Cadherin 6 expression status in determination of renal fibrosis and related uses thereof

Abstract

After acute kidney injury (AKI), the injured proximal tubular epithelial cells activate Sox9 to restore themselves. We have identified a dynamic Sox9 switch. The lineages that regenerated the epithelia silenced Sox9 and healed without fibrosis (Sox9on-off). In contrast, the unrestored descendants maintained Sox9 activity in an attempt to regenerate and attained unique nephron progenitor-like programs, demarcated by Sox9-induced Cadherin 6 (Sox9on-on Cdh6pos) cell state. This cell state generated single-cell Wnt activity that provoked a fibroproliferative response in adjacent fibroblasts to drive AKI to chronic kidney disease. Human kidney transplants displayed similar dynamic SOX9 / CDH6 / WNT2B responses associated with fibrosis at single-cell level. Hence a Sox9 switch to the Sox9on-on Cdh6pos cell state tightly links fibrosis to the duration of regeneration responses after injury. Uses of relevant cell state detection are provided for monitoring and providing treatment guidepost in renal disorder or transplantation.

Description

CADHERIN 6 EXPRESSION STATUS IN DETERMINATION OF RENAL FIBROSIS AND RELATED USES THEREOF CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application includes a claim of priority under 35 U.S.C. §119(e) to U.S. provisional patent application No.63 / 605,777, filed December 4, 2023, the entirety of which is hereby incorporated by reference. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made with Government support under grant no. DK118265 awarded by the National Institutes of Health. The Government has certain rights in the invention. REFERENCE TO SEQUENCE LISTING

[0003] This application contains a Sequence Listing submitted as a computer readable form named “065472_000904WOPT_SequenceListing.xml”, having a size in bytes of 36,375 bytes, and created on December 3, 2024. The information contained in this computer readable form is hereby incorporated by reference in its entirety. FIELD OF INVENTION

[0004] This invention relates to the use of cadherin 6 as an epithelial cell surface marker, as well as a urinary or plasma marker, for indicating organ fibrosis, especially renal fibrosis, and for guiding selection or assessing efficacy of therapies against fibrotic processes. BACKGROUND

[0005] All publications herein are incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. The following description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication specifically or implicitly referenced is prior art.

[0006] Depending upon the nature and severity of the initial injury, damaged-tissue microenvironment of adult mammalian organs can demonstrate progressive scar tissue formation, while other foci can heal with no obvious scarring. This spatial heterogeneity in interstitial fibrosis seen across diverse organ systems is also frequently observed during progression of acute kidney injury (AKI) to chronic kidney disease (CKD). AKI, defined by abrupt decline in kidney function according to acute kidney injury network (AKIN) criteria 4866-7185-2533.5 Page 1 of 53065472-000904WOPT(www.uptodate.com / contents / image?imageKey=NEPH%2F83168), is often due to acute proximal tubular epithelial cell (PTEC) injury with selective damage per se able to drive interstitial fibrosis. Failed tubule recovery has been broadly linked with post-AKI fibrosis; however, the precise mechanisms that determine why one focus progressively scars, while other initially injured foci, which might only be a few cell-distances away, can result healing devoid of fibrosis have remained elusive.

[0007] It is an object of the present invention to provide methods for identifying, assessing, and / or monitoring the presence or progression of interstitial fibrosis, especially for patients with solid organ transplantation or having had organ injuries.

[0008] It is another object of the present invention to provide methods for assessing the risk of developing organ fibrosis in a patient undertaking medicines post organ injury or post organ transplantation, so as to determine a continued course of medication or cessation of medication. SUMMARY OF THE INVENTION

[0009] The following embodiments and aspects thereof are described and illustrated in conjunction with compositions and methods which are meant to be exemplary and illustrative, not limiting in scope.

[0010] Methods are provided for assaying a biological sample, wherein the biological sample is obtained from a subject having received transplantation of a kidney allograft or having had an acute kidney injury (AKI), and optionally the subject being suspected of or desiring a determination regarding presence of a fibrotic kidney disease or a chronic kidney disease (CKD). In various embodiments, the methods include detecting a cadherin-6 (CDH6) level, a wingless-type MMTV integration site (WNT) 2B (WNT2B) level, or both in the biological sample obtained from the subject.

[0011] In various embodiments, the methods for assaying a biological sample include detecting a higher CDH6 level, a higher WNT2B level, or both in the biological sample obtained from the subject relative to a control. In some embodiments, if the subject is one having received the transplantation, the subject detected with the higher CDH6 level, the higher WNT2B level, or both has increased severity of kidney interstitial fibrosis, , compared to a reference subject having received a renal transplantation and whose CDH6 and / or WNT2B level is not higher than the control. In some embodiments, if the subject is one having received the transplantation, the subject detected with the higher CDH6 level, the higher WNT2B level, or both has reduced renal function, compared to a reference subject having received a renal transplantation and whose CDH6 and / or WNT2B level is not higher than the control. In some4866-7185-2533.5Page 2 of 53 065472-000904WOPTembodiments, if the subject is one having received the transplantation, the subject detected with the higher CDH6 level, the higher WNT2B level, or both has an increased likelihood of delayed graft function, compared to a reference subject having received a renal transplantation and whose CDH6 and / or WNT2B level is not higher than the control.

[0012] In some embodiments, if the subject is one having had the AKI, the subject detected with the higher CDH6 level, the higher WNT2B level, or both has an increased likelihood of developing or possessing the fibrotic kidney disease or the CKD, compared to a reference subject having had an AKI and whose CDH6 and / or WNT2B level is not higher than the control.

