Methods and compositions for improving transplantation outcomes with human pluripotent stem cell-derived cardiomyocytes
By introducing IGF-1 modRNA into hPSC-CMs, the issue of early graft cell death is addressed, resulting in enhanced cardiomyocyte survival and proliferation, thereby improving transplantation outcomes.
Patent Information
- Application Number
- PCT/IB2024/062340
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-06
- Filing Date
- 2024-12-06
- Publication Date
- 2025-06-12
AI Technical Summary
Human pluripotent stem cell-derived cardiomyocytes (hPSC-CMs) face significant graft cell death within the first 4-5 days post-transplantation, limiting the size and functionality of intracardiac grafts.
Introducing a nucleic acid encoding insulin-like growth factor 1 (IGF-1), specifically a chemically-modified mRNA (modRNA), into hPSC-CMs to enhance cardiomyocyte survival and proliferation.
The expression of IGF-1 modRNA in hPSC-CMs increases cardiomyocyte proliferation and enhances survival during ischemic challenge, providing a more durable cytoprotective effect compared to recombinant IGF-1 ligand treatment.
Smart Images

Figure IB2024062340_12062025_PF_FP_ABST
Abstract
Description
[0001] METHODS AND COMPOSITIONS FOR IMPROVING
[0002] TRANSPLANTATION OUTCOMES WITH HUMAN
[0003] PLURIPOTENT STEM CELL-DERIVED
[0004] CARDIOMYOCYTES
[0005] CROSS-REFERENCE TO RELATED APPLICATIONS
[0006] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 606,889, filed December 6, 2023. The disclosure of the prior application is considered part of the disclosure of this application, and is incorporated in its entirety into this application.
[0007] TECHNICAL FIELD
[0008] This disclosure generally relates to methods and compositions for improving transplantation outcomes when using human pluripotent stem cell-derived cardiomyocytes.
[0009] BACKGROUND
[0010] Human pluripotent stem cell-derived cardiomyocytes (hPSC-CMs) show considerable promise for regenerating injured hearts, but transplantation outcomes are limited by graft cell death. The vast majority of graft cardiomyocytes are known to die within the first 4-5 days post-transplantation, and this phenomenon greatly limits the size and functionality of intracardiac hPSC-CM grafts. Graft cell death can be attenuated somewhat by previously reported interventions including transient heat-shock prior to transplantation, but there is considerable room for improvement. Even large doses of optimally delivered and heat- shocked hPSC-CMs typically re-muscularize only about 10-20% of the infarct zone.
[0011] Improved methods of cell therapy, particularly with respect to hPSC-CMs, are desirable. SUMMARY
[0012] This disclosure describes methods and compositions for improving transplantation outcomes when using human pluripotent stem cell-derived cardiomyocytes.
[0013] In one aspect, methods of expressing IGF-1 in a population of pluripotent stem cells (PSCs)-derived cardiomyocytes are provided. Such methods generally include introducing a nucleic acid encoding IGF-1 into the population of PSC-derived cardiomyocytes.
[0014] In some embodiments, the nucleic acid encoding IGF-1 comprises a modRNA sequence. In some embodiments, the nucleic acid encoding IGF-1 is a circular RNA. In some embodiments, the modRNA sequence is circularized.
[0015] In some embodiments, the nucleic acid encoding IGF-1 has at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity) to the sequence shown in SEQ ID NO: 1. In some embodiments, the nucleic acid encoding IGF- 1 is a nucleic acid encoding IGF-1 A.
[0016] In some embodiments, about 25% to about 35% of the PSC-derived cardiomyocytes comprise the nucleic acid encoding IGF-1.
[0017] In another aspect, methods of enhancing cardiomyocyte survival are provided. Such methods generally include the steps of introducing an IGF-1 modRNA into cardiomyocytes in culture, thereby enhancing cardiomyocyte survival.
[0018] In some embodiments, the method is performed in vivo. In some embodiments, the method further comprises transplanting the population of cardiomyocytes comprising the modRNA nucleic acid encoding IGF-1 into a subject.
[0019] In some embodiments, about 25% to about 35% of the population of cardiomyocytes comprises the modRNA nucleic acid encoding IGF-1.
[0020] In still another aspect, methods of enhancing cardiomyocyte survival are provided. Such methods generally include the steps of providing a population of cardiomyocytes that comprises a modRNA nucleic acid encoding IGF-1, thereby enhancing cardiomyocyte survival.
