tumor growth curves (B-C) and overall survival (D).*p<0.05; **p<0.01; ****p<0.0001. DEFINITIONS To facilitate an understanding of the present invention, a number of terms and phrases are defined below: An “immunogen” refers to a molecule, or a composition comprising the molecule, that is capable of eliciting an immune response by an organism's immune system. An “antigen” refers to a molecule that is capable of binding to the product of an immune response. “Pathogenic” agents are agents, such as microbes, such as bacteria or viruses, which are known to cause infection in a host in nature, and in this sense, “pathogenic” is used in the context of the present invention to mean “naturally pathogenic”. Although a wide variety of microbes may be capable of causing infection under artificial conditions, such as artificial Attorney Docket No. UM-42619.601 inoculations of a microbe into a tissue, the range of microbes that naturally cause infection is necessarily limited, and well established by medical practice. An “infection” is the state or condition in which the body or a part of it is invaded by a pathogenic agent (e.g., a microbe, such as a bacterium) which, under favorable conditions, multiplies and produces effects that are injurious (Taber's Cyclopedic Medical Dictionary, 14th Ed., C. L. Thomas, Ed., F. A. Davis Company, PA, USA). An infection may not always be apparent clinically and may result in only localized cellular injury. Infections may remain subclinical, and temporary if the body's defensive mechanisms are effective. Infections may spread locally to become clinically apparent as an acute, a subacute, or a chronic clinical infection or disease state. A local infection may also become systemic when the pathogenic agent gains access to the lymphatic or vascular. Infection is usually accompanied by inflammation, but inflammation may occur without infection. “Inflammation” is the characteristic tissue reaction to injury (marked by swelling, redness, heat, and pain), and includes the successive changes that occur in living tissue when it is injured. Infection and inflammation are different conditions, although one may arise from the other (Taber's Cyclopedic Medical Dictionary, 14th Ed., C. L. Thomas, Ed., F. A. Davis Company, PA, USA). Accordingly, inflammation may occur without infection and infection may occur without inflammation (although inflammation typically results from infection by pathogenic bacteria or viruses). Inflammation is characterized by the following symptoms: redness (rubor), heat (calor), swelling (tumour), pain (dolor). Localized visible inflammation on the skin may be apparent from a combination of these symptoms, particularly redness at a site of administration. Various subjects may be treated or assayed or sampled in accordance with alternative aspects of the invention. As used herein, a “subject” is an animal, for e.g., a vertebrate or a mammal. Accordingly, a subject may be a patient, e.g., a human, suffering from an immune dysregulation. A subject may also be an experimental animal, e.g., an animal model of an immune dysregulation. In some aspects, the terms “subject” and “patient” may be used interchangeably, and may include a human, a non-human mammal, a non-human primate, a rat, mouse, or dog. A healthy subject may be a human who is not suffering from a disease, such as a cancer or immune dysfunction, or suspected of having the disease, or who is not suffering from a chronic disorder or condition. A “healthy subject” may also be a subject who is not immunocompromised. By immunocompromised is meant any condition in which the immune system functions in an abnormal or incomplete manner. Immunocompromisation may be due to disease, certain medications, or conditions present at birth. Immunocompromised subjects may Attorney Docket No. UM-42619.601 be found more frequently among infants, the elderly, and individuals undergoing extensive drug or radiation therapy. A “sample” from a subject may include any relevant biological material, including for example a cell, tissue or bodily fluid sample taken from a patient. For example, a sample may conveniently include samples of skin, cheek, blood, stool, hair or urine. Sample nucleic acids for use in diagnostic and prognostic methods can for example be obtained from a selected cell type or tissue of a subject. For example, a subject's bodily fluid (e.g. blood) can be obtained by known techniques. Alternatively, nucleic acid tests can be performed on dry samples (e.g., hair or skin). An “immune response” includes, but is not limited to, one or more of the following responses in a mammal: induction or activation of antibodies, neutrophils, monocytes, macrophages (including both M1-like macrophages and M2-like macrophages as described herein), B cells, or T cells (including helper T cells, natural killer cells, cytotoxic T cells, gamma-delta (γδ) T cells), such as induction or activation by one or more immunogens in an immunogenic composition, following administration of the composition. An immune response to a composition thus generally includes the development in the host animal of a cellular and / or antibody-mediated response to the composition. In some aspects, the immune response is such that it will also result in slowing or stopping the progression of an immune dysregulation, or a disease characterized by immune dysregulation. An immune response may accordingly include one or both of a cellular immune response and / or a humoral immune response, and may be an adaptive response or an innate immune response. “Immune dysregulation” is an inappropriately regulated immune response, such as an inappropriately restrained or inappropriately robust immune response. The immune dysregulation may for example be in the context of an autoimmune, inflammatory, or degenerative disease (such as rheumatoid arthritis, Crohn's disease, inflammatory bowel disease, multiple sclerosis, neurodegenerative disease, or allergies) or a neoplastic disease, such as a cancer, or a host defense against pathogens. Inflammatory bowel disease (IBD) is a name frequently given to a group of inflammatory conditions of the colon and small intestine, generally characterized by similar symptoms of immune dysregulation and indeterminate etiology. Major sub-types of IBD are recognized clinically as Crohn's disease and ulcerative colitis. In addition to Crohn's disease and ulcerative colitis, IBD may also include conditions recognized as any one of the following: collagenous colitis, lymphocytic colitis, ischaemic colitis, diversion colitis, Behçet's syndrome or indeterminate colitis. The difference between these conditions relate primarily to the location and nature of the inflammatory changes in the Attorney Docket No. UM-42619.601 gastrointestinal tract (GIT). Crohn's disease, for example, is generally recognized as potentially affecting any part of the gastrointestinal tract, from mouth to anus, with a majority of the cases marked by relapsing and remitting granulomatous inflammation of the alimentary tract in the terminal ileum and colon. Ulcerative colitis, in contrast, is generally considered to be restricted to the colon and the rectum. The various regions of the gastrointestinal tract in which these inflammatory conditions may exhibit symptoms include: the bowel or intestine, including: the small intestine (which has three parts: the duodenum, the jejunum, and the ileum); the large intestine (which has three parts: the cecum, the colon, which includes the ascending colon, transverse colon, descending colon and sigmoid flexure; and the rectum); and, the anus. A “cancer” or “neoplasm” is any unwanted growth of cells serving no physiological function. In general, a cancer cell has been released from its normal cell division control, i.e., a cell whose growth is not regulated by the ordinary biochemical and physical influences in the cellular environment. Thus, “cancer” is a general term for diseases characterized by abnormal uncontrolled cell growth. In most cases, a cancer cell proliferates to form clonal cells that are malignant. The lump or cell mass, “neoplasm” or “tumour,” is generally capable of invading and destroying surrounding normal tissues. By “malignancy”, as used herein, is meant as an abnormal growth of any cell type or tissue that has a deleterious effect in the organism having the abnormal growth. The term “malignancy” or “cancer” includes cell growths that are technically benign but which carry the risk of becoming malignant. Cancer cells may spread from their original site to other parts of the body through the lymphatic system or blood stream in a process known as “metastasis.” Many cancers are refractory to treatment and prove fatal. Examples of cancers or neoplasms include, without limitation, transformed and immortalized cells, tumours, carcinomas, in various organs and tissues as described herein or known to those of skill in the art. Most cancers fall within three broad histological classifications: carcinomas, which are the predominant cancers and are cancers of epithelial cells or cells covering the external or internal surfaces of organs, glands, or other body structures (for e.g., skin, uterus, lung, breast, prostate, stomach, bowel), and which tend to metastasize; carcinomas, which are derived from connective or supportive tissue (for e.g., bone, cartilage, tendons, ligaments, fat, muscle); and hematologic tumours, which are derived from bone marrow and lymphatic tissue. Carcinomas may be adenocarcinomas (which generally develop in organs or glands capable of secretion, such as breast, lung, colon, prostate or bladder) or may be squamous cell carcinomas (which originate in the squamous epithelium and generally develop in most areas of the body). Sarcomas may be osteosarcomas or osteogenic sarcomas (bone), chondrosarcomas (cartilage), Attorney Docket No. UM-42619.601 leiomyosarcomas (smooth muscle), rhabdomyosarcomas (skeletal muscle), mesothelial sarcomas or mesotheliomas (membranous lining of body cavities), fibrosarcomas (fibrous tissue), angiosarcomas or hemangioendotheliomas (blood vessels), liposarcomas (adipose tissue), gliomas or astrocytomas (neurogenic connective tissue found in the brain), myxosarcomas (primitive embryonic connective tissue), or mesenchymous or mixed mesodermal tumours (mixed connective tissue types). Hematologic tumours may be myelomas, which originate in the plasma cells of bone marrow; leukemias which may be “liquid cancers” and are cancers of the bone marrow and may be myelogenous or granulocytic leukemia (myeloid and granulocytic white blood cells), lymphatic, lymphocytic, or lymphoblastic leukemias (lymphoid and lymphocytic blood cells) or polycythemia vera or erythremia (various blood cell products, but with red cells predominating); or lymphomas, which may be solid tumours and which develop in the glands or nodes of the lymphatic system, and which may be Hodgkin or Non-Hodgkin lymphomas. In addition, mixed type cancers, such as adenosquamous carcinomas, mixed mesodermal tumours, carcinosarcomas, or teratocarcinomas also exist. Cancers may also be named based on the organ in which they originate i.e., the “primary site,” for example, cancer of the breast, brain, lung, liver, skin, prostate, testicle, bladder, colon and rectum, cervix, uterus, etc. This naming persists even if the cancer metastasizes to another part of the body that is different from the primary site. With the present invention, treatment is directed to the site of the cancer, not type of cancer, so that a cancer of any type that is symptomatic or etiologically located in the lung, for example, would be treated on the basis of this localization in the lung. DETAILED DESCRIPTION OF THE INVENTION Many PRR agonist-based adjuvants are administered as a single agonist and can only activate a single or a few innate immune pathways, poorly mimicking naturally occurring immune responses to pathogens. Mounting evidence shows that combining PRR agonists can promote synergistic immune activation. Furthermore, TLR agonist multivalency can enhance innate immune activation via receptor oligomerization. However, the combinatorial and spatial space of PRR agonists remains largely unexplored: it remains poorly understood how combinations of agonists of different compositions, spatial densities, and ratios function at the molecular, cellular, and organismal levels and influence innate and adaptive immune responses. Further exacerbating these knowledge gaps is a shortage of modular tools that enable precise control over the spatial organization of PRR agonists and their stoichiometric ratios in combinatorial agonist platforms. While many synthetic nanomaterials have been developed for Attorney Docket No. UM-42619.601 spatial modulation and delivery of TLR agonists, the increased translational complexity, risk of materials-induced inflammatory response, and potential batch-to-batch variations associated with many nanoparticle formulations remain challenges. These knowledge and technological gaps underscore a need to develop a modular platform capable of precise spatial and combinatorial control of innate immune activation, for tuning desired immune responses as well as potentially enabling dose sparing. Motivated by the clinical successes of RNA therapeutics such as messenger RNA vaccines, experiments were conducted to address the above challenges by leveraging the structural, sequence, and functional versatilities of RNA to develop an “all-in-one” innate immune agonist platform. Building upon the recognition of RNA structural motifs by specific PRRs, a polymeric RNA (polyRNA) structure was engineered that comprises many repeat units, serving as both a modular multifunctional agonist and a molecular scaffold for patterning multiple agonists and other modalities (Fig.1). By exploiting the versatility of a previously developed rolling circle transcription (RCT) method for synthesizing a polymeric form of small interfering RNA (siRNA), RNA with modular agonist motifs and building blocks was constructed to sculpt the immune response. Further inspired by the recent discovery of endogenous glycosylated RNA and the immune cell-targeting and activation capabilities of fungal cell wall polysaccharides, mannan along the polyRNA scaffold was generated to create a synthetic glyco-RNA capable of self-delivery, targeting to APCs, and multimodal innate immune activation. Such an “all-in-one” adjuvant was shown to closely mimic the naturally occurring multifaceted recognition of RNA viruses and other pathogens by the innate immune system. The “all-in-one” adjuvant provides multifold advantages: (1) precise spatial modulation and combinations of innate immune agonists, juxtaposed in the same molecule to ensure coactivation of innate immune pathways in the same cell; (2) multivalent presentation of agonists with structural flexibility to optimally engage PRRs; (3) technological enablement of mechanistic studies of how combinations and spatial densities of agonists mediate different immune responses; (4) all-natural bioactive components for agonist design and targeted delivery. The “all-in-one” adjuvant further provides the following conceptual innovations: (1) harnessing RNA as a multifunctional scaffold to precisely couple innate immune agonists in a spatially controlled fashion, to understand combinatorial and synergistic efficacies and to optimize immune response profiles, representing a departure from the status quo in using synthetic nanomaterials or complex chemistries for spatial modulation or integration of multiple agonists; (2) engineering an “all-in-one” RNA as both adjuvant cargo and a targeted delivery Attorney Docket No. UM-42619.601 platform, in contrast to most approaches focusing on either delivery vehicle or agonist molecule design only; (3) introducing a bioinspired synthetic glyco-RNA platform for immune cell- targeted delivery of RNA therapeutics. In conjunction, the “all-in-one” adjuvant provides major technical innovations: (1) enzymatic synthesis of a versatile DNA-encoded polymeric RNA platform for precise spatial patterning of innate immune agonists and other diverse functionalities; (2) elimination of the requirement for synthetic nanomaterials for multivalent presentation or delivery of innate immune agonists, thus decreasing translational complexity and risks of materials-induced inflammatory responses. Furthermore, by virtue of templated enzymatic synthesis, the sequence- defined patterning of the agonists in polyRNA provides absolute consistency in spatial separation. Accordingly, the invention provides therapeutic comprising polymeric macromolecules, wherein each of the polymeric macromolecules comprise a plurality of connected pattern recognition receptor (PRR) agonists, wherein each of the PRR agonists comprise an nucleic acid molecule capable of activating a specific PRR. Specifically, the pattern of PRR agonists