Pluripotent stem cell-derived RPE cell, formulation, pharmaceutical composition, reagent, method, and kit

Abstract

The present invention relates to the field of regenerative medicine, relates to cell therapy, and specifically provides a pluripotent stem cell (PSC)-derived RPE cell, a formulation, a pharmaceutical composition, a reagent, a method, and a kit. Differentiating an iPSC to obtain RPE cells is implemented by adding chemical small molecules into an E6 culture medium as an inhibitor or an activator, and comprises the following stages: a neuroectodermal cell induction phase, an RPE progenitor cell induction phase, an RPE cell induction phase, and an RPE cell maturation phase. During differentiation, non-RPE-like heterogeneous cells do not need to be manually removed, and pure RPE cells can be obtained by means of subculturing.

Description

RPE cells, preparations, pharmaceutical compositions, reagents, methods and kits derived from pluripotent stem cells Technical Field

[0001] The present invention belongs to the field of regenerative medicine and relates to cell therapy, and specifically relates to RPE cells derived from pluripotent stem cells, preparations, pharmaceutical compositions, reagents, methods and kits. Background Art

[0002] The macula is an important area of ​​the retina, located at the posterior pole of the eye, and is primarily related to visual functions such as fine vision and color perception. Lesions in the macular area cause a progressive loss of retinal pigment epithelium (RPE) cells, ultimately leading to loss of visual function. Age-related macular degeneration (AMD) is a common, chronic, and persistent macular degeneration disease with a global prevalence of approximately 8.7%, and the drug market presents a vast market. The current mainstream treatments for AMD are mainly divided into three categories: laser-mediated, surgical, and drug therapy:

[0003] (1) Neither laser-mediated nor drug therapy can cure neovascular AMD. The efficacy of anti-VEGF drugs gradually weakens with the number of injections, and in some patients, it may promote the development of atrophic AMD. The annual treatment cost of laser therapy is between 4,000 and 60,000 yuan, while the cost of drug treatment is generally over 20,000 yuan, and long-term medication is required.

[0004] (2) Retinal pigment epithelial (RPE) cells are a layer of regular, tightly packed, polygonal pigment cells located on the basal side of the retina. Their tops are covered with microvilli, surrounding the outer segments (POS) of photoreceptor cells and participating in the phagocytosis of RPE cells. Their bottoms have a large number of folds that promote material exchange. They are connected to the choroid through Bruch's membrane, together forming the blood-eye barrier. RPE cell surgical treatment has become a research hotspot in recent years. Many clinical trials of RPE cell transplantation have been conducted at home and abroad. The patients' vision has improved to a certain extent one year after surgery, but they need to take immunosuppressants for a long time. In long-term follow-up observations, immune rejection still occurs, the number of RPE cells in the transplanted area decreases, and the patients' vision declines again.

[0005] Reprogrammed iPSC technology: The emergence of human induced pluripotent stem cell (iPSC) technology provides an ethically feasible and unlimited source of cells for cell therapy for macular degeneration. Although multiple clinical studies have confirmed the efficacy and safety of stem cell-derived RPE cells for macular degeneration, rapid clinical adoption is hindered by factors such as the lengthy differentiation time of autologous iPSC-RPE cells (hereinafter referred to as iPSC-RPE), which delays treatment timing, high production costs, and inconsistent quality. Furthermore, allogeneic iPSC-RPE cells require long-term immunosuppressant therapy and lack permanent survival, making rapid clinical adoption difficult.

[0006] CRISPR / Cas9 technology: The continuous development of gene editing technology has highlighted another great advantage of iPSC-RPE, namely, genome selection and gene editing (immune privilege) at the iPSC stage. This solves the problem of immune rejection of allogeneic iPSC-RPE during clinical use and makes mass production of RPE cells and strict quality control before transplantation possible. Technical issues

[0007] Technical issues and disadvantages of iPSC-to-RPE cell differentiation: To date, most clinical studies and literature reports on RPE cell differentiation methods based on in vivo differentiation of RPE cells have used spontaneous differentiation, which has the following problems:

[0008] Labor-intensive and operator-demanding, most differentiation methods still rely on manual selection of pigmented patches to achieve higher purity. This manual selection makes large-scale production of RPE cells very difficult and poses a potential tumorigenic risk if residual undifferentiated cells are not detected in the final product.

[0009] Differentiation cycles, yields, and quality standards are highly variable across different stem cell lines, resulting in poor reproducibility. For example, in Reference 1, the differentiation cycle was 60 days, and the markers used included CD140b, CD56, CD104, CD184, and GD2. The yield was 6,500–13,000 therapeutic RPE cells per 1 million undifferentiated hiPSCs (Ref. 1: Plaza Reyes, A. et al. Identification of cell surface markers and establishment of monolayer differentiation to retinal pigment epithelial cells. Nat Commun 11, 1609 (2020)). https: / / doi.org / 10.1038 / s41467-020-15326-5. ); The differentiation cycle of Reference 2 is 42 days, and the markers used are: LUM, FN1, MITF and BEST. Its output is based on the automated robot to produce 16 billion RPE cells with therapeutic uses in 12 weeks (Reference 2: Regent, F., Morizur, L., Lesueur, L. et al. Automation of human pluripotent stem cell differentiation toward retinal pigment epithelial cells for large-scale productions. Sci Rep 9, 10646 (2019). https: / / doi.org / 10.1038 / s41598-019-47123-6.).

[0010] At the same time, the differentiation methods in the literature all use animal-derived components to induce the differentiation of RPE cells. In recent years, with the deepening of people's understanding of the in vivo and in vitro development of RPE cells, directed differentiation methods have gradually emerged. Technical Solutions

[0011] The present application provides RPE cells, preparations, pharmaceutical compositions, reagents, methods and kits derived from pluripotent stem cells. During the differentiation process, manual removal of non-RPE-like foreign cells is not required, and no animal-derived components are contained. Pure iPSC-RPE cells can be obtained through subculture, providing a safe and reliable RPE cell product for later clinical trials.

[0012] To achieve the above technical objectives, the technical solution adopted in this application is a RPE cell derived from pluripotent stem cells, wherein the RPE cell is obtained from the pluripotent stem cells based on the following differentiation steps:

[0013] Neuroectodermal cell induction period: Induce differentiation by inhibiting any one or more of the three signaling pathways: TGF-β / Nodal / Activin signaling pathway, BMP signaling pathway, and WNT signaling pathway;

[0014] RPE progenitor cells: activate the Nicotinamide metabolic signaling pathway to induce differentiation;

[0015] RPE cell induction phase: activating the TGF-β / Nodal / Activin signaling pathway, inhibiting the FGF signaling pathway, and activating the WNT signaling pathway to induce differentiation by any one or more of the three signaling pathways;

[0016] During the maturation stage of RPE cells: activating either one or more of the two signaling pathways, the Nicotinamide metabolic signaling pathway and the WNT signaling pathway, to induce differentiation.

[0017] As an improved technical solution of this application, the pluripotent stem cells are ESCs, iPSCs or universal iPSCs HLA-KO differentiation acquisition;

[0018] The universal iPSC HLA-KO These are iPSCs with immune privilege that have been gene-edited to specifically reduce HLA expression.

[0019] As an improved technical solution of the present application, the ESCs are ESCs that have been passaged to passage 4-7, and the ratio of each inoculation to passage is designed to be 1:(3-12); the cultured ESCs are digested into single cells, cultured in iPSC medium for 1 day, and then differentiated into RPE cells;

[0020] The iPSC or universal iPSC HLA-KO For passage 4-7 of iPSC cells, the ratio of each inoculation to passage was designed to be 1:(3-12); the cultured iPSCs were digested into single cells, cultured in iPSC medium for 1 day, and then differentiated into RPE cells.

[0021] As an improved technical solution of the present application, the iPSC culture medium is: E8, Stem Flex or mTeSR1 as the basic culture medium, with the addition of additive Y27632, and the dosage of Y27632 is 10 μM.

[0022] As an improved technical solution of the present application, iPSC differentiation to obtain RPE cells is achieved by adding chemical small molecules as inhibitors or activators to E6 culture medium, including the following stages: neuroectoderm cell induction period, RPE progenitor cell induction period, RPE cell induction period and RPE cell maturation period.

[0023] As an improved technical solution of this application, during the neuroectoderm cell induction period,

[0024] The small molecule used to inhibit the TGF-β / Nodal / Activin signaling pathway is SB431542, with an addition dose of 1-50 μM;

[0025] The small molecule used to inhibit the BMP signaling pathway is LDN193183, added at a dosage of 10-100 nM;

[0026] The small molecules used to inhibit the WNT signaling pathway are IWR-1 or IWR-2, and the added amount is IWR-1 10-100μM, IWR-2 10-100μM.

[0027] As an improved technical solution of the present application, during the induction period of RPE progenitor cells: activation of the Nicotinamide metabolic signaling pathway is achieved by adding Nicotinamide; the added amount is: Nicotinamide 1-50mM.

[0028] As an improved technical solution of the present application, during the RPE cell induction period,

[0029] The small molecule used to activate the TGF-β / Nodal / Activin signaling pathway is Activin A, added at a dosage of 10-200 ng / mL;

[0030] The small molecule used to inhibit the FGF signaling pathway was SU5402, added at a dosage of 1-10 μM;

[0031] The small molecule used to activate the WNT signaling pathway is CHIR99021, and the addition amount is 1-10μM.

[0032] As an improved technical solution of this application, during the maturation stage of RPE cells,

[0033] The small molecule used to activate the Nicotinamide metabolic signaling pathway is Nicotinamide, and the addition amount is 1-50mM;

[0034] The small molecule used to activate the WNT signaling pathway is CHIR99021, and the addition amount is 1-10μM.