[0021] In some embodiments, the population of cardiomyocytes is a population of cardiomyocytes generated from pluripotent stem cells (PSCs).
[0022] In some embodiments, the population of cardiomyocytes comprising the modRNA nucleic acid encoding IGF-1 are transplanted into a subject. In some embodiments, the method further comprises transplanting the population of cardiomyocytes comprising the modRNA nucleic acid encoding IGF-1 into a subject.
[0023] In some embodiments, about 30% of the population of cardiomyocytes comprises the modRNA nucleic acid encoding IGF-1.
[0024] In yet another aspect, a population of cardiomyocytes is provided, wherein about 25% to about 35% of the cardiomyocyte cells in the population of cardiomyocytes includes a modRNA nucleic acid sequence encoding IGF-1.
[0025] In some embodiments, about 30% of the population of cardiomyocytes comprises the modRNA nucleic acid encoding IGF-1. In some embodiments, the population of cardiomyocytes is a population of pluripotent stem cells (PSCs)-derived cardiomyocytes.
[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the methods and compositions of matter belong. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the methods and compositions of matter, suitable methods and materials are described below. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.
[0027] DESCRIPTION OF DRAWINGS
[0028] FIG. 1. Schematic showing that human pluripotent stem cells (hPSCs) were aggregated and differentiated into hPSC-CMs using a growth factor protocol. hPSC-CMs were then re-plated on day 16. Commercially prepared IGF-1 modRNA or ligand was added to hPSC-CMs as indicated.
[0029] FIG. 2A. Schematic of experiments to evaluate IGF-1 secretion from IGF-1- modRNA-transfected hPSC-CMs.
[0030] FIG 2B. Quantification of IGF-1 secretion from modRNA-transfected versus control hPSC-CMs (n=3). ****p<0.0001.
[0031] FIG. 3A. Schematic for assessing hPSC-CM proliferation via EdU incorporation in modRNA-transfected versus control cells. FIG. 3B. Representative photomicrographs of EdU+ and DAPI+ hPSC-CMs in each experimental condition.
[0032] FIG. 3C. % of EdU+ nuclei in control, IGF-1 ligand, and IGF-1 modRNA treated hPSC-CM cultures (n=3). **p<0.01, ****p<0.0001.
[0033] FIG. 4A. Schematic of the experiments performed to evaluate hPSC-CM proliferation via cell counts and Ki67 flow cytometry.
[0034] FIG. 4B. Cell counts over time in hPSC-CM cultures treated with control vehicle, IGF-1 ligand, or IGF-1 modRNA. (n=3). #p<0.05, ####p<0.0001 between control (standard hPSC-CM culture) and hPSC-CMs with 100 ng / mL IGF-1 ligand; ****p<0.0001 between control and hPSC-CMs transfected with 150 ng / mL IGF-1 modRNA.
[0035] FIG. 4C. Representative flow cytometry plots for hPSC-CMs stained for cardiac troponin T+(cTnT+) and the proliferation marker Ki67+.
[0036] FIG. 4D. % of cTnT and Ki67 double-positive cells by condition (n=3). *p<0.001, ***p<0.001, ****p<0.0001.
[0037] FIG. 5A. Schematic of experiments performed to determine the percentage of hPSC- CMs that need to be transfected with IGF-1 modRNA to exert the beneficial effect on proliferation.
[0038] FIG. 5B. Representative photomicrographs of hPSC-CM cultures comprised of 10%, 30%, and 100% modRNA transfected cells. The depicted cultures were fixed after a 48-hour EdU pulse and stained for a-actinin and EdU.
[0039] FIG. 5C. %EdU+a-actinin+ cells at varying ratios of transfected to non-transfected cells. (n=3) *p<0.05, **p<0.001, ***p<0.0001.
[0040] FIG. 6A. Schematic for in vitro ischemic challenge of hPSC-CMs with and without IGF-1 pre-treatment. For ischemic challenge, cultures were exposed to hypoxia (1% O2) and ischemic buffer (pH 6.4, low lactate).
[0041] FIG. 6B. Photomicrographs of representative hPSC-CM cultures stained for live (green) vs dead (red) cells.