is designed to recapitulate a distinct portion of one or more PRR agonist signatures of one or more pathogens. The plurality of PRR agonists are formulated together in a manner enabling combined presentation in a mammalian subject so as to modulate an immune response. Aspects of the invention involve compositions comprising one or more polymeric macromolecules, wherein each of the polymeric macromolecules comprise a plurality of connected PRR agonists, and wherein each of the polymeric macromolecules include at least two different PRR agonists. In some aspects, the plurality of connected PRR agonists are formulated together for combined presentation following administration to a mammalian subject. In some aspects, the plurality of connected PRR agonists are arranged to recapitulate a distinct portion of one or more PRR agonist signatures of one or more pathogens. In some aspects, a specific PRR agonist within the plurality of connected PRR agonists is present two or more times. In some aspects, the present two or more times is between 2 and 1,000,000 times. In some aspects, two or more different PRR agonists within the plurality of connected PRR agonists are each independently present two or more times. In some aspects, the present two or more times is between 2 and 1,000,000 times. In some aspects, at least one of the PRR agonists comprises a hairpin loop within the nucleic acid molecule. In some aspects, at least one of the PRR agonists comprises single stranded RNA (ssRNA) and / or single stranded DNA (ssDNA) within the nucleic acid molecule. In some aspects, the ssRNA and / or ssDNA within the nucleic acid molecule is between 4 and Attorney Docket No. UM-42619.601 1000 bases. In some aspects, the percentage of guanine / uracil bases within the ssRNA is between 0 and 100%. In some aspects, at least one of the PRR agonists comprises double stranded RNA (dsRNA) and / or double stranded DNA (dsDNA) within the nucleic acid molecule. In some aspects, the dsRNA and / or dsDNA within the nucleic acid molecule is between 1 and 500 base pairs. In some aspects, at least one of the PRR agonists comprises a 5’- triphosphate moiety within the nucleic molecule. In some aspects, at least one of the PRR agonists comprises a stem moiety within the nucleic acid molecule. In some aspects, the plurality of connected PRR agonists are arranged in a linear one-by- one manner. In some aspects, each PRR agonist within the series of linearly connected PRR agonists is successively positioned in a linear one-by-one manner. In some aspects, the plurality of connected PRR agonists are arranged in a non-linear manner. In some aspects, the plurality of PRR agonists is between 2 and 10,000 PRR agonists; or 2 and 1,000 PRR agonists; or 2 and 100 PRR agonists; or 2 and 10 PRR agonists. In some aspects, the number of different PRR agonists within each polymeric macromolecule is between 2 and 10,000; or 2 and 1,000 PRR agonists; or 2 and 100 PRR agonists; or 2 and 10 PRR agonists. In some aspects, the plurality of PRR agonists is selected from 3 PRR agonists, 4 PRR agonists, 5 PRR agonists, 6 PRR agonists, 7 PRR agonists, 8 PRR agonists, 9 PRR agonists, 10 PRR agonists, 11 PRR agonists, 12 PRR agonists, 13 PRR agonists, 14 PRR agonists, 15 PRR agonists, 16 PRR agonists, 17 PRR agonists, 18 PRR agonists, 19 PRR agonists, 20 PRR agonists, 25 PRR agonists, and 50 PRR agonists. In some aspects, the plurality of different PRR agonists within each polymeric macromolecule is selected from 3 PRR agonists, 4 PRR agonists, 5 PRR agonists, 6 PRR agonists, 7 PRR agonists, 8 PRR agonists, 9 PRR agonists, 10 PRR agonists, 11 PRR agonists, 12 PRR agonists, 13 PRR agonists, 14 PRR agonists, 15 PRR agonists, 16 PRR agonists, 17 PRR agonists, 18 PRR agonists, 19 PRR agonists, 20 PRR agonists, 25 PRR agonists, and 50 PRR agonists. In some aspects, at least one of the polymeric macromolecules or the composition further comprise a targeting moiety to facilitate a targeted delivery of the polymeric macromolecule to a desired location. Indeed, the polymeric macromolecules or compositions can also be associated (e.g., complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed)) with one or more targeting moieties. Targeting moieties can cause such compositions and polymeric macromolecules to localize onto a tumor, disease site, site of interest for imaging, or any other desired site. Targeting molecules include but are not limited to antibody molecules, growth Attorney Docket No. UM-42619.601 receptor ligands, vitamins, peptides, fungal wall polysaccharides, haptens, aptamers, and other targeting molecules known to those skilled in the art. Specific, non-limiting examples of targeting moieties include vitamins, ligands, amines, peptide fragments, antibodies, aptamers, a transferrin, an antibody or fragment thereof, sialyl Lewis X antigen, lipoids (including cationic, neutral, and steroidal lipids, virosomes, and liposomes), hyaluronic acid, mannan, mannose derivatives, glucose derivatives, cell specific lectins, galaptin, galectin, lactosylceramide, a steroid derivative, an RGD sequence, EGF, EGF-binding peptide, urokinase receptor binding peptide, a thrombospondin-derived peptide, an albumin derivative and / or a molecule derived from combinatorial chemistry. In some aspects, the targeting moiety comprises an antibody specific for a macrophage, dendritic cell, NK cell, NKT, or T cell antigen. In certain aspects, the targeting moiety comprises a scFv, nanobody, peptide, minibody, polynucleotide aptamer, heavy chain variable region, light chain variable region or fragment thereof. In some aspects, the targeting moiety is selected from mannose, mannose-6-phosphate, mannan, fucose, and n-acetylglucosamine. In some aspects, the targeting moiety comprises an antibody, such as an antibody selected from an intact polyclonal antibody, an intact monoclonal antibody, an antibody fragment, a single chain Fv (scFv) mutant, a multispecific antibody, a bispecific antibody, a chimeric antibody, a humanized antibody, a human antibody, a fusion protein comprising an antigenic determinant portion of an antibody, and modified immunoglobulin molecules comprising antigen recognition sites. In some aspects, the targeting moiety comprises an antibody selected from Muromonab-CD3, Abciximab, Rituximab, Daclizumab, Palivizumab, Infliximab, Trastuzumab (herceptin), Etanercept, Basiliximab, Gemtuzumab ozogamicin, Alemtuzumab, Ibritumomab tiuxetan, Adalimumab, Alefacept, Omalizumab, Efalizumab, Tositumomob-I131, Cetuximab, Bevacizumab, Natalizumab, Ranibizumab, Panitumumab, Eculizumab, Rilonacept, Certolizumab pegol, Romiplostim, AMG-531, CNTO-148, CNTO- 1275, ABT-874, LEA-29Y, Belimumab, TACI-Ig, Second generation anti-CD20, ACZ-885, Tocilizumab, Atlizumab, Mepolizumab, Pertuzumab, Humax CD20, Tremelimumab (CP-675 206), Ticilimumab, MDX-010, IDEC-114, Inotuzumab ozogamycin, HuMax EGFR, Aflibercept, HuMax-CD4, Ala-Ala, ChAglyCD3, TRX4, Catumaxomab, IGN101, MT-201, Pregovomab, CH-14.18, WX-G250, AMG-162, AAB-001, Motavizumab, MEDI-524, Efumgumab, Aurograb, Raxibacumab, Third generation anti-CD20, LY2469298, and Veltuzumab. Attorney Docket No. UM-42619.601 In some aspects, the targeting moiety binds to a receptor selected from the group consisting of a sialoadhesin receptor, a folate receptor, a galactose receptor, a mannose receptor, a β-glucan receptor, a scavenger receptor, and a tuftsin receptor. In some aspects, the targeting moiety is selected from the group consisting of sialic acid, 9-N-(4H-thieno[3,2-c]chromene-2-carbamoyl)-Neu5Acα2-3Ga1β-4G1cNAc (TCCNeu5Ac), folic acid, methotrexate, folate, galactose residue, lactose, low density lipoprotein (LDL), ovalbumin (OVA), lactobionic acid, mannose-rich glycoconjugates, mannose, mannan, mannosylated poly(L-lysine) (MPL), zymosan and other β-glucans, glucan, poly-guanine, and apoB protein fragment. In some aspects, the targeting moiety comprises any of the nanoparticles, liposomes, adjuvants, antibodies or antigens described herein. In some aspects, at least one of the polymeric macromolecules further comprise one or more of mannan, mannose, β-glucan, N-acetylgalactosamine, polysaccharide A1, hyaluronic acid, a-galactosylceramide, cholesterol, and α-tocopherol succinate. In some aspects, the composition further comprises one or more of mannan, mannose, β- glucan, N-acetylgalactosamine, polysaccharide A1, hyaluronic acid, a-galactosylceramide, cholesterol, and α-tocopherol succinate. In some aspects, the composition is associated with a liposome moiety, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed. In some aspects, the polymeric macromolecule is associated with a liposome moiety, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed. In some aspects, the PRR agonists may for example be available commercially, for example in widely available preparations of attenuated or killed recombinant bacteria, which may for example be ligands for TLR2, TLR4 and TLR5. Compositions of pathogen-associated molecular patterns (PAMPs) may include PAMPS that are recognized by PRRs, including: Toll- like receptors (TLRs), NOD-like receptors (NLRs), RIG-I-like receptors (RLRs), C-type lectin receptors (CLRs) including Dectin-1, cytosolic dsDNA sensors (CDSs) and NLRs involved in the formation of inflammasomes. Toll-like receptor 2 (TLR2) is involved in the recognition of a wide array of microbial molecules representing broad groups of species including Gram-positive and Gram-negative bacteria, as well as mycoplasma and yeast. TLR2 recognizes cell-wall components such as peptidoglycan, lipoteichoic acid and lipoprotein from Gram-positive bacteria, Attorney Docket No. UM-42619.601 lipoarabinomannan from mycobacteria, and zymosan from the yeast cell wall. Toll-like receptor 3 (TLR3) recognizes double-stranded RNA (dsRNA). Bacterial lipopolysaccharide (LPS) is recognized by Toll-like receptor 4 (TLR4) which interacts with at least three different extracellular proteins: LPS-binding protein (LBP), CD14 and, myeloid differentiation protein 2 (MD-2), to induce a signaling cascade leading to the activation of NF-κB and the production of proinflammatory cytokines. LPS generally consists of a polysaccharide region that is anchored in the outer bacterial membrane by a carbohydrate lipid moiety: lipid A, which is largely responsible for the immunostimulatory activity of LPS. Particularly active forms of lipid A contain six fatty acyl groups, as for example may be found in pathogenic bacteria that are strains of Escherichia coli or Salmonella spp. Toll-like receptor 5 (TLR5) recognizes flagellin from both Gram-positive and Gram-negative bacteria. Toll-like receptor 7 (TLR7) and TLR8 recognize single stranded RNAs and small synthetic molecules such as imidazoquinolines and nucleoside analogs. Toll-like receptor 9 (TLR9) recognizes specific unmethylated CpG motifs prevalent in microbial but not vertebrate genomic DNA. NLRs are a family of at least 22 cytoplasmic innate immune sensors, including NOD1 (CARD4) and NOD2 (CARD15) which are intracellular pattern-recognition receptors involved in the recognition of peptidoglycan (PGN). These receptors detect specific motifs within PGN. NOD1 senses the diaminopimelatic acid (DAP)-containing muropeptide (specifically d-Glu- meso-DAP dipeptide “iE-DAP” dipeptide) which is found primarily in PGN of Gram-negative bacteria, as well as certain Gram-positive bacteria. NOD2 recognizes the muramyl dipeptide (MDP) structure found in almost all bacterial PGN. The RIG-I-Like receptors (RLRs), particularly RIG-I and MDA-5, detect viral RNA species. CLR ligands include Dectin-1 and Mincle (macrophage-inducible C-type lectin) agonists. Dectin-1 is a specific receptor for β-glucans, which are glucose polymers found in the cell walls of fungi. Mincle is a multi-tasking danger signal receptor that recognizes a wide variety of ligands such as damaged cells, fungal components, yeast components and components of mycobacteria. Cytosolic DNA Sensors (CDS) bind intracellular DNA from pathogens, and there are multiple CDSs which may display contextual preferences for the recognition of particular DNAs. Cyclic dinucleotides (CDNs) and xanthenone derivatives, such as DMXAA, bind to and activate STING (STimulator of INterferon Genes). Attorney Docket No. UM-42619.601 The inflammasome is a multi-protein complex involved in the production of mature IL- 1β, specifically through cleavage of pro-IL-1β and pro-IL-18 into active and secretable forms. Inflammasomes may be segregated into NLRP1, NLRP3, NLRC4 and AIM2 subtypes, which are activated by a wide variety of microbial molecules, danger signals and crystalline substances. In some aspects, the PRR agonist is a STING agonist. The CDNs cyclic-di-AMP (produced by Listeria monocytogenes) and its analog cyclic-di-GMP (produced by Legionella pneumophila) are recognized by a host cell as a PAMP (Pathogen Associated Molecular Pattern), which bind to the PRR known as STING. STING is an adaptor protein in the cytoplasm of host mammalian cells which activates the TANK binding kinase (TBK1)-IRF3 signaling axis, resulting in the induction of IFN-β and other IRF-3 dependent gene products that strongly activate innate immunity. It is now recognized that STING is a component of the host cytosolic surveillance pathway, that senses infection with intracellular pathogens and in response induces the production of IFN-β, leading to the development of an adaptive protective pathogen-specific immune response consisting of both antigen-specific CD4 and CD8 T cells as well as pathogen- specific antibodies. In some aspects, each of the plurality of PRRs and PRR agonists is independently selected from: TLR2 and TLR2 agonists, TLR3 and TLR3 agonists, TLR4 and TLR4 agonists, TLR5 and TLR5 agonists, TLR7 / 8 and TLR7 / 8 agonists, TLR9 and TLR9 agonists, NOD1 and NOD1 agonists, NOD2 and NOD2 agonists, TLR2 / NOD2 and TLR2 / NOD2 agonists, NOD1 / NOD2 and NOD1 / NOD2 agonists, RIG1 / MDA5 and RIG1 / MDA5 agonists, DAI and DAI agonists, LRRFIP1 and LRRFIP1 agonists, AIM2 and AIM2 agonists, RIG1 and RIG1 agonists, Dectin-1 and Dectin-1 agonists, Attorney Docket No. UM-42619.601 Mincle and Mincle agonists, STING and STING agonists, MDA5 and MDA5 agonists, LGP2 and LGP2 agonists, DDX41 and DDX41 agonists, DHX9 and DHX9 agonists, DDX3 and DDX3 agonists, DDX36 and DDX36 agonists, DDX-1-DDX-21-DDX36 and DDX-1-DDX-21-DDX36 agonists, DDX60 and DDX60 agonists, KU70 and KU70 agonists, cGAS and cGAS agonists, NLRP3 and NLRP3 agonists, IFI16 and IFI16 agonists, LRRFIP1 and LRRFIP1 agonists, DAI and DAI agonists, CDS and CDS agonists, RLR and RLR agonists, CLR and CLR agonists, IFIT1 and IFIT1 agonists, IFIT2 and IFIT2 agonists, IFIT3 and IFIT3 agonists, and IFIT5 and IFIT5 agonists. In some aspects, one or more of the polymeric macromolecules further comprise one or more portions of nucleic acid molecules not characterized as a PRR agonist. In some aspects, the composition is capable of stimulating and / or modulating an innate immune response in a mammalian subject upon administration to the mammalian subject. In some aspects, the composition is used to elicit an immune response to a vaccine application. In some aspects, the composition is capable of stimulating an innate immune response in at least one cancer cell upon administration to the subject, wherein the mammalian subject is suffering from cancer. In some aspects, stimulating an innate immune response comprises stimulating an innate cytokine response mediated through cytokines, wherein the innate cytokine response is mediated through type 1 interferon. Attorney Docket No. UM-42619.601 In some aspects, the composition is further associated with an antigen, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed; and / or the polymeric macromolecule is further associated with an antigen, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed. In some aspects, the antigen is selected from the group consisting of alpha-actinin-4, Bcr-Abl fusion protein, Casp-8, beta-catenin, cdc27, cdk4, cdkn2a, coa-1, dek-can fusion protein, EF2, ETV6-AML1 fusion protein, LDLR-fucosyltransferaseAS fusion protein, HLA- A2, HLA-A11, hsp70-2, KIAAO205, Mart2, Mum-1, 2, and 3, neo-PAP, myosin class I, OS-9, pml-RARα fusion protein, PTPRK, K-ras, N-ras, Triosephosphate isomeras, Bage-1, Gage 3,4,5,6,7, GnTV, Herv-K-mel, Lage-1, Mage-A1,2,3,4,6,10,12, Mage-C2, NA-88, NY-Eso- 1 / Lage-2, SP17, SSX-2, and TRP2-Int2, MelanA (MART-I), gp100 (Pmel 17), tyrosinase, TRP- 1, TRP-2, MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, p15(58), CEA, RAGE, NY-ESO (LAGS), SCP-1, Hom / Mel-40, PRAME, p53, H-Ras, HER-2 / neu, BCR-ABL, E2A-PRL, H4- RET, IGH-IGK, MYL-RAR, Epstein Barr virus antigens, EBNA, human papillomavirus (HPV) antigens E6 and E7, TSP-180, MAGE-4, MAGE-5, MAGE-6, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, TAG-72-4, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, β-Catenin, CDK4, Mum-1, p16, TAGE, PSMA, PSCA, CT7, telomerase, 