[0013] In various aspects, the biological sample comprises a renal allograft biopsy or a renal biopsy. In various aspects, the detected CDH6 level, WNT2B level, or both is in proximal tubule of the biological sample. In various aspects, the detected CDH6 level, WNT2B level, or both is in proximal tubular epithelial cells of the renal allograft biopsy or the renal biopsy. In additional aspects, the biological sample comprises a blood or urine specimen. In further aspects, the detected level comprises protein expression level, mRNA level, or both.

[0014] In some embodiments of the methods for assaying a biological sample, the subject is one having received the transplantation, and the biological sample is obtained at least 3 months after the kidney transplantation. In some embodiments of the methods for assaying a biological sample, the subject is one having had the AKI, and the biological sample is obtained at least 3 months after beginning of the AKI. In some embodiments, the subject is the one having received the transplantation, and the biological sample is obtained about 12 months after the kidney transplantation. In some embodiments, the subject is one having received the transplantation, and the control is respective CDH6 level and / or WNT2B level of a living kidney donor immediately before, or within 2 weeks before, isolation from the donor. In some embodiments, the subject is one having received the transplantation, and the control is respective CDH6 level and / or WNT2B level of a reference subject having received a kidney transplantation and repaired kidney function, without transitioning to or developing chronic kidney injury in at least 12 months post-transplantation, or the control is respective level of a reference subject who does not have a fibrotic kidney disease.

[0015] In some embodiments, the methods for assaying a biological sample further include detecting an SRY-box transcription factor 9 (SOX9) level in the biological sample obtained from the subject.

[0016] In some embodiments, the subject is one having received the transplantation, the biological sample comprises a biopsy of the transplanted kidney, and wherein the detection4866-7185-2533.5Page 3 of 53 065472-000904WOPTof the SOX9 level is detecting a higher SOX9 level in the biopsy of the transplanted kidney obtained about 1 month after the transplantation relative to a baseline SOX9 level in a biopsy of the transplanted kidney before transplantation or before reperfusion of the transplanted kidney in the subject. In other embodiments, the subject receives a treatment therapy, and the detection detects the CDH6 level, the WNT2B level, or both in response to the treatment therapy.

[0017] Methods are also provided for assaying or monitoring a subject receiving a medication, optionally the medication comprising calcineurin inhibitor, wherein the subject has an acute kidney injury or has a renal transplant. In various embodiments, the method for assaying or monitoring a subject include: detecting a CDH6 level, a WNT2B level, or both in a biological sample obtained from the subject; and discontinuing administration of the medication to the subject if the detected CDH6 and / or WNT2B level is higher relative to a control, or continuing administration of the medication to the subject if the detected CDH6 and / or WNT2B level is not higher relative to the control, wherein the control is respective CDH6 and / or WNT2B level in the subject prior to receiving the medication, or the control is respective CDH6 and / or WNT2B level in a reference subject not having a renal disease and not receiving the medication.

[0018] In some embodiments, the medication comprises the calcineurin inhibitor, and the calcineurin inhibitor comprises tacrolimus, cyclosporin, or a combination thereof.

[0019] In some embodiments, the subject receives the calcineurin inhibitor after having received a renal transplant.

[0020] In some embodiments, the biological sample comprises a renal sample, and the detected CDH6 level, WNT2B level, or both is in proximal tubule of the renal sample.

[0021] In some embodiments, the detection comprises detecting a lower CDH6 level, a lower WNT2B level, or both the lower CDH6 level and the lower WNT2B level in the biological sample in response to the medication, and the method comprises the continuing administration of the medication to the subject.

[0022] Other features and advantages of the invention will become apparent from the following detailed description, taken in conjunction with the accompanying drawings, which illustrate, by way of example, various features of embodiments of the invention. BRIEF DESCRIPTION OF THE FIGURES

[0023] Exemplary embodiments are illustrated in referenced figures. It is intended that the embodiments and figures disclosed herein are to be considered illustrative rather than restrictive.4866-7185-2533.5Page 4 of 53 065472-000904WOPT

[0024] Figures 1A-1G depict that scRNA-seq reveals a dynamic SOX9 / CDH6 switch within the repairing nephron epithelium. (1A) Identification of a dynamic Sox9 switch. Lineage-tracing of injury-induced Sox9poscells and co-immunoanalysis for SOX9 and the basolateral polarity marker ATP1A1 were studied, showing that cells with disrupted basolateral polarity activated SOX9. The co-localization of tdT with SOX9poscells at 48 hours after IRI (IRI 48 hours: Sox9oncells). By day 10 after IRI, the lineage of Sox9oncells that restored basolateral polarity had silenced SOX9 (Sox9on-offcell state, regenerated epithelia), whereas the lineage with unrestored ATP1A1 maintained SOX9 activity (Sox9on-oncells). (1B) Schema of isolating single cells to compare IRI 48 hours Sox9pos(n = 2) versus day 10 Sox9poscells, with dot plot showing average gene expression values and percentage of cells expressing cell- type-specific markers of differentiation, injury (Havcr1 and Lcn2), and repair (Sox9) response. (1C) Topmost enriched GO cellular components and biological processes in IRI day 10 Sox9poscells versus 48 hour Sox9poscells. (1D) Heatmap of genes driving the GO terms. Shown is the enrichment of epithelial cell-cell adhesion machinery, including Cdh6, within day 10 Sox9poscells. (1E and 1F) Quantification of co-immunostaining for CDH6 and SOX9 and for ATP1A1 shows CDH6 expression restricted to day 10 SOX9poscells (1E) and to the Sox9 lineage with unrestored ATP1A1-based basolateral polarity versus the lineage that restored polarity (1F), indicating that CDH6 demarcates Sox9on-oncells (SOX9posCDH6poscell state). (1G) Quantifications of co-immunostaining for SOX9 and the epithelial tight junction marker ZO-1 and immunoblot for SOX9 and CDH6 show that cells that lacked cell-cell contact (subconfluent state) activated SOX9 and CDH6, which waned upon restoration of tight junctions (confluent monolayer). All n = 3 animals per time point unless otherwise stated. Data are shown as mean ± SEM.