[0042] FIG. 6C. % viability by condition. (n=3) ####p<0.0001 between hPSC-CMs without pre-treatment and hPSC-CMs with lOOng / mL IGF-1 ligand pre-treatment after ischemic challenge; ****p<0.0001 between hPSC-CMs without pre-treatment and hPSC-CMs with 150ng / mL IGF-1 modRNA after ischemic challenge. DETAILED DESCRIPTION
[0043] Human pluripotent stem cells (hPSC-CMs) represent an essentially unlimited source of cardiomyocytes to replace muscle lost following myocardial infarction (MI). hPSC-CMs stably engraft in small and large animal MI models, but outcomes are limited by substantial graft cell death within the first four to five days post-transplantation. In addition, any benefits imparted by cytoprotective agents on graft cells typically subside rapidly due to metabolism or diffusion post-transplantation.
[0044] As demonstrated herein, introducing a nucleic acid, specifically a chemically- modified mRNA (modRNA), encoding for insulin-like growth factor 1 (IGF-1) into hPSC- CMs facilitates translation of IGF-1 for several days after transplantation of the IGF-1- modRNA-containing cells into a subject and, therefore, provides methods for enhancing cardiomyocyte survival post-transplantation. This disclosure establishes that the expression of IGF-1 modRNA in hPSC-CMs is a translationally viable approach. In preliminary studies, we have confirmed that IGF-1 modRNA treatment increases hPSC-CM proliferation and enhances hPSC-CM survival during ischemic challenge. The magnitude of these effects is at least comparable to those achieved by treatment with the recombinant IGF-1 ligand but are significantly longer-lasting, particularly when using a circularized modRNA.
[0045] It would be understood that a nucleic acid encoding IGF-1 (e.g., a modRNA nucleic acid encoding IGF-1) can be introduced into cells (e.g., hPSC-CMs) using any number of methods including, for example, liposomes, nanoparticles, viral vectors (e.g., adenovirus, adeno-associated virus, lentiviral), electroporation, biolistic, and other methods known in the art.
[0046] A representative IGF-1 sequence is shown in SEQ ID NO:1 (GenBank Accession No. NM_001111283.3). Additional IGF-1 sequences are available. See, for example, NM_001111284.2; NM_001111285.3; NM_000618.5; NM_001414005.1;
[0047] NM_001414006.1; and NM_001414007.1. atgggaaaaatcagcagtcttccaacccattatttaagtgctgcttttgtgatttcttgaag gtgaagatgcacacatgtcctcctcgcatctcttctacctggcctgtgcctgctcaccttca ccagctctgccacggctggacggagacgctctgcggggctgagctggtgatgctcttcagtt cgtgtgtggagacaggggttttatttcaacaagcccacagggtatggctccagcagtcggag ggcgcctcagacaggatcgtggatgagtgctgcttccggagctgtgatctaaggaggctgga gatgtattgcgccccctcaagcctgccaagtcagctcgctctgtccgtgcccagcgccacac cgacatgccaagacccagaaggaagtacatttgaagaacgcaagtagagggagtgcaggaaa caagaactacaggatgtag (SEQ ID NO: 1)
[0048] The methods and compositions described herein should not be limited to SEQ ID NO: 1 ; SEQ ID NO: 1 is a representative IGF-1 sequence. It would be understood that any IGF-1 sequence, or portion thereof, that enhances cardiomyocyte survival posttransplantation can be used in the methods and compositions described herein. In some instances, a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity) to SEQ ID NO:1 can be used in the methods and compositions described herein, provided the sequence encodes an IGF-1 that enhances cardiomyocyte survival post-transplantation.
[0049] In calculating percent sequence identity, two sequences are aligned and the number of identical matches of nucleotides or amino acid residues between the two sequences is determined. The number of identical matches is divided by the length of the aligned region (i.e., the number of aligned nucleotides or amino acid residues) and multiplied by 100 to arrive at a percent sequence identity value. It will be appreciated that the length of the aligned region can be a portion of one or both sequences up to the full-length size of the shortest sequence. It also will be appreciated that a single sequence can align with more than one other sequence and hence, can have different percent sequence identity values over each aligned region.
[0050] The alignment of two or more sequences to determine percent sequence identity can be performed using the algorithm described by Altschul et al. (1997, Nucleic Acids Res., 25:3389 3402) as incorporated into BLAST (Basic Local Alignment Search Tool) programs, available at ncbi.nlm.nih.gov on the World Wide Web. BLASTN is the program used to align and compare the identity between nucleic acid sequences, while BLASTP is the program used to align and compare the identity between amino acid sequences. When utilizing BLAST programs to calculate the percent identity between a sequence and another sequence, the default parameters of the respective programs generally are used.