43-9F, 5T4, 791Tgp72, α-fetoprotein, 13HCG, BCA225, BTAA, CA 125, CA 15-3 (CA 27.29\BCAA), CA 195, CA 242, CA-50, CAM43, CD68\KP1, CO-029, FGF-5, G250, Ga733 (EpCAM), human EGFR protein or its fragments, such as human EGFR residues 306–325 (SCVRACGADSYEMEEDGVRK (SEQ ID NO: 1)) and residues 897–915 (VWSYGVTVWELMTFGSKPY (SEQ ID NO: 2)), HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB\70K, NY-CO-1, RCAS1, SDCCAG16, TA-90 (Mac-2 binding protein\cyclophilin C-associated protein), TAAL6, TAG72, TLP, TPS, WT1 (and WT1- derived peptide sequences: WT1126–134 (RMFP NAPYL (SEQ ID NO: 3)), WT1122–140 (SGQARMFPNAPYLPSCLES (SEQ ID NO: 4)), and WT1122–144 (SGQARMFPNAPYLPSCLESQPTI (SEQ ID NO: 5)), MUC1 (and MUC1-derived peptides and glycopeptides such as RPAPGS (SEQ ID NO: 6), PPAHGVT (SEQ ID NO: 7), and PDTRP (SEQ ID NO: 8))), LMP2, EGFRvIII, Idiotype, GD2, Ras mutant, p53 mutant, Proteinase3 (PR1), Survivin, hTERT, Sarcoma translocation breakpoints, EphA2, EphA4, LMW-PTP, PAP, ML-IAP, AFP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, ALK, Androgen receptor, Cyclin B1, Polysialic acid, MYCN, RhoC, TRP-2, GD3, Fucosyl GM1, Mesothelin, sLe(animal), CYP1B1, PLAC1, GM3, BORIS, Tn, GloboH, NY-BR-1, RGS5, SART3, STn, Carbonic anhydrase IX, PAX5, OY-TES1, Sperm protein 17, LCK, HMWMAA, AKAP-4, Attorney Docket No. UM-42619.601 XAGE 1, B7H3, Legumain, Tie 2, Page4, VEGFR2, MAD-CT-1, FAP, PDGFR- alpha, PDGFR-β, MAD-CT-2, Fos-related antigen 1, ERBB2, Folate receptor 1 (FOLR1 or FBP), IDH1, IDO, LY6K, fms-related tyro- sine kinase 1 (FLT1, best known as VEGFR1), KDR, PADRE, TA-CIN (recombinant HPV16 L2E7E6), SOX2, neoantigens, and aldehyde dehydrogenase. In some aspects, the antigen is derived from a self-antigen. In some aspects, the antigen is conjugated to the outer surface of the composition; and / or the antigen is conjugated to the polymeric macromolecule. In some aspects, the composition is associated with an adjuvant, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed; and / or the polymeric macromolecule is associated with an adjuvant, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed. In some aspects, the adjuvant is selected from the group consisting of CPG, polyIC, poly-ICLC, 1018 ISS, aluminum salts (for example, aluminum hydroxide, aluminum phosphate), Amplivax, BCG, CP-870,893, CpG7909, CyaA, dSLIM, Cytokines (such as GM- CSF, IL-2, IFN-a, Flt-3L), IC30, IC31, Imiquimod, ImuFact IMP321, IS Patch, ISS, ISCOMATRIX, Juvlmmune, LipoVac, MF59, monophosphoryl lipid A, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, Montanide ISA-51, OK-432, OM-174, OM-197-MP- EC, ONTAK, PepTel.RTM, vector system, PLGA microparticles, imiquimod, resiquimod, gardiquimod, 3M-052, SRL172, Virosomes and other Virus-like particles, YF-17D, VEGF trap, beta-glucan, Pam3Cys, Aquila's QS21 stimulon, vadimezan, AsA404 (DMXAA), 3M MEDI9197, glucopyranosyl lipid adjuvant (GLA), GLA-SE, CD1d ligands (such as C20:2, OCH, AH04-2, α-galatosylceramide, α-C-galatosylceramide,α-mannosylceramide, α- fructosylceramide, β-galatosylceramide, β-mannosylceramide), STING agonists (e.g. cyclic dinucleotides, including Cyclic [G(3’,5’)pA(3’,5’)p], Cyclic [G(2’,5’)pA(3’,5’)p], Cyclic [G(2’,5’)pA(2’,5’)p], Cyclic diadenylate monophosphate, Cyclic diguanylate monophosphate), CL401, CL413, CL429, Flagellin, RC529, E6020, imidazoquinoline-based small molecule TLR- 7 / 8a (including its lipidated analogues), virosomes, AS01, AS02, AS03, AS04, AS15, IC31, CAF01, ISCOM, Cytokines (such as GM-CSF, IL-2, IFN-a, Flt-3L), bacterial toxins (such as CT, and LT), any derivative of an adjuvant, and any combination of adjuvant. In some aspects, composition is associated with a nanoparticle, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed; and / or the polymeric macromolecule is associated with a nanoparticle, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed. Attorney Docket No. UM-42619.601 In some aspects, the nanoparticle is selected from the group consisting of sHDL nanoparticles, metal-polyhistidine-DOPE@liposome, metal-polyhistidine-PEG, 4arm-PEG- polyhistidine-metal hydrogels, sHDL-polyhistidine, fullerenes, endohedral metallofullerenes buckyballs, trimetallic nitride templated endohedral metallofullerenes, single-walled and mutli- walled carbon nanotubes, branched and dendritic carbon nanotubes, gold nanorods, silver nanorods, single-walled and multi-walled boron / nitrate nanotubes, carbon nanotube peapods, carbon nanohorns, carbon nanohorn peapods, liposomes, nanoshells, dendrimers, any nanostructures, microstructures, or their derivatives formed using layer-by-layer processes, self- assembly processes, or polyelectrolytes, microparticles, quantum dots, superparamagnetic nanoparticles, nanorods, cellulose nanoparticles, glass and polymer micro- and nano-spheres, biodegradable PLGA micro- and nano-spheres, gold nanoparticles, silver nanoparticles, carbon nanoparticles, iron nanoparticles, modified micelles, and metal-organic framework (MOF) coordination polymer (CP). In some aspects, the composition is associated with one or more of a nanoparticle, a liposome, a dendrimer, a micelle, a nanoemulsion, a nanosuspension, a niosome, a nanocapsule, a magnetic nanoparticle, a lipoprotein-based carrier, andor a lipoplex nanoparticle; wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed; and / or the polymeric macromolecule is associated with one or more of a nanoparticle, a liposome, a dendrimer, a micelle, a nanoemulsion, a nanosuspension, a niosome, a nanocapsule, a magnetic nanoparticle, a lipoprotein-based carrier, andor a lipoplex nanoparticle; wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed. In some aspects, at least one of the polymeric macromolecules and / or compositions further comprise an imaging moiety. In some aspects, at least of the polymeric macromolecules is associated with (e.g., complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed) an imaging moiety. In some aspects, the composition is associated with (e.g., complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed) an imaging moiety. In some aspects, the imaging agent is selected from a fluorophore, radionuclide, biotin, luciferase, fluorescein, rhodamine, GFP, FITC, Alexa Fluor®, Cy3, CyS, BODIPY, cyanine dye,11C,13N,15O,18F,123I,125I,131I,64Cu, or32P, and a quantum dot or gold nanoparticle. Certain aspects of the invention provide a composition comprising a DNA molecule encoding one or more polymeric macromolecules as described herein. In some aspects, the DNA Attorney Docket No. UM-42619.601 molecule is a circular DNA molecule. In some aspects, rolling circle transcription of the circular DNA molecule with an RNA polymerase results in generation of one or more polymeric macromolecules encoded by the circular DNA molecule. In some aspects, the RNA polymerase is T7 RNA polymerase. Certain aspects of the invention provide a method, comprising transcribing a circular DNA molecule encoding one or more polymeric macromolecules as described herein, wherein the circular DNA molecule is transcribed with rolling circle transcription with an RNA polymerase, wherein the transcribing results in generation of one or more polymeric macromolecules encoded by the circular DNA molecule. In some aspects, the RNA polymerase is a T7 RNA polymerase. Certain aspects of the invention provide methods for treating or preventing an immune dysregulation in a mammalian subject comprising administering to the mammalian subject a composition comprising one or more of the described polymeric macromolecules, wherein the administering results in stimulating and / or modulating an innate immune response in the mammalian subject. In some aspects, the mammalian subject is suffering from a disease or condition characterized by the immune dysregulation. In some aspects, the disease or condition is a cancer, an infectious disease, an autoimmune disorder, and / or an inflammatory disorder. In some aspects, the cancer is selected from the group consisting of breast, brain, thyroid, prostate, colorectal, pancreas, cervix, stomach, endometrium, liver, bladder, ovary, testis, head and neck, skin, mesothelial lining white blood cells, esophagus, muscle, connective tissue, lung, adrenal gland, kidney, bone or testicle cancer, and metastasis thereof. In some aspects, the disease or condition is one or more disease or condition selected from: Acne vulgaris; Acute disseminated encephalomyelitis; Acute hemorrhagicleukoencephalitis; Addison's Disease; Agammaglobulinemia; Allergies; Alopecia areata; Alzheimer's; Amyotrophic Lateral Sclerosis; autoimmune anaemia, hemolytic anaemia; pernicious anaemia; Ankylosing spondylitis; Anti-GBM / TBM Nephritis; Antiphospholipid syndrome; Antisynthetase syndrome; Arteritis, temporal (also known as “giant cell arteritis”); Arthritis, juvenile; Arthritis, psoriatic; Arthritis, reactive (Reiter's syndrome, rea); Arthritis, rheumatoid; Asthma; Atherosclerosis; Atopic allergy; Atopic dermatitis; Autoimmune enteropathy; Autoimmune aplastic anemia; Balo disease / Balo concentric sclerosis; Bartter syndrome; Bechets Syndrome; Berger's disease; Bickerstaff's encephalitis; Blau syndrome; Bronchitis, chronic; Bullous pemphigoid; Bursitis; Cardiomyopathy, autoimmune; Castleman's disease; Celiac disease; Chronic fatigue syndrome; Chronic inflammatory demyelinating Attorney Docket No. UM-42619.601 polyneuropathy; Chronic recurrent multifocal osteomyelitis; Churg-Strauss syndrome; Cicatricialpemphigoid; Cirrhosis, primary biliary Cogan syndrome; Cold agglutinin disease; Colitis; Complement component 2 deficiency; Connective tissue disease, mixed; Connective tissue disease, undifferentiated COPD (chronic obstructive lung disease); Cranial arteritis; CREST syndrome; Cryoglobulinemia; Cushing's Syndrome; Cutaneous leukocytoclasticangiitis; Cystitis, interstitial; Dacryadenitis; Dego's disease; Dercum's disease; Dermatitis; Dermatitis herpetiformis; Dermatitis, autoimmune progesterone; Dermatomyositis; Diabetes; Diabetes insipidus, nephrogenic; Diabetes mellitus type 1; Diffuse cutaneous systemic sclerosis; Discoid lupus erythematosus; Diverticulitis; Dressler's syndrome; Dysmenorrhea (menstrual cramps / pain); Eczema; Endometriosis; Enthesitis-related arthritis; Eosinophilic fasciitis; Eosinophilic gastroenteritis; Epidermolysisbullosaacquisita; Erythema nodosum, Essential mixed cryoglobulinemia; Evan's syndrome; Fibrodysplasiaossificansprogressiva; Fibromyalgia; Fibrosingaveolitis; Gastritis, atrophic; Gastrointestinal pemphigoid; Giant cell arteritis; Glomerulonephritis; Goodpasture's syndrome; Gout, acute; Gout, arthritic; Graves' disease; Guillain-Barré syndrome (GBS); Haemolytic anaemia; Hashimoto's encephalitis; Hashimoto's thyroiditis; Hemolyticanemia, autoimmune; Henoch-Schonleinpurpura; Hepatitis, autoimmune; Hepatitis, viral; Herpes gestationis; Hypogammaglobulinemia; Idiopathic Inflammatory Demyelinating Diseases; Idiopathic pulmonary fibrosis; Iga nephropathy; Ileus (bowel obstruction); Inclusion body myositis; Inflammatory bowel disease, Crohn's disease; Inflammatory bowel disease, ulcerative colitis; Inflammatory demyelinating polyneuopathy; Inner ear disease, autoimmune; Interstitial cystitis; Irritable bowel syndrome (IBS); Juvenile idiopathic arthritis; Juvenile rheumatoid arthritis; Kawasaki's Disease; Kidney stones Lambert- Eaton myasthenic syndrome; Leukocytoclasticvasculitis; Lichen planus; Lichen sclerosus; Linear iga disease (LAD); Lou Gehrig's disease (Also Amyotrophic lateral sclerosis); Lupoid hepatitis; Lupus; Lupus erythematous; Lymphoproliferative syndrome, autoimmune; Majeed syndrome; Meniere's disease; Meningitis; Microscopic polyangiitis; Miller-Fisher syndrome; Morphea; Mucha-Habermann disease; Multiple sclerosis; Multiple sclerosis; Myasthenia gravis; Myositis; Myositis, inclusion body; Nephritis; Nephrotic syndrome; Neuromyelitisoptica (Also Devic's Disease); Neuromyotonia; Neutropenia; Neutropenia caused by a myelosuppressive chemotherapy; Occular cicatricial pemphigoid; Ocular inflammation (acute and chronic non- bacterial inflammation of the anterior part of the eyes); Opsoclonus myoclonus syndrome; Ord thyroiditis; Osteoarthritis; Paget's disease of bone; Palindromic rheumatism; Pancreatitis, autoimmune; PANDAS (pediatric autoimmune neuropsychiatric disorders associated with streptococcus); Paraneoplastic cerebellar degeneration; Parkinson's; Paroxysmal nocturnal Attorney Docket No. UM-42619.601 hemoglobinuria (PNH); Parry Romberg syndrome; Pars planitis; Parsonnage-Turner syndrome; Pelvic inflammatory disease; Pemphigus; Pemphigus vulgaris; Pericarditis, non-rheumatic; Peripheral neuropathy, autoimmune; Perivenous encephalomyelitis; POEMS syndrome; Polyarteritisnodosa; Polychondritis, relapsing Polyendocrine syndrome, autoimmune; Polymyalgia rheumatica; Polymyalgia rheumatica; Polymyositis; Primary sclerosing cholangitis; Progressive inflammatory neuropathy; Prostatitis, chronic Pseudogout; Psoriasis; Psoriasis; Pure red cell aplasia; Pyodermagangrenosum; Rasmussen's encephalitis; Raynaud phenomenon; Reiter's syndrome; Restless leg syndrome; Retinopathy of prematurity; Retroperitoneal fibrosis; Rheumatoid fever; Rhinitis, allergic; Sarcoidosis; Schmidt syndrome; Schnitzler syndrome; Scleritis; Scleroderma; Sclerosis, systemic; Sjogren's syndrome; Spondyloarthropathy; Still's disease; Subacute bacterial endocarditis (SBE); Susac's syndrome; Sweet's syndrome; Sydenham chorea; Sympathetic ophthalmia; Takayasu's arteritis; Temporomandibular joint disorder (TMJD or TMD), or TMJ syndrome; Thrombocytopenic purpura, autoimmune; Thrombocytopenic purpura, idiopathic Tolosa-Hunt syndrome; Transplant rejection; Transverse myelitis; Undifferentiated spondyloarthropathy; Urticaria; Uveitis, autoimmune; Valvular disease, non- rheumatic; Vasculitis; Vitiligo, and Wegener's granulomatosis. In some aspects, the cancer is one or more selected from bladder cancer, brain cancer, breast cancer, cervical cancer, ovarian cancer, colo-rectal cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, nasopharangeal cancer, pancreatic cancer, prostate cancer, skin cancer, stomach cancer, gastric cancer, head and neck cancer, testicular cancer, melanoma, acute myelogenous leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia, T cell lymphocytic leukemia, and B cell lymphomas, and uterine cancer. In some aspects, the autoimmune disorder is selected from Systemic lupus erythematosus, Aicardi–Goutières syndrome, Acute pancreatitis Age-dependent macular degeneration, Alcoholic liver disease, Liver fibrosis, Metastasis, Myocardial infarction, Nonalcoholic steatohepatitis (NASH), Parkinson’s disease, Polyarthritis / fetal and neonatal anemia, Sepsis, inflammatory bowel disease, and multiple sclerosis. In some aspects, the composition is administered in an amount effective to modulate an adaptive immune response in the mammalian subject. In some aspects, the administration site is the skin or subcutaneous tissue. In some aspects, the administration site is enteric. In some aspects, the administration site is non-enteric. In some aspects, the administration site is the respiratory tract. In some aspects, the composition is formulated for systemic distribution of the PRR agonists following administration. Attorney Docket No. UM-42619.601 In some aspects, administration of the composition is intracutaneous, subcutaneous, intravenous, intraperitoneal, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, transdermal, transtracheal, subcuticular, intraarticular, intratumoral, subcapsular, subarachnoidal, intraspinal, intrasternal, oral, sublingual, buccal, rectal, vaginal, nasal or ocular, or by infusion, inhalation, or nebulization. In some aspects, the composition is administered in a plurality of doses over a dosage duration, and the dosage duration is at least two weeks. In some aspects, the doses are administered subcutaneously every day, or every other day. In some aspects, mammalian subject is a human patient. In some aspects, the human patient is immunosuppressed or immunocompromised. In some aspects, the human patient is a geriatric patient. In some aspects, the human patient is a pediatric patient. Compositions of the invention (e.g., having one or more polymeric macromolecules) may be provided alone or in combination with other compounds (for example, nucleic acid molecules, small molecules, peptides, or peptide analogues), in the presence of a liposome, an adjuvant, or any pharmaceutically acceptable carrier, in a form suitable for administration to mammals, for example, humans (a “therapeutic vehicle”). As used herein “pharmaceutically acceptable carrier” or “excipient” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. The carrier can be suitable for any appropriate form of administration, including subcutaneous, intradermal, intravenous, parenteral, intraperitoneal, intramuscular, sublingual, inhalational, intratumoural or oral administration. Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. Treatment with the polymeric macromolecules according to the invention may be combined with more traditional and existing therapies. For cancer, for example, these may include chemotherapy, radiation therapy, surgery, etc., or with a therapy that stimulates the immune system, reduces inflammation or otherwise benefits the subject, such as nutrients, vitamins and supplements. For example, vitamin A, vitamin D, vitamin E, vitamin C, vitamin B complex, selenium, zinc, co-enzyme Q10, beta carotene, fish oil, curcumin, green tea, bromelain, resveratrol, ground flaxseed, garlic, lycopene, milk thistle, melatonin, other antioxidants, cimetidine, indomethacin, or COX-2 Inhibitors (e.g., Celebrex™ [celecoxib] or Vioxx™ [rofecoxib]) may be also be administered to the subject. Conventional pharmaceutical practice may be employed to provide suitable formulations or compositions to administer the polymeric macromolecules to subjects. Alternative routes of Attorney Docket No. UM-42619.601 administration may be employed, for example, parenteral, intravenous, intradermal, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intrathecal, intracisternal, intraperitoneal, intranasal, inhalational, aerosol, topical, intratumoural, sublingual or oral administration. Therapeutic formulations may be in the form of liquid solutions or suspensions; for oral administration, formulations may be in the form of tablets or capsules; for intranasal formulations, in the form of powders, nasal drops, or aerosols; and for sublingual formulations, in the form of drops, aerosols or tablets. Methods well known in the art for making formulations are found in, for example, “Remington's Pharmaceutical Sciences” (20th edition), ed. A. Gennaro, 2000, Mack Publishing Company, Easton, Pa. Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes. Biocompatible, biodegradable lactide polymer, lactide / glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds. Other potentially useful parenteral delivery systems for include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation may contain excipients, for example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel. For therapeutic or prophylactic compositions, the pathogenic bacterial species are administered to an individual in an amount effective to stop or slow progression or metastasis of the cancer, or to increase survival of the subject (relative to, for example, prognoses derived from the SEER database) depending on the disorder. Pharmaceutical compositions or formulations may be packaged in a variety of ways depending upon the method used for administering the drug. For example, an article of manufacture or package may include a container having deposited therein the pharmaceutical formulation in an appropriate form. Suitable containers may for example include materials such as bottles (plastic and glass), sachets, ampoules, plastic bags, metal cylinders, and vials. The container may have a sterile access port, for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle. The package or container may also include a tamper-proof or multi-use mechanism adapted to control access to the contents of the package or the container, for example a multi dose vial adapter matched to a vial contained in the package. The container or package may include a label, for example a lable that describes the contents of the container, for example a drug label identifying the pharmaceutical composition therein and / or specifying modes or routes of Attorney Docket No. UM-42619.601 administration. The label may also include appropriate warnings, for example specifying storage conditions for the container or package, or setting out contraindications or adverse effects of a mode of treatment. Articles of manufacture may accordingly take the form of a “kit” comprising pharmaceutical compositions or accessories adapted to facilitate use of pharmaceutical compositions. Kits may include a label or package insert, where the term “package insert” is used to refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration, contraindications and / or warnings concerning the use of such therapeutic products. Kits may further include accessories associated with use of the pharmaceutical composition, including buffers, diluents, filters, needles, and syringes. Kits may also be adapted for the delivery of selected dosage forms of a pharmaceutical composition, for example including a number of unit dosages. Such kits can include a memory aid or mechanism, in the form of a physical or written indication of the intended timing of a treatment schedule in which the dosages are to be used. An “effective amount” of a composition according to the invention includes a therapeutically effective amount or a prophylactically effective amount. A “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result, such as reduction or elimination of the immune dysregulation. A therapeutically effective amount of a composition may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the compound to elicit a desired response in the individual. Dosage regimens may be adjusted to provide the optimum therapeutic response. A therapeutically effective amount may also be one in which any toxic or detrimental effects of the composition are outweighed by the therapeutically beneficial effects. A “prophylactically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result, such as amelioration of immune dysregulation. Typically, a prophylactic dose is used in subjects prior to or at an earlier stage of cancer, so that a prophylactically effective amount may be less than a therapeutically effective amount. For any particular subject, the timing and dose of treatments may be adjusted over time (e.g., timing may be daily, every other day, weekly, monthly) according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions. For example, in the context of subcutaneous or intradermal administration, the compositions may be administered every second day. An initial dose of approximately 0.05 ml may be administered subcutaneously, followed by increases from 0.01-0.02 ml every second day until an adequate skin reaction is achieved at the injection site (for example, a 1 inch to 2 inch Attorney Docket No. UM-42619.601 diameter delayed reaction of visible redness at the injection site). Once this adequate immune reaction is achieved, this dosing is continued as a maintenance dose. The maintenance dose may be adjusted from time to time to achieve the desired visible skin reaction (inflammation) at the injection site. Dosing may be for a dosage duration, for example of at least 1 week, 2 weeks, 2 months, 6 months, 1, 2, 3, 4, or 5 years or longer. Oral dosages may for example range from 4 times per day, daily or weekly. Dosing may be for a dosage duration, for example of at least 1 week, 2 weeks, 2 months, 6 months, 1, 2, 3, 4, or 5 years or longer. In some aspects, the invention may include compositions administered sublingually or by inhalation, or administered to one or more epithelial tissues (i.e., skin by intradermal or subcutaneous injection; lung epithelium by inhalation; gastrointestinal mucosa by oral ingestion; mouth mucosa by sublingual administration) simultaneously or sequentially. Accordingly, in some aspects the compositions of the invention are administered so as to provoke an immune response in an epithelial tissue. In some aspects, one or more epithelial routes of administration may be combined with one or more additional routes of administration, such as intratumoural, intramuscular or intravenous administration. In the case of immunogenic formulations, an immunogenically effective amount of a composition of the invention can be provided, alone or in combination with other compounds, for example with an immunological adjuvant. The composition may for example include polymeric macromolecules linked with a carrier molecule, such as bovine serum albumin or keyhole limpet hemocyanin to enhance immunogenicity. An immunogenic composition is a composition that includes materials that elicit a desired immune response. An immunogenic composition may select, activate or expand, without limitation: memory B, T cells, neutrophils, monocytes or macrophages of the immune system. In another aspect, a method of monitoring efficacy of a treatment regime in an individual being treated for an immune dysfunction in a specific organ or tissue is provided. The method involves measuring a characteristic of an immune response in a post-treatment immune sample obtained from the specific organ or tissue after the individual has been subject to the treatment regime for a period of time. In certain aspects, compositions comprising polymeric macromolecules capable of stimulating an innate immune response in a subject upon administration to the subject are associated with (e.g., complexed, conjugated, encapsulated, absorbed, adsorbed, admixed) modified micelle moieties. In these aspects, the modified micelle comprises polyol polymers modified to contain a hydrophobic polymer block. The term “hydrophobic polymer block” as used in the present disclosure indicates a segment of the polymer that on its own would be Attorney Docket No. UM-42619.601 hydrophobic. The term “micelle” as used herein refers to an aggregate of molecules dispersed in a liquid. A typical micelle in aqueous solution forms an aggregate with the hydrophilic “head” regions in contact with surrounding solvent, sequestering the hydrophobic single tail regions in the micelle centre. In some aspects the head region may be, for example, a surface region of the polyol polymer while the tail region may be, for example, the hydrophobic polymer block region of the polyol polymer. In certain aspects, compositions comprising polymeric macromolecules capable of stimulating an innate immune response in a subject upon administration to the subject are associated with (e.g., complexed, conjugated, encapsulated, absorbed, adsorbed, admixed) liposome moieties. Amphipathic lipids include, for example, any lipid molecule which has both a hydrophobic and a hydrophilic moiety. Examples include phospholipids or glycolipids. Examples of phospholipids which may be used include but are not limited to dipalmitoylphosphatidylcholine (DPPC), dioleoyl-sn-glycero-3-phosphoethanolamine-N-[3-(2- pyridyldithio) propionate] (DOPE-PDP), 1,2-dipalmitoyl-sn-glycero-3-phosphothioethanol, 1,2- di-(9Z-octadecenoyl)-sn-glycero-3-phosphoethanolamine-N-[4-(p- maleimidophenyl)butyramide], 1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine-N-[4-(p- maleimidophenyl)butyramide], 1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine-N-[4-(p- maleimidomethyl)cyclohexane-carboxamide], 1,2-di-(9Z-octadecenoyl)-sn-glycero-3- phosphoethanolamine-N-[4-(p-maleimidomethyl)cyclohexane-carboxamide], phosphatidylcholine, phosphatidylinositol, phosphatidylserine, phosphatidylethanolamine, and combinations thereof. In some aspects, the phospholipid is complexed with an imaging agent (e.g., rhodamine (Rhod)-labeled DOPE (DOPE-Rhod)). In some aspects, the phospholipids are thiol reactive phospholipids such as, for example, Dioleoyl-sn-glycero-3-phosphoethanolamine- N-[3-(2-pyridyldithio) propionate] (DOPE-PDP), 1,2-dihexadecanoyl-sn-glycero-3- phosphothioethanol, or N-4-(p-maleimidophenyl)butyryl) dipalmitoylphosphatidylethanolamine (MPB-DPPE)). In some aspects, exemplary phospholipids include, but are not limited to, small alkyl chain phospholipids, egg phosphatidylcholine, soybean phosphatidylcholine, dipalmitoylphosphatidylcholine, dimyristoylphosphatidylcholine, distearoylphosphatidylcholine 1-myristoyl-2-palmitoylphosphatidylcholine, 1-palmitoyl-2-myristoylphosphatidylcholine, 1- palmitoyl-2-stearoylphosphatidylcholine, 1-stearoyl-2-palmitoylphosphatidylcholine, dioleoylphosphatidylcholine dioleophosphatidylethanolamine, dilauroylphosphatidylglycerol phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, phosphatidylinositol, Attorney Docket No. UM-42619.601 phosphatidylglycerols, diphosphatidylglycerols such as dimyristoylphosphatidylglycerol, dipalmitoylphosphatidylglycerol, distearoylphosphatidylglycerol, dioleoylphosphatidylglycerol, dimyristoylphosphatidic acid, dipalmitoylphosphatidic acid, dimyristoylphosphatidylethanolamine, dipalmitoylphosphatidylethanolamine, dimyristoylphosphatidylserine, dipalmitoylphosphatidylserine, brain phosphatidylserine, brain sphingomyelin, egg sphingomyelin, milk sphingomyelin, palmitoyl sphingomyelin, phytosphingomyelin, dipalmitoylsphingomyelin, distearoylsphingomyelin, dipalmitoylphosphatidylglycerol salt, phosphatidic acid, galactocerebroside, gangliosides, cerebrosides, dilaurylphosphatidylcholine, (1,3)-D-mannosyl-(1,3)diglyceride, aminophenylglycoside, 3-cholesteryl-6′-(glycosylthio)hexyl ether glycolipids, and cholesterol and its derivatives. Phospholipid fractions including SM and palmitoylsphingomyelin can optionally include small quantities of any type of lipid, including but not limited to lysophospholipids, sphingomyelins other than palmitoylsphingomyelin, galactocerebroside, gangliosides, cerebrosides, glycerides, triglycerides, and cholesterol and its derivatives. In some aspects, the lipid molecule is a membrane-forming lipid molecule. In some aspects, the lipid molecule molecule is a non-membrane-forming lipid molecule. Examples of lipid molecules applicable with the aspects of the present invention include, but are not limited to, phospholipids such as lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebrosides, dicetylphosphate, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoyl-phosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), palmitoyloleyol-phosphatidylglycerol (POPG), dioleoylphosphatidylethanolamine 4- (N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl- phosphatidylethanolamine (DPPE), dimyristoyl-phosphatidylethanolamine (DMPE), distearoyl- phosphatidylethanolamine (DSPE), monomethyl-phosphatidylethanolamine, dimethyl- phosphatidylethanolamine, dielaidoyl-phosphatidylethanolamine (DEPE), stearoyloleoyl- phosphatidylethanolamine (SOPE), lysophosphatidylcholine, dilinoleoylphosphatidylcholine, and mixtures thereof. Other diacylphosphatidylcholine and diacylphosphatidylethanolamine phospholipids can also be used. The acyl groups in these lipids are preferably acyl groups derived from fatty acids having C10-C24carbon chains, e.g., lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl. Attorney Docket No. UM-42619.601 Other non-limiting examples of lipid molecules include sterols such as cholesterol and derivatives thereof such as cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2′- hydroxyethyl ether, cholesteryl-4′-hydroxybutyl ether, and mixtures thereof. Other examples of lipid molecules suitable for use in the present invention include nonphosphorous containing lipids such as, e.g., stearylamine, dodecylamine, hexadecylamine, acetyl palmitate, glycerolricinoleate, hexadecyl stereate, isopropyl myristate, amphoteric acrylic polymers, triethanolamine-lauryl sulfate, alkyl-aryl sulfate polyethyloxylated fatty acid amides, dioctadecyldimethyl ammonium bromide, ceramide, sphingomyelin, and the like. Other examples of lipid molecules suitable for use in the present invention include fatty acids and derivatives or analogs thereof. They include oleic acid, lauric acid, capric acid (n- decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C1-10alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654). Other examples of lipid molecules suitable for use in the present invention include a lipid molecule modified with PEG (PEG-lipid). Examples of PEG-lipids include, but are not limited to, PEG coupled to dialkyloxypropyls (PEG-DAA) as described in, e.g., PCT Publication No. WO 05 / 026372, PEG coupled to diacylglycerol (PEG-DAG) as described in, e.g., U.S. Patent Publication Nos.20030077829 and 2005008689, PEG coupled to phospholipids such as phosphatidylethanolamine (PEG-PE), PEG conjugated to ceramides as described in, e.g., U.S. Pat. No.5,885,613, PEG conjugated to cholesterol or a derivative thereof, and mixtures thereof. The disclosures of these patent documents are herein incorporated by reference in their entirety for all purposes. Additional PEG-lipids include, without limitation, PEG-C-DOMG, 2 KPEG- DMG, and a mixture thereof. PEG is a linear, water-soluble polymer of ethylene PEG repeating units with two terminal hydroxyl groups. PEGs are classified by their molecular weights; for example, PEG 2000 has an average molecular weight of about 2,000 daltons, and PEG 5000 has an average molecular weight of about 5,000 daltons. PEGs are commercially available from Sigma Chemical Co. and other companies and include, for example, the following: monomethoxypolyethylene glycol (MePEG-OH), monomethoxypolyethylene glycol-succinate