[0035] As an improved technical solution of the present application, the ratio of RPE cells during the induction phase and the RPE cells during the maturation phase is designed to be 1:(3-20).

[0036] Another object of the present application is to provide an RPE cell preparation, comprising the aforementioned RPE cells derived from pluripotent stem cells.

[0037] Another object of the present application is to provide a pharmaceutical composition for ophthalmology, comprising the aforementioned RPE cells derived from pluripotent stem cells as an active ingredient.

[0038] Another object of the present application is to provide a reagent for evaluating the toxicity or efficacy of a test substance, comprising the aforementioned RPE cells derived from pluripotent stem cells.

[0039] Another object of the present application is to provide a method for evaluating the toxicity or efficacy of a test substance, comprising contacting the aforementioned pluripotent stem cell-derived RPE cells with the substance, and determining the effect of the substance on the cells.

[0040] Yet another object of the present application is to provide a kit comprising a culture medium combination;

[0041] The culture medium combination comprises: a first culture medium, a second culture medium, a third culture medium and a fourth culture medium;

[0042] The first culture medium includes a basal culture medium and an additive A; the additive A is one of SB431542, LDN193183, IWR-1, or IWR-2, or multiple thereof in any molar ratio; wherein the amount of SB431542 added is 1-50 μM, the amount of LDN193183 added is 10-100 nM, the amount of IWR-1 added is 10-100 μM, and the amount of IWR-2 added is 10-100 μM; the second culture medium includes a basal culture medium and an additive B, wherein the additive B is Nicotinamide, and the amount of Nicotinamide added is 1-50 mM;

[0043] The third culture medium comprises a basal culture medium and an additive C, wherein the additive C is one or more of Activin A, SU5402, or CHIR99021 in any molar ratio; wherein the amount of Activin A added is 10-200 ng / mL, the amount of SU5402 added is 1-10 μM, and the amount of CHIR99021 added is 1-10 μM;

[0044] The fourth culture medium includes a basal culture medium and an additive D, wherein the additive D is one of Nicotinamide and CHIR99021 or both in any molar ratio; wherein the amount of Nicotinamide added is 1-50 mM, and the amount of CHIR99021 added is 1-10 μM.

[0045] As an improved technical solution of the present application, the basal culture medium is E6.

[0046] As another object of the present application, a method for obtaining RPE cells based on the kit comprises the following steps:

[0047] Step 1: culturing pluripotent stem cells in a first culture medium for 2 days to obtain neuroectoderm cells;

[0048] Step 2, culturing the neuroectoderm cells in the second culture medium for 4 days to obtain RPE progenitor cells;

[0049] Step 3, culturing the RPE progenitor cells in the third culture medium for 4 days to obtain RPE cells;

[0050] Step 4: The RPE cells are cultured in the fourth culture medium for 20 days to obtain mature RPE cells. Beneficial effects

[0051] In the prior art, during the process of inducing ESC / iPSC differentiation to obtain RPE cells, the cell state is unclear, the efficiency of the obtained RPE cells is low, and the cycle is long (for example, the Chinese patent CN110573610A "Method for preparing retinal pigment epithelial cells" has a differentiation cycle of 43 days). However, in the present application, the differentiation process is combined with the differentiation signal pathway of RPE cells in vivo to clarify the state of the cells during the differentiation process, greatly improving the differentiation efficiency and shortening the differentiation cycle. The present application only takes 30 days; and the cell purity and yield are high.

[0052] The present application specifies the signal pathway activators or inhibitors that need to be added during the differentiation process, so that the differentiation method is fixed and can be efficiently repeated.

[0053] The differentiation process of this application does not introduce any animal-derived components, which blocks the possibility of exogenous virus invasion and improves the safety of future clinical applications.

[0054] The differentiation process in this application is applicable to iPSCs and also to general-purpose iPSCs with immune privilege. HLA-KO The two methods have similar differentiation effects into RPE and similar functional effects of the obtained RPE cells. Based on a large number of experimental studies, the applicant has concluded that the differentiation method of the present application is universal in the direction of differentiating iPSCs into RPE cells.

[0055] This application combines cutting-edge induced pluripotent stem cell (iPSC) technology and gene editing technology to reduce immunogenicity at the iPSC stage, and combines different differentiation stages and signaling pathways of RPE cells in vivo to differentiate RPE cells, so as to minimize immune rejection during RPE cell transplantation.

[0056] In summary, the RPE cells obtained in this application are based on animal-free small molecules to induce directed differentiation to obtain highly safe, stable, donor-independent, and immunogenic universal iPSCs. HLA-KO -RPE cells, realize the treatment and clinical transformation of retinal degenerative diseases, and solve the safety issues such as immune rejection caused by transplanting RPE cells through the allogeneic subretinal space in the existing technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1A is a flow chart of small molecule-induced differentiation.

[0058] Figure 1B shows the induction of iPSC-RPE or iPSC differentiation at different time points HLA-KO - Bright field images of typical cell morphology of cells in RPE process.

[0059] Figure 2A: Immunofluorescence analysis of the expression of specific proteins in differentiated cells iKO-RPE-1, iKO-RPE-2, iKO-RPE-3, and the positive control fRPE (fRPE); the iKO-RPE cells in the figure are iPSCs HLA-KO Differentiated RPE cells (iPSCs) HLA-KO -RPE), iRPE cells are RPE cells differentiated from iPSCs (abbreviated as iPSC-RPE).

[0060] Figure 2B Immunofluorescence identification of the expression of specific proteins of differentiated cells iRPE-1, iRPE-2, and iRPE-3; cells iKO-RPE-1, iKO-RPE-2, and iKO-RPE-3 are iPSCs HLA-KO -RPE cells were obtained according to the three different experimental methods in Example 1, iRPE-1, iRPE-2 and iRPE-3 were iPSC-RPE cells obtained according to the three different experimental methods in Example 2; iKO-RPE cells in the figure are iPSC HLA-KO Differentiated RPE cells (iPSCs) HLA-KO -RPE), iRPE cells are RPE cells differentiated from iPSCs (abbreviated as iPSC-RPE).

[0061] Figure 3A shows the expression of PAX6 in iPSC, fRPE, iKO-RPE-1, iKO-RPE-2, iKO-RPE-3, iRPE-1, iRPE-2 and iRPE-3; iKO-RPE in the figure is iPSC HLA-KO Differentiated RPE cells (iPSCs HLA-KO -RPE), iRPE are RPE cells differentiated from iPSC (iPSC-RPE).

[0062] Figure 3B shows the expression of MITF in iPSC, fRPE, iKO-RPE-1, iKO-RPE-2, iKO-RPE-3, iRPE-1, iRPE-2, and iRPE-3; iKO-RPE in the figure is iPSC HLA-KO Differentiated RPE cells (iPSCs HLA-KO -RPE), iRPE are RPE cells differentiated from iPSC (iPSC-RPE).

[0063] Figure 3C shows the expression of RPE65 in RPE cells of iPSC, fRPE, iKO-RPE-1, iKO-RPE-2, iKO-RPE-3, iRPE-1, iRPE-2 and iRPE-3; iKO-RPE in the figure is iPSC HLA-KO Differentiated RPE cells (iPSCs HLA-KO -RPE), iRPE are RPE cells differentiated from iPSC (iPSC-RPE).

[0064] Figure 3D shows the expression of BEST1 in iPSCs, fRPE, iKO-RPE-1, iKO-RPE-2, iKO-RPE-3, iRPE-1, iRPE-2, and iRPE-3; Normalized to GAPDH in Figure 3 is translated as the expression level relative to GAPDH.

[0065] Figure 4A is a flow cytometric analysis of the expression of the specific protein MITF in fRPE, iKO-RPE-1, iKO-RPE-2, and iKO-RPE-3 cells: A is the expression of the specific protein MITF of fRPE (98.98%); B is the expression of the specific protein MITF of iKO-RPE-1 (98.52%); C is the expression of the specific protein MITF of iKO-RPE-2 (99.41%); D is the expression of the specific protein MITF of iKO-RPE-3 (99.26%); iKO-RPE in the figure is iPSC HLA-KO Differentiated RPE cells (iPSCs HLA-KO -RPE), iRPE are RPE cells differentiated from iPSC (iPSC-RPE).

[0066] Figure 4B is a flow cytometry analysis of the expression of iPSC-RPE specific protein MITF: A is the expression of iRPE-1 specific protein MITF (98.56%); B is the expression of iRPE-2 specific protein MITF (97.93%); C is the expression of iRPE-3 specific protein MITF (99.02%); iRPE-1, iRPE-2 and iRPE-3 are iRPE obtained according to the three different experimental methods in Example 2; iKO-RPE in the figure is iPSC HLA-KO Differentiated RPE cells (iPSCs HLA-KO -RPE), iRPE are RPE cells differentiated from iPSC (iPSC-RPE).

[0067] Figure 5A shows flow cytometry analysis of iPSC cells HLA-KO -RPE and positive control fRPE specific protein RPE65 expression: A is fRPE specific protein RPE65 expression (99.19%); B is iKO-RPE-1 specific protein RPE65 expression (99.02%); C is iKO-RPE-2 specific protein RPE65 expression (99.13%); D is iKO-RPE-3 specific protein RPE65 expression (99.59%); iKO-RPE-1, iKO-RPE-2 and iKO-RPE-3 were obtained according to the three different experimental methods in Example 1; iKO-RPE in the figure is iPSC HLA-KO Differentiated RPE cells (iPSCs HLA-KO -RPE), iRPE are RPE cells differentiated from iPSC (iPSC-RPE).