[0025] Figures 2A-2G depict that CDH6 status is tightly linked to repair with or without αSMAposmyofibroblast response through single-cell Wnt activity. αSMAposmyofibroblasts is shown to be adjacent to SOX9postdTposcells (Sox9on-oncells) but there is no detectable αSMA activity around the Sox9on-offcells. (2A) Quantification of co- immunoanalysis shows αSMAposmyofibroblasts encasing the CDH6posSox9 lineages at single- cell spatial distance; by contrast, the paucity of such response can be observed around the CDH6negSox9-lineage. (2B) Schemas for purifying Slc34a1posnormal PTECs (control tdTposcells) and Sox9poscells 48 hours and day 14 after IRI, and quantification of principal components analysis (PCA) plot shows distinct transcriptomic profiles of purified tdTposcells. Sox9 transcripts were enriched in purified tdTposcells. (2C) Quantification of qPCR of purified tdTposcells confirms Sox9 and Cdh6 enrichment. (2D) Volcano plot demonstrating enrichment4866-7185-2533.5Page 5 of 53 065472-000904WOPTof Wnt ligands within day 14 versus 48 hour tdTposcells. (2E) Upset plot analysis of scRNAseq datasets showing subset of single Cdh6poscells enriched with Wnt4, including Cdh6posSox11possubsets. (2F) qPCR of purified tdTposcells confirming Wnt4 enrichment in day 14 post-IRI tdTposcells versus their 48-hour counterparts. (2G) Schema for labeling early Axin2poscells after IRI and quantification of immunoanalysis for CDH6 shows co-localization of tdTposand GFPposcells with tdTposGFPposcells located adjacent to CDH6possubsets. All n = 3 animals per time point unless otherwise stated. Data are shown as mean ± SEM.

[0026] Figures 3A-3O depict that Sox9on-oncell state is the main driver of myofibroblast formation and maintenance. (3A to 3C) Schema of Wls removal from Sox9on-oncells (3A), and quantification of blinded co-immunoanalysis for SOX9 and αSMA (n = 5 animals / group) shows no difference can be seen in Sox9on-oncells between the two groups (3B). Mosaic tissue–damaged microenvironment displayed significantly (P < 0.01) reduced αSMAposmyofibroblasts adjacent to tdTposdemarcated Wls-KO tubules versus tdTnegtubules with intact Wls (3C). (3D) Schema of isolating early Axin2poscells after IRI with FACS plot showing that nearly all tdTposcells co-expressed GFP. (3E) PCA plot of purified tdTposGFPposand tdTnegGFPposcells. (3F) GO analysis showing Wnt pathway among the top 10 terms, confirming that Axin2poscells demarcated early WRCs. (3G and 3H) Volcano plot showing the molecular signature of early WRCs (3G), with qPCR confirming Axin2 enrichment within tdTposGFPposcells (3H), thus validating reporter animals. (3I) Quantitative scores of interstitial fibrosis (blinded analysis, n = 5 Sox9-Ctrl and 6 Sox9-cKO animals). (3J) Blinded co- immunoanalysis showing head-head comparison between KIM1+regions for αSMA activity in Sox9-cKO versus Sox9-Ctrl animals. (3K) qPCR analysis of genes associated with fibrosis in the kidneys from Sox9-cKO versus Sox9-Ctrl animals. (3L and 3M) Western blot confirming SOX9 knock-down in subconfluent primary TECs (3L), with qPCR showing Sox9 and Wnt4 down-regulation (3M). (3N) Analysis showing significant (P < 0.01) Wnt4 reduction. (3O) qPCR analysis of Wnts under scrutiny and Axin2, Nkd1, and Nkd2 in the kidneys from Sox9- cKO versus Sox9-Ctrl. All images are representative images. Data are shown as mean ± SEM. *P < 0.05, **P < 0.01 unpaired two-sided Student’s t test; ***P < 0.01, paired Student’s t test.

[0027] Figure 4 depicts that integration of scRNA-seq and snATAC-seq shows the cellular identity of single-tdTposnuclei (n = 2 animals). Epigenetic reprogramming of single Sox9on-on nuclei to a nephron progenitor–like state contrasts with the Sox9on-offcounterpart, which reverts to normal PTEC.

