VIPR1l protein, and the use thereof in biopesticides and biological breeding

By expressing VIPR1L protein and forming a protein complex with VDAL and RKL1, the problem of insufficient growth and stress resistance in the face of diseases and abiotic stress is solved, and the effect of improving plant disease resistance, drought resistance and salt resistance is achieved, and crop yield and fruit and vegetables are promoted.

WO2025119289A1PCT designated stage expired Publication Date: 2025-06-12BEIJING AGROALADDIN BIOTECHNOLOGY CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/137189
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-07
Filing Date
2024-12-05
Publication Date
2025-06-12

AI Technical Summary

Technical Problem

The prior art is difficult to effectively promote plant growth, improve plant disease resistance and adverse conditions, especially in the face of diseases and abiotic stresses.

Method used

By expressing and applying the VIPR1L protein, it combines the VDAL protein and the receptor RKL1 to form a protein complex, mediating the signal transduction of disease/adversity signals, thereby regulating plant growth, development, immunity and antiretrograde responses.

Benefits of technology

VIPR1L protein significantly improves the disease resistance, drought resistance and salt resistance of plants, promotes plant growth, increases crop yield and quality, and has significant fruit and vegetable preservation effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024137189_12062025_PF_FP_ABST
    Figure CN2024137189_12062025_PF_FP_ABST
Patent Text Reader

Abstract

A VIPR1L protein and the use thereof in biopesticides and biological breeding. The protein is localized on a cell membrane and participates in the resistance effect of plants on verticillium wilt; has the effects of improving germination of wheat and corn and promoting plant growth; can induce the drought tolerance, salt tolerance and disease resistance of plants; can increase the content of chlorophyll and improve the yield of all crops comprising cereal crops (such as corn), vegetables, fruits and tea leaves; improves the content of tea polyphenols; enhances the flavor of tomatoes and the like; and improves the quality of melons, fruits, tea leaves and the like. A biological formulation prepared on the basis of the protein and a coding DNA thereof has good application prospects in regulating and controlling growth and development or immunity or stress resistance responses of plants, improving the yield, and producing green-flavored fruits and vegetables.
Need to check novelty before this filing date? Find Prior Art

Description

A VIPR1L protein and its application in biopesticides and biobreeding Technical Field

[0001] The present invention relates to the field of biotechnology, and more specifically to a VIPR1L protein and its application in biopesticides and biobreeding. In particular, the present invention relates to a VIPR1L protein and its application in promoting plant growth, enhancing plant disease resistance, improving plant resistance to abiotic stress, increasing crop yield and quality, and preserving fruits and vegetables. Background Art

[0002] Plants induce their own immune responses by sensing foreign pathogenic pattern molecules. However, plants are not limited to recognizing pathogenic factors (Effectors) of pathogens; they can also recognize their own endogenous elicitors (Elicitors), such as plant cell wall fragments and endogenous small peptide molecules. Therefore, plants rely on the recognition of both internal and external pattern molecules to establish their innate immune response mechanism.

[0003] Small peptides generally refer to peptide segments of 150 amino acids in length. Plants contain some endogenous small peptide precursors that can be modified and transformed into functional small peptides to regulate plant immunity.

[0004] In 1991, the plant peptide systemin was first reported in tomatoes. It can enhance the tomato's defense function by regulating the accumulation of protease inhibitors of anti-herbivore defense proteins. Furthermore, a 23-amino acid small peptide, Pep1, has been reported to enhance resistance to Pseudomonas syringae (tomato DC3000) in Arabidopsis and to leaf blight fungi in maize. Numerous endogenous plant peptides have been discovered and demonstrated to be involved in regulating plant growth and development, plant-microbe interactions, and responses to adverse environmental conditions such as biotic and abiotic stresses.

[0005] Summary of the Invention

[0006] In response to the deficiencies in the prior art, the present invention aims to provide a VIPR1L protein and its application in biopesticides and biobreeding. The VIPR1L protein is involved in plant disease resistance, promoting seed germination and plant growth, and has the effects of inducing drought resistance, salt resistance, and disease resistance in plants, while increasing chlorophyll content. Furthermore, the VIPR1L protein interacts with VDAL and forms a protein complex with the similar receptor kinase RKL1, which can jointly mediate signal transduction of disease / adversity signals, thereby regulating plant growth and development, or immune or stress resistance responses.

[0007] In order to achieve the above purpose, the technical solution adopted by the present invention is:

[0008] 1. A VIPR1L protein, comprising:

[0009] (1) The amino acid sequence of the VIPR1L protein is shown in SEQ ID No. 1;

[0010] (2) An amino acid sequence described in item (1) in which any substitution is made except for amino acids 50 to 114, and which has 75% or more identity with the amino acid sequence described in item (1);

[0011] SEQ ID No. 6-10 are merely examples of the amino acid sequence described in item (2) above and do not limit the amino acid sequence described in item (2). Their identities with the amino acid sequence described in item (1) are 75.38%, 81.54%, 88.46%, 91.5% and 97.69% respectively;

[0012] (3) An amino acid sequence described in item (1) in which any substitution is made except for amino acids 102 to 114, and which has 75% or more identity with the amino acid sequence described in item (1);

[0013] SEQ ID No. 11-15 are merely examples of the amino acid sequence described in item (3) above and do not limit the amino acid sequence described in item (3). Their identities with the amino acid sequence described in item (1) are 75.38%, 80.76%, 86.15%, 91.5% and 96.15% respectively;

[0014] (4) A polypeptide tag is connected to the N-terminus or C-terminus of the amino acid sequence of the VIPR1L protein described in any one of (1) to (3) above;

[0015] The polypeptide tag comprises:

[0016] Poly-Arg, an oligomer of Arg, the number of Arg residues in the oligomer is 5-6;

[0017] Poly-His is a His oligomer with 2-10 His residues in the oligomer;

[0018] FLAG, sequence: DYKDDDDK;

[0019] Strep-tag II, sequence: WSHPQFEK;

[0020] c-myc, sequence EQKLISEEDL;

[0021] SEQ ID No. 16-31 is merely an example of an amino acid sequence based on the amino acid sequence described in item (1) above coupled with the polypeptide tag described in item (4), and does not limit the amino acid sequence based on the amino acid sequence described in item (1) coupled with the polypeptide tag described in item (4);

[0022] SEQ ID No.32-47 are merely examples of amino acid sequences based on the amino acid sequence described in item (2) above and the polypeptide tag described in item (4), and do not limit the amino acid sequence based on the amino acid sequence described in item (2) and the polypeptide tag described in item (4); the amino acid sequence based on item (2) takes SEQ ID No.6 as an example;

[0023] SEQ ID No. 48-63 are merely examples of amino acid sequences based on the amino acid sequence described in item (2) above and the polypeptide tag described in item (4), and do not limit the amino acid sequence based on the amino acid sequence described in item (2) and the polypeptide tag described in item (4); the amino acid sequence based on item (2) takes SEQ ID No. 7 as an example;

[0024] SEQ ID No. 64-79 are merely examples of amino acid sequences based on the amino acid sequence described in item (2) above and the polypeptide tag described in item (4), and do not limit the amino acid sequence based on the amino acid sequence described in item (2) and the polypeptide tag described in item (4); the amino acid sequence based on item (2) takes SEQ ID No. 8 as an example;

[0025] SEQ ID No.80-95 are merely examples of amino acid sequences based on the amino acid sequence described in item (2) above and the polypeptide tag described in item (4), and do not limit the amino acid sequence based on the amino acid sequence described in item (2) and the polypeptide tag described in item (4); the amino acid sequence based on item (2) takes SEQ ID No.9 as an example;

[0026] SEQ ID No.96-111 are merely examples of amino acid sequences based on the amino acid sequence described in item (2) above and the polypeptide tag described in item (4), and do not limit the amino acid sequence based on the amino acid sequence described in item (2) and the polypeptide tag described in item (4); the amino acid sequence based on item (2) takes SEQ ID No.10 as an example;

[0027] SEQ ID No. 112-127 are merely examples of amino acid sequences based on the amino acid sequence described in item (3) above and the polypeptide tag described in item (4), and do not limit the amino acid sequence based on the amino acid sequence described in item (3) and the polypeptide tag described in item (4); the amino acid sequence based on item (3) takes SEQ ID No. 11 as an example;

[0028] SEQ ID No. 128-143 are merely examples of amino acid sequences based on the amino acid sequence described in item (3) above and the polypeptide tag described in item (4), and do not limit the amino acid sequence based on the amino acid sequence described in item (3) and the polypeptide tag described in item (4); the amino acid sequence based on item (3) takes SEQ ID No. 12 as an example;

[0029] SEQ ID No. 144-159 are merely examples of amino acid sequences based on the amino acid sequence described in item (3) above and the polypeptide tag described in item (4), and do not limit the amino acid sequence based on the amino acid sequence described in item (3) and the polypeptide tag described in item (4); the amino acid sequence based on item (3) takes SEQ ID No. 13 as an example;

[0030] SEQ ID No. 160-175 are merely examples of amino acid sequences based on the amino acid sequence described in item (3) above and the polypeptide tag described in item (4), and do not limit the amino acid sequence based on the amino acid sequence described in item (3) and the polypeptide tag described in item (4); the amino acid sequence based on item (3) takes SEQ ID No. 14 as an example;

[0031] SEQ ID No. 176-191 is merely an example of an amino acid sequence based on the amino acid sequence described in item (3) above and linked to the polypeptide tag described in item (4), and does not limit the amino acid sequence based on the amino acid sequence described in item (3) and linked to the polypeptide tag described in item (4); the amino acid sequence based on item (3) takes SEQ ID No. 15 as an example;

[0032] 2. A DNA, characterized in that the sequence of the DNA comprises:

[0033] (1) A nucleotide sequence as shown in SEQ ID No. 2, encoding the VIPR1L protein described in item (1) of claim 1;

[0034] (2) a nucleotide sequence encoding the VIPR1L protein described in item (2) of item 1 above;

[0035] SEQ ID No. 192-196 are merely examples of the nucleotide sequence described in item (2) of item 2 above, and do not limit the nucleotide sequence described in item (2) of item 2 above; SEQ ID No. 192-196 are used to encode the amino acid sequences shown in SEQ ID No. 6-10 above, respectively;

[0036] (3) a nucleotide sequence encoding the VIPR1L protein described in item (3) of item 1 above;

[0037] SEQ ID No. 197-201 are merely examples of the nucleotide sequences described in item (3) of item 2 above, and do not limit the nucleotide sequences described in item (3) of item 2 above; SEQ ID No. 197-201 are used to encode the amino acid sequences shown in SEQ ID No. 11-15 above, respectively;

[0038] (4) a nucleotide sequence encoding the VIPR1L protein described in item (4) of item 1;

[0039] SEQ ID No. 202-217 are merely examples of the nucleotide sequences according to item (4) of item 2 above, and do not limit the nucleotide sequences according to item (4) of item 2 above; SEQ ID No. 202-217 are used to encode the amino acid sequences shown in SEQ ID No. 16-31 above, respectively;

[0040] In addition, based on the amino acid sequence shown in SEQ ID No. 32-191 that has been listed, although the corresponding nucleotide sequences are not listed one by one, they certainly fall within the scope of the nucleotide sequence described in item (4) of the above-mentioned item 2; based on the same reason, these unlisted nucleotide sequences are also not considered as a limitation of the amino acid sequence described in item (4) of the above-mentioned item 2.

[0041] 3. An expression cassette, recombinant vector, VIPR1L gene-transgenic cell line, VIPR1L gene-transgenic plant tissue, or VIPR1L gene-transgenic plant organ containing the DNA described in item 2 above;

[0042] The above-mentioned VIPR1L gene-transgenic cell lines include: transgenic microbial cell lines, transgenic animal cell lines or transgenic plant cell lines in which the DNA described in item 2 above is recombined into the genome;

[0043] The above-mentioned VIPR1L gene-transformed plant tissue or VIPR1L gene-transformed plant organ refers to: a transgenic plant tissue or plant organ into which the DNA described in the above-mentioned item 2 is recombined into the genome.

[0044] For example: an expression cassette, recombinant vector, VIPR1L gene transgenic cell line, VIPR1L gene transgenic plant tissue or VIPR1L gene transgenic plant organ containing the nucleotide sequence shown in SEQ ID No. 2 or SEQ ID Nos. 192-217; or an expression cassette, recombinant vector, VIPR1L gene transgenic cell line, VIPR1L gene transgenic plant tissue or VIPR1L gene transgenic plant organ containing the nucleotide sequence encoding the amino acids shown in SEQ ID Nos. 32-191.

[0045] 4. A recombinant vector, cell line, VIPR1L gene-transgenic cell line, VIPR1L gene-transgenic plant tissue, or VIPR1L gene-transgenic plant organ containing the expression cassette described in item 3 above;

[0046] The above-mentioned cell lines include microbial cell lines, animal cell lines or plant cell lines;

[0047] The above-mentioned VIPR1L gene-transgenic cell lines include: transgenic microbial cell lines, transgenic animal cell lines or transgenic plant cell lines in which the DNA described in item 2 above is recombined into the genome;

[0048] The above-mentioned VIPR1L gene-transformed plant tissue or VIPR1L gene-transformed plant organ refers to: a transgenic plant tissue or plant organ into which the DNA described in the above-mentioned item 2 is recombined into the genome.