[0068] Figure 5B is a flow cytometry analysis of the expression of iPSC-RPE specific protein RPE65: A is the expression of iRPE-1 specific protein RPE65 (99.54%); B is the expression of iRPE-2 specific protein RPE65 (99.83%); C is the expression of iRPE-3 specific protein RPE65 (99.87%); iRPE-1, iRPE-2 and iRPE-3 were obtained according to the three different experimental methods in Example 2; iKO-RPE in the figure is iPSC HLA-KO Differentiated RPE cells (iPSCs HLA-KO -RPE), iRPE are RPE cells differentiated from iPSC (iPSC-RPE).

[0069] Figure 6A is flow cytometry analysis of iPSC cells HLA-KO-RPE and positive control fRPE-specific protein PAX6 expression: A is fRPE-specific protein PAX6 expression (99.10%); B is iKO-RPE-1 specific protein PAX6 expression (99.23%); C is iKO-RPE-2 specific protein PAX6 expression (99.37%); D is iKO-RPE-3 specific protein PAX6 expression (98.18%); iKO-RPE-1, iKO-RPE-2 and iKO-RPE-3 were obtained according to the three different experimental methods in Example 1; iKO-RPE in the figure is iPSC HLA-KO Differentiated RPE cells (iPSCs HLA-KO -RPE), iRPE are RPE cells differentiated from iPSC (iPSC-RPE).

[0070] Figure 6B is a flow cytometry analysis of the expression of the iPSC-RPE specific protein PAX6: A is the expression of the iRPE-1 specific protein PAX6 (98.23%); B is the expression of the iRPE-2 specific protein PAX6 (97.01%); C is the expression of the iRPE-3 specific protein PAX6 (98.65%); iRPE-1, iRPE-2 and iRPE-3 were obtained according to the three different experimental methods in Example 2. In the figure, iKO-RPE is iPSC HLA-KO Differentiated RPE cells (iPSCs HLA-KO -RPE), iRPE are RPE cells differentiated from iPSC (iPSC-RPE).

[0071] Figure 7A shows the phagocytic ability of fRPE, iRPE (iRPE-1, iRPE-2, and iRPE-3), and iKO-RPE (iKO-RPE-1, iKO-RPE-2, and iKO-RPE-3) at 37°C. iKO-RPE in the figure is iPSC HLA-KO Differentiated RPE cells (iPSCs HLA-KO -RPE), iRPE are RPE cells differentiated from iPSC (iPSC-RPE).

[0072] Figure 7B shows the phagocytic ability test of fRPE, iRPE (iRPE-1, iRPE-2 and iRPE-3) and iKO-RPE (iKO-RPE-1, iKO-RPE-2 and iKO-RPE-3) at 4°C; iKO-RPE in the figure is iPSC HLA-KO Differentiated RPE cells (iPSCs HLA-KO -RPE), iRPE are RPE cells differentiated from iPSC (iPSC-RPE).

[0073] Figure 7C shows the negative control group of fRPE, iRPE (iRPE-1, iRPE-2 and iRPE-3) and iKO-RPE (iKO-RPE-1, iKO-RPE-2 and iKO-RPE-3); iKO-RPE in the figure is iPSC HLA-KO Differentiated RPE cells (iPSCs HLA-KO -RPE), iRPE are RPE cells differentiated from iPSC (iPSC-RPE).

[0074] FIG8A is a graph showing the effect of the HLA-A, B, and C (HLA-ABC) gene group encoding HLA on the class I immune immunity characteristic.

[0075] FIG8B is a graph showing the effect of HLA-DR, DQ, and DP (HLA-DR DQ DP) encoding the HLA class II immune immunity characteristics. Best Mode for Carrying Out the Invention

[0076] Introduction to the overall method of the experimental group. (1) Cultivation of human induced pluripotent stem cells (hiPSC): The obtained iPSCs were knocked out of the B2M gene of HLA class I molecules and the CIITA gene, the main regulator of HLA class II. HLA-KO Cells were seeded at a 1:8 ratio on laminin-incubated 12-well plates and cultured in a 37°C, 5% CO2 incubator. Growth was observed daily under a microscope and fresh E8 medium was replaced daily. Cells were passaged every 3-4 days at a 1:8 ratio. During passage, cells were treated with 0.25% EDTA (mass-to-volume ratio) for 5-10 minutes and washed once with DPBS. Cells were then gently pipetted with 1 mL of E8 medium no more than eight times, and transferred to a fresh volume of laminin-incubated 12-well plates for continued culture. On the first day after each passage, 10 μM Y-27632 was added to the culture medium. After four passages, differentiation was performed. The detailed differentiation process is shown in Figure 1A.

[0077] (2) Induced universal human induced pluripotent stem cells (iPSCs) HLA-KO ) differentiated into human retinal pigment epithelial cells (iPSCs) HLA-KO -RPE): When the cultured hiPSCs reached 80% fusion, this time point was defined as Day (-1). At this time, the cells were digested and seeded onto a 12-well plate incubated with Laminin at a passage ratio of 1:10. The culture medium was replaced with E8 medium supplemented with 10 μM Y27632 for culture. After 1 day of treatment, this time point was defined as Day (0).

[0078] Day (0) to Day (2), the culture medium was replaced with differentiation medium Neuroectoderm Medium (the first culture medium in the kit). The culture medium (Neuroectoderm Medium) contains any combination of 10-100 ng / mL SB431542, 50-100 ng / mL LDN193183, and 10-50 mM IWR-1 added to E6 medium for neuroectoderm cell induction.

[0079] After inducing neuroectodermal cells to Day (6), the culture medium was replaced with Retinal Progenitor Medium (the second culture medium in the kit), which is an E6 culture medium with 1-50 mM Nicotinamide added thereto for RPE progenitor cell induction.

[0080] On Day (10), when RPE progenitor cell induction is complete, the culture medium is replaced with Immature RPE Medium (the third culture medium in the kit). The culture medium (Immature RPE Medium) is E6 medium supplemented with any combination of 10-200 ng / mL Activin A, 1-10 μM SU5402, and 1-10 μM CHIR99021 for RPE progenitor cell induction.

[0081] RPE progenitor cell induction was completed until Passage 0 (Day (16)), and the differentiated cells were digested and passaged with 1×Triple in a 37°C, 5% CO2 incubator for 5-10 minutes. After passage, the 12-well plates were pre-incubated with Laminin to obtain naive iPSCs. HLA-KO -RPE were passaged at a ratio of 1:(3-20) and cultured in Mature RPE Medium (the fourth medium in the kit). The medium (Mature RPE Medium) mainly contains any combination of E6 basal medium, 1-50mM Nicotinamide, and 1-10μM CHIR99021.

[0082] The cells were cultured using Mature RPE Medium. On Day (16)-Passage 1 and Day (22)-Passage 2, 1×Triple was used for digestion in a 37°C, 5% CO2 incubator for 5-10 minutes to obtain mature iPSCs. HLA-KO -RPE cells were passaged at a ratio of 1:4 and continued to be cultured in Mature RPE Medium until Day (30).

[0083] Table 1 Small molecule selection scheme at each stage Group Neuroectodermal cell induction stage RPE progenitor cell induction stage RPE cell induction stage RPE cell maturation stage iKO-RPE-1 25μM SB431542, 50nM LDN193183, 20μM IWR-1 25 mM Nicotinamide 100ng / mL Activin A 5μM CHIR9902, 25mM Nicotinamide iKO-RPE-2 25μM SB431542, 20μM IWR-1 25 mM Nicotinamide 100ng / mL Activin A , 5μM SU5402 5μM CHIR9902 iKO-RPE-3 50nM LDN193183 25 mM Nicotinamide 100ng / mL Activin A , 5μM SU5402, 5μM CHIR9902 15μM CHIR9902, 25mM Nicotinamide

[0084] The applicant has verified through multiple experiments that SB431542 1-50μM, LDN193183 10-100nM, IWR-1 10-100μM, Nicotinamide 1-50mM, Activin A 10-200ng / mL, CHIR99021 1-10μM, and SU5402 1-10μM, under the same signaling pathway, different dosages are selected within their respective ranges, all of which produce the same or similar effects as in Table 1. Modes for Carrying Out the Invention

[0085] The technical solution of this application is clearly and completely explained below in conjunction with the specific implementation content.

[0086] 1. Definition of noun.

[0087] iPSCs (induced pluripotent stem cells) and hiPSCs (human induced pluripotent stem cells) are derived from human peripheral blood mononuclear cells through reprogramming. HiPSCs are stem cells with the ability to self-renew and differentiate into cells of the three germ layers. Trigerm layer differentiation refers to differentiation into cells of the ectoderm, mesoderm, and endoderm lineages. Source: T / CSCB0005-2021, Group Standard "Human Induced Pluripotent Stem Cells," issued by the Chinese Society of Cell Biology.

[0088] Universal iPSCs HLA-KOThis refers to knocking out class I (such as B2M) and / or class II (such as CIITA) genes of the HLA gene group in iPSCs using CRISPR / Cas9 technology. The acquisition method is similar to the steps listed in the specification of Chinese patent "2022106036092 A method for preparing low-immunogenic iPSC cells, low-immunogenic iPSC cells and compositions", except that the iPSCs in this article do not rely on CD47 editing; hPSCs that do not express classical human leukocyte antigen (HLA) class I proteins on the surface can also be engineered by knocking out β-2 microglobulin (B2M) or knocking in HLA-G1 biallelic genes within the framework of the endogenous B2M locus. The reference is Shi L, Li W. et al. Generation of hypoimmunogenic human pluripotent stem cells via expression of membrane-bound and secreted β2m-HLA-G fusion proteins. Stem Cells. 2020 Nov;38(11):1423-1437.doi: 10.1002 / stem.3269. Epub 2020 Sep 15. PMID: 32930470.).