Attorney Docket No. UM-42619.601 (MePEG-S), monomethoxypolyethylene glycol-succinimidyl succinate (MePEG-S-NHS), monomethoxypolyethylene glycol-amine (MePEG-NH2), monomethoxypolyethylene glycol- tresylate (MePEG-TRES), and monomethoxypolyethylene glycol-imidazolyl-carbonyl (MePEG- IM). Other PEGs such as those described in U.S. Pat. Nos.6,774,180 and 7,053,150 (e.g., mPEG (20 KDa) amine) are also useful for preparing the PEG-lipid conjugates of the present invention. The disclosures of these patents are herein incorporated by reference in their entirety for all purposes. In addition, monomethoxypolyethyleneglycolacetic acid (MePEG-CH2COOH) is particularly useful for preparing PEG-lipid conjugates including, e.g., PEG-DAA conjugates. The PEG moiety of the PEG-lipid conjugates described herein may comprise an average molecular weight ranging from about 550 daltons to about 10,000 daltons. In certain instances, the PEG moiety has an average molecular weight of from about 750 daltons to about 5,000 daltons (e.g., from about 1,000 daltons to about 5,000 daltons, from about 1,500 daltons to about 3,000 daltons, from about 750 daltons to about 3,000 daltons, from about 750 daltons to about 2,000 daltons, etc.). In preferred aspects, the PEG moiety has an average molecular weight of about 2,000 daltons or about 750 daltons. In certain instances, the PEG can be optionally substituted by an alkyl, alkoxy, acyl, or aryl group. The PEG can be conjugated directly to the lipid or may be linked to the lipid via a linker moiety. Any linker moiety suitable for coupling the PEG to a lipid can be used including, e.g., non-ester containing linker moieties and ester-containing linker moieties. In a preferred aspect, the linker moiety is a non-ester containing linker moiety. As used herein, the term “non- ester containing linker moiety” refers to a linker moiety that does not contain a carboxylic ester bond (—OC(O)—). Suitable non-ester containing linker moieties include, but are not limited to, amido (—C(O)NH—), amino (—NR—), carbonyl (—C(O)—), carbamate (—NHC(O)O—), urea (—NHC(O)NH—), disulphide (—S—S—), ether (—O—), succinyl (— (O)CCH2CH2C(O)—), succinamidyl (—NHC(O)CH2CH2C(O)NH—), ether, disulphide, as well as combinations thereof (such as a linker containing both a carbamate linker moiety and an amido linker moiety). In a preferred aspect, a carbamate linker is used to couple the PEG to the lipid. In other aspects, an ester containing linker moiety is used to couple the PEG to the lipid. Suitable ester containing linker moieties include, e.g., carbonate (—OC(O)O—), succinoyl, phosphate esters (—O—(O)POH—O—), sulfonate esters, and combinations thereof. Phosphatidylethanolamines having a variety of acyl chain groups of varying chain lengths and degrees of saturation can be conjugated to PEG to form the lipid conjugate. Such phosphatidylethanolamines are commercially available, or can be isolated or synthesized using Attorney Docket No. UM-42619.601 conventional techniques known to those of skilled in the art. Phosphatidylethanolamines containing saturated or unsaturated fatty acids with carbon chain lengths in the range of C10to C20are preferred. Phosphatidylethanolamines with mono- or diunsaturated fatty acids and mixtures of saturated and unsaturated fatty acids can also be used. Suitable phosphatidylethanolamines include, but are not limited to, dimyristoyl- phosphatidylethanolamine (DMPE), dipalmitoyl-phosphatidylethanolamine (DPPE), dioleoylphosphatidylethanolamine (DOPE), and distearoyl-phosphatidylethanolamine (DSPE). Certain aspects of the invention provide compositions comprising a DNA molecule encoding one or more polymeric macromolecules as described herein. In some aspects, the DNA molecule is a circular DNA molecule. In some aspects, rolling circle transcription of the circular DNA molecule with an RNA polymerase results in generation of one or more polymeric macromolecules encoded by the circular DNA molecule. In some aspects, the RNA polymerase is T7 RNA polymerase. Certain aspects of the invention provide methods comprising transcribing a circular DNA molecule encoding one or more polymeric macromolecules as described herein, wherein the circular DNA molecule is transcribed with rolling circle transcription with an RNA polymerase, wherein the transcribing results in generation of one or more polymeric macromolecules encoded by the circular DNA molecule. In some aspects, the RNA polymerase is a T7 RNA polymerase. The invention further provides a method of inducing a neoplasia / tumor specific immune response in a subject, vaccinating against a neoplasia / tumor, treating and or alleviating a symptom of cancer in a subject by administering the subject a composition comprising polymeric macromolecules as described herein. According to the invention, the above-described cancer vaccine may be used for a patient that has been diagnosed as having cancer, or at risk of developing cancer. In one aspect, the patient may have a solid tumor such as breast, ovarian, prostate, lung, kidney, gastric, colon, testicular, head and neck, pancreas, brain, melanoma, and other tumors of tissue organs and hematological tumors, such as lymphomas and leukemias, including acute myelogenous leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia, T cell lymphocytic leukemia, and B cell lymphomas. The present disclosure further provides kits comprising compositions comprising polymeric macromolecules as described herein or the ingredients necessary to synthesize such compositions. In some aspects, the kit includes all of the components necessary, sufficient or useful for administering such compositions to a mammalian subject. Attorney Docket No. UM-42619.601 EXPERIMENTAL The following examples are provided in order to demonstrate and further illustrate certain preferred aspects and aspects of the present invention and are not to be construed as limiting the scope thereof. Example 1. A study of a polymeric form of siRNA was conducted and the immunostimulatory and therapeutic potential of large RNA concatemers was demonstrated. Using an isothermal RCT method with a dumbbell DNA template, polymeric RNAs (polyRNAs) of up to ~3000 bases were synthesized, consisting of hairpin repeats containing a 25-base pair (bp) stem, linked by spacer sequences (Fig.2A). When complexed with biodegradable polymers, the polyRNA enhanced TLR3 activation in vitro over the clinically tested TLR3 agonist poly(I:C), with additional TLR7 activation (Fig.2B). Notably, the polyRNA significantly prolonged survival in a syngeneic ID8Trp53- / -mouse model of ovarian cancer, compared to poly(I:C) (Fig.2C). Enzymatically removing hairpin loops reduced innate immune activation and therapeutic efficacy. Example 2. Engineer a modular polymeric RNA-scaffolding platform for spatially defined combinatorial control of innate immune signaling. Rationale. Despite widespread exploration of vaccine adjuvants, few adjuvants, particularly PRR agonists, are approved for clinical use in vaccines, in part due to (1) reliance on mostly single-agonist systems, poorly mimicking natural pathogen recognition by the innate immune system; (2) poor mechanistic understanding of how combinations of agonists mediate synergistic or inhibitory immune responses; (3) limited tools for precise spatial modulation and combination of agonists. To address these challenges, we will engineer a modular molecular scaffold for controlled combination and spatial patterning of PRR agonists. By encoding and enzymatically synthesizing repeat RNA sequences through rolling circle transcription, we will use polyRNA repeats as building blocks to pattern multiple agonists, while providing structural flexibility to optimize multivalent PRR engagement. We will pursue a bottom-up approach, exploring the polyRNA backbone first and then expanding the RNA as a scaffold (Fig.3). The modular platform will enable exploration of structure-function relationships and ultimately the rational design of multi-PRR agonists for tuning innate immune activation. Attorney Docket No. UM-42619.601 Synthesize a library of polyRNA backbones with combinations of RIG-I, TLR3, and TLR7 / 8 agonists. We will first explore the combinatorial design space of the polyRNA backbone, which can integrate three structural motifs as PRR agonists: (1) double-stranded RNA (dsRNA) for TLR3 and melanoma differentiation-associated protein-5 (MDA5) activation; (2) single-stranded RNA (ssRNA) for TLR7 / 8 activation; (3) 5’ triphosphate dsRNA for RIG-I activation. To synthesize a library of polyRNA backbones, we will design a series of circular DNA templates that encode the polyRNA repeats. Circular templates will be generated by ligating linear DNA, followed by RCT by T7 RNA polymerase at 37°C for 24-48 hours to generate large RNA concatemers. The template library will span different structural features in the polyRNA backbone design space: (1) dsRNA motif lengths (0-40 bp); (2) ssRNA motif lengths (6-30 bases); (3) percentage of G / U bases in ssRNA motifs (50-100%), as TLR7 / 8 can exhibit increased specificity for G / U-rich ssRNA25. As TLR3 activation occurs in a largely sequence-independent manner, a randomized dsRNA sequence will be used across the library. In addition, all the polyRNAs will contain a 5’ triphosphate, introducing the possibility of RIG-I activation. Systematic variation of the ds- and ssRNA lengths can modulate innate immune activation via both length-dependent TLR activation and spatial separation of the TLR agonists, as each component serves as a spacer between other agonists. Structural characterization. We will analyze the polyRNA size distributions by agarose gel electrophoresis and probe RNA folding by sequence-specific enzymatic digests. We will further use (1) atomic force microscopy (AFM); and (2) negative stain single-particle electron microscopy (EM) for screening the panel of polyRNAs. Both techniques will provide initial pictures of the folding, structural homogeneity, and any self-assembled or aggregate structures of the polyRNA, as functions of the ds- and ssRNA region repeat regions. These results, combined with evaluations of innate immune activation and efficacy in this and subsequent aims, will pave the way towards future in-depth studies using single-particle cryo-EM to elucidate the mechanisms of polyRNA engagement with various PRRs and inform the rational design of polyRNA. In vitro studies. We will assess PRR signaling induced by the polyRNA library, using reporter cell lines (InvivoGen), including HEK-BlueTMhuman and mouse TLR3, TLR7, and TLR8, and HEK-LuciaTMRIG-I cells, each of which co-expresses a specific PRR and a secreted downstream reporter. As a proof-of-principle, we will use the transfection reagent LipofectamineTM3000 for screening. EC50 values will be determined via dose response curves (0.1-10,000 ng / mL). As the modular polyRNA design enables independent variation of each component, we will determine the effects of RNA motif lengths and spatial separation using Attorney Docket No. UM-42619.601 individual PRR reporter cell lines. As positive controls, we will use known PRR agonists: high molecular weight poly(I:C) (TLR3), resiquimod (TLR7 / 8), and 5’ triphosphate 19-bp dsRNA (RIG-I). Next, to evaluate the overall effects of polyRNA-linked PRR combinations on downstream signaling, we will measure (1) NF-κB transcription factor activity and interferon stimulatory genes (ISGs) expression using RAW264.7 mouse macrophage and THP-1 human monocyte reporter cells; (2) mouse bone-marrow-derived dendritic cell (BMDC) activation (CD40, CD80, CD86 markers) and secreted cytokine profiles (IFN-β, TNF-α, IL-6, IL-12p70). In addition to the abovementioned known PRR agonists, we will include a physical mixture of these agonists to assess whether multivalent combinations of PRR agonists in a single molecule enhance activation. We will identify structure-function relationships and determine how combinations and spatial arrangements of agonist motifs along polyRNA exert synergistic or inhibitory effects on immune activation. While rigorous deconvolution of each component is difficult due to the linked nature of polyRNA, the following polyRNA structures will serve as proxies for single-PRR agonist polyRNA controls: (1) TLR3: mostly dsRNA repeats with minimal (<6 base) ssRNA spacers to enable template circularization, with 5’ triphosphate removal by RNA 5’ pyrophosphohydrolase; (2) TLR7 / 8: completely ssRNA repeats, with 5’ triphosphate removal; (3) RIG-I and TLR3: same as (1) but without 5’ triphosphate removal. Introduce patterned TLR9 agonists onto the polyRNA scaffold and tune agonist ratios and spatial densities to define a spectrum of immune response profiles. We will next harness polyRNA as a scaffold to attach TLR9 agonists in a spatially controlled manner (Fig.3). The defined sequence of each repeat enables hybridization of complementary DNA strands with extended CpG-rich sequences, acting like combs along the RNA backbone. We will design a library of polyRNAs with these parameters: (1) hybridization sequence length (10-20 bases); (2) CpG DNA comb length (20-40 bases); (3) dsRNA (10-30 bp) and ssRNA (12-42 bases) spacer lengths. We will start from a subset of backbones identified in Aim 1.1 with synergistic innate immune activation and add backbones with extended ssRNA regions for longer hybridization and / or spacer sequences. The polyRNA backbones will be heated to 95°C with the CpG combs and slowly cooled to room temperature for hybridization. Hybridization will be verified via gel electrophoresis and enzyme digests with RNase H and DNase I. We will carry out structural characterization via AFM and negative stain EM screening. In vitro evaluations of innate immune activation will be performed with LipofectamineTM: (1) activation of specific PRRs, including TLR9, in reporter cell lines; (2) NF-κB activation and ISG expression in RAW264.7 and THP-1 reporter cells; (3) BMDC activation and secreted cytokine profiles. Ratios of TLR9 to TLR3 and TLR7 / 8 agonists will be Attorney Docket No. UM-42619.601 tuned by titrating the molar amounts of CpG DNA combs hybridized. The in vitro immune response profiles will be compared among the polyRNA scaffolds, RNA backbones without CpG combs, CpG combs alone, and known PRR agonists (including CpG oligodeoxynucleotide for TLR9) and their physical mixtures to determine synergistic or inhibitory effects of agonist combinations in the polyRNA scaffold. Success criteria and statistical analysis: PolyRNA structural features will be optimized based on successful PRR activation by each agonist programmed in the polyRNA and synergistic combinations of PRR agonist components, as determined by dose response curves and BMDC activation. Dose response curves will be assessed via EC50 values and Bliss / Loewe synergy scoring to assess combinatorial effects in polyRNA, using the abovementioned single- PRR agonist polyRNA proxies and known PRR agonists. Significant differences in immune activation profiles will be assessed by ANOVA with a Tukey post hoc test. Anticipated outcomes and alternative strategies. We anticipate that integrating multiple PRR agonists along the polyRNA scaffold will promote synergistic innate immune activation over single agonists and physical agonist mixtures due to the polyRNA’s spatial control, structural flexibility, and juxtaposition of agonists in the same molecule for cellular coactivation. We expect the defined repeating nature of polyRNA will enable control of a spectrum of immune response profiles via tuning of agonist spatial arrangement and ratios. Example 3. Develop a synthetic strategy for mannan-decorated polyRNA. To create a synthetic glyco-polyRNA, we will conjugate mannan to polyRNA via reductive amination. Mannan will be oxidized by sodium periodate to obtain aldehyde groups and then incubated with a polyRNA scaffold containing hybridized amine-modified CpG DNA strands, in the presence of sodium cyanoborohydride. The conjugates will be characterized by polyacrylamide gel electrophoresis (PAGE) to determine changes in migration. AFM and negative stain transmission electron microscopy will be used to characterize the glyco-polyRNA conjugate structures. To further assess whether the glyco-polyRNAs form self-assembled nanostructures, we will carry out dynamic light scattering measurements. Importantly, we will evaluate the stability of glyco-polyRNA against nuclease degradation by incubating the glyco- polyRNA in human serum at 37°C and assessing RNA degradation by PAGE. The amount of mannan for conjugation will be titrated to optimize the serum stability of glyco-polyRNA. Evaluate the cellular uptake and innate immune activation capabilities of glyco- polyRNA. We will assess the uptake of Cy5-labeled glyco-polyRNA, generated using Cy5-UTP Attorney Docket No. UM-42619.601 during RCT, by mouse BMDCs after one and four