[0028] Figures 5A-5J depict that human renal allografts display dynamic SOX9 / CDH6 / WNT2B activity, with CDH6poscells demarcating SOX9on-onactivity and fibrotic4866-7185-2533.5Page 6 of 53 065472-000904WOPTfoci. (5A) Box plot showing SOX9 levels at different time points within kidney transplant protocol biopsies (n = 163). (5B and 5C) Dot plots (5B) and box plots (5C) showing categorization of patients and kidney function according to SOX9 levels at 1 year (comparison by Mann-Whitney U test; n = 35). (5D) Histograms showing the number of patients with different degrees of kidney fibrosis, as estimated by ci-score according to Banff classification (comparison by chi-square test; n = 39). (5E) Box plot showing SOX9 and CDH6 levels categorized discriminating the transcriptome of kidney transplant biopsies in successful repair (1), transition to chronic injury (2), or CKD (3). LD, biopsies obtained from living donors at the time of transplantation. (5F) Heatmap showing expression correlation of genes of interest at 3 and 12 months after transplantation (Spearman r correlation coefficient; n = 72). Arrows highlight the identified molecular signatures of SOX9 / CDH6 / WNT, including AXIN2 and NKD1 in human kidneys. Note that CDH6 is the topmost correlated gene. (5G) Analysis comparing the percentage of cluster 8 and the interstitial fibrosis and tubular atrophy (IFTA) grade for each patient. Percentage of cluster 8 is calculated with respect to the PTEC number in each patient. P < 0.05 based on the Kruskal-Wallis test and Pearson correlation analysis. (5H) Immunoblot showing that subconfluent human primary PTECs activated SOX9, which waned upon confluency. (5I and 5J) Quantification of co-immunoanalysis (5I) and qPCR (5J) showing reduction in CDH6poscells and Cdh6 mRNA, respectively, upon removal of Sox9on-onactivity (blinded analysis, unpaired two-sided Student’s t test; data are shown as mean ± SEM).

[0029] Figures 6A-6B depict the identification of a dynamic Sox9 switch that parallels restorative status of its lineage post IRI-AKI. (6A) Quantification of co-immunoanalysis for SOX9 and initial injury marker KIM1 (Havcr1 encodes kidney injury molecule1) showing SOX9 activation within KIM1+ cells at 48h post-IRI. At day10, the Sox9-lineage that attained KIM1negstatus silenced SOX9, whilst subset of KIM1+Sox9-lineage maintained SOX9 expression (Sox9on-oncells). (6B) Quantification of co-immunoanalysis for SOX9 and LTL showing cells with disrupted apical brush border activated SOX9, the latter co-localized with tdTposcells at 48h after IRI. At day10 post-IRI, the Sox9-lineage that restored apical brush border silenced SOX9 (regenerated epithelia; Sox9on-offcells), whilst the lineage with unrestored apical polarity maintained SOX9 expression (Sox9on-oncells).

[0030] Figure 7 depicts injury-induced Sox9 lineage displays dynamic Sox9 switch after rhabdomyolysis induced AKI. At day10 post glycerol injection, the Sox9-lineage that restored apico-basolateral polarity silenced SOX9 (SOX9negtdTpos, Sox9-derived regenerated4866-7185-2533.5Page 7 of 53 065472-000904WOPTepithelia; Sox9on-offcells), whilst the lineage with unrestored polarity maintained SOX9 expression, marking cells with sustained Sox9 activity (SOX9postdTpos; Sox9on-oncells).

[0031] Figure 8A-8B depict that scRNA-seq reveals CDH6posSox9poscells are Megalinlowcell state. (Megalin is eoncoded by Lrp2.) (8A) Heatmap of expression of genes involved in apicobasolateral polarity that were differentially expressed between Sox9on-oncells versus Sox9oncells. (8B) Heatmap of expression of genes driving the enriched GO terms within Sox9on-oncells versus Sox9oncells.

[0032] Figure 9A-9B depict lineage tracing of Sox9on-oncells highlight repair capability and continuum of adaptive Sox9 / Cdh6 activity during progression of AKI to CKD phase. (9A) Quantification of co-immunoanalysis for SOX9 and ATP1A1, LTL, respectively, showing Sox9on-oncells lacked LTL+apical brush border and ATP1A1+basolateral polarity, irrespective of region. Colocalization of SOX9+cells with Sox9-CreERT2-activated tdT fluorescence (tdT+cells) demonstrating fidelity of the reporter for Sox9 in the day12 tissue damaged microenvironment. At day28 post-IRI, the subset of Sox9on-onlineage that repaired the epithelia reflected by restored apico-basolateral polarity had silenced SOX9 activity. (9B) Quantification of co-immunoanalysis for CDH6 and megalin (encoded by Lrp2) showing dynamic Cdh6 activity, in addition to, capability to repair as highlighted by restoration of megalinposapical polarity and switching off CDH6 expression at day 28.

[0033] Figure 10A-10B depict injury-induced Sox9 lineages display dynamic Sox9 / Cdh6 switch after rhabdomyolysis-AKI. (10A) Quantification of co-immunoanalysis showing that at day10 post glycerol injection, CDH6 demarcated Sox9on-oncell state. Note, restriction of CDH6 expression within Sox9-lineage with unrestored ATP1A1 polarity, whilst the ones that restored basolateral polarity were CDH6negative. (10B) QPCR of kidneys post rhabdo-induced AKI for Cdh6. Unpaired Student’s t-test. n=3 animals / time-point.

[0034] Figure 11A-11C depict Sox9on-offcells heal with no scar, but Sox9on-oncells, display robust, single-cell spatial association with αSMA+myofibroblasts within the same tissue damaged microenvironment after AKI. (11A) Quantification of co-immunoanalysis shows αSMA+myofibroblasts adjacent to Sox9on-oncells, with striking paucity of αSMA+myofibroblasts around the SOX9negtdT+at 10 days post-IRI. (11B) Quantification of co-immunoanalysis for SOX9 shows distinct juxtaposition between GFP+and Sox9on-oncells at single-cell spatial distance, whilst no GFP+cells were detected adjacent to SOX9on-offcells after rhabdomyolysis-induced AKI. (11C) Quantification of immunoanalysis for αSMA and SOX9 in kidneys harvested from Acta2-GFP animals shows cells with green fluorescent protein (GFP+cells) were mostly αSMA+thus4866-7185-2533.5Page 8 of 53 065472-000904WOPTvalidated the Acta2-GFP mice for Acta2 activity. Note, the tight association of most of the αSMA+myofibroblasts with SOX9+cells.