[0089] RPE cells refer to retinal pigment epithelial (RPE) cells. Located on the outer side of the retina, they form a dense, pigmented monolayer between the choroid and the central nervous system, providing support, nutrition, and circulation for photoreceptor cells. In this application, RPE is confirmed by: first, positive expression of RPE-specific marker proteins: TYR, RPE65, MITF, PAX6, and BEST1; second, the presence of melanin granules (brown-black); and third, distinctive cell morphology, characterized by tight intercellular connections and a typical polygonal, cobblestone-like cell morphology. The function of RPE cells was verified in this article using an in vitro phagocytic assay.

[0090] iRPE (iPSC-RPE, induced pluripotent stem cell-derived retinal pigment epithelium) is a type of retinal pigment epithelial cell derived from human induced pluripotent stem cells. iRPE cells are cultured adherently, seeded on laminin-treated plates for differentiation. Laminins include laminin521, laminin α4 antibody (Laminin α4), laminin α5β1γ1, and laminin α1β1γ1; vitronectin (VTN) can also be used as an alternative.

[0091] Signaling Pathways: The development of cell lineages is often regulated by multiple signaling pathways that control cell proliferation and differentiation. Each of these pathways is regulated by a complex array of genetic, epigenetic (e.g., histone modifications), and exogenous signaling factors that manipulate cell fate and behavior during development and differentiation. The pathways regulated in this article are: TGF-β / Nodal / Activin signaling, BMP signaling, WNT signaling, nicotinamide metabolism signaling, and FGF signaling. Pathways not described were not regulated by additional small molecules.

[0092] Neuroectodermal cell induction period: cells can reach 100% fusion and the cell morphology forms neuroectodermal cell-like.

[0093] RPE progenitor cell induction period: cells are densely packed, cell boundaries are fuzzy, and cell morphology is irregular and stacked.

[0094] RPE cell induction period: About 10% of non-RPE cells undergo apoptosis, and the non-apoptotic cells appear as a tight single layer of cobblestone-like RPE cells, which are RPE precursor cells.

[0095] RPE cell maturation stage: RPE precursor cells gradually form a cobblestone pattern with evenly distributed melanin; when a functional single layer of RPE cells is formed, the cells become more regular cobblestone-like and the melanin becomes darker.

[0096] A key indicator of "functionality" is the phagocytic function of RPE cells in vitro. Cell phagocytosis is divided into three stages: binding, endocytosis and elimination. During the binding process, the inner microvilli cell membrane of the RPE cell binds to the shed outer segment of the photoreceptor cell, which is then internalized into the cell and finally transported to the lysosome by the cytoskeleton and vesicles for elimination.

[0097] TGF-β / Nodal / Activin signaling pathway: refers to the simultaneous activation or inhibition of the TGF-β signaling pathway, Nodal signaling pathway and Activin signaling pathway.

[0098] Nicotinamide metabolic signaling pathway: This pathway relies on the small molecule nicotine. The theoretical basis comes from: Hong S. et al. Nicotinamide N-methyltransferase regulates hepatic nutrient metabolism through Sirt1 protein stabilization. Nat Med. 2015 Aug;21(8):887-94. doi: 10.1038 / nm.3882. Epub 2015 Jul 13. PMID: 26168293; PMCID: PMC4529375.

[0099] The culture medium used during the differentiation process in this article was serum-free. The culture medium used for culturing iPSCs was E8; for RPE cell differentiation from iPSCs, E6 medium supplemented with small molecules was used. E6 medium is a medium that has been reduced in FGF2 and TGF-β compared to E8 medium.

[0100] Unless otherwise specified, the reagents, materials, and equipment used in this example are all commercially available; and the experimental methods, unless otherwise specified, are all conventional experimental methods in the art.

[0101] Activin A belongs to the transforming growth factor superfamily and plays a role in many aspects, including early embryogenesis, vascular smooth muscle proliferation, arteriosclerosis, neural differentiation induction, hematopoietic cell proliferation and differentiation, and endocrine center pituitary hormone secretion regulation. In this application, its role is to activate the TGF-β / Activin signaling pathway and differentiate retinal progenitor cells into RPE precursor cells.

[0102] In this specification, various chemical substances such as WNT inhibitors, BMP inhibitors, FGF inhibitors, etc. each include free forms, salts, etc. For example, Y-27632 includes free forms of Y-27632 and its hydrochloride, Y-27632 dihydrochloride, etc.

[0103] In the text, “not more than” means less than or equal to.

[0104] Day(0) represents day 0, Day(1) represents day 1, and so on.

[0105] Differentiation Bassal Medium: translated as basic culture medium.

[0106] Retinal progenitor Medium: translated as retinal progenitor cell culture medium.

[0107] Immature RPE Medium: translated as RPE precursor culture medium.

[0108] fRPE (human fetal retinal pigment epithelial cells) served as a positive control for iRPE. They were isolated and cultured from aborted fetal eyeballs using existing methods, including but not limited to the method described in Chinese Patent CN201310552005.0 for isolating and culturing human fetal retinal pigment epithelial cells.

[0109] 2. Culture condition design. In all steps herein, the culture and cell differentiation of cells are carried out by the method of adherent culture. There is no particular restriction on the culture container for the differentiation of human induced pluripotent stem cells and human induced pluripotent stem cells to be used for adherent culture, as long as it can adhere to the culture cells and can realize the differentiation of human induced pluripotent stem cells into RPE cells in the culture medium. The application is selected as the well plate incubated with Laminin.

[0110] In the present application, the most critical point is that only by combining small chemical molecules with basal culture medium, a higher and more stable RPE cell population can be obtained in a shorter time under simplified and clear culture medium components, and the differentiated RPE cells have a better phagocytic effect.

[0111] Therefore, the culture medium of this application is primarily based on E6 medium, or a culture medium with clear components that have equivalent or similar functionalities to E6. Of course, a culture medium with more complex components than E6 can also achieve the technical effects of this application. However, the first purpose of this application is to clarify the differentiation pathway; the second purpose is to use a culture medium with simplified and clear components for differentiation to ensure subsequent industrial production.

[0112] The replacement of culture medium is to carry out the replacement of culture medium at the end of each step, and the replacement of culture medium here refers to that the culture medium of neuroectodermal cell induction phase is replaced with the culture medium of RPE progenitor cells or the culture medium of RPE progenitor cells is replaced with RPE cell induction phase culture medium or RPE cell induction phase culture medium is replaced with RPE cell maturation phase culture medium.

[0113] In this article, each stage: neuroectoderm cell induction stage, RPE progenitor cell stage, RPE cell induction stage, and RPE cell maturation stage, is to change the medium every day or every other day. Here, the medium change refers to replacing the same basal medium supplemented with the same small molecule.

[0114] Culture conditions (such as culture temperature and CO2 concentration) can be appropriately determined. Although the culture temperature is not particularly limited, it is 30°C to 40°C, preferably 37°C. The CO2 concentration is about 1% to 10%, preferably about 5%.

[0115] 3. Selection of iPSCs. iPSCs used in the neuroectodermal cell induction phase are preferably iPSCs or immunogenic-restricted universal iPSCs with B2M and CIITA gene knockouts. HLA-KO The universal iPSC HLA-KO iPSCs can be prepared using methods known to those skilled in the art. This can avoid immune rejection of differentiated RPE cells and make them more versatile. iPSCs can be prepared using methods known to those skilled in the art.

[0116] Compared to embryonic stem cells (ESC, ESC is derived from the commercial embryonic stem cell line H9), this application specifically uses iPSC or universal iPSC HLA-KO There are more factors to consider during RPE cell differentiation, such as universal iPSC HLA-KO The stability of its own pluripotency, whether the low immunogenicity after differentiation can be effectively retained, etc. Therefore, these factors have also become technical difficulties in the differentiation process of this application. In order to weaken the impact of these problems on the stability of RPE cells obtained by iPSC differentiation, and to improve the differentiation effect of RPE cells obtained by iPSC differentiation, this application has made some changes to iPSC or universal iPSC. HLA-KO Perform certain pretreatment. iPSC or universal iPSC HLA-KO Culture in iPSC medium for 4-7 generations, preferably 4-5 generations, to obtain more stable iPSCs or universal iPSCs HLA-KO ; Guaranteed iPSC or universal iPSC HLA-KO Higher purity, iPSC removal or universal iPSC HLA-KO Impurity cells in the iPSC or universal iPSC HLA-KO It can have a stable differentiation effect and ensure that the differentiated RPE cells have low immunogenicity.

[0117] The ratio of each inoculation to passage is designed to be 1: (3-12), preferably 1: (3-10), and exemplary ratios are 1: 3, 1: 4, 1: 5, 1: 6, 1: 7, 1: 8, 1: 9, and 1: 10. A passage ratio lower than 1: 3 will cause the cells to be too full after passage, and the cells will die due to crowding. A passage ratio higher than 1: 12 will cause the cells to differentiate into other miscellaneous cells. In actual application, a passage ratio of 1: (3-10) has little effect on the performance, differentiation efficiency, and stability of the RPE cells finally obtained. This application selects a passage ratio of 1: 8 for verification in the description of subsequent embodiments.

[0118] Among them, any commercially available stem cell culture medium can be selected as the pluripotent stem cell culture medium. In this application, in order to clarify the ingredients and ensure that the differentiation process is repeatable, the pluripotent stem cell culture medium selected is: culture medium and additive Y27632. The dosage of Y27632 is to ensure that pluripotent stem cells can adhere to the wall culture, so it can be appropriately confirmed by ordinary technicians in this field. For example, specifically, the dosage of Y27632 is 10μM (10μmol / L). As a basic culture medium for factors that maintain the undifferentiated state, commercially available E8, Stem Flex or mTeSR1 can also be used; these culture media can be used to maintain or expand pluripotent stem cells.