hours of incubation, using flow cytometry and confocal microscopy. Glyco-polyRNA generated with varying amounts of mannan conjugation will be tested. Mannan only and unmodified polyRNA will be included as comparisons. To verify the immune cell targeting specificity and uptake mechanisms of mannan-decorated polyRNA, we will (1) measure uptake in the presence of antibodies against different receptors that can recognize mannan (Dectin-1, Dectin-2, CD206, CD209, TLR2, and TLR4) or inhibitors of scavenger receptor class A-mediated and clathrin-mediated endocytosis; (2) compare uptake of the glyco-polyRNA in various non-immune cell lines. We will next measure the activation of specific PRRs by glyco-polyRNA, unmodified polyRNA, and mannan only in HEK-BlueTMreporter cell lines as in Aim 1, with the addition of TLR2, TLR4, Dectin- 1, and Dectin-2 reporter cell lines to test whether glyco-polyRNA additionally activates these PRRs. Zymosan and lipopolysaccharide will be used as positive controls for Dectin-1 / 2 and TLR2 / 4 activation, respectively. Activation of BMDCs by glyco-polyRNA will be assessed by (1) staining for CD40 and CD86 activation markers; (2) measuring secreted cytokines, including IFN-β, IL-6, TNF-α, and IL-12p70. As a benchmark, we will use a clinically approved lipid nanoparticle packaging system (DLin-MC3-DMA) 27for the polyRNA. Success criteria: Optimization of glyco-polyRNA design will be guided by (1) the absence of nuclease degradation of glyco-polyRNA over 24 hours in serum; (2) comparable RNA uptake levels by BMDCs using glyco-polyRNA versus lipid nanoparticle-packaged polyRNA; (3) BMDC activation levels that are equal or greater than those induced by unmodified polyRNA. We will evaluate synergistic effects of mannan and polyRNA agonist components and perform statistical comparisons of BMDC activation. Anticipated outcomes and alternative strategies. As reductive amination has been used to conjugate polysaccharides to proteins, we expect that hybridizing amine-modified DNA to polyRNA will allow successful conjugation of mannan. We anticipate that conjugating mannan along polyRNA will enable multivalent interactions with target PRRs on BMDCs that, along with polyRNA’s structural flexibility, will promote robust cellular uptake and immune activation. Example 3. Validate the therapeutic efficacy of the RNA platform in a syngeneic mouse model of melanoma. Rationale. Cancer vaccines are highly promising for training the immune system to recognize and attack tumor cells, but have shown limited clinical benefit to date. The Attorney Docket No. UM-42619.601 development of effective adjuvants that can promote robust antitumor immune responses, as well as identification of suitable tumor antigens, remain major gaps. In situ vaccines can initiate and amplify an antitumor immune response via released tumor antigens from immunogenic cell death and subsequent APC recruitment and activation, providing advantages of (1) presenting a full spectrum of tumor antigens; (2) a simple off-the-shelf approach that does not require resource-intensive ex vivo procedures or individual neo-antigen prediction. To evaluate the translational potential of the “all-in-one” RNA, we will test its therapeutic efficacy as an in situ vaccine in a well-established B16F10 mouse model of melanoma. The poor immunogenicity and high aggressiveness of the B16F10 model provides a rigorous test for the efficacy of the polyRNA. With several TLR agonists in clinical trials as in situ vaccines (e.g., NCT04544007, NCT03865082), we expect that the multipronged glyco-polyRNA can induce more robust antitumor immunity. As the main feasibility goal is to assess the antitumor immune response induced by glyco-polyRNA, we will use localized treatment to decouple potential effects of systemic delivery and toxicity from the immunological functions of the RNA36. We will exploit the rich tumor antigen repertoire in the tumor as a training camp to initiate and amplify an antitumor response in situ that can elicit potential systemic immunity, while minimizing risks of systemic toxicity. As shown by many others, achieving high local bioavailability while confining initial exposure to the tumor via local administration can improve antitumor immunity safely and effectively. Evaluate the antitumor immune response induced by glyco-polyRNA. We will subcutaneously inoculate B16F10 cells into the right flanks of 6-8-week-old C57BL / 6 mice. When average tumor volume reaches 150 mm3, we will administer glyco-polyRNA (10 µg) and control treatments intratumorally every three days for three doses (Table 1). Clinically tested agonists corresponding to the agonist components in the polyRNA will serve as benchmarks, using formulations currently in clinical trials (NCT04570332, nanoplexed poly(I:C) BO112) 41. Lipid nanoparticle (DLin-MC3-DMA)-packaged polyRNA will be used as a delivery benchmark for glyco-polyRNA. While there are further possible combination controls, we prioritize these treatment groups for practical considerations. Tumor size and survival will be monitored daily to evaluate therapeutic efficacy. Body weight will also be monitored to assess systemic toxicity. Any mice with eradicated tumors will be rechallenged with a B16F10 tumor on the contralateral flank to determine systemic long-term antitumor immunity. In vivo profiling of immune response. We will profile the in vivo immune response to glyco-polyRNA in another cohort of mice (n=5-6 per treatment group). Following three treatments, key effector cells in the tumor will be measured by flow cytometry: CD8+T cell Attorney Docket No. UM-42619.601 frequency, CD8+ T cells / CD4+Tregcells, activated CD8+ T cells (IFN-γ, granzyme B expression), activated natural killer cell (CD69+, CD107a+) frequencies, and M1- and M2-like macrophages (CD206 and CD86 expression, respectively). Activated dendritic cells (CD86 expression) in tumor draining lymph nodes will be assessed. We will use ELISA to measure intratumoral and serum cytokine levels (including IFN-β, TNF-α, CXCL-9, and CXCL-10, which are key mediators of antitumor T-cell activation and recruitment) four hours after two doses in a separate cohort (n=5-6 per group). Success criteria and statistical analysis: Overall survival will be compared using a log- rank (Mantel-Cox) test, with success defined as significantly increased survival with glyco- polyRNA over benchmark agonists and lipid nanoparticle-polyRNA. We will use a Cox proportional hazards model to estimate hazard ratio. According to our power analysis using a log-rank test with a 5% significance level and 80% power, we estimate that 10 mice are needed per group for the survival study. Each treatment group will comprise equal numbers of male and female mice to account for sex as a biological variable. We will use ANOVA with Tukey post hoc test to assess differences in tumor volumes, cytokine levels, and flow cytometric quantification of immune cell populations. Anticipated outcomes and alternative strategies. As glyco-polyRNA integrates multiple, spatially controlled PRR agonists and an APC-targeting mannan component, we expect that it can enable multipronged innate immune activation and improved therapeutic efficacy over the benchmark single-PRR agonists. Furthermore, as mannan displayed multivalently on nanoparticles has been shown to induce antitumor immunity, we anticipate that conjugating mannan along the polyRNA scaffold will enhance therapeutic efficacy over mannan alone and lipid nanoparticle-packaged polyRNA. Example 4. This example describes polyRNA synthesis and characterization, hybridization with DNA combs. Reagents: • DNA template T52 (ordered from IDT, purified by RNase-free HPLC). DNA template sequence (T52): 5’phos - CACGAACTTGCTGAT TGATAAGGAGGTGTGGTGTGATGGAAAGTT ATCAGCAAGTTCGTGTTCTTTCAGC CAACAA GCTGAAAGAA (SEQ ID NO: 9) • DNA combs (ordered from IDT, purified by RNase-free HPLC) Attorney Docket No. UM-42619.601 • T4 DNA Ligase - 20000 units (NEB, cat. no. M0202S) • UltraPure™ DNase / RNase-Free Distilled Water (Invitrogen, cat. no.10977015) • NxGen T7 RNA Polymerase (Biosearch, cat. no.30223-1) • Ribonucleotide (NTP) solution mix (NEB, cat. no. N0466) • DNase I (RNase-free) - 5000 units (NEB, cat. no. M0303L) • RNA Clean & Concentrator-25 (Zymo Research, cat.no. R1017) • Agarose (Low-EEO / Multi-Purpose / Molecular Biology Grade) (Fisher BioReagents™, cat. no. BP160-500) • NaCl (5 M), RNase-free (Invitrogen, cat. no. AM9759) • EDTA, 0.5M (pH 8.0), Molecular Grade (Promega™, cat. no. V4233) • UltraPure™ 1 M Tris-HCl Buffer, pH 7.5(Invitrogen, cat. no.15567027) Procedure: Part 1 Ligation of DNA template 1. Use the RNase Away spray to spray the bench, empty tube racks, and pipettes before work, though make sure to wipe dry before using, especially the pipettes. (optional) 2. Prepare the heat block: set to 95°C. 3. Thaw DNA templates and put on ice until use. 4. Thaw the ligation buffer (T4 DNA Ligase buffer (10x)) and put on ice until use. Pipette mix up and down up and down before use. 5. Set up the ligation reaction following the table blow (add all the components except T4 DNA ligase). Use the Eppendorf 0.5 mL tubes. Pour out the tubes onto a clean Kimwipe to avoid RNase contamination. Add water first, then template, and Ligation buffer. Pipette mix up and down as adding small volumes of liquid into the mixture. Ligation Stock Final Volume Attorney Docket No. UM-42619.601 Total volume 180 (uL) naturing / cooling step. at block and let cool slowly in the heat block to room temperature over ~1.5 hours. 7. Keep T4 DNA ligase on ice whenever taking out from freezer. 8. After the reaction has cooled to room temperature, spin down the condensation on the cap briefly and add T4 DNA ligase to the reaction. Pipette mix up and down, also using a larger tip to gently mix well. 9. Incubate for 2 hours at room temperature for the ligation reaction. Part 2 Rolling Circle Transcription (RCT) 1. Add components for RCT reaction to the ligation reaction. Thaw T7 reaction buffer and NTP solution mix, vortexed briefly, and spun down before adding. Keep T7 RNA polymerase on ice whenever taking out from freezer. Add T7 RNA polymerase last and pipette mix. RCT reactions (300 ul) Stock Final Volume t 1000 rpm, for the RCT reaction. 3. After RCT reaction, you will be able to observe some white precipitate near bottom / walls of the tube. Attorney Docket No. UM-42619.601 Part 3 DNase I treatment 1.Set up the following reaction on ice and mix well by inverting the tube for 10 times. Note: Do not spin down. Product Dnase DNase I Reaction Identity volume Total volume (ul) 3. Add 37 ul 0.5 M EDTA to dissolve the white precipitate / cloudiness which is composed of RNA-Mg2+micro-sponges. Mix well by inverting the tube for 10 times. Incubate at room temperature for around 10 min until the solution becomes clear and spin down the liquid attached to the cap and the tube wall. 4. Heat inactivate at 75°C for 10 minutes and cool on ice. Equilibrate the temperature of the mixture to room temperature before starting the column purification procedure in Step 5. 5. Purify the product using RNA Clean & Concentrator-25 (Zymo Research). Follow “Purification of Small and Large RNAs into Separate Fractions” in the protocol provided by the manufacturer to obtain large RNAs (> 200 nt) as the final product. Notes: (1) Number of spin column to use: For T52 use 1 spin column for 900 ul RCT. (2) Use around 80 ul Rnase free water per column for eluting the purified RNA. Part 4 Characterization of polyRNA 1. Measure the concentration by Nanodrop, calculate the “corrected” concentration, make aliquots and store at -80°C. 1.) Obtain the molecular weight (in grams / mol) of one repeat nucleotide sequence of a desired polyRNA a. Using this website (www.bugaco.com / calculators / dna_reverse_complement.php), input the nucleotide sequence of the DNA template the polyRNA was transcribed from to get the reverse complementary repeat polyRNA sequence b. Using this website (www.biosearchtech.com / oligospec-calculator-6628), input the reverse complementary repeat polyRNA sequence to obtain the backbone MW of the desired polyRNA 2.) Calculate the “corrected” concentration of the polyRNA (in ng / uL) Attorney Docket No. UM-42619.601 a. First obtain the raw concentration (in ng / uL) of the polyRNA by NanoDrop UV-Vis spectrophotometry b. Using this website (www.biosearchtech.com / oligospec-calculator-6628), input one repeat nucleotide sequence of the desired polyRNA to obtain the extinction coefficient at 260 nm (Ɛ) c. Calculate the custom factor of desired polyRNA by using the equation below: d. factor used by the Nanodrop to quantify RNA (it is usually 40 ngcm / μL) e. Obtain the ratio between the custom factor and the default factor (custom / default) and multiply this ratio to the raw polyRNA concentration obtained by the Nanodrop to calculate the “corrected” polyRNA concentration 2. Perform a 1.5 % agarose gel electrophoresis to determine the molecular weight distribution of polyRNA synthesized using T52 as a DNA template. The desired average molecular weight of the heat-denatured polyRNA should be around 1000 nt. Running condition: 80V, 1.5 h, 90 ml gel (1.5%). Loading condition: ~400 ng per lane for poly RNA. Denaturation condition: heat the prepared sample at 70°C 4-5 min. Part 5 polyRNA:DNA Hybridization 1. Calculate the amount of nanomoles that corresponds to one repeat nucleotide sequence of a polyRNA depending on the desired X amount (in µg) of polyRNA the user wants to hybridize to DNA using the equation below: 2. Identify what DNA:RNA ratios the user wants to obtain (the DNA:RNA ratios are based off the # of nanomoles per polyRNA repeat, and the polyRNA value will be always equal 1 while the # of nanomoles per DNA is changed based on what ratio the user wants to obtain). Note: For example, if planning to make a 0.25:1 DNA:RNA hybrid, multiply the obtained # of nmoles per repeat from step 3 by 0.25 to obtain the nmoles of DNA required to mix with the RNA. 3. Calculate the volume (in uL) of DNA comb required to mix with the desired amount of polyRNA to obtain the desired DNA:RNA ratio using the equation below: Attorney Docket No. UM-42619.601 4. Calculate the volume (in uL) of the desired amount of polyRNA required to mix with the desired amount of DNA comb. 5. Make 10x concentrated hybridization buffer with final concentration of 150 mM NaCl, 1 mM EDTA pH 8.0, and 10 mM Tris pH 7.5. 6. Calculate the volume of the final hybridization solution (containing DNA and polyRNA) by dividing the total amount of RNA and DNA in the solution (in ng) by the value 148.2. Mix the polyRNA and DNA comb together with 10x hybridization buffer and RNAse-free water in a 200 uL PCR tube up to the final volume calculated in step 8 and in which the 10x hybridization buffer becomes 10-fold diluted (1x final concentration). Note: The final concentration of the hybrid is 148.2 ng / uL. 7. Put the PCR tube inside a thermocycler and set the thermocycler to have a 80oC constantly heated lid 8. Set a thermocycler protocol in which the tube is heated at 75oC for 5 minutes, and then followed by gradual decrease in temperature of 1oC / min until it reaches 22oC. 9. Store hybrids in -80oC until further use. Figure 3 presents a schematic showing a polymeric macromolecule having a RIG-1 PRR agonist, a TLR7 / 8 PRR agonist, TLR9 PRR agonist, and a TLR3 PRR agonist. hTLR3, hTLR7, hTLR8, and hRIG-1 activation data is further provided. Figure 4 shows the formation of hybrids (polyRNA, DNA comb, polyRNA-DNA comb); mTLR9 activaiton by T19:D12-CpG; RAW-Dual NF-kB activation by T19:D12-CpG; and RAW-dual IRF activation by T19:D12-CpG Figure 5 shows ionizable lipids (DLin-MC3-DMA (MC3)) (OF-C4-Deg-Lin (C4)); MW distribution of polyRNAs (T19 polyRNA; T51 polyRNA; and T52 polyRNA); MC3 LNPs (IRF activation); and MC3 vs. C4 (activation). Example 5. This example demonstrates in vivo therapeutic efficacy of polymeric RNA scaffolds. CT26 colorectal tumor-bearing mice were treated with polyRNA (T52), polyRNA:CpG DNA hybrids (T52:D15-CpG), and benchmark controls via intratumoral injection (see, Fig.6A). T52:D15-CpG and T51:D15ctl-CpG represent polyRNA hybridized with CpG combs and mismatched CpG DNA controls (see, Figs. B-D). Tumor growth curves (B-C) and overall survival are demonstrated (see, Figs.6B-D).*p<0.05; **p<0.01; ****p<0.0001. Attorney Docket No. UM-42619.601 INCORPORATION BY REFERENCE The entire disclosure of each of the patent documents and scientific articles referred to herein is incorporated by reference for all purposes. EQUIVALENTS The invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The foregoing aspects are therefore to be considered in all respects illustrative rather than limiting the invention described herein. Scope of the invention is thus indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are intended to be embraced therein.