[0035] Figure 12A-12B depict Sox9on-oncells maintain active Wnt4 activity during progression of AKI to CKD. (12A) Quantification of co-immunoanalysis for SOX9 and WNT4 showing co-localization of WNT4 expression with SOX9+tdT+cells (Sox9on-oncells). (12B) Such cells displayed intimate, near exclusive association with GFP+myofibroblasts.

[0036] Figure 13A-13C depict Wntless removal within LyzCre-derived immune cells does not impact post-IRI induced fibrosis. (13A) LyzMCre / +:R26RtdT / +animals were subjected to sham or renal IRI surgery. Quantification of FACS shows significant increase in F4 / 80+macrophage population with F4 / 80+macrophages expressing tdT at day7 post IRI. (13B) qPCR analysis of Wnt4, Wnt7b, Wnt9b, and Wnt11 in FACS-purified F4 / 80+tdT+cells demonstrate no significant upregulation of Wnt ligands under scrutiny, post day7 IRI compared to controls. (13C) Co-immunostaining for F4 / 80 and aSMA+in day 28 post-IRI kidneys harvested from LyzMCre-derived immune cells-specific Wntless (WIs) knock-out mice compared with control animals with intact Wntless secretory apparatus showed no effect on fibrosis.

[0037] Figure 14 depicts genetic that fate mapping of Sox9on-ondeficient cells shows significant reduction in the tubules with disrupted NaKATPase based basolateral polarity. Quantification of co-immunoanalysis for ATP1A1 (NaKATPase). tdTposshowing tubules that underwent recombination in Sox9-Ctrl and Sox9-cKO animals.

[0038] Figures 15A-15B depict identification of WNT2B induction that parallels the fibrosis in transplanted human kidneys. QPCR analysis of WNT2B (15A) and COL1A1 (15B). Fold-change, compared to the (non-fibrotic) control sample. The RNA extracted from paraffinized-embedded human kidney transplant biopsy samples underwent QPCR-based analysis. Specifically, QPCR-based analysis of RNA isolated from paraffinized biopsy samples of transplanted human kidneys from patient 1, patient 2, and patient 3 revealed an elevation in WNT2B mRNA levels by 2.53-fold, 6.43-fold, and 8.47-fold, respectively, compared to the control sample. This observed upregulation aligned with the response seen in COL1A1 (a fibrosis marker) mRNA, which showed elevations of 3.48-fold, 27.62-fold, and 32.84-fold in these respective patients. Therefore, these findings unveil WNT2B, a secretory peptide, as a promising biomarker for kidney fibrosis. It can serve as a guide to customize calcineurin inhibitor-based immunosuppressive regimens and represents a potential therapeutic target for kidney fibrosis. DESCRIPTION OF THE INVENTION4866-7185-2533.5Page 9 of 53 065472-000904WOPT

[0039] All references cited herein are incorporated by reference in their entirety as though fully set forth. Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton et al., Dictionary of Microbiology and Molecular Biology 3rded., Revised, J. Wiley & Sons (New York, NY 2006); March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 7thed., J. Wiley & Sons (New York, NY 2013); and Sambrook and Russel, Molecular Cloning: A Laboratory Manual 4thed., Cold Spring Harbor Laboratory Press (Cold Spring Harbor, NY 2012), provide one skilled in the art with a general guide to many of the terms used in the present application.

[0040] One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described. For purposes of the present invention, the following terms are defined below.

[0041] “Before implantation” or “PRE-implantation” (before reperfusion) generally refers to a time point when a kidney allograft is flushed and stored on ice. “After reperfusion” or “POST-reperfusion (after reperfusion) generally refers to a time point at the end of the reperfusion surgical procedure. “Protocol biopsies” in the Example section refers to biopsies at predetermined time points in a protocol, e.g., 3 months and 12 months, after transplantation.

[0042] The severity of chronic histological lesions can be semiquantitatively scored according to the Banff categories for mesangial matrix expansion (“mm”), tubular atrophy (“ct”), vascular intimal thickening / arteriosclerosis (“cv”), interstitial fibrosis (“ci”), arteriolar hyalinosis (“ah”), and transplant glomerulopathy (“cg”).

[0043] “Acute kidney injury” (AKI) generally refers to an abrupt decline in kidney function, which is categorized according to acute kidney injury network (AKIN) standards. The AKIN diagnostic criterion for AKI is an increase in serum creatinine of ≥0.3 mg / dL or ≥50% within 48 hours, OR urine output of <0.5 mL / kg / hour for >6 hours. The AKIN staging criteria for AKI is: stage 1 being an increase in serum creatinine of ≥0.3 mg / dL or to 150 to 200% baseline, OR urine output of <0.5 mL / kg / hour for 6 to 12 hours; stage 2 being an increase in serum creatinine to 200 to 300% baseline, OR urine output of <0.5 mL / kg / hour for 12 to 24 hours; and stage 3 being an increase in serum creatinine to >300% baseline, OR an increase in serum creatinine by >0.5 mg / dL to ≥4 mg / dL, OR urine output of <0.3 mL / kg / hour for >24 hours or anuria for >12 hours, OR initiation of kidney replacement therapy.