[0119] The iPSCs after subculture were digested, mainly using 0.25% EDTA by mass volume ratio for 5-10 minutes, washed once with DPBS buffer, and then pipetted with 1 mL of iPSC culture medium; then re-inoculated onto a 12-well plate incubated with Laminin and continued to be cultured. This embodiment mainly clarifies the differentiation pathways of each step of differentiation, so EDTA with a more clear chemical composition is used instead of protease. Its ultimate goal is to ensure that the components of each operation link in this application are fully clear, to avoid karyotype changes in the treated cells due to proteases during the digestion process, so as to ensure that the post-differentiation process can have a high degree of stability and repeatability.

[0120] 4. Preparation of retinal pigment epithelial (RPE) cells. Figure 1A shows a flowchart of small molecule-based differentiation in E6 basal medium; Figure 1B shows the induction of iPSC-RPE or iPSC differentiation at different time points. HLA-KO - Bright field images of typical cell morphology of cells in RPE process.

[0121] The RPE cells of this application are based on iPSC (iPSC or universal iPSC HLA-KOThe differentiation of iPSCs into RPE cells is achieved by adding chemical small molecules as inhibitors or activators to E6 culture medium: neuroectoderm cell induction period, RPE progenitor cell induction period, RPE cell induction period and RPE cell maturation period.

[0122] The main process is as follows: (1) D0-D2, neuroectodermal cell induction period (Neuroectodem): inhibit any one or more of the three signaling pathways, including the TGF-β / Nodal / Activin signaling pathway, the BMP signaling pathway, and the WNT signaling pathway, to induce differentiation.

[0123] Specifically, inhibitors used to inhibit the TGF-β / Nodal / Activin signaling pathway are limited to small molecules, including but not limited to SB431542. Preferably, the dosage of SB431542 is 1-50 μM. A dosage too low will prevent stem cells from differentiating into the ectoderm, while a high dosage will be cost-prohibitive. The concentration can be maintained at a constant daily dose or varied on different days, as long as retinal pigment epithelial cells can be obtained using the methods of this application.

[0124] Inhibitors used to inhibit the BMP signaling pathway are limited to small molecules, including but not limited to LDN193183, at a dosage of 10-100 nM. A dosage too low will prevent stem cells from differentiating into the ectoderm, while a dosage too high will be costly. The concentration can be maintained at a constant daily dose or varied on different days, as long as retinal pigment epithelial cells can be obtained using the methods of this application.

[0125] The inhibitors used to inhibit the WNT signaling pathway are mainly limited to small molecules, including but not limited to IWR-1 or IWR-2, with an addition dosage of 10-100 μM for IWR-1 and 10-100 μM for IWR-2. Too low a dosage will cause stem cells to differentiate into the mesoderm, while too high a dosage will be too costly. In specific use, the concentration can be a constant addition amount every day or different addition amounts can be used on different days, as long as retinal pigment epithelial cells can be obtained using the method of this application.

[0126] The number of days in the neuroectodermal cell induction period is not particularly limited, but is usually not more than 5 days, and preferably not more than 3 days.

[0127] As shown in FIG1B , the end of the neuroectodermal cell induction period is when the cells reach 100% fusion and the cell morphology forms a neuroectodermal cell-like state. At this point, the differentiation induction of the RPE progenitor cell induction period is carried out.

[0128] (2) Day 2-Day 6 RPE progenitor induction period (Retional progenitor induction): Activate the Nicotinamide metabolic signaling pathway to induce differentiation.

[0129] Specifically, activation of the nicotinamide metabolic signaling pathway is limited to the use of chemical small molecules, including but not limited to nicotinamide. The dosage of nicotinamide is selected to be 1-50mM. If the dosage is too low, the cells will not differentiate into retinal progenitor cells, while if the dosage is too high, a large number of cells will die and the cost is too high. The concentration can be maintained at a constant addition amount every day or different addition amounts can be used on different days, as long as retinal pigment epithelial cells can be obtained using the methods of the present application.

[0130] The number of days in the RPE progenitor cell induction period is not particularly limited, but is usually not more than 6 days, and preferably not more than 4 days.

[0131] As shown in FIG1B , the RPE progenitor cell induction period can be expressed by the morphology of the cells or by some indicators used during the experiment to determine the completion of the process.

[0132] (3) Day 6-Day 10 RPE cell induction period (RPE specialization): Induce differentiation by activating any one or more of the three signaling pathways: TGF-β / Nodal / Activin signaling pathway, inhibiting FGF signaling pathway, and activating WNT signaling pathway.

[0133] Specifically, the inhibition of the FGF signaling pathway in this process is limited to the use of small molecules, including but not limited to SU5402, added at a dosage of 1-10 μM. Too low a dosage will result in impure differentiated RPE precursor cells and the appearance of many neurons, and too high a dosage will cause cell death. The activation of the TGF-β / Nodal / Activin signaling pathway in this process is limited to the use of small molecules, including but not limited to Activin A, added at a dosage of 10-200 ng / mL. Too low a dosage will result in impure differentiated RPE precursor cells and the appearance of many neurons, and too high a dosage will be too costly. The activation of the WNT signaling pathway in this process is limited to the use of small molecules, including but not limited to CHIR99021, added at a dosage of 1-10 μM. Too low a dosage will result in impure differentiated RPE precursor cells and the appearance of many neurons, and too high a dosage will also cause the cell morphology to develop into fibroblasts.

[0134] The number of days in the RPE cell induction period is not particularly limited, and is generally no more than 10 days, and preferably no more than 6 days. Here, no more than means less than or equal to.

[0135] As shown in Figure 1B , the end of the RPE cell induction period is marked by apoptosis of about 10% of non-RPE cells, and the non-apoptotic cells appear as a tight single layer of cobblestone-like RPE-like cells, which are RPE precursor cells.

[0136] (4) Day 10-Day 30, RPE cell maturation: Activate the Nicotinamide metabolic signaling pathway and any one or more of the WNT signaling pathways to induce differentiation.

[0137] Specifically, the late-stage RPE culture medium includes E6 culture medium and small molecules used to activate the Nicotinamide metabolic signaling pathway and the WNT signaling pathway. The small molecule used to activate the Nicotinamide metabolic signaling pathway is Nicotinamide, and the addition amount is 1-50mM. Too low a dosage will cause the maturation of RPE cells to slow down, affecting the maturation time of RPE cells. Too high a dosage will be too costly. The small molecule used to activate the WNT signaling pathway is CHIR99021, and the addition amount is 1-10μM. Too low a dosage will cause the maturation of RPE cells to slow down, affecting the maturation time of RPE cells, and affecting RPE cell proliferation. Too high a dosage will be too costly.

[0138] The number of days in the neuroectodermal cell induction period is not particularly limited, but is usually not more than 15 days, preferably not more than 10 days.

[0139] As shown in Figure 1B, during the maturation stage of RPE cells, RPE precursor cells gradually form a cobblestone pattern with evenly distributed melanin. When a functional monolayer of RPE cells is formed, the cells become more regular cobblestone-like with darker melanin.

[0140] In the differentiation technology scheme of the present application, there is no need to manually remove non-RPE-like cells during the differentiation process; pure iPSCs-RPE (iPSC-RPE or iPSC) can be obtained by subculturing the mature RPE cells. HLA-KO -RPE). The basic components of the differentiation medium at this stage only include E6 (reduced bFGF and TGF-β compared to E8) medium, without other animal-derived components. At the same time, through the control of the signal pathway of this application, iPSC (iPSC or universal iPSC) HLA-KO ) Differentiated RPE cells have a higher density than the initial seeded iPSCs by about 10 11 times the cell yield.

[0141] Compared to the differentiation process in the prior art, such as the differentiation method disclosed in Document 1, which takes nearly 60 days to obtain RPE cells with uniform pigmentation, and 42 days to obtain stable RPE cells compared to Document 2, the cycle for obtaining RPE cells with uniform pigmentation in the present application is only about 30 days.

[0142] Preferably, in order to obtain more RPE cells and to ensure the functional stability of RPE cells, the ratio of RPE cells during induction phase and RPE cells during maturation phase is designed to be 1:(3-20), exemplified by 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20.

[0143] In this application, RPE cells (iPSC or universal iPSC) are obtained by differentiation of iPSC HLA-KO ) differentiation efficiency and RPE cell performance verification are mainly based on flow cytometry, immunofluorescence detection, reverse transcription PCR (RT-PCR) detection, and in vitro phagocytic function detection.

[0144] 1. Identical cells (iPSCs) HLA-KO ), validation of different differentiation methods. Introduction to the overall method of the experimental group. (1) Cultivation of human induced pluripotent stem cells (hiPSC): The obtained iPSCs were knocked out of the B2M gene of HLA class I molecules and the CIITA gene, the main regulator of HLA class II. HLA-KO Cells were seeded at a 1:8 ratio on laminin-incubated 12-well plates and cultured in a 37°C, 5% CO2 incubator. Growth was observed daily under a microscope and fresh E8 medium was replaced daily. Cells were passaged every 3-4 days at a 1:8 ratio. During passage, cells were treated with 0.25% EDTA (mass-to-volume ratio) for 5-10 minutes and washed once with DPBS. Cells were then gently pipetted with 1 mL of E8 medium no more than eight times, and transferred to a fresh volume of laminin-incubated 12-well plates for continued culture. On the first day after each passage, 10 μM Y-27632 was added to the culture medium. After four passages, differentiation was performed. The detailed differentiation process is shown in Figure 1A.

[0145] (2) Induced universal human induced pluripotent stem cells (iPSCs) HLA-KO ) differentiated into human retinal pigment epithelial cells (iPSCs) HLA-KO-RPE): When the cultured hiPSCs reached 80% fusion, this time point was defined as Day (-1). At this time, the cells were digested and seeded onto a 12-well plate incubated with Laminin at a passage ratio of 1:10. The culture medium was replaced with E8 medium supplemented with 10 μM Y27632 for culture. After 1 day of treatment, this time point was defined as Day (0).