[0051] To avoid systemic effects of IGF-1 signaling as well as any sustained increase in hPSC-CM proliferation, it would be appreciated that the IGF-1 ligand signal can be limited to the graft tissue and applied only during the critical window of graft cell death that occurs immediately surrounding delivery and in the first few days after transplantation. For example, transient expression of IGF- 1 by the graft cells themselves likely is the most efficient approach, but biomaterial-based delivery strategies can be adopted to achieve temporally and spatially controlled IGF- 1 signaling (e.g., co-delivery of hPSC-CMS with IGF- 1 -eluting microspheres). An IGF-1 expression cassette designed to allow temporal control to turn off IGF-1 expression at later time-points also can be generated.
[0052] A population of hPSC-CMs can be provided that expresses IGF-1 modRNA. The involved hPSC-CMs can be manufactured via any of a number of established guided differentiation protocols, and there are different modRNA chemistries that are compatible with hPSC-CM transfection. Moreover, as described herein, only a subset of the hPSC-CM population needs to express IGF-1 modRNA to mediate salutary effects (e.g., about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of cells). Surprisingly, about 30% (e.g., about 25% to about 35%) of hPSC-CM expressing IGF-1 modRNA actually mediated greater mitogenic effects than 100% of hPSC-CM expressing IGF-1 modRNA.
[0053] Notably, cells expressing IGF-1 modRNA provided a more durable cytoprotective effect, with hPSC-CMs expressing IGF-1 modRNA showing a 2.2-fold increase in viability during ischemic challenge at 5 days post-treatment compared to controls. Both IGF-1 ligand and modRNA expression enhanced hPSC-CM proliferation as assessed by flow cytometry for Ki67, EdU incorporation, and cell counts; but, again, the mitogenic effect persisted longer in the presence of the IGF-1 modRNA than with the IGF-1 ligand.
[0054] Cells expressing IGF-1 modRNA can be transplanted into a subject. Cells expressing IGF-1 modRNA can be formulated in a suitable manner to include, without limitation, one or more solvents, excipients, compounds that modify viscosity and / or pH, and / or other types of cells (e.g., cardiac, endothelial).
[0055] In accordance with the present invention, there may be employed molecular biology, microbiology, biochemical, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. The invention will be further described in the following examples, which do not limit the scope of the methods and compositions of matter described in the claims. EXAMPLES
[0056] 1 — Materials and Methods
[0057] Human pluripotent stem cells (hPSCs) were aggregated and differentiated into hPSC- CMs using growth factor protocol (Kattman et al., 2011, Cell Stem Cell., 8(2):228-40). hPSC-CMs were then re-plated on day 16. Commercially prepared IGF-1 modRNA (TriLink) or IGF-1 ligand (recombinant IGF-1; R&D Systems) was added to hPSC-CMs as indicated. See FIG. 1. Isoform lEa of IGF-1 (“IGF-lEa” or “IGF-1 A”) was used in these experiments.
[0058] During preliminary in vitro experiments, hPSC-CMs were treated with 0.15 pg / mL IGF-1 modRNA, delivered with Lipof ectamine Stem transfection reagent. The IGF-1 modRNA was synthesized by the commercial vendor TriLink, and all uridines were substituted with N1 -methylpseudouridine.
[0059] Example 2 — Peak IGF-1 Secretion Observed in First 12 Hours
[0060] Experiments were performed to evaluate IGF-1 secretion from IGF-1 modRNA- transfected hPSC-CMs and compared to control cells lacking the IGF-1 modRNA. See FIG. 2A for a description of the experimental timeline. IGF-1 secretion from cells was quantified over 96 hours (see FIG. 2B). These data demonstrated that IGF-1 secretion with this particular modRNA formulation was sustained at high levels for as long as 24 hours, with peak IGF-1 secretion observed within the initial 12 hours.
[0061] Example 3 — hPSC-CM Proliferation Increased in the Presence of IGF-1
[0062] To examine cellular replication as a marker for cellular activity, IGF-1 modRNA was transfected into hPSC-CMs, and cells were grown in the presence of 5-ethynyl-2’- deoxyuridine (EdU). See FIG. 3A for a description of the experimental timeline. As shown in FIG. 3A, EdU was fed to cells starting at 24 hours, and cells were fixed and evaluated for EdU incorporation at 48 hrs and 96 hrs.