[0044] “Chronic kidney disease” (CKD) generally refers to kidney abnormalities or dysfunction including urinary, biochemical or radiological which persist for more than 34866-7185-2533.5Page 10 of 53 065472-000904WOPTmonths. In various embodiments, CKD patients have kidney dysfunction characterized by decrease in estimated glomerular filtration rate to less than 60 ml / min / 1.73m2for more than 3 months

[0045] “Fibrosis,” also known as fibrotic scarring, generally refers to a pathological wound healing in which connective tissue replaces normal parenchymal tissue to the extent that it leads to considerable tissue remodeling and the formation of permanent scar tissue. Without wishing to be bound by a theory, this formation of scar tissue is believed to represent an attempt by the body to encapsulate the injured tissue. Examples of fibrosis include dermal scar formation, keloids, liver fibrosis, lung fibrosis (e.g., silicosis, asbestosis), kidney fibrosis (including diabetic nephropathy), scleroderma, and glomerulosclerosis. In some embodiments, the fibrosis is a kidney fibrosis. In some embodiments the fibrosis to be treated or prevented, or the fibrotic organ of a subject whose biological sample is assayed, is fibrosis of the kidney, heart, liver or lung. In some embodiments the fibrosis to be treated or prevented is fibrosis of the kidney; or the fibrotic organ of a subject whose biological sample is assayed is a kidney. In further embodiments, the fibrotic organ is a kidney allograft after transplantation in a recipient.

[0046] The term “condition(s) associated with kidney fibrosis” or “fibrotic kidney disease” refers to any condition having kidney fibrosis as a symptom or cause of the condition, or a condition that can be worsened by the development of kidney fibrosis, or a condition the progression of which is linked to the progression of kidney fibrosis. A condition associated with kidney fibrosis can therefore benefit therapeutically by inhibiting kidney fibrosis. Conditions associated with kidney fibrosis include, but are not limited to, diabetic nephropathy, chronic kidney disease, end-stage renal disease, systemic lupus erythematosis, vasculitis, IgA nephropathy, other autoimmune diseases, paraprotein diseases, diabetes. Chronic kidney disease associated with kidney fibrosis is a very important risk factor for cardiovascular disease. A condition associated with kidney fibrosis, including kidney fibrosis itself can be diagnosed by a blood test that measures the level of waste products such as creatinine and urea, a urine test that looks for abnormalities, a test that measures the level of expression of a gene described herein, an imaging test using ultrasound to assess kidney's structure and size, or a kidney biopsy. In some embodiments, the kidney fibrosis can be chronic kidney fibrosis.

[0047] The terms, “patient”, “individual” and “subject” are used interchangeably herein. A “subject” means a human or animal. Usually the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. In various embodiments, the subject is a human. In some embodiments, the subject is a human recipient of a kidney allograft. In other embodiments, the subject is a human having acute kidney injury.4866-7185-2533.5Page 11 of 53 065472-000904WOPT

[0048] The term “expression levels,” or “level” in relation to a protein or gene, refers to a quantity reflected in or derivable from the gene or protein expression data, whether the data is directed to gene transcript accumulation or protein accumulation or protein synthesis rates, etc. The term “expression level” or “level” refers to the amount of either gene transcript accumulation or protein transcript accumulation, unless the context suggests gene expression level or protein / peptide expression level, or unless specifically noted. For example, “gene expression level” refers to the amount of gene transcript accumulation; “protein expression level” refers to the amount of protein accumulation.

[0049] In various embodiments, measuring the expression level of two or more markers in a set include measuring the expression level of each marker in the set, and a decreased (lower) or increased (higher) level of the expression level of the two or more markers in a set include a decreased (lower), or increased (higher) respectively, level of each marker in the set. In further embodiments, a higher or lower level is a statistically significantly higher or lower, respectively, level. In some aspects, multiple specimens may be obtained from a subject and / or from a reference subject or control, for detection of an expression level, so as to derive any statistical significance in comparison.

[0050] “Biological sample” or “sample” in various embodiments refers to tissue or a specimen obtained from a subject. In various embodiments, biological samples are tissue or specimen (including biopsies) of a solid organ having had an injury, a solid organ at risk of or suspected of developing fibrosis, or a solid organ allograft that is to be transplanted or having been implanted, or another solid organ in one or more uses disclosed herein. In additional embodiments, biological samples are urine, or plasma, serum, or whole blood.

[0051] As used herein the term “about” when used in connection with a referenced numeric indication means the referenced numeric indication plus or minus up to 5% of that referenced numeric indication, unless otherwise specifically provided for herein. For example, the language “about 50%” covers the range of 45% to 55%. In various embodiments, the term “about” when used in connection with a referenced numeric indication can mean the referenced numeric indication plus or minus up to 4%, 3%, 2%, 1%, 0.5%, or 0.25% of that referenced numeric indication, if specifically provided for in the claims.