[0049] For example: a recombinant vector, cell line, VIPR1L gene-transforming cell line, VIPR1L gene-transforming plant tissue or VIPR1L gene-transforming plant organ containing an expression cassette of the nucleotide sequence shown in SEQ ID No. 2 or SEQ ID Nos. 192-217; or a recombinant vector, recombinant microorganism, VIPR1L gene-transforming cell line, VIPR1L gene-transforming plant tissue or VIPR1L gene-transforming plant organ containing an expression cassette of the nucleotide sequence encoding the amino acids shown in SEQ ID Nos. 32-191.

[0050] 5. A cell line, a cell line transgenic for VIPR1L gene, a plant tissue transgenic for VIPR1L gene, or a plant organ transgenic for VIPR1L gene containing the recombinant vector described in item 3 above;

[0051] The above-mentioned cell lines include microbial cell lines, animal cell lines or plant cell lines;

[0052] The above-mentioned VIPR1L gene-transgenic cell lines include: transgenic microbial cell lines, transgenic animal cell lines or transgenic plant cell lines in which the DNA described in item 2 above is recombined into the genome;

[0053] The above-mentioned VIPR1L gene-transformed plant tissue or VIPR1L gene-transformed plant organ refers to: a transgenic plant tissue or plant organ into which the DNA described in the above-mentioned item 2 is recombined into the genome.

[0054] For example: a cell line, a VIPR1L gene-transforming cell line, a VIPR1L gene-transforming plant tissue, or a VIPR1L gene-transforming plant organ containing a recombinant vector containing the nucleotide sequence shown in SEQ ID No. 2 or SEQ ID Nos. 192-217; or a cell line, a VIPR1L gene-transforming cell line, a VIPR1L gene-transforming plant tissue, or a VIPR1L gene-transforming plant organ containing a recombinant vector containing the nucleotide sequence encoding the amino acids shown in SEQ ID Nos. 32-191.

[0055] 6. A recombinant microorganism, a cell line transgenic for VIPR1L gene, a plant tissue transgenic for VIPR1L gene, or a plant organ transgenic for VIPR1L gene containing the recombinant vector described in item 4 above;

[0056] The above-mentioned VIPR1L gene-transfected cell line includes: a transgenic microbial cell line, a transgenic animal cell line or a transgenic plant cell line in which the DNA described in item 2 above is recombined into the genome.

[0057] The above-mentioned VIPR1L gene-transformed plant tissue or VIPR1L gene-transformed plant organ refers to: a transgenic plant tissue or plant organ into which the DNA described in the above-mentioned item 2 is recombined into the genome.

[0058] For example: a recombinant microorganism, a cell line, a plant tissue or a plant organ that is transfected with VIPR1L gene and a recombinant vector containing an expression cassette of the nucleotide sequence shown in SEQ ID No. 2 or SEQ ID Nos. 192-217; or a recombinant microorganism, a cell line, a plant tissue or a plant organ that is transfected with VIPR1L gene and a recombinant vector containing an expression cassette of the nucleotide sequence encoding the amino acids shown in SEQ ID Nos. 32-191.

[0059] Some specific examples of the expression cassettes, recombinant vectors, recombinant microorganisms, cell lines, transgenic cell lines, transgenic plant tissues, and transgenic plant organs described in items 3-6 above are shown below:

[0060] I Expression cassette (number E1-E7)

[0061] E1: pET-28a (bacterial expression cassette), which belongs to the expression cassette described in item 3, and the DNA contained therein is: the DNA shown in SEQ ID No. 2 or any one of SEQ ID Nos. 192-217, or the nucleotide sequence encoding the amino acid shown in any one of SEQ ID Nos. 32-191

[0062] E2: pPICZ-28a (fungal expression cassette, such as yeast), which belongs to the expression cassette described in item 3, and the DNA contained therein is: the DNA shown in SEQ ID No. 2 or any one of SEQ ID Nos. 192-217, or the nucleotide sequence encoding the amino acid shown in any one of SEQ ID Nos. 32-191

[0063] E3: pFastBac™1 (insect expression cassette), which belongs to the expression cassette described in item 3, and the DNA contained therein is: the DNA shown in SEQ ID No. 2 or any one of SEQ ID Nos. 192-217, or the nucleotide sequence encoding the amino acid shown in any one of SEQ ID Nos. 32-191

[0064] E4: pCAMBIA (plant expression cassette), which belongs to the expression cassette described in item 3, wherein the DNA contained therein is: the DNA represented by SEQ ID No. 2 or any one of SEQ ID Nos. 192-217, or the nucleotide sequence encoding the amino acid represented by any one of SEQ ID Nos. 32-191

[0065] E5: pSV (animal expression cassette), which belongs to the expression cassette described in item 3, wherein the DNA contained therein is: the DNA shown in SEQ ID No. 2 or any one of SEQ ID Nos. 192-217, or the nucleotide sequence encoding the amino acid shown in any one of SEQ ID Nos. 32-191

[0066] E6: pcDNA3.1 V5 His (human expression cassette), which belongs to the expression cassette described in item 3, and the DNA contained therein is: the DNA shown in SEQ ID No. 2 or any one of SEQ ID Nos. 192-217, or the nucleotide sequence encoding the amino acid shown in any one of SEQ ID Nos. 32-191

[0067] E7: pCX62 (Plant & Animal Knockout Gene Expression Cassette), which belongs to the expression cassette described in item 3, and contains the DNA shown in SEQ ID No. 2 or any one of SEQ ID Nos. 192-217, or the nucleotide sequence encoding the amino acid shown in any one of SEQ ID Nos. 32-191

[0068] II Recombinant vector (number E8-E10)

[0069] E8: pET-28a recombinant vector, belonging to the recombinant vector described in item 3, wherein the DNA contained therein is: the DNA represented by SEQ ID No. 2 or any one of SEQ ID Nos. 192-217, or the nucleotide sequence encoding the amino acid represented by any one of SEQ ID Nos. 32-191

[0070] E9: pFastBac™1 recombinant vector, belonging to the recombinant vector described in item 3, wherein the DNA contained therein is: the DNA represented by SEQ ID No. 2 or any one of SEQ ID Nos. 192-217, or the nucleotide sequence encoding the amino acid represented by any one of SEQ ID Nos. 32-191

[0071] E10: A recombinant vector containing any one of the expression cassettes E1-E7 above, belonging to the recombinant vector described in item 4

[0072] III VIPR1L gene-transfected cell lines (numbers E11-E17)

[0073] E11: pPICZ VIPR1L gene transgenic cell line, belonging to the VIPR1L gene transgenic cell line described in item 3, wherein the VIPR1L gene transgenic cell line is a yeast cell line, and the DNA contained therein is: the DNA shown in SEQ ID No. 2 or any one of SEQ ID Nos. 192-217, or the nucleotide sequence encoding the amino acid shown in any one of SEQ ID Nos. 32-191

[0074] E12: pCAMBIA VIPR1L gene-transgenic cell line, belonging to the VIPR1L gene-transgenic cell line described in Item 3, wherein the VIPR1L gene-transgenic cell line is a wheat or cotton cell line; the DNA contained therein is: the DNA represented by SEQ ID No. 2 or any one of SEQ ID Nos. 192-217, or the nucleotide sequence encoding the amino acid represented by any one of SEQ ID Nos. 32-191

[0075] E13: pcDNA3.1 V5 His VIPR1L gene-transgenic cell line, belonging to the VIPR1L gene-transgenic cell line described in Item 3, wherein the VIPR1L gene-transgenic cell line is a rabbit cell line, and the DNA contained therein is: the DNA represented by SEQ ID No. 2 or any one of SEQ ID Nos. 192-217, or the nucleotide sequence encoding the amino acid represented by any one of SEQ ID Nos. 32-191

[0076] E14: A VIPR1L gene-transforming cell line containing the expression cassette described in any one of E1-E7 above, belonging to the VIPR1L gene-transforming cell line described in Item 4, wherein the VIPR1L gene-transforming cell line is a HeLa cell line

[0077] E15: A VIPR1L gene-transforming cell line containing the expression cassette described in any one of E1-E7 above, belonging to the VIPR1L gene-transforming cell line described in Item 4, wherein the VIPR1L gene-transforming cell line is a horse cell line

[0078] E16: A VIPR1L gene-transforming cell line containing the recombinant vector described in any one of E8-E9 above, which belongs to the VIPR1L gene-transforming cell line described in Item 5, wherein the VIPR1L gene-transforming cell line is a cotton cell line

[0079] E17: A VIPR1L gene-transforming cell line containing the recombinant vector described in E10, which belongs to the VIPR1L gene-transforming cell line described in item 6, and the VIPR1L gene-transforming cell line is a yeast cell line

[0080] IV. Transgenic VIPR1L plant tissues (No. E18-E21)

[0081] E18: VIPR1L transgenic plant tissue containing a pCAMBIA series vector, which belongs to the VIPR1L transgenic plant tissue described in Item 3, wherein the VIPR1L transgenic plant tissue is cotton tissue, and the DNA contained therein is: the DNA represented by SEQ ID No. 2 or any one of SEQ ID Nos. 192-217, or the nucleotide sequence encoding the amino acid represented by any one of SEQ ID Nos. 32-191

[0082] E19: A VIPR1L transgenic plant tissue containing the expression cassette described in any one of E1 to E7 above, which belongs to the VIPR1L transgenic plant tissue described in Item 4, wherein the VIPR1L transgenic plant tissue is cotton tissue.

[0083] E20: A VIPR1L gene-transforming plant tissue containing the expression vector described in any one of E8-E9 above, which belongs to the VIPR1L gene-transforming plant tissue described in Item 5, wherein the VIPR1L gene-transforming plant tissue is cotton tissue.

[0084] E21: A VIPR1L gene-transforming plant tissue containing the expression vector described in E10, which belongs to the VIPR1L gene-transforming plant tissue described in item 6, wherein the VIPR1L gene-transforming plant tissue is cotton tissue.

[0085] V Transgenic VIPR1L plant organs (numbers E22-E25)

[0086] E22: pCAMBIA VIPR1L transgenic plant organ, belonging to the VIPR1L transgenic plant organ described in Item 3, wherein the VIPR1L transgenic plant organ is a cotton organ, and the DNA contained therein is: the DNA represented by SEQ ID No. 2 or any one of SEQ ID Nos. 192-217, or the nucleotide sequence encoding the amino acid represented by any one of SEQ ID Nos. 32-191

[0087] E23: A VIPR1L transgenic plant organ containing the expression cassette of any one of E1-E7 above, which belongs to the VIPR1L transgenic plant organ described in Item 4, wherein the VIPR1L transgenic plant organ is a cotton organ.

[0088] E24: A VIPR1L gene-transforming plant organ containing the expression vector described in any one of E8-E9 above, which belongs to the VIPR1L gene-transforming plant organ described in Item 5, wherein the VIPR1L gene-transforming plant organ is a cotton organ.

[0089] E25: A VIPR1L gene-transforming plant organ containing the expression vector described in E10, which belongs to the VIPR1L gene-transforming plant organ described in item 6, wherein the VIPR1L gene-transforming plant organ is a cotton organ.

[0090] VI cell lines (no. E26-E30)

[0091] E26: A cell line containing the expression cassette of any one of E1-E7 above, belonging to the cell line described in item 4, wherein the cell line is a yeast cell line

[0092] E27: A cell line containing the expression cassette of any one of E1-E7 above, belonging to the cell line described in item 4, which is a maize cell line

[0093] E28: A cell line containing the expression cassette of any one of E1-E7 above, belonging to the cell line described in item 4, wherein the cell line is a rabbit cell line

[0094] E29: A cell line containing the expression cassette of any one of E1-E7 above, belonging to the cell line described in item 4, wherein the cell line is a HeLa cell line

[0095] E30: A cell line containing the recombinant vector described in any one of E8-E9 above, belonging to the cell line described in item 5, wherein the transgenic cell line is a horse cell line

[0096] E30: A cell line containing the recombinant vector described in any one of E8-E9 above, belonging to the cell line described in item 5, wherein the transgenic cell line is a HeLa cell line

[0097] VII Recombinant Microorganism (No. E31)

[0098] E31: A recombinant microorganism containing the expression vector described in E10 above, which belongs to the recombinant microorganism described in item 6, wherein the recombinant microorganism is Escherichia coli

[0099] The above examples (E1-E31) are merely illustrative of the expression cassettes, recombinant vectors, recombinant microorganisms, cell lines, transgenic cell lines, transgenic plant tissues, and transgenic plant organs described in Items 3-6 above, and do not constitute limitations on the expression cassettes, recombinant vectors, transgenic cell lines, transgenic plant tissues, and transgenic plant organs described in Items 3-6 above.

[0100] 7. A biological agent, characterized in that:

[0101] (1) comprising the VIPR1L protein described in item 1 above;

[0102] For example, a biological agent comprising the amino acid sequence shown in SEQ ID No. 1 or SEQ ID No. 6-191 (VIPR1L protein).

[0103] (2) or contains the DNA described in item 2 above;

[0104] For example, a biological agent comprising the nucleotide sequence (DNA) shown in SEQ ID No. 2 or SEQ ID Nos. 192-217.

[0105] (3) or comprising the expression cassette, recombinant vector, VIPR1L gene-transgenic cell line, VIPR1L gene-transgenic plant tissue or VIPR1L gene-transgenic plant organ according to claim 3;

[0106] (4) or comprising the recombinant vector, recombinant microorganism, VIPR1L gene-transgenic cell line, VIPR1L gene-transgenic plant tissue or VIPR1L gene-transgenic plant organ according to claim 4;

[0107] (5) or comprising the recombinant microorganism, VIPR1L gene-transgenic cell line, VIPR1L gene-transgenic plant tissue or VIPR1L gene-transgenic plant organ according to claim 5;

[0108] (6) Or comprising the recombinant microorganism, VIPR1L gene-transgenic cell line, VIPR1L gene-transgenic plant tissue or VIPR1L gene-transgenic plant organ according to claim 6.