[0063] FIG. 3B shows several representative photomicrographs of DAPI+-stained hPSC- CMs at 48 or 96 hrs following exposure to EdU only (control), the IGF-1 ligand (100 ng / ml) or the IGF-1 modRNA (150 ng / ml). The data from these experiments was quantitated, and the results are shown in FIG. 3C. Notably, the IGF-1 modRNA-treated cells incorporated significantly more EdU than cells exposed to any of the other treatments, particularly at 96 hrs.
[0064] Example 4 — IGF- 1 modRNA Increases hPSC-CM Proliferation
[0065] Proliferation of hPSC-CMs transfected with an IGF-1 modRNA was examined at 48 hrs by counting cells and evaluating the cells for the presence of the Ki67 proliferation biomarker. A schematic of the experimental timeline for these experiments is shown in FIG. 4A.
[0066] Cells were counted over time in hPSC-CM cultures treated with the control vehicle, the IGF-1 ligand, or the IGF-1 modRNA. The graph in FIG. 4B shows that statistically significant increases in the number of hPSC-CMs transfected with 150 ng / mL IGF-1 modRNA was observed at 48 hrs and 96 hrs. FIG. 4C show representative flow cytometry plots for hPSC-CMs stained for cTnT and Ki67.
[0067] In addition, the percentage of cardiomyocyte marker, cardiac troponin T+ (cTnT+) and Ki67 double-positive cells were determined following treatment with the control vehicle, the IGF-1 ligand, or the IGF-1 modRNA. Results of these experiments are shown in FIG. 4D, and, again, demonstrated a statistically significant increase in the percentage of cTnT / Ki67 hPSC-CMs transfected with 150 ng / mL IGF-1 modRNA.
[0068] Example 5 — Transfection of a Subset of hPSC-CMs Required for Proliferation
[0069] Mixing experiments were performed to determine the fraction of IGF-1 modRNA transfected hPSC-CMs required for the beneficial effects that are described herein. FIG. 5A shows a schematic for these experiments. modRNA-transfected and non-transfected hPSC- CMs were mixed at various ratios and then subjected to EdU pulses to screen for effects on proliferation (measured by EdU incorporation).
[0070] FIG. 5B shows representative photomicrographs of hPSC-CM cultures that include 0%, 10%, 30%, and 100% modRNA-transfected hPSC-CMs. Each of the cultures were fixed after a 48-hour EdU pulse and stained for alpha-actinin and EdU. FIG. 5C is a graphical presentation of this data, which demonstrates that a statistically significant increase in cells that are positive for both EdU and a-actinin at 48 hrs was observed in the presence of only 30% of transfected cells. In other words, transfection of 100% of hPSC-CMs with IGF-1 is not required to achieve the benefits to hPSC-CMs as described herein.
[0071] Example 6 — IGF- 1 modRNA is Cytoprotective During In Vitro Ischemic Challenge
[0072] Experiments were performed to evaluate the response of hPSC-CMs to in vitro ischemic challenge in the presence or absence of IGF-1 pre-treatment. FIG. 6A shows a schematic timeline of these experiments. For ischemic challenge, cell cultures were exposed to hypoxia (1% O2) and ischemic buffer (pH 6.4, low lactate).
[0073] FIG. 6B shows photomicrographs of representative hPSC-CM cultures stained for live (green) vs dead (red) cells under control conditions (i.e., no ischemia and no IGF-1) or under ischemic conditions in the presence of no treatment, 100 ng / mL IGF-1 ligand or 150 ng / mL IGF-1 modRNA. FIG. 6C is a graphical representation of the results of these experiments, demonstrating statistically significant differences between hPSC-CMs without pre-treatment and hPSC-CMs with 100 ng / mL IGF-1 ligand pre-treatment after ischemic challenge and between hPSC-CMs without pre-treatment and hPSC-CMs with 150 ng / mL IGF-1 modRNA after ischemic challenge.
[0074] Example 7 — Additional Experiments Using Circular modRNA
[0075] The experiments described above in Examples 1-6 are repeated using a circular modRNA. Briefly, human pluripotent stem cells (hPSCs) are aggregated and differentiated into hPSC-CMs using growth factor protocol (Kattman et al., 2011, Cell Stem Cell., 8(2):228-40). hPSC-CMs are then re-plated on day 16. Commercially prepared IGF-1 modRNA (TriLink) that has been circularized (circ-modRNA) or IGF-1 ligand (recombinant IGF-1; R&D Systems) is added to hPSC-CMs as indicated.