Claims
Attorney Docket No. UM-42619.601 CLAIMS We Claim:
1. A composition comprising one or more polymeric macromolecules, wherein each of the polymeric macromolecules comprise a plurality of connected pattern recognition receptor (PRR) agonists, wherein each of the polymeric macromolecules include at least two different PRR agonists, wherein each of the PRR agonists comprise a nucleic acid molecule capable of activating a specific PRR.
2. The composition of claim 1, wherein the plurality of connected PRR agonists are formulated together for combined presentation following administration to a mammalian subject.
3. The composition of claim 1, wherein the plurality of connected PRR agonists are arranged to recapitulate a distinct portion of one or more PRR agonist signatures of one or more pathogens.
4. The composition of claim 1, wherein a specific PRR agonist within the plurality of connected PRR agonists is present two or more times.
5. The composition of claim 4, wherein the present two or more times is between 2 and 1,000,000 times.
6. The composition of claim 1, wherein two or more different PRR agonists within the plurality of connected PRR agonists are each independently present two or more times.
7. The composition of claim 5, wherein the present two or more times is between 2 and 1,000,000 times.
8. The composition of claim 1, wherein at least one of the PRR agonists comprises a hairpin loop within the nucleic acid molecule.Attorney Docket No. UM-42619.601 9. The composition of claim 1, wherein at least one of the PRR agonists comprises single stranded RNA (ssRNA) and / or single stranded DNA (ssDNA) within the nucleic acid molecule.
10. The composition of claim 9, wherein the ssRNA and / or ssDNA within the nucleic acid molecule is between 4 and 1000 bases.
11. The composition of claim 9, wherein the percentage of guanine / uracil bases within the ssRNA is between 0 and 100%.
12. The composition of claim 1, wherein at least one of the PRR agonists comprises double stranded RNA (dsRNA) and / or double stranded DNA (dsDNA) within the nucleic acid molecule.
13. The composition of claim 12, wherein the dsRNA and / or dsDNA within the nucleic acid molecule is between 1 and 500 base pairs.
14. The composition of claim 1, wherein at least one of the PRR agonists comprises a 5’- triphosphate moiety within the nucleic acid molecule.
15. The composition of claim 1, wherein at least one of the PRR agonists comprises a stem moiety within the nucleic acid molecule.
16. The composition of claim 1, wherein the plurality of connected PRR agonists are arranged in a linear one-by-one manner.
17. The composition of claim 16, wherein each PRR agonist within the series of linearly connected PRR agonists is successively positioned in a linear one-by-one manner.
18. The composition of claim 1, wherein the plurality of connected PRR agonists are arranged in a non-linear manner.
19. The composition of claim 1, wherein the plurality of PRR agonists is between 2 and 10,000 PRR agonists; orAttorney Docket No. UM-42619.601 wherein the plurality of PRR agonists is between 2 and 1,000 PRR agonists; or wherein the plurality of PRR agonists is between 2 and 100 PRR agonists; or wherein the plurality of PRR agonists is between 2 and 10 PRR agonists.
20. The composition of claim 1, wherein the number of different PRR agonists within each polymeric macromolecule is between 2 and 10,000; or wherein the number of different PRR agonists within each polymeric macromolecule is between 2 and 1,000; or wherein the number of different PRR agonists within each polymeric macromolecule is between 2 and 100; or wherein the number of different PRR agonists within each polymeric macromolecule is between 2 and 10.
21. The composition of claim 1, wherein the plurality of PRR agonists is selected from 3 PRR agonists, 4 PRR agonists, 5 PRR agonists, 6 PRR agonists, 7 PRR agonists, 8 PRR agonists, 9 PRR agonists, 10 PRR agonists, 11 PRR agonists, 12 PRR agonists, 13 PRR agonists, 14 PRR agonists, 15 PRR agonists, 16 PRR agonists, 17 PRR agonists, 18 PRR agonists, 19 PRR agonists, 20 PRR agonists, 25 PRR agonists, and 50 PRR agonists.
22. The composition of claim 1, wherein the plurality of different PRR agonists within each polymeric macromolecule is selected from 3 PRR agonists, 4 PRR agonists, 5 PRR agonists, 6 PRR agonists, 7 PRR agonists, 8 PRR agonists, 9 PRR agonists, 10 PRR agonists, 11 PRR agonists, 12 PRR agonists, 13 PRR agonists, 14 PRR agonists, 15 PRR agonists, 16 PRR agonists, 17 PRR agonists, 18 PRR agonists, 19 PRR agonists, 20 PRR agonists, 25 PRR agonists, and 50 PRR agonists.
23. The composition of claim 1, wherein at least one of the polymeric macromolecules and / or the composition further comprise a targeting moiety, wherein the targeting moiety is selected from: vitamins, ligands, amines, peptide fragments, antibodies, aptamers, a transferrin, an antibody or fragment thereof, sialyl Lewis X antigen, lipoids, lipids (including cationic, neutral, and steroidal lipids, virosomes, and liposomes), fungal wall polysaccharides, hyaluronic acid, mannan, mannose derivatives, glucoseAttorney Docket No. UM-42619.601 derivatives, cell specific lectins, galaptin, galectin, lactosylceramide, a steroid derivative, an RGD sequence, EGF, EGF-binding peptide, urokinase receptor binding peptide, a thrombospondin-derived peptide, an albumin derivative and / or a molecule derived from combinatorial chemistry.
24. The composition of claim 1, wherein the targeting moiety is selected from: sialic acid, 9-N-(4H-thieno[3,2- c]chromene-2-carbamoyl)-Neu5Acα2-3Ga1β-4G1cNAc (TCCNeu5Ac), folic acid, methotrexate, folate, galactose residue, lactose, low density lipoprotein (LDL), ovalbumin (OVA), lactobionic acid, mannan, mannose, mannose-rich glycoconjugates, mannosylated poly(L-lysine) (MPL), zymosan and other β-glucans, glucan, poly-guanine, and apoB protein fragment.
25. The composition of claim 1, wherein the composition is associated with a liposome moiety, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed; and / or wherein the polymeric macromolecule is associated with a liposome moiety, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed.
26. The composition of claim 1, wherein each of the plurality of PRRs and PRR agonists is independently selected from: TLR2 and TLR2 agonists, TLR3 and TLR3 agonists, TLR4 and TLR4 agonists, TLR5 and TLR5 agonists, TLR7 / 8 and TLR7 / 8 agonists, TLR9 and TLR9 agonists, NOD1 and NOD1 agonists, NOD2 and NOD2 agonists, TLR2 / NOD2 and TLR2 / NOD2 agonists, NOD1 / NOD2 and NOD1 / NOD2 agonists, RIG1 / MDA5 and RIG1 / MDA5 agonists, DAI and DAI agonists,Attorney Docket No. UM-42619.601 LRRFIP1 and LRRFIP1 agonists, AIM2 and AIM2 agonists, RIG1 and RIG1 agonists, Dectin-1 and Dectin-1 agonists, Mincle and Mincle agonists, STING and STING agonists, MDA5 and MDA5 agonists, LGP2 and LGP2 agonists, DDX41 and DDX41 agonists, DHX9 and DHX9 agonists, DDX3 and DDX3 agonists, DDX36 and DDX36 agonists, DDX-1-DDX-21-DDX36 and DDX-1-DDX-21-DDX36 agonists, DDX60 and DDX60 agonists, KU70 and KU70 agonists, cGAS and cGAS agonists, NLRP3 and NLRP3 agonists, IFI16 and IFI16 agonists, LRRFIP1 and LRRFIP1 agonists, DAI and DAI agonists, CDS and CDS agonists, RLR and RLR agonists, CLR and CLR agonists, IFIT1 and IFIT1 agonists, IFIT2 and IFIT2 agonists, IFIT3 and IFIT3 agonists, and IFIT5 and IFIT5 agonists.
27. The composition of claim 1, wherein the plurality of PRR agonists within at least one of the polymeric macromolecules comprises: one or more RIG-1 agonists, one or more TLR7 / 8 agonists, one or more TLR9 agonists, and one or more TLR3 agonists.Attorney Docket No. UM-42619.601 28. The composition of claim 27, wherein one or more of the PRR agonists comprise a hairpin loop.
29. The composition of claim 27, wherein one or more of the RIG-1 agonists comprise a 5’- triphosphate moiety.
30. The composition of claim 27, wherein one or more of the TLR7 / 8 agonists comprise ssRNA.
31. The composition of claim 27, wherein one or more of the TLR7 / 8 agonists comprise ssRNA having a guanine / uracil percentage between 0 and 100.
32. The composition of claim 27, wherein one or more of the TLR3 agonists comprise dsRNA.
33. The composition of claim 27, wherein one or more of the TLR9 agonists comprise ssDNA.
34. The composition of claim 27, wherein one or more of the RIG1 agonists comprise dsRNA or ssRNA.
35. The composition of claim 1, wherein the composition is capable of stimulating and / or modulating an innate immune response in a mammalian subject upon administration to the mammalian subject.
36. The composition of claim 1, wherein one or more of the polymeric macromolecules further comprise one or more portions of nucleic acid molecules not characterized as a PRR agonist.
37. The composition of claim 1, wherein the composition is used to elicit an immune response to a vaccine application.Attorney Docket No. UM-42619.601 38. The composition of claim 1, wherein the composition is capable of stimulating an innate immune response in at least one cancer cell upon administration to the subject, wherein the mammalian subject is suffering from cancer.
39. The composition of claim 1, wherein stimulating an innate immune response comprises stimulating an innate cytokine response mediated through cytokines, wherein the innate cytokine response is mediated through type 1 interferon.
40. The composition of claim 1, wherein the composition is further associated with an antigen, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed; and / or wherein the polymeric macromolecule is further associated with an antigen, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed.
41. The composition of claim 40, wherein the antigen is selected from the group consisting of alpha-actinin-4, Bcr-Abl fusion protein, Casp-8, beta-catenin, cdc27, cdk4, cdkn2a, coa-1, dek-can fusion protein, EF2, ETV6-AML1 fusion protein, LDLR-fucosyltransferaseAS fusion protein, HLA-A2, HLA-A11, hsp70-2, KIAAO205, Mart2, Mum-1, 2, and 3, neo-PAP, myosin class I, OS-9, pml-RARα fusion protein, PTPRK, K-ras, N-ras, Triosephosphate isomeras, Bage- 1, Gage 3,4,5,6,7, GnTV, Herv-K-mel, Lage-1, Mage-A1,2,3,4,6,10,12, Mage-C2, NA-88, NY- Eso-1 / Lage-2, SP17, SSX-2, and TRP2-Int2, MelanA (MART-I), gp100 (Pmel 17), tyrosinase, TRP-1, TRP-2, MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, p15(58), CEA, RAGE, NY- ESO (LAGS), SCP-1, Hom / Mel-40, PRAME, p53, H-Ras, HER-2 / neu, BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR, Epstein Barr virus antigens, EBNA, human papillomavirus (HPV) antigens E6 and E7, TSP-180, MAGE-4, MAGE-5, MAGE-6, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, TAG-72-4, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, β-Catenin, CDK4, Mum-1, p16, TAGE, PSMA, PSCA, CT7, telomerase, 43-9F, 5T4, 791Tgp72, α- fetoprotein, 13HCG, BCA225, BTAA, CA 125, CA 15-3 (CA 27.29\BCAA), CA 195, CA 242, CA-50, CAM43, CD68\KP1, CO-029, FGF-5, G250, Ga733 (EpCAM), human EGFR protein or its fragments, such as human EGFR residues 306–325 (SCVRACGADSYEMEEDGVRK (SEQ ID NO: 1)) and residues 897–915 (VWSYGVTVWELMTFGSKPY (SEQ ID NO: 2)), HTgp- 175, M344, MA-50, MG7-Ag, MOV18, NB\70K, NY-CO-1, RCAS1, SDCCAG16, TA-90 (Mac-2 binding protein\cyclophilin C-associated protein), TAAL6, TAG72, TLP, TPS, WT1Attorney Docket No. UM-42619.601 (and WT1-derivaed peptide sequences: WT1126–134 (RMFP NAPYL (SEQ ID NO: 3)), WT1 122–140 (SGQARMFPNAPYLPSCLES (SEQ ID NO: 4)), and WT1122–144 (SGQARMFPNAPYLPSCLESQPTI (SEQ ID NO: 5)), MUC1 (and MUC1-derived peptides and glycopeptides such as RPAPGS (SEQ ID NO: 6), PPAHGVT (SEQ ID NO: 7), and PDTRP (SEQ ID NO: 8))), LMP2, EGFRvIII, Idiotype, GD2, Ras mutant, p53 mutant, Proteinase3 (PR1), Survivin, hTERT, Sarcoma translocation breakpoints, EphA2, EphA4, LMW-PTP, PAP, ML-IAP, AFP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, ALK, Androgen receptor, Cyclin B1, Polysialic acid, MYCN, RhoC, TRP-2, GD3, Fucosyl GM1, Mesothelin, sLe(animal), CYP1B1, PLAC1, GM3, BORIS, Tn, GloboH, NY-BR-1, RGS5, SART3, STn, Carbonic anhydrase IX, PAX5, OY-TES1, Sperm protein 17, LCK, HMWMAA, AKAP-4, XAGE 1, B7H3, Legumain, Tie 2, Page4, VEGFR2, MAD-CT-1, FAP, PDGFR- alpha, PDGFR-β, MAD-CT-2, Fos-related antigen 1, ERBB2, Folate receptor 1 (FOLR1 or FBP), IDH1, IDO, LY6K, fms-related tyro- sine kinase 1 (FLT1, best known as VEGFR1), KDR, PADRE, TA-CIN (recombinant HPV16 L2E7E6), SOX2, neoantigens, and aldehyde dehydrogenase.
42. The composition of claim 40, wherein the antigen is derived from a self-antigen.
43. The composition of claim 40, wherein the antigen is conjugated to the outer surface of the composition; and / or wherein the antigen is conjugated to the polymeric macromolecule.
44. The composition of claim 1, wherein the composition is associated with an adjuvant, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed; and / or wherein the polymeric macromolecule is associated with an adjuvant, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed.