[0109] For example, a biological preparation comprising any one of the expression cassettes, recombinant vectors, recombinant microorganisms, cell lines, transgenic cell lines, transgenic plant tissues or transgenic plant organs described in items 3 to 6 above.

[0110] 8. A biological preparation, characterized in that: the biological preparation is prepared by mixing the VIPR1L protein and the VDAL protein according to claim 1, wherein the mass ratio of the VIPR1L protein to the VDAL protein is 5-10:8.

[0111] 9. The use of the biological agent as described in item 7 or 8 above is characterized in that the biological agent can be used to promote plant growth, improve plant disease resistance, improve plant salt resistance, improve biological drought resistance, increase crop yield, improve crop quality, and preserve fruits and vegetables.

[0112] The VIPR1L protein and its application in biopesticides and biobreeding described in the present invention have the following beneficial effects:

[0113] The VIPR1L protein, a 130-amino acid protein with unknown function in plants, is involved in plant disease resistance; it improves germination and growth in wheat and corn; it can induce drought, salt, and disease resistance in plants; it increases chlorophyll content, boosting the yield of crops like corn and wheat, as well as vegetables, fruits, and tea; it also increases tea polyphenols, enhancing the flavor of tomatoes and improving the quality of fruits and tea, and it has a significant effect on preserving fruits and vegetables.

[0114] In addition, VIPR1L protein, VDAL and receptor RKL1 constitute a protein complex that jointly mediates signal transduction of disease / adversity signals, thereby regulating plant growth and development or immunity or stress resistance.

[0115] Overexpression of the VIPR1L gene in plants can improve plant resistance to Verticillium wilt. The development of VIPR1L protein into a dry powder product can be used to develop biochemical pesticides, which has good application prospects in improving crop disease resistance, stress resistance, increasing yield and producing green and flavorful fruits and vegetables.

[0116] BRIEF DESCRIPTION OF THE DRAWINGS

[0117] The present invention has the following accompanying drawings:

[0118] Figure 1 shows the GbVIPR1L protein coding and its conserved domains.

[0119] FIG2 shows the statistical expression levels of the GbVIPR1L gene before and after the root dipping treatment with Verticillium dahliae in Example 1.

[0120] FIG3 shows the experimental results of the stem injection method for inoculating the Vd991 strain in Example 1.

[0121] FIG4 shows the experimental results of the VIPR1L mechanism of action study in Example 2.

[0122] FIG5 shows the experimental results of the VIPR1L mechanism of action study in Example 2.

[0123] FIG6 shows the crude protein of VIPR1L prepared in Example 3 and the Western-blot detection results.

[0124] Figure 7 shows the experimental results of dehydration treatment and rehydration treatment after dehydration of wheat seeds treated with VIPR1L protein in Example 3: (a) plant height statistics on the first day of sowing; (b) plant height statistics one week after sowing; (c) photos of some treatment groups one week after sowing; (d) results of the dehydration and rehydration experiment.

[0125] FIG8 shows the results of improving the germination rate of corn seeds by VIPR1L protein treatment in Example 3.

[0126] FIG9 shows the results of promoting corn growth by VIPR1L protein treatment in Example 3.

[0127] FIG10 shows the promoting effect of VIPR1L protein treatment on maize plant height, leaf width and chlorophyll in Example 3.

[0128] FIG11 shows the effects of exogenous VIPR1L protein treatment on water loss and rehydration of corn in Example 3.

[0129] FIG12 shows the effect of exogenous VIPR1L protein treatment on improving salt resistance of maize in Example 3.

[0130] FIG. 13 shows the effects of exogenous spraying of VIPR1L protein on growth promotion, disease resistance and yield increase of maize in the field experiment of Example 3.

[0131] FIG14 shows the effect of exogenous treatment with VIPR1L protein in Example 3 on increasing tomato yield and preventing premature aging.

[0132] FIG15 shows the effect of VIPR1L protein treatment on the yield of Yinghong No. 9 tea plants in Example 3: (a) fresh leaf yield of tea plants 15 days after treatment; (b) fresh leaf yield of tea plants 25 days after treatment.

[0133] FIG16 shows the effect of VIPR1L protein treatment on the bud density and 100-bud weight of Yinghong No. 9 tea plants in Example 3: (a) bud density; (b) 100-bud weight.

[0134] FIG. 17 shows the effect of VIPR1L protein treatment in Example 3 on total polyphenols in fresh leaves of Yinghong No. 9 tea plant.

[0135] FIG18 shows the effect of VIPR1L protein treatment in Example 3 on the total amount of free amino acids in fresh leaves of Yinghong No. 9 tea plant.

[0136] Figure 19 shows the effect of VIPR1L protein treatment in Example 3 on the contents of catechins and alkaloids: GA: gallic acid; GC: gallocatechin; EGC: epigallocatechin; C: catechin; CAF: caffeine; EC: epicatechin; EGCG: epigallocatechin gallate; ECG: epicatechin gallate; CG: catechin gallate (all data were repeated three times, and different letters indicate significance).

[0137] Figure 20 shows the effect of VIPR1L protein treatment on blueberry preservation in Example 3. Compared to the control, VIPR1L3 showed the best preservation effect on blueberries. Its decay index on day 11 was 33.3% lower than the CK control and 23.3% lower than the preservative. On day 31, its decay index was 4.2% lower than both the CK control and the preservative. VDP33 was second, with its decay index on day 31 being 2.5% lower than both the CK control and the preservative. Figure caption: The figure above shows the blueberry preservation results at day 11 and day 31. (All data were replicated three times.)

[0138] DETAILED DESCRIPTION

[0139] The present invention will be described in further detail below with reference to the accompanying drawings. The examples provided are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. The examples provided below are intended to serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0140] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0141] The nucleotide sequence of the GbVIPR1L gene is shown in SEQ ID No. 2, and it is derived from chromosome 4 of Gossypium barbadense Linn. The amino acid sequence of the VIPR1L protein encoded by this GbVIPR1L gene is shown in SEQ ID No. 1, and its cDNA sequence is shown in SEQ ID No. 2. The GbVIPR1L gene responds to VDAL and Verticillium dahliae induction in cotton.

[0142] The VIPR1L protein code and its conserved domain are shown in Figure 1 , where Figure 1 A shows the VIPR1L protein code and Figure 1 B shows the conserved domain of the VIPR1L protein.

[0143] Example 1 Study on the function of the GbVIPR1L gene (resistance to Verticillium wilt)

[0144] 1. Preparation of TRV::VIPR1L and TRV::GFP Plants

[0145] (1) The GbVIPRIL gene (sequence shown in SEQ ID No. 2) was constructed into a TRV vector and transformed into Agrobacterium. The successfully transformed strain was named TRV::GbVIPRIL. The plasmids pTRV-GFP, pTRV-GhCLA1, and pTRV-RNA1 were transformed into Agrobacterium, and the successfully transformed strains were named TRV::GFP, TRV::CLA1, and TRV::RNA1, respectively.

[0146] (2) Activate TRV::GbVIPRIL / GFP / CLA1 / RNA1 on R+K resistant solid culture medium and culture inverted at 28°C for 1-2 days.

[0147] (3) Small-scale shaking culture: Pick the activated monoclonal cells mentioned above and culture them in 2-3 ml of YEP liquid culture medium containing R+K resistance at 28°C and 220 rpm in a shaking incubator overnight. Wrap the test tube with a plastic bag to prevent contamination.

[0148] (4) Inoculation of large quantities of bacteria: 100 μl of kanamycin stock solution, 100 μl of rifampicin stock solution, 10 μl of 200 mM As, 1 ml of 0.5 mM MES, and 1 ml of a small amount of shaking bacterial solution were gradually added to 100 ml of YEP culture medium in the above order. The culture was shaken at 220 rpm and 28 °C for 12 h. The mouth of the conical flask needed to be wrapped with newspaper to prevent contamination.

[0149] (5) Collect bacteria: Divide 100 ml of the bacterial solution obtained in step (4) into two 50 ml centrifuge tubes. Use a room temperature high-speed centrifuge to centrifuge at 6000 rpm for 8 min to collect the bacteria. Add a small amount of resuspension solution and mix it by pipetting. Then add about 40 ml of resuspension solution. Measure the concentration of the bacterial solution and continue to dilute until the OD value of the bacterial solution reaches about 1.5.

[0150] (6) The TRV::RNA1 obtained in step (5) was mixed with the other bacterial solutions (TRV::GbVIPRIL / GFP / CLA1) obtained in step (5) at a volume ratio of 1:1, and the mixture was inverted back and forth until uniform. The mixture was wrapped in a black plastic bag and placed in the dark at room temperature for 3 h to obtain a mixed bacterial solution of GbVIPRIL, GFP, and CLA1.

[0151] (7) Seeds of upland cotton Xinluzao 48 were pulled out about one week after sowing, leaving three plants in each pot. After about two weeks of growth, when the cotyledons unfolded but true leaves had not yet grown, a wound was made on the back of the leaf with a needle and injected until both cotyledons were soaked with the mixed bacterial solution of GbVIPRIL, GFP, or CLA1. The seedlings were bagged and protected from light for 24 hours before being removed from the bag. After inoculation, the seedlings were placed in a greenhouse at 25°C with 16 hours of light and 8 hours of darkness for incubation. Two trays of cotton seedlings were injected per treatment, with three replicates.

[0152] (8) Approximately 10-14 days later, the true leaves of the cotton seedlings that had been injected with CLA1 showed an albino phenotype, confirming the successful VIGS silencing of the cotton seedlings. The plants that had been successfully silenced by the GbVIPRIL mixture were named TRV::GbVIPR1L, the plants that had been successfully silenced by the GFP mixture were named TRV::GFP, and the plants that had been successfully silenced by the CLA1 mixture were named TRV::CLA1.

[0153] The expression levels of silenced plants were detected and the silencing efficiency was calculated.

[0154] The preparation method of the reagents used above is as follows:

[0155] 200 mM As: Weigh 0.7848 g of solid As, dissolve it in 20 ml of DMSO, filter sterilize, and aliquot into sterilized 1.5 ml centrifuge tubes for later use.

[0156] 0.5M MES: Weigh 10.66 g of solid MES and dissolve it in 100 ml of ddH2O. Adjust the pH to 5.6 with KOH. Filter-sterilize and aliquot into sterilized 5 ml centrifuge tubes for later use.

[0157] 2M MgCl2: Weigh 20.33 g of solid MgCl2, dissolve it in 50 ml of ddH2O, and sterilize it by autoclaving at 121°C for 15 min.

[0158] YEP medium (1 L): 10 g yeast powder, 10 g peptone, 5 g NaCl, dilute to 1 L with distilled water. For solid culture medium, add 12 g agar powder and sterilize at 121°C for 15 min.

[0159] Solid culture medium for R+K resistance: Add 100 μL of kanamycin stock solution and rifampicin stock solution to every 100 ml of the above YEP solid culture medium, mix well, and pour into plates.

[0160] Kanamycin sulfate stock solution (50 mg / ml): Dissolve 2.5 g of kanamycin sulfate (Kan) powder in 50 ml of ultrapure water. After filtration and sterilization, dispense into sterile centrifuge tubes at 1 ml / tube for later use.

[0161] Rifampicin antibiotic stock solution (25 mg / ml): Dissolve 2.5 g of rifampicin (Rif) in 100 ml of methanol, filter sterilize, and dispense into sterile centrifuge tubes at 1 ml / tube for later use.

[0162] The formula of the resuspension solution is shown in Table 1.

[0163] Table 1 Resuspension formula

[0164] Reagent volume: 2M MgCl2 1ml 0.5M MES: 4ml 200mM As: 200μl ddH2O: dilute to 200ml

[0165] 2. Inoculate Verticillium dahliae

[0166] (1) After the above-mentioned cotton plants showed a silencing phenotype (CLA1 showed an albino phenotype), samples were taken to extract total RNA from the TRV::GFP / GbVIPR1L cotton plants, and the silencing level of GbVIPR1L was detected by quantitative PCR.

[0167] The primers used were GhVIPR1L-RT-F: AGCCAAGGTTTCTAGCTTGGAG; GhVIPR1L-RT-R: GAAGGCTATCCGGCTTGTCATT.

[0168] (2) Activate the Vd991 strain on PDA medium.

[0169] (3) After 10 days, observe the growth of the Vd991 strain. If there are patches of white hyphae, it indicates that the strain is growing well. First, add a small amount of ddH2O to the plate, pick up the hyphae with a pipette, filter them through gauze into a conical flask, and then add about 100ml of ddH2O to dilute it. Then dilute it to 10x or 100x spore solution. Count the spores with a hemocytometer until the concentration is 2 × 106 to 3 × 106 cfu / ml. Prepare and use immediately.

[0170] (4) Use a 1 ml syringe to absorb the above-mentioned Verticillium dahliae spore solution and inject it into the cotton plant through the cotton stem after the silent phenotype appears.

[0171] (5) About 3 weeks later, the cotton plants showed the phenotype of Verticillium wilt (yellow leaf edges, wilting, and drooping). The disease situation of the cotton was observed, and the incidence and disease index of TRV::GFP and TRV::GbVIPR1L were calculated according to Table 2, and photos were taken and recorded.