[0076] During preliminary in vitro experiments, hPSC-CMs are treated with 0.15 gg / mL IGF-1 circ-modRNA (isoform lEa), delivered with Lipofectamine Stem transfection reagent. The IGF-1 circ-modRNA is synthesized by the commercial vendor TriLink, and all uridines are substituted with N1 -methylpseudouridine.
[0077] Experiments are performed to evaluate IGF-1 secretion from IGF-1 circ-modRNA- transfected hPSC-CMs and compared to control cells lacking the IGF-1 circ-modRNA. IGF- 1 secretion from cells is quantified over 96 hours. These experiments demonstrate that IGF-1 secretion with this particular circ-modRNA formulation is sustained at high levels for longer than as 24 hours, with peak IGF-1 secretion observed within the initial 12-18 hours.
[0078] To examine cellular replication as a marker for cellular activity, IGF-1 circ-modRNA is transfected into hPSC-CMs, and cells are grown in the presence of 5-ethynyl-2’- deoxyuridine (EdU). EdU is fed to cells starting at 24 hours, and cells are fixed and evaluated for EdU incorporation at 48 hrs and 96 hrs. Notably, the IGF-1 circ-modRNA- treated cells incorporate significantly more EdU than cells exposed to any of the other treatments, at both 48 hrs and 96 hrs.
[0079] Proliferation of hPSC-CMs transfected with an IGF-1 circ-modRNA is examined at 48 hrs by counting cells and evaluating the cells for the presence of the Ki67 proliferation biomarker. Cells are counted over time in hPSC-CM cultures treated with the control vehicle, the IGF-1 ligand, or the IGF-1 circ-modRNA. Statistically significant increases in the number of hPSC-CMs transfected with 150 ng / mL IGF-1 circ-modRNA is observed at 48 hrs and 96 hrs.
[0080] In addition, the percentage of cardiomyocyte marker, cardiac troponin T+ (cTnT+) and Ki67 double-positive cells are determined following treatment with the control vehicle, the IGF-1 ligand, or the IGF-1 circ-modRNA. Results of these experiments demonstrate a statistically significant increase in the percentage of cTnT / Ki67 hPSC-CMs transfected with 150 ng / mL IGF-1 circ-modRNA.
[0081] Experiments are performed to evaluate the response of hPSC-CMs to in vitro ischemic challenge in the presence or absence of IGF-1 pre-treatment. For ischemic challenge, cell cultures are exposed to hypoxia (1% O2) and ischemic buffer (pH 6.4, low lactate). Statistically significant differences are observed between hPSC-CMs without pretreatment and hPSC-CMs with 100 ng / mL IGF-1 ligand pre-treatment after ischemic challenge and between hPSC-CMs without pre-treatment and hPSC-CMs with 150 ng / mL IGF-1 circ-modRNA after ischemic challenge.
[0082] The experiments described above in Examples 1-6 using IGF-1 A isotype are repeated using the other two isotypes, IGF-lEb (“IGF-1B”) or IGF-lEc (“IGF-1C”). Briefly, human pluripotent stem cells (hPSCs) are aggregated and differentiated into hPSC-CMs using growth factor protocol (Kattman et al., 2011, Cell Stem Cell., 8(2):228-40). hPSC-CMs are then re-plated on day 16. Commercially prepared IGF-lEb modRNA and IGF-lEc modRNA, in either the circularized and linear form (TriLink), or IGF-1 ligand (recombinant IGF-1 ; R&D Systems) is added to hPSC-CMs as indicated.
[0083] During preliminary in vitro experiments, hPSC-CMs are treated with 0.15 pg / mL IGF-1 modRNA (each isoform, IB and 1C, in circularized or linear form), delivered with Lipof ectamine Stem transfection reagent. The IGF-1 modRNAs are synthesized by the commercial vendor TriLink, and all uridines are substituted with N1 -methylpseudouridine.
[0084] Experiments are performed to evaluate IGF-1 secretion from IGF-1 modRNA- transfected hPSC-CMs and compared to control cells lacking the IGF-1 modRNA. IGF-1 secretion from cells was quantified over 96 hours. These experiments demonstrated that IGF- 1 secretion with IGF-1B or IGF-1C modRNA formulation, linear or circularized, was sustained at high levels for as long as 24 hours, with peak IGF-1 secretion observed within the initial 12 hours.