45. The composition of claim 44, wherein the adjuvant is selected from the group consisting of CPG, polyIC, poly-ICLC, 1018 ISS, aluminum salts (for example, aluminum hydroxide, aluminum phosphate), Amplivax, BCG, CP-870,893, CpG7909, CyaA, dSLIM, Cytokines (such as GM-CSF, IL-2, IFN-a, Flt-3L), IC30, IC31, Imiquimod, ImuFact IMP321, IS Patch, ISS, ISCOMATRIX, Juvlmmune, LipoVac, MF59, monophosphoryl lipid A, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, Montanide ISA-51, OK-432, OM-174, OM-197-MP-Attorney Docket No. UM-42619.601 EC, ONTAK, PepTel.RTM, vector system, PLGA microparticles, imiquimod, resiquimod, gardiquimod, 3M-052, SRL172, Virosomes and other Virus-like particles, YF-17D, VEGF trap, beta-glucan, Pam3Cys, Aquila's QS21 stimulon, vadimezan, AsA404 (DMXAA), 3M MEDI9197, glucopyranosyl lipid adjuvant (GLA), GLA-SE, CD1d ligands (such as C20:2, OCH, AH04-2, α-galatosylceramide, α-C-galatosylceramide,α-mannosylceramide, α- fructosylceramide, β-galatosylceramide, β-mannosylceramide), STING agonists (e.g. cyclic dinucleotides, including Cyclic [G(3’,5’)pA(3’,5’)p], Cyclic [G(2’,5’)pA(3’,5’)p], Cyclic [G(2’,5’)pA(2’,5’)p], Cyclic diadenylate monophosphate, Cyclic diguanylate monophosphate), CL401, CL413, CL429, Flagellin, RC529, E6020, imidazoquinoline-based small molecule TLR- 7 / 8a (including its lipidated analogues), virosomes, AS01, AS02, AS03, AS04, AS15, IC31, CAF01, ISCOM, Cytokines (such as GM-CSF, IL-2, IFN-a, Flt-3L), bacterial toxins (such as CT, and LT), any derivative of an adjuvant, and any combination of adjuvant.
46. The composition of claim 1, wherein the composition is associated with a nanoparticle, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed; and / or wherein the polymeric macromolecule is associated with a nanoparticle, wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed.
47. The composition of Claim 46, wherein the nanoparticle is selected from the group consisting of sHDL nanoparticles, metal-polyhistidine-DOPE@liposome, metal-polyhistidine- PEG, 4arm-PEG-polyhistidine-metal hydrogels, sHDL-polyhistidine, fullerenes, endohedral metallofullerenes buckyballs, trimetallic nitride templated endohedral metallofullerenes, single- walled and mutli-walled carbon nanotubes, branched and dendritic carbon nanotubes, gold nanorods, silver nanorods, single-walled and multi-walled boron / nitrate nanotubes, carbon nanotube peapods, carbon nanohorns, carbon nanohorn peapods, liposomes, nanoshells, dendrimers, any nanostructures, microstructures, or their derivatives formed using layer-by-layer processes, self-assembly processes, or polyelectrolytes, microparticles, quantum dots, superparamagnetic nanoparticles, nanorods, cellulose nanoparticles, glass and polymer micro- and nano-spheres, biodegradable PLGA micro- and nano-spheres, gold nanoparticles, silver nanoparticles, carbon nanoparticles, iron nanoparticles, modified micelles, and metal-organic framework (MOF) coordination polymer (CP).Attorney Docket No. UM-42619.601 48. The method of claim 1, wherein the composition is associated with one or more of a nanoparticle, a liposome, a dendrimer, a micelle, a nanoemulsion, a nanosuspension, a niosome, a nanocapsule, a magnetic nanoparticle, a lipoprotein-based carrier, andor a lipoplex nanoparticle; wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed; and / or wherein the polymeric macromolecule is associated with one or more of a nanoparticle, a liposome, a dendrimer, a micelle, a nanoemulsion, a nanosuspension, a niosome, a nanocapsule, a magnetic nanoparticle, a lipoprotein-based carrier, andor a lipoplex nanoparticle; wherein associated is selected from complexed, conjugated, encapsulated, absorbed, adsorbed, and admixed.
49. A method for treating or preventing an immune dysregulation in a mammalian subject comprising administering to the mammalian subject a composition of claim 1, wherein the administering results in stimulating and / or modulating an innate immune response in the mammalian subject.
50. The method of claim 49, wherein the mammalian subject is suffering from a disease or condition characterized by the immune dysregulation.
51. The method of claim 50, wherein the disease or condition is a cancer, an infectious disease, an autoimmune disorder, and / or an inflammatory disorder.
52. The method of claim 50, wherein the cancer is selected from the group consisting of breast, brain, thyroid, prostate, colorectal, pancreas, cervix, stomach, endometrium, liver, bladder, ovary, testis, head and neck, skin, mesothelial lining white blood cells, esophagus, muscle, connective tissue, lung, adrenal gland, kidney, bone or testicle cancer, and metastasis thereof.
53. The method of claim 50, wherein the disease or condition is one or more disease or condition selected from: Acne vulgaris; Acute disseminated encephalomyelitis; Acute hemorrhagicleukoencephalitis; Addison's Disease; Agammaglobulinemia; Allergies; Alopecia areata; Alzheimer's; Amyotrophic Lateral Sclerosis; autoimmune anaemia, hemolytic anaemia; pernicious anaemia; Ankylosing spondylitis; Anti-GBM / TBM Nephritis; Antiphospholipid syndrome; Antisynthetase syndrome; Arteritis, temporal (also known as “giant cell arteritis”);Attorney Docket No. UM-42619.601 Arthritis, juvenile; Arthritis, psoriatic; Arthritis, reactive (Reiter's syndrome, rea); Arthritis, rheumatoid; Asthma; Atherosclerosis; Atopic allergy; Atopic dermatitis; Autoimmune enteropathy; Autoimmune aplastic anemia; Balo disease / Balo concentric sclerosis; Bartter syndrome; Bechets Syndrome; Berger's disease; Bickerstaff's encephalitis; Blau syndrome; Bronchitis, chronic; Bullous pemphigoid; Bursitis; Cardiomyopathy, autoimmune; Castleman's disease; Celiac disease; Chronic fatigue syndrome; Chronic inflammatory demyelinating polyneuropathy; Chronic recurrent multifocal osteomyelitis; Churg-Strauss syndrome; Cicatricialpemphigoid; Cirrhosis, primary biliary Cogan syndrome; Cold agglutinin disease; Colitis; Complement component 2 deficiency; Connective tissue disease, mixed; Connective tissue disease, undifferentiated COPD (chronic obstructive lung disease); Cranial arteritis; CREST syndrome; Cryoglobulinemia; Cushing's Syndrome; Cutaneous leukocytoclasticangiitis; Cystitis, interstitial; Dacryadenitis; Dego's disease; Dercum's disease; Dermatitis; Dermatitis herpetiformis; Dermatitis, autoimmune progesterone; Dermatomyositis; Diabetes; Diabetes insipidus, nephrogenic; Diabetes mellitus type 1; Diffuse cutaneous systemic sclerosis; Discoid lupus erythematosus; Diverticulitis; Dressler's syndrome; Dysmenorrhea (menstrual cramps / pain); Eczema; Endometriosis; Enthesitis-related arthritis; Eosinophilic fasciitis; Eosinophilic gastroenteritis; Epidermolysisbullosaacquisita; Erythema nodosum, Essential mixed cryoglobulinemia; Evan's syndrome; Fibrodysplasiaossificansprogressiva; Fibromyalgia; Fibrosingaveolitis; Gastritis, atrophic; Gastrointestinal pemphigoid; Giant cell arteritis; Glomerulonephritis; Goodpasture's syndrome; Gout, acute; Gout, arthritic; Graves' disease; Guillain-Barré syndrome (GBS); Haemolytic anaemia; Hashimoto's encephalitis; Hashimoto's thyroiditis; Hemolyticanemia, autoimmune; Henoch-Schonleinpurpura; Hepatitis, autoimmune; Hepatitis, viral; Herpes gestationis; Hypogammaglobulinemia; Idiopathic Inflammatory Demyelinating Diseases; Idiopathic pulmonary fibrosis; Iga nephropathy; Ileus (bowel obstruction); Inclusion body myositis; Inflammatory bowel disease, Crohn's disease; Inflammatory bowel disease, ulcerative colitis; Inflammatory demyelinating polyneuopathy; Inner ear disease, autoimmune; Interstitial cystitis; Irritable bowel syndrome (IBS); Juvenile idiopathic arthritis; Juvenile rheumatoid arthritis; Kawasaki's Disease; Kidney stones Lambert- Eaton myasthenic syndrome; Leukocytoclasticvasculitis; Lichen planus; Lichen sclerosus; Linear iga disease (LAD); Lou Gehrig's disease (Also Amyotrophic lateral sclerosis); Lupoid hepatitis; Lupus; Lupus erythematous; Lymphoproliferative syndrome, autoimmune; Majeed syndrome; Meniere's disease; Meningitis; Microscopic polyangiitis; Miller-Fisher syndrome; Morphea; Mucha-Habermann disease; Multiple sclerosis; Multiple sclerosis; Myasthenia gravis; Myositis; Myositis, inclusion body; Nephritis; Nephrotic syndrome; Neuromyelitisoptica (AlsoAttorney Docket No. UM-42619.601 Devic's Disease); Neuromyotonia; Neutropenia; Neutropenia caused by a myelosuppressive chemotherapy; Occular cicatricial pemphigoid; Ocular inflammation (acute and chronic non- bacterial inflammation of the anterior part of the eyes); Opsoclonus myoclonus syndrome; Ord thyroiditis; Osteoarthritis; Paget's disease of bone; Palindromic rheumatism; Pancreatitis, autoimmune; PANDAS (pediatric autoimmune neuropsychiatric disorders associated with streptococcus); Paraneoplastic cerebellar degeneration; Parkinson's; Paroxysmal nocturnal hemoglobinuria (PNH); Parry Romberg syndrome; Pars planitis; Parsonnage-Turner syndrome; Pelvic inflammatory disease; Pemphigus; Pemphigus vulgaris; Pericarditis, non-rheumatic; Peripheral neuropathy, autoimmune; Perivenous encephalomyelitis; POEMS syndrome; Polyarteritisnodosa; Polychondritis, relapsing Polyendocrine syndrome, autoimmune; Polymyalgia rheumatica; Polymyalgia rheumatica; Polymyositis; Primary sclerosing cholangitis; Progressive inflammatory neuropathy; Prostatitis, chronic Pseudogout; Psoriasis; Psoriasis; Pure red cell aplasia; Pyodermagangrenosum; Rasmussen's encephalitis; Raynaud phenomenon; Reiter's syndrome; Restless leg syndrome; Retinopathy of prematurity; Retroperitoneal fibrosis; Rheumatoid fever; Rhinitis, allergic; Sarcoidosis; Schmidt syndrome; Schnitzler syndrome; Scleritis; Scleroderma; Sclerosis, systemic; Sjogren's syndrome; Spondyloarthropathy; Still's disease; Subacute bacterial endocarditis (SBE); Susac's syndrome; Sweet's syndrome; Sydenham chorea; Sympathetic ophthalmia; Takayasu's arteritis; Temporomandibular joint disorder (TMJD or TMD), or TMJ syndrome; Thrombocytopenic purpura, autoimmune; Thrombocytopenic purpura, idiopathic Tolosa-Hunt syndrome; Transplant rejection; Transverse myelitis; Undifferentiated spondyloarthropathy; Urticaria; Uveitis, autoimmune; Valvular disease, non- rheumatic; Vasculitis; Vitiligo, and Wegener's granulomatosis.
54. The method of claim 50, wherein the cancer is one or more selected from bladder cancer, brain cancer, breast cancer, cervical cancer, ovarian cancer, colo-rectal cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, nasopharangeal cancer, pancreatic cancer, prostate cancer, skin cancer, stomach cancer, gastric cancer, head and neck cancer, testicular cancer, melanoma, acute myelogenous leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia, T cell lymphocytic leukemia, and B cell lymphomas, and uterine cancer; wherein the autoimmune disorder is selected from Systemic lupus erythematosus, Aicardi–Goutières syndrome, Acute pancreatitis Age-dependent macular degeneration, Alcoholic liver disease, Liver fibrosis, Metastasis, Myocardial infarction, NonalcoholicAttorney Docket No. UM-42619.601 steatohepatitis (NASH), Parkinson’s disease, Polyarthritis / fetal and neonatal anemia, Sepsis, inflammatory bowel disease, and multiple sclerosis.
55. The method of claim 49, wherein the composition is administered in an amount effective to modulate an adaptive immune response in the mammalian subject.
56. The method of claim 49, wherein administration of the composition is intracutaneous, subcutaneous, intravenous, intraperitoneal, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, transdermal, transtracheal, subcuticular, intraarticular, intratumoral, subcapsular, subarachnoidal, intraspinal, intrasternal, oral, sublingual, buccal, rectal, vaginal, nasal or ocular, or by infusion, inhalation, or nebulization.
57. The method of claim 49, wherein the administration site is the skin or subcutaneous tissue.
58. The method of claim 49, wherein the administration site is enteric.
59. The method of claim 49, wherein the administration site is non-enteric.
60. The method of claim 49, wherein the administration site is the respiratory tract.
61. The method of claim 49, wherein the composition is formulated for systemic distribution of the PRR agonists following administration.
62. The method of claim 49, wherein the composition is administered in a plurality of doses over a dosage duration, and the dosage duration is at least two weeks.
63. The method of claim 62, wherein the doses are administered subcutaneously every day, or every other day.
64. The method of claim 49, wherein the mammalian subject is a human patient.
65. The method of claim 64, wherein the human patient is immunosuppressed or immunocompromised.Attorney Docket No. UM-42619.601 66. The method of claim 64, wherein the human patient is a geriatric patient.
67. The method of claim 64, wherein the human patient is a pediatric patient.
68. The method of claim 49, further comprising co-administering one or more additional therapeutic agents.
69. The method of claim 68, wherein the additional therapeutic agent is selected from the group consisting of disease-modifying antirheumatic drugs (e.g., leflunomide, methotrexate, sulfasalazine, hydroxychloroquine), biologic agents (e.g., rituximab, infliximab, etanercept, adalimumab, golimumab), nonsteroidal anti-inflammatory drugs (e.g., ibuprofen, celecoxib, ketoprofen, naproxen, piroxicam, diclofenac), analgesics (e.g., acetaminophen, tramadol), immunomodulators (e.g., anakinra, abatacept), glucocorticoids (e.g., prednisone, methylprednisone), TNF-α inhibitors (e.g., adalimumab, certolizumab pegol, etanercept, golimumab, infliximab), IL-1 inhibitors, and metalloprotease inhibitors. In some aspects, the therapeutic agents include, but are not limited to, infliximab, adalimumab, etanercept, parenteral gold or oral gold.
70. The method of claim 68, wherein the additional therapeutic agent is selected from the group consisting of aldesleukin, altretamine, amifostine, asparaginase, bleomycin, capecitabine, carboplatin, carmustine, cladribine, cisapride, cisplatin, cyclophosphamide, cytarabine, dacarbazine (DTIC), dactinomycin, docetaxel, doxorubicin, dronabinol, epoetin alpha, etoposide, filgrastim, fludarabine, fluorouracil, gemcitabine, granisetron, hydroxyurea, idarubicin, ifosfamide, interferon alpha, irinotecan, lansoprazole, levamisole, leucovorin, megestrol, mesna, methotrexate, metoclopramide, mitomycin, mitotane, mitoxantrone, omeprazole, ondansetron, paclitaxel (TAXOL), pilocarpine, prochloroperazine, rituximab, tamoxifen, taxol, topotecan hydrochloride, trastuzumab, vinblastine, vincristine and vinorelbine tartrate.
71. A composition comprising a DNA molecule encoding one or more polymeric macromolecules recited in claim 1.
72. The composition of claim 71, wherein the DNA molecule is a circular DNA molecule.Attorney Docket No. UM-42619.601 73. The composition of claim 72, wherein rolling circle transcription of the circular DNA molecule with an RNA polymerase results in generation of one or more polymeric macromolecules encoded by the circular DNA molecule.
74. The composition of claim 73, wherein the RNA polymerase is T7 RNA polymerase.
75. A method, comprising: transcribing a circular DNA molecule encoding one or more polymeric macromolecules recited in claim 1, wherein the circular DNA molecule is transcribed with rolling circle transcription with an RNA polymerase, wherein the transcribing results in generation of one or more polymeric macromolecules encoded by the circular DNA molecule.
76. The method of claim 75, wherein the RNA polymerase is a T7 RNA polymerase.
Citation Information
Patent Citations
Pattern recognition receptor agonist prodrugs and methods of use thereof
US20200370052A1
Therapeutically Triggering an Innate Immune Response in a Target Tissue
US20220236284A1