[0172] Table 2 Cotton disease classification standards

[0173] Disease level No leaf disease 00-1 / 4 diseased 11 / 4-2 / 4 diseased 22 / 4-3 / 4 diseased 3>3 / 4 diseased 4

[0174] Disease index = [∑ (number of diseased plants at each level × disease level) / (total number of plants surveyed × 4)] × 100

[0175] Root dipping method:

[0176] (1) When inoculating, use the TRV::GbVIPR1L plant material treated with VIGS as described above, and inoculate when the two true leaves are flattened.

[0177] (2) Use the root cutting and fungus dipping method to treat Verticillium wilt: dilute to 2 × 10 6 ~ 3 × 10 6 Pour the spore solution of Verticillium dahliae at a concentration of cfu / ml into a 50ml centrifuge tube, then pull the cotton out of the bottom plastic pot with its roots, rinse it with distilled water, put it into the centrifuge tube, and culture it in a greenhouse at 25℃ for 16 hours under light and 8 hours in the dark.

[0178] (3) Samples were collected before root dipping with Verticillium dahliae and 1 day, 2 days, 3 days, 4 days, and 5 days after root dipping with Verticillium dahliae. RNA was extracted and reverse transcribed into cDNA, and then quantitative PCR was used to detect the expression level of GbVIPR1L.

[0179] The primers used were GhVIPR1L-RT-F: AGCCAAGGTTTCTAGCTTGGAG and GhVIPR1L-RT-R: GAAGGCTATCCGGCTTGTCATT.

[0180] The results are shown in Figure 2, where CK is the GbVIPR1L expression level of cotton plants before root dipping with Verticillium dahliae, and Vd991-1D, Vd991-2D, Vd991-3D, Vd991-4D, and Vd991-5D are the GbVIPR1L expression levels of cotton plants 1 day, 2 days, 3 days, 4 days, and 5 days after root dipping with Verticillium dahliae, respectively. This shows that when cotton roots are soaked with Verticillium dahliae, the expression level of the GbVIPR1L gene is significantly increased within one day and then gradually decreases after two days.

[0181] The experimental results of the stem injection method of inoculation with the Vd991 strain are shown in Figure 3. The upper left picture in Figure 3A shows the disease status of TRV::GFP cotton plants after inoculation, and the upper right picture shows the disease status of TRV::GbVIPR1L cotton plants after inoculation; the lower picture in Figure 3A shows the phenotypic differences in leaves. Compared with the plants and leaves of TRV::GFP plants (TRV::00), the plants of TRV::GbVIPR1L plants (TRV::GbVIPR1L) were more seriously ill, and the leaves turned yellow and withered.

[0182] Figure 3 B shows the relative expression level of the GbVIPR1L gene silenced by VIGS technology. Compared with the TRV::GFP plant (TRV::00), the relative expression level of the GbVIPR1L gene in the TRV::GbVIPR1L plant (TRV:: GbVIPR1L) was reduced.

[0183] Figure 3C shows the disease index of VIPR1L-VIGS plants and the control GFP-VIGS. The disease index of TRV::GbVIPR1L plants (TRV::GbVIPR1L) was higher than that of TRV::GFP plants (TRV::00). VIGS silencing of the GbVIPR1L gene in upland cotton variety Xinluzao 48 showed that TRV::GbVIPR1L plants developed early and severe disease under Verticillium wilt inoculation conditions, with most leaves turning yellow, wilting, and falling off. In contrast, the control TRV::GFP plants showed only partial yellowing of leaves, with less severe disease, and almost no wilting or falling off. Therefore, cotton plants expressing RNA interference (RNAi) for the GbVIPR1L gene were more susceptible to Verticillium wilt than wild-type plants, suggesting that this gene is involved in cotton resistance to Verticillium wilt.

[0184] Example 2 Study on the mechanism of action of VIPR1L

[0185] 1. Yeast two-hybrid assay

[0186] (1) The target gene and the gene to be verified to interact with it are constructed into AD

[0187] The pGADT7 and BD (pGBKT7) vectors were used to transform the pGADT7 into the golden PLUS yeast strain.

[0188] (2) Streak the yeast strain stored at -80°C onto YPDA to restore its activity, and culture it upside down in an incubator (28°C) for 3 days.

[0189] (3) Pick 2-3 fresh single clones and culture them in a small amount using 3-4 ml of liquid YPDA medium. Culture them in a shaking incubator at 28°C and 220 rpm overnight.

[0190] (4) Transfer the above bacterial solution into 100 ml YPDA liquid culture medium and culture in a shaking incubator at 28°C and 220 rpm for 3-5 h. Measure the OD value to be between 0.5-0.6.

[0191] Bacteria collection:

[0192] (5) Transfer the bacterial suspension to a 50 ml centrifuge tube, balance it, and centrifuge at 2500 rpm for 5 min at room temperature to collect the bacteria. Discard the supernatant. (At this point, boil the ssDNA at 900 W for 20 min and immediately insert it into ice.)

[0193] (6) First, resuspend the two tubes of bacterial suspension with a small amount of ddH2O, then combine them into one tube, make the volume up to 50 ml with ddH2O, centrifuge at 2500 rpm for 5 min at room temperature to collect the bacteria, and discard the supernatant.

[0194] Suspension bacteria:

[0195] (7) Prepare yeast competent cells by resuspending the cells in 1xTE / LiAc (calculate the required volume first). The formula is 10x TE: 10x LiAc: ddH2O = 1:1:8 (100 μl is required for one reaction).

[0196] conversion

[0197] (8) Pre-pipette 300 ng of AD and BD vector plasmids into a 1.5 ml sterilized centrifuge tube and add 10 μl of ssDNA to mix.

[0198] (9) Add 100 μl of yeast competent cells to the above mixed plasmids and mix thoroughly by pipetting.

[0199] (10) After mixing 50% PEG:10xTE:10xLiAc = 8:1:1, add 600 μl to the system in step (9) above and gently tap to mix.

[0200] Recovery culture

[0201] (11) Resume the culture at 30°C, 200 rpm on a shaker for 30 min while opening a 42°C water bath.

[0202] (12) Add 70 μl of DMSO to the above system, flick gently to mix, heat in a 42 °C water bath for 15 min, and immediately insert into ice and let stand for 5 min.

[0203] (13) Collect the bacteria by centrifugation at 12,000 rpm for 1 min at room temperature. Aspirate the supernatant with a sterilized blue pipette tip in a clean bench. Resuspend the bacteria in 50 μl of 1xTE (10xTE: ddH2O = 1:9), spread on 2D solid culture medium, and culture inverted at 30°C for 2-3 days.

[0204] (14) Pick a single colony from the 2D culture medium and place it on a PCR plate. Use 100 μl of ddH2O to suspend the bacteria, mix well, and then dilute 10 times and 100 times with ddH2O. Drop 6 μl on the 2D and 4D culture medium respectively. Incubate the culture at 28°C for three days and observe the growth of the yeast. If the yeast can grow normally on the 4D culture medium but the negative control does not grow, it indicates that the two proteins may interact with each other.

[0205] 2. Firefly luciferase complementation assay (LCI)

[0206] The firefly luciferase gene, used as a reporter gene, is split into two parts, N-LUC and C-LUC, and linked to the pCAMBIA vector. The target gene is constructed on these two vectors, injected into tobacco plants, and transiently expressed in the tobacco plant. If the two proteins interact, they will move closer together, allowing N-LUC and C-LUC to re-form firefly luciferase, which then produces light when it encounters a substrate.

[0207] (1) The target gene to be detected is constructed into N-LUC and C-LUC vectors and transformed into Agrobacterium.

[0208] (2) Streak the strain on a solid culture medium containing only rifampicin resistance and incubate it upside down in a 28°C oven for 48 h to restore activity (P19, N-LUC, and C-LUC also need to be activated). P19 can inhibit gene silencing.

[0209] (3) Pick a single clone of Agrobacterium and culture it overnight in a shaker at 28°C and 220 rpm using 2-3 ml of YEB liquid medium containing R+K resistance.

[0210] (4) Measure the OD value between 0.3 and 0.6 and calculate the required volume of bacterial solution.

[0211] V=1 / OD600

[0212] V(P19)=0.6 / OD600

[0213] (5) Mix the two bacterial suspensions to be verified for possible interaction according to the calculated volumes above into a 2 ml centrifuge tube. Add the corresponding volume of P19 and centrifuge at 12,000 rpm for 1 min at room temperature to collect the cells. Discard the supernatant and pour the remaining liquid upside down onto absorbent paper. Add 1 ml of the resuspension solution to the centrifuge tube and pipette to mix thoroughly. Then add another 1 ml of the resuspension solution and mix thoroughly by inverting. Place the tube in the dark at room temperature for at least 2 h and inject the tube into one-month-old tobacco leaves from the back.

[0214] (6) After culturing for 2-3 days, cut the tobacco leaf into pieces and stick them on white paper. Spray the LUC substrate after ice bath and observe the luminescence using CDD imaging system. If the experimental group and the positive control emit light but the negative control does not, the interaction is verified.

[0215] The components of the LUC / BIFC resuspension are shown in Table 3.

[0216] Table 3 Components of LUC / BIFC resuspension

[0217] Reagent volume: 0.5 mM MES (pH 5.7) 40 μl, 2 M MgCl2 10 μl, 200 mM AS 2 μl, H2O 1948 μl

[0218] 3. Bimolecular fluorescence complementation experiment

[0219] (1) Construct the target gene to be detected into YNE and YCE vectors and transform them into Agrobacterium.

[0220] (2) Streak the strain on a solid culture medium containing only rifampicin resistance and incubate it upside down in a 28°C oven for 48 h to restore its activity (P19, GUS-YNE, and GUS-YCE also need to be activated). P19 can inhibit gene silencing.

[0221] (3) Pick a single clone of Agrobacterium and culture it overnight in a shaker at 28°C and 220 rpm using 2-3 ml of YEB liquid medium containing R+K resistance.

[0222] (4) Measure the OD value between 0.3-0.6 and calculate the required volume of bacterial solution

[0223] V=1 / OD600

[0224] V(P19)=0.6 / OD600

[0225] (5) Mix the two bacterial suspensions to be verified for possible interaction according to the calculated volumes above into a 2 ml centrifuge tube. Add the corresponding volume of P19 and centrifuge at 12,000 rpm for 1 min at room temperature to collect the bacteria. Discard the supernatant and pour the remaining liquid upside down onto absorbent paper. Add 1 ml of the resuspension solution to the centrifuge tube and pipette to mix thoroughly. Add another 1 ml of the resuspension solution and mix thoroughly by inverting. Invert the tube to mix thoroughly. Place the tube in the dark at room temperature for at least 2 h and inject the solution into one-month-old tobacco leaves from the back.

[0226] (6) After culturing for 2-3 days, cut small pieces of tobacco leaves to prepare slides and observe the luminescence using a confocal microscope. If the experimental group cells glow but the negative control cells do not, the interaction is verified.

[0227] The target gene was GbVIPR1L, and the gene to be verified for potential interaction was VDAL (nucleotide sequence shown in SEQ ID No. 4). Yeast two-hybrid, firefly luciferase complementation, and bimolecular fluorescence complementation assays were performed. The results, shown in Figure 4, demonstrate a direct interaction between GbVIPR1L and VDAL. In Figure 4, Panel A shows a yeast two-hybrid assay of VIPR1L and VDAL. This demonstrates a direct interaction between the two proteins within yeast cells, as the yeast can grow normally in medium lacking Leu, Trp, His, and Ade in the presence of both proteins. Panel B shows a firefly fluorescence complementation assay. The upper left corner of the image demonstrates an interaction between VIPR1L and VDAL, resulting in a fluorescence emission similar to that of the positive control in the upper right corner under ultraviolet light. Panel C shows a green fluorescent protein complementation assay, further demonstrating a direct interaction between the two proteins.

[0228] The target gene was GbVIPR1L, and the gene to be verified as potentially interacting was RKL1 (sequence shown in SEQ ID No. 5). Yeast two-hybrid, firefly luciferase complementation, and bimolecular fluorescence complementation experiments were performed. The results, shown in Figure 5, demonstrate that the GbVIPR1L protein directly interacts with RKL1. RKL1 is a leucine-rich repeat-like receptor kinase that forms a dynamic complex with regulatory receptor kinases by recognizing pathogen-associated pattern molecules, thereby triggering downstream defense responses.

[0229] Figure 5A shows the firefly luminescence complementation experiment. VIPR1L is located in the lower right corner of the figure. 49-109 In the interaction with VDAL, the smallest peptide was subsequently shown to be VIPR1L 50-114It interacts with VDAL, so that under ultraviolet light, the upper left corner of the figure emits fluorescence similar to the positive control in the upper right corner. Figure B shows the complementary luminescence experiment of green fluorescent protein (lower left corner), further showing that the two proteins have a direct interaction. It is believed that the GbVIPR1L gene plays an important role in the signal transduction process of cotton resistance to Verticillium wilt. VIPR1L 49-109 is the core sequence of the gene.

[0230]

[0231] In this example, unless otherwise specified, all contents related to the VIPR1L protein are based on the VIPR1L protein shown in SEQ ID No. 1 as an example.

[0232] 1. Preparation of VIPR1L Protein

[0233] (1) The GbVIPR1L gene (sequence shown in SEQ ID No. 2) was substituted for the small sequence between the NcoI and SalI recognition sites of the His vector, while keeping the other sequences of the His vector unchanged. This resulted in a recombinant vector, which was named HIS-GbVIPR1L. The recombinant vector HIS-GbVIPR1L expressed the protein VIPR1L-His, which consists of six His tags at the carboxyl terminus of the VIPR1L protein (sequence shown in SEQ ID NO. 18).