[0085] To examine cellular replication as a marker for cellular activity, IGF-1 modRNA is transfected into hPSC-CMs, and cells are grown in the presence of 5-ethynyl-2’-deoxyuridine (EdU). EdU is fed to cells starting at 24 hours, and cells are fixed and evaluated for EdU incorporation at 48 hrs and 96 hrs. Notably, the IGF-1B and the IGF-1 C modRNA-treated cells, either linear or circularized, incorporate significantly more EdU than cells exposed to any of the other treatments, particularly at 96 hrs.
[0086] Proliferation of hPSC-CMs transfected with IGF-1 modRNA is examined at 48 hrs by counting cells and evaluating the cells for the presence of the Ki67 proliferation biomarker. Cells are counted over time in hPSC-CM cultures treated with the control vehicle, the IGF-1 ligand, or the IGF- IB or IGF-1C modRNAs, circularized or linear. Statistically significant increases in the number of hPSC-CMs transfected with 150 ng / mL IGF- IB or IGF-1C modRNA, either circularized or linear, is observed at 48 hrs and 96 hrs.
[0087] In addition, the percentage of cardiomyocyte marker, cardiac troponin T+ (cTnT+) and Ki67 double-positive cells are determined following treatment with the control vehicle, the IGF-1 ligand, or the IGF- IB or IGF-1C modRNA, circularized or linear. Results demonstrate a statistically significant increase in the percentage of cTnT / Ki67 hPSC-CMs transfected with 150 ng / mL IGF-1B or IGF-1C modRNA, circularized or linear. Experiments are performed to evaluate the response of hPSC-CMs to in vitro ischemic challenge in the presence or absence of IGF- 1 pre-treatment. For ischemic challenge, cell cultures are exposed to hypoxia (1% O2) and ischemic buffer (pH 6.4, low lactate). The results of these experiments demonstrate statistically significant differences between hPSC-CMs without pre-treatment and hPSC-CMs with 100 ng / mL IGF-1 ligand pre-treatment after ischemic challenge and between hPSC-CMs without pre-treatment and hPSC-CMs with 150 ng / mL IGF-1B or IGF-1C modRNA, circularized or linear, after ischemic challenge.
[0088] The guinea pig MI model is used to compare histological graft outcomes after the delivery of control vs. eGFP modRNA vs. IGF-1 modRNA hPSC-CMs (1x108cells per heart). IGF-1 modRNA hPSC-CMs include hPSC-CMs transfected with one of the three isotypes (IGF-1 A, IGF-1B and IGF-1C) in either circularized or linear form (i.e., IGF-1 A modRNA; IGF-1 A circ-modRNA; IGF- IB modRNA; IGF- IB circ-modRNA; IGF-1C modRNA; or IGF-1 C circ-modRNA). Recipient hearts are harvested at 4 days and 14 days post-transplantation (n=3 and 6 animals per condition, respectively).
[0089] Again, because IGF-1 is a secreted factor, only a small fraction of transfected cells is required to achieve a meaningful paracrine signaling within the graft tissue, so modRNA and transfection time and cost is minimized by using the smallest ratio proving effective.
[0090] The primary endpoint is graft size determined by histomorphometry at 14-days posttransplantation, but other relevant parameters are examined including graft composition (immunohistochemistry for cardiomyocyte and non-myocyte markers), graft cell proliferation (by detecting the Ki67 marker, phospho-histone H3, or EdU incorporation), graft cell death (by detecting caspase-3) and IGF-1 and eGFP expression (using immunohistochemistry). A significant increase in ultimate graft size at 14 days is observed, but earlier timepoints also are examined in a subset of animals, as IGF-1 expression occurs and differences in graft cell proliferation and cytoprotection are detected. Example 10 — Conclusions
[0091] The experiments described herein demonstrated that pre-treatment with recombinant IGF-1 ligand improved the viability of hPSC-CMs during in vitro ischemic challenge by 1.4- fold at 2 days post-treatment, but this improvement was lost by 5 days. In contrast, IGF-1 modRNA showed a more durable cytoprotective effect, as hPSC-CMs pretreated with IGF-1 modRNA, irrespective of IGF-1 isotype (A, B or C) or structure (circularized or linear), maintained at least a 1.3-fold improvement at 5 days post-treatment.