[0052] Our previous work identified Sox9 (a SRY-related high-mobility-group box family of transcription factor) activation as a fundamental epithelial injury-induced repair response (Sox9+); that is, Sox9 is rapidly upregulated within proximal tubule (PT) cells, the nephron cell type most vulnerable to AKI, and descendants of Soc9+ cells generate the bulk of the nephron during development and regenerate functional PT epithelium after AKI-induced4866-7185-2533.5Page 12 of 53 065472-000904WOPTreactivation of Sox9 after renal injury. We believed that persistent Sox9 activity observed about four weeks after AKI (i.e., after restoration of renal function post-AKI) can represent regions of unresolved injury / repair processes. However, the precise characterization of the “unresolved injury / repair processes”, including the relationship of such cells to the initial Sox9+cell remained unexamined. To this end, we first tested our hypothesis that the descendants of Sox9+cells would shut down Sox9 upon regeneration, whereas persistence of Sox9 activity was predicted for the Sox9-lineage with features of unrestored epithelia. This would provide an unprecedented opportunity to conduct head-to-head, high resolution and spatiotemporal examination of the descendant cells regenerating the epithelia vis-à-vis the progeny which could not fully restore the epithelia right from the onset of a single-inciting insult within with same damaged tissue microenvironment. Various embodiments are based, at least in part, on our findings from our tests. Detection / Assay Methods

[0053] Various embodiments provide methods for assaying a biological sample obtained from a subject, wherein the subject has had an injury, wound, or inflammation in a solid organ, or the subject has received a transplantation of a solid organ, or the subject is at risk of or desires determination of likelihood of developing fibrotic tissue in one or more such organs.

[0054] Various embodiments provide methods for assaying a biological sample obtained from a subject, wherein the subject has had an injury, wound, or inflammation in a solid organ. In some embodiments, the subject has had an injury, wound, or inflammation in kidney.

[0055] Various embodiments provide methods for assaying a biological sample obtained from a subject, wherein the subject has received a transplantation of a solid organ. In some embodiments, the subject has received transplantation of a kidney allograft.

[0056] Various embodiments provide methods for assaying a biological sample obtained from a subject, wherein the subject is at risk of or desires determination of likelihood of developing fibrotic tissue in one or more such organs. In some embodiments, the subject is at risk of or desires determination of likelihood of developing fibrotic kidney. In some embodiments, a subject at risk of developing fibrotic kidney (or kidney fibrosis) is one having chronic kidney disease (CKD) caused by conditions like diabetes or hypertension, advanced age, family history of kidney disease, exposure to toxins like heavy metals, autoimmune disorders like lupus, history of acute kidney injury, smoking, obesity, and genetic4866-7185-2533.5Page 13 of 53 065472-000904WOPTpredisposition to fibrosis development. A significant risk factor for fibrotic kidney is poorly managed chronic kidney disease.

[0057] Suitable methods for assaying these subjects include detecting the expression level of cadherin-6 (CDH6) in a biological sample, wherein the biological sample is a tissue or specimen of the solid organ. In various aspects, detecting a higher expression level of the CDH6 compared to a control indicates that the subject is likely to develop fibrosis in the solid organ.

[0058] In some embodiments, methods are provided for assaying a biological sample obtained from a subject having received transplantation of a graft kidney, especially a graft kidney suffering from ischemia reperfusion injury, and the methods include detecting a higher CDH6 level in the biological sample relative to a control, wherein the subject detected with the higher CDH6 level has increased severity of kidney interstitial fibrosis, reduced renal function, and / or an increased likelihood of delayed graft function.

[0059] Suitable methods for assaying these subjects also include detecting the expression level of WNT2B in a biological sample, wherein the biological sample is a tissue or specimen of the solid organ. In various aspects, detecting a higher expression level of the WNT2B compared to a control indicates that the subject is likely to develop fibrosis in the solid organ.

[0060] In some embodiments, methods are provided for assaying a biological sample obtained from a subject having received transplantation of a graft kidney, especially a graft kidney suffering from ischemia reperfusion injury, and the methods include detecting a higher WNT2B level in the biological sample relative to a control, wherein the subject detected with the higher WNT2B level has increased severity of kidney interstitial fibrosis, reduced renal function, and / or an increased likelihood of delayed graft function.

[0061] Suitable methods for assaying these subjects further include detecting the expression level of cadherin-6 (CDH6) and WNT2B in a biological sample, wherein the biological sample is a tissue or specimen of the solid organ. In various aspects, detecting a higher expression level of the CDH6 and the WNT2B compared to a control indicates that the subject is likely to develop fibrosis in the solid organ.

[0062] In some embodiments, methods are provided for assaying a biological sample obtained from a subject having received transplantation of a graft kidney, especially a graft kidney suffering from ischemia reperfusion injury, and the methods include detecting a higher CDH6 level and a higher WNT2B level in the biological sample relative to a control, wherein the subject detected with the higher CDH6 level and the higher WNT2B level has increased4866-7185-2533.5Page 14 of 53 065472-000904WOPTseverity of kidney interstitial fibrosis, reduced renal function, and / or an increased likelihood of delayed graft function.

[0063] Preferably the biological sample is a specimen of the graft kidney. The methods may assay the graft kidney obtained before transplantation to the recipient, or right after isolation from a donor, or having been stored after isolation from the donor but before transplantation, or right before reperfusion with a recipient’s circulatory system, or at two or more of the preceding time points. Additional embodiments provide that the methods may assay the graft kidney that is obtained after transplantation into the recipient, e.g., immediately after (within 1-3 minutes, 5-10 minutes, or 10-60 minutes from) reperfusion with the recipient’s circulatory system. Some embodiments provide that the methods assay the graft kidney about 6-12 hours after the transplantation. Some embodiments provide that the methods assay the graft kidney about 12-24 hours after the transplantation. Some embodiments provide that the methods assay the graft kidney about 24-36 hours after the transplantation. Some embodiments provide that the methods assay the graft kidney about 36-72 hours after the transplantation. Some embodiments provide that the methods include assaying the graft kidney about 7 days, 10 days, 14 days, 21 days, or 1 month after the transplantation. Some embodiments provide that the methods include assaying the graft kidney about 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years, or longer post-transplantation.