[0234] The GbVIPR1L gene (sequence shown in SEQ ID No. 2) was substituted for the small sequence between the BamHI and SalI recognition sites of the GST vector, while the other GST sequences remained unchanged. This recombinant vector was named GST-GbVIPR1L. The recombinant vector GST-GbVIPR1L expresses the protein VIPR1L-GST, which is a GST tag attached to the carboxyl terminus of the VIPR1L protein.

[0235] The recombinant vector HIS-GbVIPR1L and the recombinant vector GST-GbVIPR1L were transformed into Pichia pastoris strains respectively.

[0236] (2) Streak the transformed strain stored at -80°C onto solid LB medium containing kanamycin / amphetamine resistance to restore its activity. Incubate the strain upside down in an incubator (37°C) for 1 day. Pick 2-3 fresh single clones and culture them in liquid LB with the corresponding resistance overnight at 37°C in a shaker at 220 rpm to obtain a small amount of shaken culture.

[0237] (3) Transfer the above-mentioned small amount of shaken bacterial liquid to 300 ml of the corresponding resistance liquid LB (LB + 100 μg / ml Amp liquid medium (LB + 100 μg / ml Amp liquid medium is a liquid medium obtained by adding ampicillin to LB liquid medium, and the content of ampicillin in LB + 100 μg / ml Amp liquid medium is 100 μg / ml)), culture in a shaker at 37 ° C and 220 rpm for about 3 h, and control the OD value between 0.8 and 1 to obtain the pre-induction bacterial liquid.

[0238] (4) In a clean bench, aspirate 1 ml of the pre-induction bacterial solution and add 0.65 mM IPTG. Induce the culture overnight on a shaker at 22°C, 110 rpm (HIS-GbVIPR1L) or 30°C, 110 rpm (GST-GbVIPR1L) to obtain the post-induction bacterial solution.

[0239] (5) Aspirate 1 ml of the induced bacterial solution and collect the bacteria in a 500 ml centrifuge tube (centrifuge at 6000 rpm for 10 min in a high-speed centrifuge at 4°C and discard the supernatant).

[0240] (6) Add a small amount of Lys (HIS-GbVIPR1L) / PBS (GST-GbVIPR1L), pipette and mix thoroughly to completely resuspend the bacterial solution. Transfer all of the solution to a 50 ml centrifuge tube, dilute to 30 ml with the corresponding buffer, transfer the bacterial solution to a 50 ml beaker, place it in an ice-water mixture, and ultrasonicate at 4°C for 20 min (power not greater than 40%) to disrupt the bacteria. After the ultrasonication, pour it back into the original 50 ml centrifuge tube, balance it, and centrifuge it at 7500 rpm for 30 min in a 4°C centrifuge. Filter the supernatant with gauze into a new 50 ml centrifuge tube. Use the cut-end imported pipette tip to suck up a certain amount of beads in advance, and calculate according to the need to add 100 μl HIS beads (HIS-GbVIPR1L) / GST beads (GST-GbVIPR1L) to each tube of supernatant (Beads washing method: add 1 ml buffer to the beads, gently flick them with your fingertips, place them in a 4℃ refrigerator and rotate them for 5 min. After taking them out, centrifuge them at 3000 rpm for 3 min at 4℃, and remove the supernatant. Repeat the above steps 3 times until the beads are completely washed). Add 100 μl of washed beads to the above supernatant and rotate them in a 4℃ refrigerator for more than 2 hours to allow the beads to fully adsorb the protein.

[0241] (7) Centrifuge at 3000 rpm for 3 min in a 4°C centrifuge. Discard the supernatant, add a small amount of resuspension solution, gently flick to suspend the beads, and transfer them to a 1.5 ml centrifuge tube using a cut blue pipette tip.

[0242] (8) Wash the beads three more times according to the above method.

[0243] (9) Add 200 μl of imidazole / GSH to the beads obtained by the final centrifugation in step (8) above, rotate and bind in a 4°C refrigerator for 20 min, centrifuge at 3000 rpm for 3 min in a 4°C centrifuge, and transfer 200 μl of the supernatant to a 1.5 ml centrifuge tube. This supernatant is the eluted proteins VIPR1L-His and VIPR1L-GST.

[0244] The cells obtained in step (5) above were disrupted, dehumidified at high temperature, and spray-dried to obtain VIPR1L-His crude protein and VIPR1L-GST crude protein, respectively. The crude proteins are shown on the left side of Figure 6. The following assay method was used to determine the VIPR1L protein content in the VIPR1L-His crude protein to be 12.5%.

[0245] Protein detection method:

[0246] Weigh 0.01 g of protein powder and dissolve it in 2 ml of ddH2O. Dilute bovine serum albumin to a 1 mg / ml protein standard solution. Add 0, 1, 2, 3, 4, 5, 6, and 7 μl of the protein standard solution to standard wells 1–8 of a 96-well plate. Add 1 μl of the sample to be tested to the remaining sample wells. Add PBS to each well to a total volume of 200 μl. Determine the protein concentration using a microplate reader. The total protein content of the protein powder can be calculated using the formula: total protein content in the protein powder = protein concentration × sample volume / dry powder mass.

[0247] VIPR1L protein was detected by Western-blot method, and the primary antibody was Anti-His Tag Mouse. The results are shown in the right figure of Figure 6, where lane CK is CFP-His protein powder, lane VIPR1 is VIPR1L-His protein powder, and lane M is Marker.

[0248] 2. Preparation of VDAL protein and VDAL-HIS stock solution

[0249] VDAL protein and VADAL-HIS stock solution were purchased from Beijing Zhongjie Sifang Co., Ltd. (Application effect of the new plant immune activation protein VDAL on green onion, Hebei Agricultural Science, 2021, 108 (2) 2, 77-82) and prepared by the company according to the following method:

[0250] (1) Construction of recombinant vectors and recombinant bacteria

[0251] The DNA molecule represented by nucleotides 1-894 in SEQ ID No. 4, i.e., the VdAL gene, was artificially synthesized. The sequence between the NdeI and KpnI recognition sites of the vector pET42a(+) (a product of Beijing Bichenglan Biotechnology Co., Ltd.) was replaced with the DNA molecule represented by nucleotides 1-894 in SEQ ID No. 5 (i.e., the VdAL gene), while the other sequences of pET42a(+) remained unchanged. This recombinant vector was named pET42a-VdAL. The recombinant vector pET42a-VdAL expresses the protein VdAL represented by SEQ ID No. 3.

[0252] Among them, SEQ ID No. 4 consists of 894 nucleotides and encodes the amino acid sequence shown in SEQ ID No. 3.

[0253] pET42a-VdAL was introduced into Agrobacterium tumefaciens Escherichia coli JM109 to obtain a recombinant bacterium, which was named JM109-pET42a-VdAL. JM109-pET42a-VdAL expressed the protein shown in SEQ ID No. 3.

[0254] The steps for culturing recombinant microorganisms are as follows:

[0255] Step 1, double enzyme digestion of VIPR1L PCR product:

[0256] The PCR product of the VIPR1L open reading frame sequence containing NcoI at the 5' end and HindIII restriction sites at the 3' end was directly digested with NcoI and HindIII to form a VIPR1L sequence with sticky ends;

[0257] The enzyme digestion system is as follows:

[0258] VIPR1L full-length cDNA (containing NcoI / HindIII restriction sites) 20.0 μL 10× K Buffer 8.0 μL NcoI (10 U / μL) 1.0 μL HindIII (10 U / μL) 1.0 μL dH2O 50.0 μL Total volume 80.0 μL

[0259] Expansion strain: DH5α, preserved in this laboratory (purchased from BioVector Plasmid Vector Strain Cell Protein Antibody Gene Collection Center)

[0260] Prokaryotic expression strain: BL21, produced by Broadtech

[0261] Step 2, double enzyme digestion of pET-28a vector:

[0262] The pET-28a plasmid was double-digested with NcoI and HindIII, and the linear vector with sticky ends was recovered by electrophoresis;

[0263] pET-28a plasmid was purchased from BioVector Plasmid Vector Strain Cell Protein Antibody Gene Collection Center

[0264] Step 3, ligation of pET-28a vector and target fragment:

[0265] The pET-28a large vector containing NcoI and HindIII restriction sites and the VIPR1L target fragment were ligated with T4 ligase at 4°C for 72 h.

[0266] The connection system is as follows:

[0267] VIPR1L full-length cDNA (containing NcoI / HindIII restriction sites) 6.5 μL pET-28a large vector (containing NcoI / HindIII restriction sites) 2.0 μL 10× T4 Legation Buffer 1.0 μL T4 Ligase 0.5 μL Total volume 10.0 μL

[0268] Step 4, pET-28a-VIPR1L transformation BL21:

[0269] First, transform DH5α Escherichia coli, extract the plasmid pET-28a-VIPR1L from the positive strain identified, and then use the competent transformation steps of Broadtech to transform the BL21 expression strain to obtain the BL21 expression strain containing the pET-28a-VIPR1L plasmid.

[0270] Step 5, prokaryotic expression detection

[0271] A BL21 expression strain containing the pET-28a-VIPR1L plasmid was selected and induced for VIPR1L expression using the prokaryotic expression method described in the third edition of the Molecular Cloning Manual. A BL21 strain containing only the empty pET-28a plasmid was used as a control. Samples were collected every hour from 1 to 16 hours after induction, and the expression product was analyzed by 6% polyacrylamide gel electrophoresis.

[0272] (2) Preparation of VDAL protein

[0273] JM109-pET42a-VdAL was fermented at 37°C to an OD value of 0.6 to obtain a pre-fermentation broth. IPTG was added to the pre-fermentation broth to a concentration of 1 mM to obtain an induction broth. The induction broth was fermented at 25°C for 6 hours to obtain a fermentation broth. The fermentation broth was centrifuged, the supernatant discarded, and the resulting bacterial pellet was the crude VDAL protein. The obtained bacterial pellet was broken, resuspended with lysis buffer (HIS), and PMSF (1%) was added and mixed; the bacterial cells were fully lysed by ultrasonic disruption; centrifuged at 7000 rpm at 4°C for 30 min, and the supernatant was transferred to a new tube; after balancing the beads, 200 μl beads were added to the above supernatant, and the beads were combined on a shaker at 4°C for 3 h; the beads were centrifuged at 3000 rpm at 4°C for 3 min to separate the beads, and the beads were eluted 3 times to wash away the weakly bound impurities; to elute the target protein: 500 μl HIS label elution buffer (imidazole elution buffer) was added, and the beads were eluted on a shaker at 4°C for 20 min. The supernatant was taken, which was the purified VDAL protein, the concentration was measured, and the beads were stored at -80°C.

[0274] (3) Preparation of VDAL-HIS mother solution

[0275] The concentration of the VDAL-HIS stock solution is 40 ppm, and it is prepared by dissolving VDAL-HIS in ddH2O; VDAL-HIS is the carboxyl terminus of the VDAL protein prepared in the above step (2) connected to three His tags.

[0276] 3. Effects of VIPR1L protein treatment on wheat seed growth and drought resistance

[0277] Mother liquor configuration:

[0278] VIPR1L-His protein (sequence shown in SEQ ID NO. 18) stock solution (100 ppm): Pipette 70 μl of the eluted VIPR1L-His protein (5 mg / ml) prepared as described in item 1 of this example into a 5 ml centrifuge tube and dilute to 3.5 ml with ddH2O.

[0279] GFP-HIS (10 ppm): Pipette 1.25 μl of purified GFP-HIS (40 mg / ml) into a 5 ml centrifuge tube and dilute to 5 ml with ddH2O.

[0280] The preparation method of the GFP-HIS protein is as follows:

[0281] GFP (GenBank: AMQ45836.1) was constructed in the prokaryotic expression vector pET28a (His) to form a recombinant plasmid to transform Escherichia coli BL21; a single clone with correct sequencing was selected and inoculated in a small amount and shaken at 37°C, 220 rpm for 8-12 h; 6 ml of bacterial solution was added to 300 ml LB and shaken at 37°C, 220 rpm for 2 h, after which the OD600 value was measured. When OD600 was 0.8-1.2, 1 ml was aspirated as the pre-induction medium, and 150 μL IPTG was added to the remaining bacterial solution. Induction was carried out overnight at 16°C, 220 rpm; 1 ml of the post-induction bacterial solution was aspirated and collected by centrifugation. Protein expression was detected by adding 80 μl ddH2O and 20 μl loading solution to the centrifuged cells, boiling for 5 min, and centrifuging for 5 min. min, load the sample for SDS-PAGE electrophoresis, stain with Coomassie Brilliant Blue and decolorize to observe and compare whether the protein is induced to express; perform subsequent purification of the induced expressed protein; centrifuge the bacterial solution to collect the cells; resuspend the cells in lysis buffer (HIS) and add PMSF (1%) to mix; fully lyse the bacterial cells with an ultrasonic disruptor; centrifuge at 7000 rpm at 4°C for 30 min, transfer the supernatant to a new tube; after equilibration of the beads, add 200 μl of beads to the above supernatant and shake at 4°C for 3 h; centrifuge at 3000 rpm at 4°C for 3 min to separate the beads and wash the beads three times to wash away the weakly bound impurities; elute the target protein: add 500 μl of HIS tag elution buffer (imidazole solution), shake at 4°C for elution for 20 min, centrifuge at 3000 rpm at 4°C for 3 min, collect the supernatant, measure the concentration, and store at -80°C.