[0146] Day (0) to Day (2), the culture medium was replaced with differentiation medium Neuroectoderm Medium (the first culture medium in the kit). The culture medium (Neuroectoderm Medium) contains any combination of 10-100 ng / mL SB431542, 50-100 ng / mL LDN193183, and 10-50 mM IWR-1 added to E6 medium for neuroectoderm cell induction.

[0147] After inducing neuroectodermal cells to Day (6), the culture medium was replaced with Retinal Progenitor Medium (the second culture medium in the kit), which is an E6 culture medium with 1-50 mM Nicotinamide added thereto for RPE progenitor cell induction.

[0148] On Day (10), when RPE progenitor cell induction is complete, the culture medium is replaced with Immature RPE Medium (the third culture medium in the kit). The culture medium (Immature RPE Medium) is E6 medium supplemented with any combination of 10-200 ng / mL Activin A, 1-10 μM SU5402, and 1-10 μM CHIR99021 for RPE progenitor cell induction.

[0149] RPE progenitor cell induction was completed until Passage 0 (Day (16)), and the differentiated cells were digested and passaged with 1×Triple in a 37°C, 5% CO2 incubator for 5-10 minutes. After passage, the 12-well plates were pre-incubated with Laminin to obtain naive iPSCs. HLA-KO -RPE were passaged at a ratio of 1:(3-20) and cultured in Mature RPE Medium (the fourth medium in the kit). The medium (Mature RPE Medium) mainly contains any combination of E6 basal medium, 1-50mM Nicotinamide, and 1-10μM CHIR99021.

[0150] The cells were cultured using Mature RPE Medium. On Day (16)-Passage 1 and Day (22)-Passage 2, 1×Triple was used for digestion in a 37°C, 5% CO2 incubator for 5-10 minutes to obtain mature iPSCs. HLA-KO -RPE cells were passaged at a ratio of 1:4 and continued to be cultured in Mature RPE Medium until Day (30).

[0151] Table 1 Small molecule selection scheme at each stage Group Neuroectodermal cell induction stage RPE progenitor cell induction stage RPE cell induction stage RPE cell maturation stage iKO-RPE-1 25μM SB431542, 50nM LDN193183, 20μM IWR-1 25 mM Nicotinamide 100ng / mL Activin A 5μM CHIR9902, 25mM Nicotinamide iKO-RPE-2 25μM SB431542, 20μM IWR-1 25 mM Nicotinamide 100ng / mL Activin A , 5μM SU5402 5μM CHIR9902 iKO-RPE-3 50nM LDN193183 25 mM Nicotinamide 100ng / mL Activin A , 5μM SU5402, 5μM CHIR9902 15μM CHIR9902, 25mM Nicotinamide

[0152] The applicant has verified through multiple experiments that SB431542 1-50μM, LDN193183 10-100nM, IWR-1 10-100μM, Nicotinamide 1-50mM, Activin A 10-200ng / mL, CHIR99021 1-10μM, and SU5402 1-10μM, under the same signaling pathway, different dosages are selected within their respective ranges, all of which produce the same or similar effects as in Table 1.

[0153] 2. Verification of Different Differentiation Methods Using the Same Cells (Conventional iPSCs) The only difference from Example 1 is that conventional iPSCs are used as cells.

[0154] Table 2 Small molecule selection options at each stage

[0155] Group Neuroectoderm cells Induction period RPE progenitor cells Induction period RPE cells Induction period RPE cells Maturation period iRPE-1 25μM SB431542, 50nM LDN193183, 20μM IWR-1 25 mM Nicotinamide 100ng / mL Activin A 5μM CHIR9902, 25mM Nicotinamide iRPE-2 25μM SB431542, 20μM IWR-1 25 mM Nicotinamide 100ng / mL Activin A, 5μM SU5402 5μM CHIR9902 iRPE-3 50nM LDN193183 25 mM Nicotinamide 100ng / mL Activin A, 5μM SU5402, 5μM CHIR9902 15μM CHIR9902, 25mM Nicotinamide

[0156] The applicant has verified through multiple experiments that SB431542 1-50μM, LDN193183 10-100nM, IWR-1 10-100μM, Nicotinamide 1-50mM, Activin A 10-200ng / mL, CHIR99021 1-10μM, and SU5402 1-10μM, under the same signaling pathway, different dosages are selected within their respective ranges, all of which produce the same or similar effects as in Table 2.

[0157] III. Immunofluorescence Assay. After cells in each experimental group, positive control group, and negative control group reached confluency, the supernatant was aspirated and washed once with DPBS. The cells were incubated with 4% paraformaldehyde (v / v) for 15 minutes at room temperature. The cells were then washed three times with DPBS for 2 minutes each. The cells were then permeabilized with 0.2% Triton-X100 (w / v) for 10 minutes and blocked with 1% bovine serum albumin (BSA) in DPBS for 1 hour at room temperature. After aspirating the BSA, the cells were directly incubated with the following primary antibodies: mouse monoclonal MITF antibody (1:100 dilution in diluent), mouse monoclonal OCT2 antibody (1:300 dilution in diluent), rabbit monoclonal TYROSINASE antibody (1:100 dilution in diluent), rabbit monoclonal RPE65 antibody (1:100 dilution in diluent), and rabbit monoclonal ZO-1 antibody (1:500 dilution in diluent) without washing, and incubated overnight at 4°C. The sections were then washed three times with PBS for 5 minutes each. Secondary antibodies were then added: 546-conjugated goat anti-rabbit IgG (1:1000 dilution in diluent), 546-conjugated goat anti-mouse IgG (1:1000 dilution in diluent), FITC-conjugated goat anti-rabbit IgG (1:1000 dilution in diluent), and FITC-conjugated goat anti-mouse IgG (1:1000 dilution in diluent). The sections were incubated at room temperature for 2 hours. The sections were then washed three times with DPBS for 5 minutes each. DAPI staining solution was then added and incubated in the dark for 15 minutes at room temperature. Finally, the sections were washed three times with DPBS for 5 minutes each and observed and photographed directly under an inverted fluorescence microscope.

[0158] Immunofluorescence analysis of the target cells iRPE or iKO-RPE generated after differentiation showed that the subcultured iRPE or iKO-RPE positively expressed RPE cell-specific marker proteins: MITF, ZO-1, TYROSINASE (TYR), BEST1, and RPE65, as shown in Figure 2. Figure 2A shows immunofluorescence analysis of specific protein expression in differentiated iKO-RPE cells and the positive control fRPE (fRPE); Figure 2B shows immunofluorescence analysis of specific protein expression in differentiated iRPE cells.

[0159] IV. Reverse Transcription qPCR Assay. Total RNA was extracted from each cell group using an RNA extraction kit (Novozymes, China). OD values ​​were measured to ensure that the OD260 / OD280 ratio for each group was between 1.8 and 2.1 to ensure purity. RNA was then reverse-transcribed into cDNA using a reverse transcription kit (Novozymes, China). The reaction system and procedure were described in the product manual. The resulting cDNA was used for RT-PCR. Primer sequences are shown in Table 3. The reaction system was described in the SYBR Green Mix kit (Bio, USA) manual. After centrifugation, the reaction was placed in a PCR instrument. Pre-denaturation was performed at 95°C for 5 minutes, and the reaction was repeated for 40 cycles (94°C for 30 seconds; 59°C for 30 seconds; and 72°C for 30 seconds). A 2 μL aliquot of the reaction product was added to 3 μL of SYBR Green Mix, mixed, and then placed in a PCR instrument.

[0160] Table 3 Primer sequences

[0161] Primer sequence (5' to 3') GAPDH-FSEQ ID No.1: GGACGAGATCCCTCCAAAATGAPDH-RSEQ ID No.2: GGCTGTTGTCATACTTCTCATGGRPE65-FSEQ ID No.3: TTGGATCTGAGCCATTTTACCACRPE65-RSEQ ID No.4: GTCAGTAACCTCTACTCCTCGAAMITF-FSEQ ID No.5: TGCCCAGGCATGAACACACMITF-RSEQ ID No.6: TGGGAAAAATACACGCTGTGAGPAX6-FSEQ ID No.7: CCAGGGCAATCGGTGGTAGTPAX6-RSEQ ID No.8: ACGGGCACTCCCGCTTATACBEST1-FSEQ ID No.9: AACTGAGCCTACCACACAACABEST1-RSEQ ID No.10: CGGATTCGACCTCCAAGCC

[0162] Note: F: Forward primer; R: Reversed primer; the product sequence length of the primer for the GAPDH gene is 197bp; the product sequence length of the primer for the RPE65 gene is 236bp; the product sequence length of the primer for the MITF gene is 276bp; the product sequence length of the primer for the PAX6 gene is 84bp; the product sequence length of the primer for the BEST1 gene is 88bp.

[0163] RPE65, MITF, PAX6 and BEST1 were used to detect the expression levels of RPE, and GAPDH was used as an internal reference gene to correct and normalize the expression of target genes.

[0164] RT-PCR results also showed that differentiated RPE cells can positively express RPE-specific marker genes: RPE-65, MITF, PAX6 and BEST1. These RPE cell marker genes were positively expressed in the positive control hRPE cells and negatively expressed in the negative control hiPSCs (Figure 3). Figure 3 is a reverse transcription PCR analysis of cell iRPE or iKO-RPE and positive control fRPE-specific gene expression: Figure 3A is the expression of PAX6 in iPSC, fRPE, iKO-RPE-1, iKO-RPE-2, iKO-RPE-3, iRPE-1, iRPE-2 and iRPE-3; Figure 3B is the expression of PAX6 in iPSC, fRPE, iKO-RPE-1, iKO-RPE-2, iKO-RPE-3, iRPE-1, iRPE Figure 3C shows the expression of MITF in RPE cells of iPSCs, fRPE, iKO-RPE-1, iKO-RPE-2, iKO-RPE-3, iRPE-1, iRPE-2, and iRPE-3; Figure 3D shows the expression of BEST1 in iPSCs, fRPE, iKO-RPE-1, iKO-RPE-2, iKO-RPE-3, iRPE-1, iRPE-2, and iRPE-3. "Normalized to GAPDH" in the figure is the expression level relative to GAPDH.