[0092] Both IGF-1 ligand and IGF-1 modRNA enhanced hPSC-CM proliferation as assessed by flow cytometry for Ki67, EdU incorporation, and cell counts. As with the pro-survival effects, increased proliferation persisted longer with IGF-1 modRNA pre-treated cells, irrespective of IGF-1 isotype (A, B or C) or structure (circularized or linear), than with IGF-1 ligand.
[0093] Therefore, pre-treatment of hPSC-CM with IGF-1 modRNA enhances proliferation in vitro, promotes hPSC-CM survival during in vitro ischemic challenge, and is a potential strategy to improve hPSC-CM engraftment and subsequent outcomes in vivo.
[0094] It is to be understood that, while the methods and compositions of matter have been described herein in conjunction with a number of different aspects, the foregoing description of the various aspects is intended to illustrate and not limit the scope of the methods and compositions of matter. Other aspects, advantages, and modifications are within the scope of the following claims.
[0095] Disclosed are methods and compositions that can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed methods and compositions. These and other materials are disclosed herein, and it is understood that combinations, subsets, interactions, groups, etc. of these methods and compositions are disclosed. That is, while specific reference to each various individual and collective combinations and permutations of these compositions and methods may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular composition of matter or a particular method is disclosed and discussed and a number of compositions or methods are discussed, each and every combination and permutation of the compositions and the methods are specifically contemplated unless specifically indicated to the contrary. Likewise, any subset or combination of these is also specifically contemplated and disclosed.
Claims
WHAT IS CLAIMED IS:
1. A method of expressing IGF-1 in a population of pluripotent stem cells (PSCs)-derived cardiomyocytes, comprising: introducing a nucleic acid encoding IGF-1 into the population of PSC-derived cardiomyocytes.
2. The method of claim 1, wherein the nucleic acid encoding IGF-1 comprises a modRNA sequence.
3. The method of claim 1 or 2, wherein the nucleic acid encoding IGF-1 is a circular RNA.
4. The method of any one of claims 1 or 2, wherein the modRNA sequence is circularized.
5. The method of any of the preceding claims, wherein the nucleic acid encoding IGF-1 has at least 80% sequence identity to the sequence shown in SEQ ID NO: 1.
6. The method of any of the preceding claims, wherein the nucleic acid encoding IGF-1 has at least 90% sequence identity to the sequence shown in SEQ ID NO: 1.
7. The method of any of the preceding claims, wherein the nucleic acid encoding IGF-1 is a nucleic acid encoding IGF-1 A.
8. The method of any of the preceding claims, wherein about 25% to about 35% of the PSC-derived cardiomyocytes comprise the nucleic acid encoding IGF-1.
9. A method of enhancing cardiomyocyte survival, comprising the steps of: introducing an IGF-1 modRNA into cardiomyocytes in culture,thereby enhancing cardiomyocyte survival.
10. The method of claim 9, wherein the method is performed in vivo.
11. The method of claim 9, further comprising: transplanting the population of cardiomyocytes comprising the modRNA nucleic acid encoding IGF-1 into a subject.
12. The method of any one of claims 9 to 11, wherein about 25% to about 35% of the population of cardiomyocytes comprises the modRNA nucleic acid encoding IGF-1.
13. A method of enhancing cardiomyocyte survival, comprising the steps of: providing a population of cardiomyocytes that comprises a modRNA nucleic acid encoding IGF-1, thereby enhancing cardiomyocyte survival.
14. The method of claim 13, wherein the population of cardiomyocytes is a population of cardiomyocytes generated from pluripotent stem cells (PSCs).
15. The method of claim 13 or 14, wherein the population of cardiomyocytes comprising the modRNA nucleic acid encoding IGF-1 are transplanted into a subject.
16. The method of claim 13 or 14, further comprising: transplanting the population of cardiomyocytes comprising the modRNA nucleic acid encoding IGF-1 into a subject.
17. The method of any one of claims 13 to 16, wherein about 30% of the population of cardiomyocytes comprises the modRNA nucleic acid encoding IGF-1.
18. A population of cardiomyocytes, wherein about 25% to about 35% of the cardiomyocyte cells in the population of cardiomyocytes comprises a modRNA nucleic acid sequence encoding IGF-1.
19. The population of cardiomyocytes of claim 18, wherein about 30% of the population of cardiomyocytes comprises the modRNA nucleic acid encoding IGF-1.
20. The population of cardiomyocytes of claim 18 or 19, wherein the population of cardiomyocytes is a population of pluripotent stem cells (PSCs)-derived cardiomyocytes.