[0282] The experiment was divided into 10 treatment groups, namely H2O, GFP-HIS, VDAL, VDAL+GFP-HIS, VDAL+VIPR1L-His 5ppm, VDAL+VIPR1L-His 10ppm, VDAL+VIPR1L-His 20ppm, VIPR1L-His 5ppm, VIPR1L-His 10ppm and VIPR1L-His 20ppm.

[0283] Thirty wheat seeds were soaked in the various reagents listed in Table 4 for each treatment group. After the seeds appeared white, they were sown on square dishes (pre-covered with four layers of absorbent paper and one layer of filter paper). Watering was controlled daily, and the white appearance rate, germination rate, and plant height were measured. After one week, the wheat seeds were dehydrated and photographed. Three biological replicates were performed.

[0284] Table 4 Reagents and preparation methods used in treatment groups

[0285] Treatment group reagents and concentration preparation method H2OH2OddH2O 3000 μlGFP-HISGFP-HIS 8 ppm2400 μl GFP+600 μl ddH2OVDALLVDAL-HIS 8 ppm600 μl VDAL+2400 μl ddH2OVDAL+GFP-HISVDAL-HIS 8ppm+GFP-HIS 8ppm600μlVDAL+2400 μlGFPVDAL+VIPR1L-His 5 ppmVDAL-HIS 8ppm+GbVIPR1L-HIS 5 ppm600μl VDAL+150 μl GbVIPR1L+2250 μl ddH2OVDAL+VIPR1L-His 10 ppmVDAL-HIS 8 ppm+GbVIPR1L 10 ppm600 μl VDAL+300 μl GbVIPR1L+2100 μl ddH2OVDAL+VIPR1L-His 20 ppmVDAL-HIS 8 ppm+GbVIPR1L 20 ppm600 μl VDAL+600 μl GbVIPR1L+1800 μl ddH2OVIPR1L-His 5 ppmGbVIPR1L 5 ppm150 μl GbVIPR1L+2850 μl ddH2OVIPR1L-His 10 ppmGbVIPR1L 10 ppm300 μl GbVIPR1L+2700 μl ddH2OVIPR1L-His 20 ppmGbVIPR1L 20ppm600 μl GbVIPR1L+2400 μl ddH2O

[0286] The experimental results are shown in the following table (Table 5), and the results are shown in Figure 7 (a)-(c), where (a) is the plant height statistics on the first day of sowing, (b) is the plant height statistics one week after sowing, and (c) is a photo of some treatment groups one week after sowing.

[0287] Table 5 Experimental results

[0288] a. Plant height on the first day (mm)

[0289] Treatment group First repeat Second repeat Third repeat Average H2O 5.26 7.00 7.33 6.53 GFP-HIS 5.23 7.00 8.46 6.90 VDAL 4.16 9.63 8.10 7.30 VDAL + GFP-His 4.76 9.40 10.90 8.35 VDAL + VIPR1L-His 5 ppm 4.33 8.23 ​​0 8.30 6.95 VDAL + VIPR1L-His 10 ppm 5.60 8.50 6.76 6.95 VDAL + VIPR1L-His 20 ppm 4.90 8.30 11.66 0 8.28 VIPR1L-His 5 ppm 4.46 8.43 10.10 7.66 VIPR1L-His 10 ppm5.69.0310.608.41VIPR1L-His 20 ppm5.166.366.165.90

[0290] b. Plant height after one week (mm)

[0291] Treatment group First repeat Second repeat Third repeat Average H2O 89.76 76.56 50.30 72.21 GFP-HIS 96.10 77.00 51.73 74.94 VDAL 81.73 92.90 45.80 73.47 VDAL + GFP-His 84.46 86.43 54.13 75.01 VDAL + VIPR1L-His 5 ppm 83.63 85.76 54.46 74.62 VDAL + VIPR1L-His 10 ppm 92.70 95.13 47.23 78.35 VDAL + VIPR1L-His 20 ppm 95.70 83.86 55.76 78.44 VIPR1L-His 5 ppm80.8682.0051.8371.56VIPR1L-His 10 ppm98.6390.7654.3381.24VIPR1L-His 20 ppm91.4682.3346.3673.38

[0292] When wheat seeds were treated with VIPR1L protein at a concentration of 10 ppm, plants grew taller than those treated with the GFP-HIS control, 5 ppm GbVIPR1L-HIS, and 20 ppm GbVIPR1L-HIS protein. After one week of dehydration, the 10 ppm treatment showed the best drought resistance, suggesting that VIPR1L is involved in wheat drought resistance. This example suggests that 10 ppm may be the optimal concentration for enhancing wheat drought resistance with purified GbVIPR1L-HIS protein. Preliminary results from experiments using VIPR1L and VDAL combined showed that wheat growth and drought resistance were best when treated with 10 ppm of purified VIPR1L protein in the presence of 8 ppm VDAL.

[0293] Wheat seeds were soaked for more than 24 h and divided into nine treatment groups, namely H2O (CK), VDAL (8 ppm VDAL pure protein, VD8), VDAL 8 ppm + VIPR1L-His 5 ppm (8 ppm VDAL pure protein + VIPR1L-His 5 ppm, VD+VP5), VDAL 8 ppm + VIPR1L-His 10 ppm (8 ppm VDAL pure protein + VIPR1L-His 10 ppm, VD+VP10), and VDAL 8 ppm + VIPR1L-His 20 ppm (8 ppm VDAL pure protein + VIPR1L-His 20 ppm, VD+VP20). Purified GbVIPR1L-GST and VDAL-HIS were mixed with different treatment solutions according to the above ratios. Twenty white wheat seeds from each treatment group were soaked in the corresponding treatment solution. Four hours later, they were sown on sterilized vermiculite, with daily watering. After one week, the wheat seeds were dehydrated (no watering at all), and photographs were taken. One week after dehydration, a rehydration experiment (plenty of watering) was conducted, and photographs were taken.

[0294] The results are shown in Figure 7(d), where the left figure shows the wheat after one week of water loss, and the right figure shows the wheat after the rehydration experiment. The results show that VDAL alone cannot rehydrate under extreme drought conditions, while VIPR1L and VDAL combined treatment can rehydrate under extreme drought conditions.

[0295] 4. Effects of VIPR1L protein on maize germination

[0296] To investigate the effect of exogenous treatment with VIPR1L protein on maize germination, plump maize seeds were soaked in a control protein (unlabeled protein, the same below) and various concentrations of VIPR1L protein for 4-5 hours, followed by incubation and observation of seed germination. As shown in Figure 3-1A, after 24 hours of incubation, soaking in various concentrations of VIPR1L protein increased the germination rate compared to the control. Seeds soaked in 20 mg / L and 40 mg / L VIPR1L protein solutions significantly increased germination rates compared to the control, by 19.35% and 32.26%, respectively. After 36 hours of incubation, the difference in germination rate between the control and experimental groups decreased, but the germination rate of seeds soaked in 20 mg / L and 40 mg / L VIPR1L protein solutions was still higher than that of the control. Therefore, exogenous treatment with VIPR1L protein can promote maize germination, and the promoting effect is more pronounced after a short period of time.

[0297] Based on this, we investigated the effects of exogenous VIPR1L protein treatment on maize seed germination under abiotic stress. 10 mL of 150 mM NaCl solution or 10 mL of 15% PEG6000 solution were added to square Petri dishes containing maize seeds, and maize seed germination was observed. The results are shown in Figures 8B and 8C. After 36 hours of incubation under NaCl stress, maize seeds treated with 10 mg / L, 20 mg / L, and 40 mg / L VIPR1L protein solutions showed significantly higher germination rates than the control, increasing by 13.54%, 19.80%, and 19.80%, respectively. At 48 hours, maize seeds treated with 25 mg / L and 40 mg / L VIPR1L protein solutions still showed higher germination rates than the control, with increases of 13.54% in each treatment (Figure 8B). No significant differences were observed between the control and experimental groups under hyperosmotic stress (Figure 8C). Therefore, under NaCl stress, exogenous treatment of VIPR1L protein can also significantly promote corn seed germination in a short period of time.

[0298] Figure 8A shows the effect of VIPR1L protein treatment on maize germination rate. Maize seeds were soaked in a control protein (same-labeled empty protein), 3 mg / L, 5 mg / L, 10 mg / L, 15 mg / L, 20 mg / L, and 40 mg / L VIPR1L protein solutions for 4-5 hours, then incubated at 25°C in the dark. Germination rates were calculated at 24 and 36 hours. The experiment was repeated three times, and data are presented as mean ± SD. Significance analysis was performed using the t-test. indicates p < 0.01; Indicates p < 0.05.

[0299] Figure 8B shows the effect of VIPR1L protein treatment on maize germination rate under NaCl stress. Maize seeds were soaked in control protein (same-labeled empty protein), 5 mg / L, 10 mg / L, 20 mg / L, and 40 mg / L VIPR1L protein solutions for 4-5 h. 10 mL of 150 mM NaCl solution was added to the culture dish and incubated at 25°C in the dark. Germination rates were calculated at 36 h and 48 h, respectively. The experiment was repeated three times independently, and the data are expressed as mean ± standard deviation. Significance analysis was performed using t-test. indicates p<0.001, Indicates p < 0.01, Indicates p < 0.05.

[0300] Figure 8C shows the effect of VIPR1L protein treatment on maize germination under hyperosmotic stress. Maize seeds were soaked in a control protein (unlabeled protein), 5 mg / L, 10 mg / L, 20 mg / L, or 40 mg / L protein solution for 4-5 hours. 10 mL of 15% PEG6000 solution was added to a Petri dish and incubated at 25°C in the dark. Germination rates were calculated at 36 and 48 hours. The experiment was repeated three times, and data are presented as mean ± SD. Significance was analyzed using a t-test; ns indicates not significant.

[0301] 5. Effects of VIPR1L on maize growth and salt, disease, and lodging resistance

[0302] Corn seeds treated with different concentrations of VIPR1L protein solution were cultured in a light incubator for 3-4 days, and their radicle growth was observed and analyzed, as shown in Figures 9A and 9B. The average radicle length of corn seeds treated with 10-40 mg / L VIPR1L protein solution was significantly longer than that of the control, and the number of lateral radicles was greater.

[0303] Figure 9A shows the growth of maize radicles treated with exogenous VIPR1L protein. Maize seeds were soaked in solutions of control protein (same-labeled empty protein) or VIPR1L protein at varying concentrations for 4-5 hours and then placed in a light incubator at 25°C with 16 hours of light and 8 hours of darkness for 3-4 days. The scale bar in the figure represents 2 cm.

[0304] Figure 9B shows the statistical results of corn radicle length. 30 seeds were counted in each group, and the experiment was repeated three times independently. The statistical results are presented using a box plot. The three horizontal lines of the rectangle represent the upper quartile (Q3, 75%), the median (Q2, 50%), and the lower quartile (Q1, 25%) from top to bottom. The bottom and top horizontal lines represent the minimum and maximum values, respectively. The significance analysis was performed using the t-test test. indicates p<0.001, Indicates p < 0.01.

[0305] Corn seeds treated with different concentrations of VIPR1L protein solution were incubated in the dark until germination, then incubated in a light incubator for 5-6 days. The growth of the embryos was observed and analyzed, as shown in Figures 9C and 9D. The average embryo length of corn seeds treated with 10-40 mg / L VIPR1L protein solution was significantly longer than that of the control, and the uniformity of the embryos of corn seeds treated with 20 mg / L VIPR1L protein solution was significantly higher than that of the control.

[0306] Figure 9C shows the growth of maize embryos treated with exogenous VIPR1L protein. Maize seeds were soaked in solutions of control protein (same-labeled empty protein) or VIPR1L protein at varying concentrations for 4-5 hours and then placed in a light incubator at 25°C with 16 hours of light and 8 hours of darkness for 5-6 days. The scale bar in the figure represents 2 cm.

[0307] Figure 9D shows the statistical results of corn germ length. Each group had 30 seeds and the experiment was repeated 3 times independently. The statistical results are presented using a box plot. The three horizontal lines of the rectangle represent the upper quartile (Q3, 75%), the median (Q2, 50%), and the lower quartile (Q1, 25%) from top to bottom. The bottom and top horizontal lines represent the minimum and maximum values, respectively. The significance analysis was performed using the t-test test. indicates p<0.001, Indicates p < 0.01, Indicates p < 0.05.

[0308] In Figure 10, Figure 10A shows corn seedlings treated with different VIPR1L concentrations. It can be seen from the figure that corn seedlings treated with 5ppm to 20ppm VIPR1L are significantly better than the control; Figure 10B shows the chlorophyll content of leaves 1 to 3, with the 20ppm treatment being the best; Figure 10C shows the plant height 15 days after sowing. All treatments are significantly better than the control, with 10ppm and 20ppm being the best; Figure 10D shows the leaf width of detached corn leaves under different treatments. The results show that GbVIPR1L is beneficial to promoting the width of corn leaves.

[0309] Figure 11 shows the effect of VIPR1L on improving drought resistance in maize.

[0310] Figure 11A shows the surface temperature of corn seedling leaves detected by an infrared thermal imager. The lower the leaf temperature, the higher the water loss rate of the leaves.