[0165] 5. Flow cytometry. After the cells reached confluency, they were digested and the single-cell suspension was washed once with DPBS. The suspension was then incubated with 4% paraformaldehyde (v / v) at room temperature for 10 minutes, washed once with DPBS, centrifuged, and the supernatant discarded. The suspension was then permeabilized with 0.2% Triton-X100 (w / v) for 10 minutes, washed once with DPBS, centrifuged, and the supernatant discarded. The suspension was then blocked with 1% bovine serum albumin (BSA) in DPBS at room temperature for 30 minutes. After centrifugation and removal of the BSA, the suspension was incubated with an APC-conjugated PAX6 antibody at room temperature for 0.5 hours, washed once with PBS, and the supernatant discarded. The suspension was loaded onto a flow cytometer for analysis. For MITF and RPE65, after aspirating and discarding BSA, apply the primary antibodies (mouse monoclonal MITF antibody at a 1:100 dilution in diluent) and rabbit monoclonal RPE65 antibody at a 1:100 dilution in diluent) without washing, and incubate overnight at 4°C. Wash once with PBS, then add the secondary antibodies (FITC-conjugated goat anti-mouse IgG antibody at a 1:1000 dilution in diluent) and PE-conjugated goat anti-rabbit IgG antibody at a 1:1000 dilution in diluent) and incubate at room temperature for 1 hour. Wash once with PBS, discard the supernatant, add DPBS, and analyze on a flow cytometer.

[0166] hiPSCs-RPE cells positively expressed RPE cell-specific marker proteins; the percentage of cells positive for RPE-65, MITF, and PAX6 was greater than 97%, indicating high purity of hiPSCs-RPE, consistent with fRPE. Residual stem cells were detected in the differentiated RPE cells by qPCR and flow cytometry, and no residual stem cells were detected.

[0167] Specifically, Figure 4A is a flow cytometry analysis of the expression of specific protein MITF in cells fRPE, iKO-RPE-1, iKO-RPE-2, and iKO-RPE-3: (a) is the expression of fRPE specific protein MITF (98.98%); (b) is the expression of iKO-RPE-1 specific protein MITF (98.52%); (c) is the expression of iKO-RPE-2 specific protein MITF (99.41%); (d) is the expression of iKO-RPE-3 specific protein MITF (99.26%); iKO-RPE-1, iKO-RPE-2 and iKO-RPE-3 were obtained according to the three different experimental methods in Example 1. Figure 4B is a flow cytometry analysis of the expression of the iPSC-RPE specific protein MITF: (a) is the expression of the iRPE-1 specific protein MITF (98.56%); (b) is the expression of the iRPE-2 specific protein MITF (97.93%); (c) is the expression of the iRPE-3 specific protein MITF (99.02%); iRPE-1, iRPE-2 and iRPE-3 were obtained according to the three different experimental methods in Example 2.

[0168] Figure 5A shows flow cytometry analysis of iPSC cells HLA-KO -RPE and positive control fRPE specific protein RPE65 expression: (a) is fRPE specific protein RPE65 expression (99.19%); (b) is iKO-RPE-1 specific protein RPE65 expression (99.02%); (c) is iKO-RPE-2 specific protein RPE65 expression (99.13%); (d) is iKO-RPE-3 specific protein RPE65 expression (99.59%); iKO-RPE-1, iKO-RPE-2 and iKO-RPE-3 are iKO-RPE obtained according to the three different experimental methods in Example 1. Figure 5B is a flow cytometry analysis of the expression of the iPSC-RPE specific protein RPE65: (a) is the expression of the iRPE-1 specific protein RPE65 (99.54%); (b) is the expression of the iRPE-2 specific protein RPE65 (99.83%); (c) is the expression of the iRPE-3 specific protein RPE65 (99.87%); iRPE-1, iRPE-2 and iRPE-3 were obtained according to the three different experimental methods in Example 2.

[0169] Figure 6A is flow cytometry analysis of iPSC cells HLA-KO-RPE and positive control fRPE-specific protein PAX6 expression: (a) fRPE-specific protein PAX6 expression (99.10%); (b) iKO-RPE-1 specific protein PAX6 expression (99.23%); (c) iKO-RPE-2 specific protein PAX6 expression (99.37%); (d) iKO-RPE-3 specific protein PAX6 expression (98.18%); iKO-RPE-1, iKO-RPE-2 and iKO-RPE-3 were obtained according to the three different experimental methods in Example 1. Figure 6B is a flow cytometry analysis of the expression of the iPSC-RPE-specific protein PAX6: (a) is the expression of the iRPE-1 specific protein PAX6 (98.23%); (b) is the expression of the iRPE-2 specific protein PAX6 (97.01%); (c) is the expression of the iRPE-3 specific protein PAX6 (98.65%); iRPE-1, iRPE-2 and iRPE-3 were obtained according to the three different experimental methods in Example 2.

[0170] 6. In vitro phagocytic function detection.

[0171] Each experimental group was 1×10 6 Cells were seeded into 12-well plates at 37°C for 2 days. After 2 days, fluorescent particles were added and incubated at 4°C / 37°C for 8 hours. Trypan Blue was added to quench the fluorescence. The cells were then washed three times with DPBS, digested with TrpLE 1×, resuspended in DPBS, and analyzed on a flow cytometer. Method: Parinot C, Rieu Q, Chatagnon J, Finnemann SC, Nandrot EF. Large-scale purification of porcine or bovine photoreceptor outer segments for phagocytosis assays on retinal pigment epithelial cells. J Vis Exp. 2014 Dec 12;(94):52100. doi: 10.3791 / 52100. PMID: 25548986; PMCID: PMC4396958.

[0172] Another important function of RPE cells is phagocytosis of shed outer segments of photoreceptors. To examine the phagocytic activity of differentiated RPE cells, fluorescent particles were used for post-cell incubation tracking. Flow cytometry revealed that the fluorescent particles were more clearly engulfed by iPSC-RPE and fRPE cells. Each experiment was repeated three times. Figure 7A is a graph showing the phagocytic ability of fRPE, iRPE-1, iRPE-2, iRPE-3, iKO-RPE-1, iKO-RPE-2, and iKO-RPE-3 at 37°C; Figure 7B is a graph showing the phagocytic ability of fRPE, iRPE-1, iRPE-2, iRPE-3, iKO-RPE-1, iKO-RPE-2, and iKO-RPE-3 at 4°C; Figure 7C is a negative control group for fRPE, iRPE-1, iRPE-2, iRPE-3, iKO-RPE-1, iKO-RPE-2, and iKO-RPE-3, i.e., no fluorescent particles were added during the incubation process. In the figure, iKO-RPE is iPSC HLA-KO Differentiated RPE cells (iPSCs HLA-KO -RPE), iRPE are RPE cells differentiated from iPSC (iPSC-RPE).

[0173] 7. In vitro iKO-RPE immune function detection.

[0174] Abnormal expression of IFN-γ is associated with many autoinflammatory and autoimmune diseases. The importance of IFN-γ to the immune system is more reflected in its immunostimulatory and immunoregulatory functions. It is mainly secreted by NK cells and NKT cells and plays a role in innate immunity; in the process of antigen-specific immunity, it is secreted by CD4+TH1 and CD8 cytotoxic T cells. In many different pathological conditions, including infection, autoimmune diseases, transplant rejection, allergic reactions, and IFN-γ can be used as a disease marker. Here, the applicant simulated the in vivo inflammatory environment under IFN-γ stimulation, knocked out the B2M and CIITA genes, and the differentiated iKO-RPE cells HLA-A, B, C and other HLA gene groups encoding HLA class I and HLA-DR, DQ, DP and other HLA gene groups encoding HLA class II MHC were inactivated, thereby eliminating the rejection reaction in the body. Method basis: Petrus-Reurer S, Winblad N, Kumar P, Gorchs L, Chrobok M, Wagner AK, Bartuma H, Lardner E, Aronsson M, Plaza Reyes Á, André H, Alici E, Kaipe H, Kvanta A, Lanner F. Generation of Retinal Pigment Epithelial Cells Derived from Human Embryonic Stem Cells Lacking Human Leukocyte Antigen Class I and II. Stem Cell Reports. 2020 Apr 14;14(4):648-662. doi: 10.1016 / j.stemcr.2020.02.006. Epub 2020 Mar 19. PMID: 32197113; PMCID: PMC7160308.

[0175] Specifically: Each experimental group was divided into 1×10 5 Cells were seeded into 12-well plates at 37°C for 2 and 5 days with or without IFN-γ stimulation. After 2 days, HLA class I proteins (HLA-A / B / C) were detected by flow cytometry. After 5 days, HLA class II proteins (HLA-DP / DQ / DR) were detected by flow cytometry. Flow cytometry visually demonstrates the inactivation of HLA class I MHC (Figure 8A) and HLA class II MHC (Figure 8B) in iKO-RPE cells differentiated from cells lacking the B2M and CIITA genes under IFN-γ stimulation.

[0176] An RPE cell preparation comprises the aforementioned RPE cells derived from pluripotent stem cells.

[0177] Another object of the present application is to provide a pharmaceutical composition for ophthalmology, comprising the aforementioned RPE cells derived from pluripotent stem cells as an active ingredient.