[0311] Figure 11B is a statistical graph of leaf temperature. Three leaves were selected for each treatment, and the average temperature of three points at the same height was taken. The experiment was repeated three times independently, and the data are expressed as mean ± standard deviation. The significance analysis was performed using t-test. indicates p<0.001, Indicates p < 0.01.

[0312] Figure 11C shows the statistical graph of water loss in detached leaves. Water loss (%) = (initial fresh weight - weight after water loss) / initial fresh weight × 100%. The results of three replicates were averaged. Data are expressed as mean ± SD.

[0313] Figure 11D shows a soil drought treatment and rewatering experiment. Corn seeds were soaked in a control protein (same-labeled empty protein) or different concentrations of VIPR1L protein for 4-5 hours, then sown in small plastic pots and cultured in a greenhouse at 25°C, 16 hours of light, and 8 hours of darkness. When the corn seedlings reached the three-leaf stage, excess water was removed from the trays and drought treatment began. After approximately one week of drought treatment, the seedlings were observed for the appearance of leaf wilting. After approximately 10 days of drought treatment, an equal amount of water was added to the trays, and the seedlings were observed for growth after 1-2 days.

[0314] Figure 12 shows the effect of VIPR1L in improving the salt tolerance of corn during germination. The control and VIPR1L 10ppm to 40ppm treatments were placed under 150mM NaCl conditions and observed after 5 days.

[0315] Figure 12A shows the effect of VIPR1L protein treatment on maize embryo growth under NaCl stress. Maize seeds were soaked in a control protein (same-labeled empty protein) or solutions of varying VIPR1L protein concentrations for 4-5 hours, then cultured in Petri dishes. 10 mL of 150 mM NaCl solution was added every two days and incubated under light for approximately 7 days. The scale bar in the figure represents 2 cm.

[0316] Figure 12B shows the statistical results of corn germ length under NaCl stress. Each group had 30 seeds and the experiment was repeated 3 times independently. The statistical results are presented using a box plot. The three horizontal lines of the rectangle represent the upper quartile (Q3, 75%), the median (Q2, 50%), and the lower quartile (Q1, 25%) from top to bottom. The bottom and top horizontal lines represent the minimum and maximum values, respectively. The significance analysis was performed using the t-test test. Indicates p < 0.05.

[0317] Figure 13 shows field trial results demonstrating that VIPR1L, both alone and in combination with VDAL, regulates maize growth and resistance, with the combined effect of the two being particularly effective in increasing yield. VIPR1L protein enhances the resistance-enhancing properties of maize through VDAL protein. Exogenous spraying of a mixture of VIPR1L and VDAL proteins at a certain ratio significantly improved maize disease resistance and lodging resistance, promoted growth, and increased maize yield. Increased corn yield: As shown in Figures 3-7E and F, compared to the control, foliar spraying of 5 mg / L VIPR1L protein solution (4.41% yield increase), 3 mg / L VDAL protein solution (7.91% yield increase), 2:10 (14.48% yield increase), and 2:5 VIPR1L and VDAL protein mixtures (11.82% yield increase) significantly increased maize yield.

[0318] Figure 13A shows the statistical results of the diameter of the middle ear of corn in the field. Thirty corn plants were randomly selected from each experimental plot, and the diameter of the middle ear of all corns was measured and the average value was calculated. Data are expressed as mean ± standard deviation, and the significance was analyzed using t-test. Indicates p < 0.01.

[0319] Figure 13B is the aerial root index of field corn. 30 corn plants were randomly selected from each experimental plot and evaluated based on the number of aerial root layers and strips above the ground, and divided into levels 0-4. Level 0: The number of aerial root strips above the ground is 0; Level 1: The number of aerial root layers above the ground is 1, and the number of aerial roots is less than 10; Level 2: The number of aerial root layers above the ground is 1, and the number of aerial roots is greater than 10; Level 3: The number of aerial root layers above the ground is 2, and the number of aerial roots is less than 20; Level 4: The number of aerial root layers above the ground is 2, and the number of aerial roots is greater than 20. Calculation of aerial root index: aerial root index = (∑ number of plants at each level × corresponding level) / (total number of corn plants × highest level) × 100. Data represent mean ± standard deviation, and significance analysis was performed using t-test. Indicates p < 0.01, Indicates p < 0.05.

[0320] Figure 13C is the disease index of corn leaf spot. 30 corn plants were randomly selected from each experimental plot to assess their leaf spot conditions. The disease level was recorded according to the following grading standards: Level 0: No disease spots on the leaves of the whole plant; Level 0.5: Sporadic disease spots on the leaves of the whole plant, accounting for about 1% of the leaf area; Level 1: A small number of disease spots on the leaves of the whole plant, accounting for 5%-10% of the leaf area; Level 2: A moderate number of disease spots on the leaves of the whole plant, accounting for 10%-25% of the leaf area; Level 3: There are many disease spots on the lower leaves of the plant, accounting for more than 50% of the leaf area. Calculate the disease index: Disease index = (∑Number of diseased plants at each level × corresponding disease level) / (Total number of corn plants × highest disease level) × 100. Data are expressed as mean ± standard deviation, and significance analysis was performed using t-test. indicates p<0.001, Indicates p < 0.01.

[0321] Figure 13D shows the fresh weight of the whole corn plant. Three 3-meter double-row sampling points were randomly selected in each experimental plot. The total fresh weight of all corn plants in each sampling point was weighed and the average value was calculated. Data are expressed as mean ± standard deviation, and significance analysis was performed using t-test. Indicates p < 0.01, Indicates p < 0.05.

[0322] Figure 13E shows the equivalent yield per mu. Three 3-meter double-row sampling sites were randomly selected in each experimental plot. The number of corn plants, average number of ears per plant, and 100-kernel weight (after drying) within the sites were counted. Equivalent yield per mu was calculated using the following formula: Equivalent yield per mu = number of plants per mu × average number of ears per plant × average number of kernels per ear × 100-kernel weight / 100.

[0323] Figure 13F shows the yield increase. The plot sprayed with the control protein was used as the control to calculate the yield change rate of the other treatment plots.

[0324] Table 6 Comparison of resistance function between VIPR1L treatment and other biological agents

[0325]

[0326] 6. Effects of VIPR1L protein powder on tomato growth

[0327] To verify the immune-inducing, anti-premature aging and yield-increasing effects of VIPR1L on tomatoes, we conducted experiments on tomatoes using VIPR1L alone, VIPR1L+VDAL, and spraying with VDAL and water as controls.

[0328] Materials and methods: Tomato varieties are orange banana tomatoes (purchased from Shandong Weier Seed Co., Ltd.)

[0329] Solutions were prepared using the previously prepared 2 wt% pure VDAL protein powder and 12.5 wt% pure GbVIPR1L powder (i.e., the crude VIPR1L-His protein prepared above): VDAL protein powder was prepared as a 3 ppm (VDAL) aqueous solution, VIPR1L-His crude protein was prepared as a 15 ppm (VIPR1L) aqueous solution, and VDAL + VIPR1L-His as a 3 ppm (VDAL) + 15 ppm (VIPR1L) aqueous solution. A spray was prepared at a ratio of 15 L of protein solution per 667 L of water and applied evenly seven days after tomato transplanting. Each treatment was randomly replicated four times in a 130 m² plot. The plants were surveyed 15 days after spraying (the total number of fruits and flowers per ear was recorded), and the fruits were tasted multiple times after ripening.

[0330] The results are shown in Figure 14. Fifteen days after spraying, the growth of tomatoes grown with VDAL, VIPR1L, and VDAL + VIPR1L was better than that of the control (Figure 14A). The number of fruits in the first and second layers, as well as the number of top-layer flowers, was greater than that of the control, with VDAL + VIPR1L showing the best growth (Figure 14B).

[0331] Three months after spraying, the anti-senescence effects of tomatoes treated with VDAL, VIPR1L, and VDAL + VIPR1L were significantly better than those of the control, as evidenced by leaves remaining green and more large fruits than the control. VIPR1L had the best anti-senescence effect, followed by VDAL ( Figure 14C ).

[0332] Yield results demonstrated that the VDAL, VIPR1L, and VDAL + VIPR1L treatments outperformed the control, with the VDAL + VIPR1L treatment yielding the highest yield, followed by VDAL (Figure 14D). Repeated tastings also revealed that tomatoes sprayed with VIPR1L were the sweetest, while VDAL + VIPR1L had a more palatable sweet and sour taste.

[0333] In summary, VIPR1L protein powder has immune-inducing, anti-premature aging and yield-increasing effects on tomatoes. If combined with VDAL, it will result in higher yields and a more unique flavor.

[0334] 7. Effects of VIPR1L protein powder on tea plant growth

[0335] To verify the effect of VIPR1L on increasing tea yield, we conducted experiments on tea trees using VIPR1L alone, VIPR1L+VDAL, and spraying with VDAL and water as controls.

[0336] (1) Experimental Materials: The tea trees selected for the experiment were Yinghong No. 9, cultivated in the Yingde Tea World Tea Garden in Yingde City, Guangdong Province. Fresh leaves were quickly frozen in liquid nitrogen and then crushed into tea powder using a High Performance Tissue Lyser (Absolute 1100). The powder was then stored in a -80°C ultra-low temperature freezer for subsequent quality metabolite analysis.

[0337] (2) Experimental methods

[0338] Spraying treatment experimental method:

[0339] VDAL treatment: 0.15g VDAL was added to 2L water and sprayed for 15m 2 For tea trees, spray once every 5 days. The spraying method is liquid surface spray during the growth period, and the same applies to the following.

[0340] VIPR1L treatment: 0.12g VIPR1L was added to 2L water and sprayed for 15m 2 For tea trees, spray once every 5 days.

[0341] VIPR1L+VDAL treatment: 0.15g VDAL, 0.12g VIPR1L (mass ratio 10:8), add 2L water and spray 15m 2 For tea trees, spray once every 5 days.

[0342] Control (CK): blank control, sprayed with the same amount of water for 15m 2 For tea trees, spray once every 5 days.

[0343] Growth index determination method:

[0344] Germination density: Randomly select 5 points in the treatment area and the control area, with an area of ​​33cm×33cm, and investigate the number of one bud and one leaf in the point. Convert the total number of buds in each point into 2 The total number of buds is the germination density.

[0345] 100 bud weight: Randomly select 100 buds from each batch of buds collected in the treatment and control areas and weigh them three times. The average value is used to obtain the 100 bud fresh weight. The 100 buds are then dried at 103°C to obtain the 100 bud dry weight.

[0346] Yield determination: The treatment area and the control area were divided into 5 areas (3m 2 ), pick fresh leaves in each area and count the yield of fresh tea leaves.

[0347] Due to the growth rate of new shoots of tea trees, the picking standard after 15 days of treatment is one bud and one leaf, and the picking standard after 25 days of treatment is one bud and two leaves.

[0348] Extraction and analysis of tea polyphenols

[0349] Weigh 0.2 g of Yinghong No. 9 fresh leaf tea powder and add 10 mL of methanol solution. Extract in an ice bath for 30 minutes, then centrifuge at 8000 rpm for 5 minutes. The supernatant is collected. Total polyphenols are determined using the Folin phenol assay: 50 μL of the extract is diluted 20-fold by adding 950 μL of methanol solution. Add 200 μL of the dilution to 500 μL of 10% Folin phenol solution, shake thoroughly, and react for 4 minutes. Then, add 400 μL of 7.5% Na2CO3 solution. After incubating at room temperature for 60 minutes, the supernatant is detected using a microplate reader at a wavelength of 765 nm.

[0350] Extraction and analysis of total free amino acids

[0351] Add 10 mL of cold water to 0.2 g of tea powder and extract in an ice bath for 30 minutes, shaking every 5 minutes. Centrifuge at 10,000 g for 5 minutes, remove the supernatant, and dilute to 10 mL. Pipette 1 mL of the extract and dilute 10-fold. Pipette 200 μL of the dilution, add 100 μL of buffer and 100 μL of ninhydrin colorimetric reagent, and heat in a boiling water bath for 15 minutes to develop color. Remove and cool to room temperature, then measure absorbance at 540 nm.

[0352] Analysis of Catechins and Caffeine by High Performance Liquid Chromatography

[0353] 0.2 g of tea powder was weighed and added to 10 mL of methanol. The mixture was extracted in an ice bath for 30 minutes, then centrifuged at 8000 rpm for 5 minutes. The supernatant was collected and diluted to 10 mL. The extract was passed through a 0.22 μm membrane and analyzed by HPLC (Alliance, Waters, Milford, MA, USA). Analysis was performed on a ZORBAX Eclipse C18 column (4.6 mm × 150 mm, 5 μm; Agilent, Santa Clara, California, USA) with a 10 μL injection volume and a column temperature of 35°C. Solvent B consisted of acetonitrile containing 2% glacial acetic acid, and solvent C consisted of deionized water containing 9% acetonitrile and 2% glacial acetic acid. The linear gradient of the solvent was as follows: 0%-30% B (0-32 min); 30% B (32.1-52 min); 30%-100% B (52-52.1 min); 100%-0% B (67-67.1 min); 100%-100% C (0.0-22.0 min); 100% C (22.1-52.0 min); 70%-0% C (52.1-67 min); 0% C (67.1-97 min). The mobile phase flow rate was 1 mL / min. The UV absorption wavelength was 278 nm.

[0354] (3) Experimental results

[0355] Effects of VIPR1L and VDAL proteins on the growth traits of Yinghong No. 9 tea plants:

[0356] The four experimental treatments were: VDAL protein treatment, VIPR1L protein treatment, VDAL+VIP treatment and control group CK. The results showed that spraying VDAL, VIP and VDAL+VIP could significantly increase the yield of Yinghong No. 9 tea trees (Figure 15, VIP in the figure refers to VIPR1L protein).