[0178] Another object of the present application is to provide a reagent for evaluating the toxicity or efficacy of a test substance, comprising the aforementioned RPE cells derived from pluripotent stem cells.

[0179] Another object of the present application is to provide a method for evaluating the toxicity or efficacy of a test substance, comprising contacting the aforementioned pluripotent stem cell-derived RPE cells with the substance, and determining the effect of the substance on the cells.

[0180] The solutions of Example 1 and Example 2 of the present application can also be implemented through a kit.

[0181] A kit comprises a culture medium combination; the culture medium combination includes: a first culture medium, a second culture medium, a third culture medium and a fourth culture medium.

[0182] The first culture medium includes a basal culture medium and additive A; the additive A is one of SB431542, LDN193183, IWR-1 or IWR-2, or multiple thereof in any molar ratio; wherein the addition amount of SB431542 is 1-50 μM, the addition amount of LDN193183 is 10-100 nM, the addition amount of IWR-1 is 10-100 μM, and the addition amount of IWR-2 is 10-100 μM; the second culture medium includes a basal culture medium and additive B, the additive B is Nicotinamide, and the addition amount of Nicotinamide is 1-50 mM.

[0183] The third culture medium includes a basal culture medium and an additive C, wherein the additive C is one or more of Activin A, SU5402, or CHIR99021 in any molar ratio; wherein the amount of Activin A added is 10-200 ng / mL, the amount of SU5402 added is 1-10 μM, and the amount of CHIR99021 added is 1-10 μM.

[0184] The fourth culture medium includes a basal culture medium and an additive D, wherein the additive D is one of Nicotinamide and CHIR99021 or both in any molar ratio; wherein the amount of Nicotinamide added is 1-50 mM, and the amount of CHIR99021 added is 1-10 μM.

[0185] As an improved technical solution of the present application, the basal culture medium is E6.

[0186] The scheme for implementing Example 1 and Example 2 of the present application based on a kit includes the following steps:

[0187] Step 1: culturing pluripotent stem cells in a first culture medium for 2 days to obtain neuroectoderm cells;

[0188] Step 2, culturing the neuroectoderm cells in the second culture medium for 4 days to obtain RPE progenitor cells;

[0189] Step 3, culturing the RPE progenitor cells in the third culture medium for 4 days to obtain RPE cells;

[0190] Step 4: The RPE cells are cultured in the fourth culture medium for 20 days to obtain mature RPE cells. Industrial Applicability

[0191] The present application combines the differentiation process with the differentiation signaling pathway of RPE cells in vivo to clarify the state of cells during the differentiation process, greatly improving the differentiation efficiency and shortening the differentiation cycle. The present application only takes 30 days; and the cells have high purity and high yield.

[0192] The present application specifies the signal pathway activators or inhibitors that need to be added during the differentiation process, so that the differentiation method is fixed and can be efficiently repeated.

[0193] The differentiation process of this application does not introduce any animal-derived components, which blocks the possibility of exogenous virus invasion and improves the safety of future clinical applications.

Claims

1. A type of RPE cells derived from pluripotent stem cells, characterized in that, the RPE cells are obtained from pluripotent stem cells based on the following differentiation steps: Neuroectodermal cell induction stage: Induce differentiation by inhibiting any one or more of the three signaling pathways of the TGF-β / Nodal / Activin signaling pathway, the BMP signaling pathway, and the WNT signaling pathway; RPE progenitor cell induction stage: Activate the Nicotinamide metabolic signaling pathway for induction and differentiation; RPE cell induction stage: Activate any one or more of the three signaling pathways of the TGF-β / Nodal / Activin signaling pathway, inhibit the FGF signaling pathway, and activate the WNT signaling pathway for induction and differentiation; RPE cell maturation stage: Activate any one or both of the two signaling pathways of the Nicotinamide metabolic signaling pathway and the WNT signaling pathway for induction and differentiation.

2. The type of RPE cells derived from pluripotent stem cells according to claim 1, characterized in that, The pluripotent stem cells are ESC, iPSC or universal iPSC HLA-KO obtained by differentiation; The universal iPSC HLA-KO is an iPSC with immune privilege characteristics that has been genetically edited to specifically reduce HLA expression.

3. The type of RPE cells derived from pluripotent stem cells according to claim 2, characterized in that, the ESC is ESC cells passaged to generations 4-7, and the ratio of each inoculation to passage is designed to be 1:(3-12); after the cultured ESC is digested into single cells, it is cultured in iPSC medium for 1 day, and then RPE cells are differentiated from the ESC; The iPSC or the universal iPSC HLA-KO is an iPSC cell passaged to generations 4-7, and the ratio of each inoculation to passage is designed to be 1:(3-12); after the cultured iPSC is digested into single cells, it is cultured with iPSC medium for 1 day, and then the iPSC is differentiated to obtain RPE cells.

4. The type of RPE cells derived from pluripotent stem cells according to claim 1, characterized in that, the iPSC medium is: E8, Stem Flex or mTeSR1 as the basal medium, added with the additive Y27632, and the dosage of Y27632 is 10 μM.

5. The type of RPE cells derived from pluripotent stem cells according to claim 1, characterized in that, the differentiation of iPSC into RPE cells is achieved by adding chemical small molecules as inhibitors or activators in E6 medium, including the following stages: neuroectodermal cell induction stage, RPE progenitor cell induction stage, RPE cell induction stage, and RPE cell maturation stage.

6. The type of RPE cells derived from pluripotent stem cells according to claim 1, characterized in that, Neuroectodermal cell induction stage: The small molecule used to inhibit the TGF-β / Nodal / Activin signaling pathway is SB431542, and the addition amount is 1-50 μM; The small molecule used to inhibit the BMP signaling pathway is LDN193183, and the addition amount is 10-100 nM; The small molecules used to inhibit the WNT signaling pathway are IWR-1 or IWR-2, the addition amount of IWR-1 is 10-100 μM, and the addition amount of IWR-2 is 10-100 μM.

7. The type of RPE cells derived from pluripotent stem cells according to claim 1, characterized in that, In the RPE progenitor cell induction stage: Activating the Nicotinamide metabolic signaling pathway is achieved by adding Nicotinamide; the addition amount is: Nicotinamide 1-50 mM.

8. A type of RPE cells derived from pluripotent stem cells according to claim 1, characterized in that, during the induction period of RPE cells, the small molecule used to activate the TGF-β / Nodal / Activin signaling pathway is Activin A, and the addition amount is 10 - 200 ng / mL; the small molecule used to inhibit the FGF signaling pathway is SU5402, and the addition amount is 1 - 10 μM; the small molecule used to activate the WNT signaling pathway is CHIR99021, and the addition amount is 1 - 10 μM.

9. A type of RPE cells derived from pluripotent stem cells according to claim 1, characterized in that, during the maturation period of RPE cells, the small molecule used to activate the Nicotinamide metabolic signaling pathway is Nicotinamide, and the addition amount is 1 - 50 mM; the small molecule used to activate the WNT signaling pathway is CHIR99021, and the addition amount is 1 - 10 μM.

10. A type of RPE cells derived from pluripotent stem cells according to claim 1, characterized in that, the subculture ratio during the induction period of RPE cells and the maturation period of RPE cells is designed to be 1:(3 - 20).

11. An RPE cell preparation, characterized in that, it includes a type of RPE cells derived from pluripotent stem cells according to any one of claims 1 - 10.

12. A pharmaceutical composition suitable for ophthalmology, characterized in that, it includes a type of RPE cells derived from pluripotent stem cells according to any one of claims 1 - 10 as an active ingredient.

13. A reagent for evaluating the toxicity or efficacy of a test substance, characterized in that, it contains a type of RPE cells derived from pluripotent stem cells according to any one of claims 1 - 10.

14. A method for evaluating the toxicity or efficacy of a test substance, characterized in that, it includes using a type of RPE cells derived from pluripotent stem cells according to any one of claims 1 - 10 to contact with the substance, and measuring the effect of the substance on the cells.

15. A kit, characterized in that, it contains a culture medium combination; the culture medium combination includes: a first culture medium, a second culture medium, a third culture medium, and a fourth culture medium; the first culture medium includes a basal medium and additive A; additive A is one or a variety of any molar ratio among SB431542, LDN193183, IWR-1, or IWR-2; among them, the addition amount of SB431542 is 1 - 50 μM, the addition amount of LDN193183 is 10 - 100 nM, the addition amount of IWR-1 is 10 - 100 μM, and the addition amount of IWR-2 is 10 - 100 μM; the second culture medium includes a basal medium and additive B, and additive B is Nicotinamide, and the addition amount of Nicotinamide is 1 - 50 mM; The third culture medium comprises a basal medium and additive C, and the additive C is one of Activin A, SU5402 or CHIR99021, or a plurality of them in any molar ratio; wherein, the addition amount of Activin A is 10 - 200 ng / mL, the addition amount of SU5402 is 1 - 10 μM, and the addition amount of CHIR99021 is 1 - 10 μM; The fourth culture medium comprises a basal medium and additive D, and the additive D is one of Nicotinamide or CHIR99021, or two of them in any molar ratio; wherein, the addition amount of Nicotinamide is 1 - 50 mM, and the addition amount of CHIR99021 is 1 - 10 μM.

16. A kit according to claim 15, characterized in that, the basal medium is E6.

17. A method for obtaining RPE cells based on the kit according to any one of claims 15 - 16, characterized in that, it comprises the following steps: Step 1, culturing pluripotent stem cells in the first culture medium for 2 days to obtain neuroectodermal cells; Step 2, culturing the neuroectodermal cells in the second culture medium for 4 days to obtain RPE progenitor cells; Step 3, culturing the RPE progenitor cells in the third culture medium for 4 days to obtain RPE cells; Step 4, culturing the RPE cells in the fourth culture medium for 20 days to obtain mature RPE cells.

Images