[0357] Effects of VIPR1L and VDAL proteins on 100-bud weight and bud density of Yinghong No. 9 tea plants:

[0358] Spraying VDAL or VIPR1L alone had no significant effect on tea bud density, while spraying both VDAL and VIPR1L significantly increased bud density. Spraying VDAL alone had no significant effect on 100-bud weight, while spraying VIPR1L alone or with both VIPR1L and VDAL significantly increased 100-bud weight (Figure 16, where VIP refers to VIPR1L protein).

[0359] Effects of VDAL and VIPR1L proteins on the quality metabolites of fresh leaves of Yinghong No. 9 tea plant:

[0360] Tea polyphenols (TPP) are the primary secondary metabolites in tea, including catechins, flavonoids and flavonoid glycosides, anthocyanins and anthocyanins, and phenolic acids (Wan Xiaochun, 2003). They contribute to the astringency of tea. Amino acids are organic compounds with amino and carboxyl groups found in tea and are one of the main chemical components of tea. The composition and content of total amino acids (TAA) in tea, as well as their degradation and transformation products, directly affect tea quality. It is generally believed that a high amino acid content contributes to the freshness of tea. Caffeine (CAF) is the main component of tea alkaloids and belongs to the xanthine alkaloid family. It accounts for 2%-5% of the dry weight of tea leaves and is the main contributor to the bitterness of tea. Studies have shown that spraying VDAL protein alone or VIPR1L and VDAL protein together significantly increases the total polyphenol content in fresh tea leaves. Spraying VIPR1L protein alone has no significant effect on total polyphenol content. (Figure 17, VIP in the figure refers to VIPR1L protein)

[0361] Amino acids account for a high percentage of fresh tea leaves and are important metabolites that contribute to tea quality. Amino acid content is generally positively correlated with tea quality. Our research found that spraying VDAL or VIPR1L protein alone, or synergistically spraying VDAL and VIP, did not significantly alter the total free amino acid content in fresh leaves of Yinghong No. 9 tea. (Figure 18, where VIP refers to VIPR1L protein)

[0362] High-performance liquid chromatography analysis of catechin and alkaloid content in fresh leaves of Yinghong No. 9 tea plants after four treatments revealed that spraying VDAL protein or VIPR1L protein alone, or spraying VIPR1L and VDAL protein simultaneously, significantly reduced EGC and EGCG content, while having no significant effect on other catechins or caffeine. (Figure 19, where VIP refers to VIPR1L protein)

[0363] 8. Blueberry preservation experiment with VIPR1L protein treatment

[0364] The experiment included five treatments: control (CK), preservative, VDAL, VIPR1L, and 3ppm VDAL + 3ppm VIPR1L. Protein was weighed based on the volume of 500ml of water. Once fully dissolved, blueberries were dipped in the corresponding solution and placed on absorbent paper to air-dry for easy observation. Thirty blueberries were sampled in each treatment. The dosage and working concentrations of VDAL and VIPR1L applied to blueberries are shown in Table 7 below.

[0365] Table 7 VDAL & VIP dosage and working concentration for blueberry

[0366] No. (B) 2% VDAL (g) 12.5% ​​VIPR1L (g) Water usage (ml) CK--500 Preservative--500 VDAL 0.075-500 VIPR1L-0.012500 VIPR1L + VDAL 0.075 0.012500

[0367] Regularly observe the freshness of blueberries, grade them based on the softness and hardness of the fruit, the proportion of lesions, etc., and keep records.

[0368] Note: The rot level of blueberries is divided into levels 0-4, where level 0 means the fruit is hard and has no lesions, level 1 means the fruit is soft or the rot area accounts for less than 25% of the fruit area, level 2 means the rot area accounts for 25% to 50% of the fruit area, level 3 means the rot area accounts for 50% to 75% of the fruit area, and level 4 means the rot area accounts for more than 75% of the fruit area.

[0369] As shown in Figure 20, compared with the control, VIPR1L protein treatment had the best preservation effect on blueberries. The rot index on the 11th day was 33.3% lower than the control CK and 23.3% lower than the preservative. The rot index on the 31st day was 4.2% lower than the control CK and the preservative. The second was VDAL+VIPR1L, and the rot index on the 31st day was 2.5% lower than the control CK and the preservative.

[0370] Spraying VIPR1L on blueberry fruits can not only delay the decay of the fruits and keep them fresh for a long time, but also slow down the loss of water, prevent drying out and reduce losses. It can be widely used in the preservation of fruits and vegetables.

[0371]

[0372] (1) The experiment was conducted using other VIPR1L proteins described in the present invention in addition to the VIPR1L protein shown in SEQ ID No. 1 instead of the VIPR1L protein shown in SEQ ID No. 1 used in Example 3 (so that the amount of the above other proteins is equivalent to the amount of the VIPR1L protein shown in SEQ ID No. 1 in Example 3).

[0373] (2) The experiment was conducted using the nucleotide sequence (DNA) shown in SEQ ID No. 2 or SEQ ID Nos. 192-217 or the nucleotide sequence (DNA) encoding the amino acids shown in any one of SEQ ID Nos. 32-191 instead of the VIPR1L protein shown in SEQ ID No. 1 used in Example 3 (so that the amount of the above DNA is equivalent to the amount of the VIPR1L protein shown in SEQ ID No. 1 in Example 3).

[0374] (3) The following biological preparations were used to replace the VIPR1L protein shown in SEQ ID No. 1 used in Example 3 (so that the amount of VIPR1L protein or DNA encoding VIPR1L protein in the biological preparation is equivalent to the amount of VIPR1L protein shown in SEQ ID No. 1 in Example 3), specifically:

[0375] A biological agent comprising the amino acid sequence shown in SEQ ID No. 6-191 (VIPR1L protein);

[0376] Alternatively, a biological agent comprising the nucleotide sequence (DNA) shown in SEQ ID No. 2 or SEQ ID Nos. 192-217, or a nucleotide sequence (DNA) encoding the amino acids shown in any one of SEQ ID Nos. 32-191;

[0377] Alternatively, a biological preparation comprising any one of the expression cassettes, recombinant vectors, recombinant microorganisms, cell lines, transgenic cell lines, transgenic plant tissues or transgenic plant organs described in items 3 to 6 of the Summary of the Invention section of this specification.

[0378] The experimental results of (1) to (3) above indicate that the use of the above-mentioned other proteins, DNA or biological agents has the same effect as the use of the VIPR1L protein shown in SEQ ID No. 1 described in Example 3 in promoting plant growth, improving plant salt resistance, disease resistance, drought resistance, increasing crop yield and quality, and preserving fruits and vegetables.

[0379] Some specific test examples are:

[0380] 1. The experimental results of the effect of VIPR1L protein treatment on wheat growth and drought resistance in wheat seeds as described in Item 3 of Example 3 are shown in the following table:

[0381]

[0382] 2. The experimental results of the effect of VIPR1L protein on corn germination described in Item 4 of Example 3 are shown in the following table

[0383]

[0384] 3. The experimental results of the effect on corn growth described in Item 5 of Example 3 are shown in the following table:

[0385]

[0386] 4. The results of the experiment on the effect on tomato growth described in Item 6 of Example 3 are shown in the following table:

[0387]

[0388] 5. The results of the tea tree yield increase experiment described in Item 7 of Example 3 are shown in the following table:

[0389]

[0390]

[0391] 6. The results of the blueberry preservation experiment described in Item 8 of Example 3 are shown in the following table:

[0392]

[0393] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

[0394] The contents not described in detail in this specification belong to the prior art known to those skilled in the art.

Claims

1. A VIPR1L protein, characterized in that include: (1) The amino acid sequence of the VIPR1L protein is shown in SEQ ID No. 1; (2) an amino acid sequence described in item (1) in which any substitution is made except for amino acids 50 to 114 and which has 75% or more identity with the amino acid sequence described in item (1); (3) an amino acid sequence described in item (1) in which any substitution is made except for amino acids 102 to 114 and which has 75% or more identity with the amino acid sequence described in item (1); (4) A polypeptide tag is connected to the N-terminus or C-terminus of the amino acid sequence of the VIPR1L protein described in any one of (1) to (3) above; The polypeptide tag comprises: Poly-Arg, which is an oligomer of Arg, and the number of Arg residues in the oligomer is 5-6; Poly-His, which is a His oligomer, the number of His residues in the oligomer is 2-10; FLAG, sequence: DYKDDDDK; Strep-tag II, sequence: WSHPQFEK; c-myc, the sequence is EQKLISEEDL.

2. A DNA, characterized in that: The sequence of the DNA comprises: (1) A nucleotide sequence as shown in SEQ ID No. 2, encoding the VIPR1L protein as described in item (1) of claim 1; (2) a nucleotide sequence encoding the VIPR1L protein described in item (2) of claim 1; (3) a nucleotide sequence encoding the VIPR1L protein as described in item (3) of claim 1; (4) A nucleotide sequence encoding the VIPR1L protein described in item (4) of claim 1.

3. An expression cassette, a recombinant vector, a VIPR1L gene-transfected cell line, a VIPR1L gene-transfected plant tissue or a VIPR1L gene-transfected plant organ containing the DNA of claim 2; The above-mentioned VIPR1L gene-transfected cell lines include: A transgenic microbial cell line, a transgenic animal cell line or a transgenic plant cell line in which the DNA of claim 2 is recombined into the genome; The above-mentioned VIPR1L gene-transformed plant tissue or VIPR1L gene-transformed plant organ refers to: a transgenic plant tissue or plant organ into which the DNA described in claim 2 is recombined into the genome.

4. A recombinant vector, cell line, VIPR1L gene-transforming cell line, VIPR1L gene-transforming plant tissue or VIPR1L gene-transforming plant organ containing the expression cassette of claim 3; The above cell lines include microbial cell lines, animal cell lines or plant cell lines; The above-mentioned VIPR1L gene-transfected cell lines include: A transgenic microbial cell line, a transgenic animal cell line or a transgenic plant cell line in which the DNA of claim 2 is recombined into the genome; The above-mentioned VIPR1L gene-transformed plant tissue or VIPR1L gene-transformed plant organ refers to: a transgenic plant tissue or plant organ into which the DNA described in claim 2 is recombined into the genome.

5. A cell line, a cell line transfected with the VIPR1L gene, a plant tissue transfected with the VIPR1L gene, or a plant organ transfected with the VIPR1L gene containing the recombinant vector according to claim 3; The above cell lines include microbial cell lines, animal cell lines or plant cell lines; The above-mentioned VIPR1L gene-transfected cell lines include: A transgenic microbial cell line, a transgenic animal cell line or a transgenic plant cell line in which the DNA of claim 2 is recombined into the genome; The above-mentioned VIPR1L gene-transformed plant tissue or VIPR1L gene-transformed plant organ refers to: a transgenic plant tissue or plant organ into which the DNA described in claim 2 is recombined into the genome.

6. A recombinant microorganism, a cell line transfected with VIPR1L gene, a plant tissue transfected with VIPR1L gene or a plant organ transfected with VIPR1L gene containing the recombinant vector according to claim 4; The above-mentioned transgenic cell line includes a VIPR1L gene-transfected microbial cell line, a VIPR1L gene-transfected animal cell line or a VIPR1L gene-transfected plant cell line; The above-mentioned VIPR1L gene-transformed plant tissue or VIPR1L gene-transformed plant organ refers to: a transgenic plant tissue or plant organ into which the DNA described in claim 2 is recombined into the genome.

7. A biological agent, characterized in that: (1) comprising the VIPR1L protein according to claim 1; (2) or comprising the DNA according to claim 2; (3) or comprising the expression cassette, recombinant vector, VIPR1L gene-transfected cell line, VIPR1L gene-transfected plant tissue or VIPR1L gene-transfected plant organ of claim 3; (4) or comprising the recombinant vector, recombinant microorganism, VIPR1L gene-transfected cell line, VIPR1L gene-transfected plant tissue or VIPR1L gene-transfected plant organ according to claim 4; (5) or comprising the recombinant microorganism, VIPR1L gene transgenic cell line, VIPR1L gene transgenic plant tissue or VIPR1L gene transgenic plant organ according to claim 5; (6) Or comprising the recombinant microorganism, VIPR1L gene transgenic cell line, VIPR1L gene transgenic plant tissue or VIPR1L gene transgenic plant organ according to claim 6.

8. A biological agent, characterized in that: The biological preparation is prepared by mixing the VIPR1L protein and the VDAL protein according to claim 1, and the mass ratio of the VIPR1L protein to the VDAL protein is 5-10:

8.

9. The use of a biological agent according to any one of claims 7 or 8, characterized in that: The biological agent can be used to promote plant growth, improve plant disease resistance, improve plant salt resistance, improve biological drought resistance, increase crop yield, improve crop quality, and preserve fruits and vegetables.

Citation Information

Patent Citations

  • Anti-verticillium wilt protein from sea island cotton as well as coding gene and application thereof

    CN104086636A

  • Anti-plant fungal disease protein GhGLP2 from cotton and its coding gene and application thereof

    CN108164589A

  • Gossypium hirsutum serine / threonine protein phosphatase GhTOPP6 as well as coding gene and application thereof

    CN112048490A

  • Application of GhLPL2 gene in improving disease resistance of cotton verticillium wilt

    CN116042697A

  • VIPR1L protein and application thereof in biopesticide and biological breeding

    CN118725061A