[0064] Therefore, some embodiments of the methods include detecting a first CDH6 level in a biological sample obtained between 1 day and 30 days after transplantation, and detecting a second CDH6 level in a biological sample obtained at a subsequent time point (e.g., 3 months after transplantation or later), wherein the second CDH6 level being higher than the first CDH6 level indicates the subject has increased severity of kidney interstitial fibrosis, reduced renal function, and / or an increased likelihood of delayed graft function.

[0065] In some embodiments, methods are provided for assaying a biological sample obtained from a subject with an acute kidney injury (including wound or inflammation), having had an acute kidney injury, desiring a determination of presence of fibrotic kidney, at risk of developing fibrotic kidney, or desiring a determination of progression to a chronic kidney disease, and the methods include detecting a higher CDH6 level and / or a higher WNT2B level in the biological sample relative to a control, wherein the subject detected with the higher CDH6 level and / or the higher WNT2B level has an increased likelihood of developing fibrotic kidney or chronic kidney disease.4866-7185-2533.5Page 15 of 53 065472-000904WOPT

[0066] Preferably the biological sample is a specimen of an injured kidney. The methods may assay a specimen of the injured kidney obtained right after (e.g., within 1 day, 2 days, or 3 days of when) an acute kidney injury occurs, or may assay a specimen of the injured kidney obtained shortly after repair from the acute kidney injury (e.g., within 1 day, 2 days, 3 days, or 7 days), or may assay specimens obtained at two or more time points of the injured kidney. The methods may also assay a specimen of the (once) injured kidney obtained after a period of time after the acute kidney injury; or alternatively speaking, the methods may assay a specimen of a kidney that had an injury (including wound or inflammation) in the previous 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 1 year, or longer.

[0067] Therefore, some embodiments of the methods include detecting a first CDH6 level (or first WNT2B level, or both first CDH6 and WNT2B levels) in a biological sample obtained shortly after (e.g., within 1-3 days, 3-7 days, or 1-2 weeks from) an acute kidney injury, and detecting a second CDH6 level (or correspondingly second WNT2B level, or both second CDH6 and WNT2B levels) in a biological sample obtained after a lengthened period of time (e.g., after 2-4 weeks, 1-3 months, or 3-6 months) of an acute kidney injury, wherein the second level(s) being higher than the first level(s) indicates the subject has an increased likelihood of developing fibrotic kidney or a fibrotic kidney disease or a chronic kidney disease.

[0068] In various aspects, the detected level(s) is compared to a control, wherein the control is the respective level detected at baseline, e.g., baseline time point being within 2 weeks (between 0 day and 2 weeks) post-transplantation for a kidney graft. In instances of subjects having injured kidney, the control may be respective level at baseline that is within about 2 weeks from the beginning of the injury. In other aspects, the detected CDH6 level is compared to a control wherein the control is respective level detected in a biological sample obtained from a reference subject. A reference subject can be one who does not have a fibrotic kidney or a fibrotic kidney disease.

[0069] In some embodiments, a higher level of a detected protein or gene expression is at least 10%, 20%, 30%, 40%, or 50% higher than a control. In some embodiments, a higher level of a detected protein or gene expression is at least 100% higher than a control. In some embodiments, a higher level of a detected protein or gene expression is at least 200% higher than a control. In some embodiments, a lower level is at least 10%, 20%, 30%, 40%, or 50% lower than a control.

[0070] Additional embodiments provide methods for assaying the biological sample further include detecting level(s) of one or more markers, including but not limited to SOX9, WNT2B, WNT4, NKD1, and in some embodiments, further includes detecting COL1A1,4866-7185-2533.5Page 16 of 53 065472-000904WOPTLEF1, AXIN2, ACTA2, or a combination thereof. In some embodiments, the methods further include detecting SOX9 level in the biological sample. In some embodiments, the methods further including detecting COL1A1, LEF1, AXIN2, and ACTA2 levels.

[0071] Suitable assays for the detection include but are not limited to gene expression level assays such as RNA sequencing, (real-time) quantitative polymerase chain reaction (RT- qPCR), microarray analysis, and / or high throughput RNA sequencing; as well as protein expression level assays such as ELISA, immunohistological staining / imaging / quantification, western blotting. Treatment Methods

[0072] Various embodiments of the invention provide methods for diagnosing fibrotic tissue and treating, reducing the severity of and / or slowing progression of the fibrosis in a subject, wherein the methods include detecting a higher CDH6 level, a higher WNT2B level, or both a higher CDH6 level and a higher WNT2B level, in a biological sample obtained from the subject relative to a control, and administering to the subject an anti-fibrotic agent. Various embodiments provide methods for treating, reducing severity and / or allowing disease progression in a subject assayed to have increased severity of kidney interstitial fibrosis, reduced renal function, and / or an increased likelihood of delayed graft function, or in a subject assayed to have an increased likelihood of developing or possessing the fibrotic kidney disease or the chronic kidney disease.

[0073] Preferably the methods are for diagnosing fibrotic kidney or identifying a kidney with fibrotic kidney disease or chronic kidney disease in a subject and treating the subject with the fibrotic kidney or chronic kidney disease.

[0074] Additional embodiments of the invention provide methods for treating, reducing the severity of and / or slowing progression of the fibrosis in a subject, wherein the methods include administering an anti-fibrotic agent, a CDH6 inhibitor or antibody, or both to a subject detected with a higher CDH6 level and / or a higher WNT2B level in a biological sample obtained from the subject relative to a control. In various aspects, the treatment methods are for a subject with a kidney allograft or an injured kidney.

[0075] In some embodiments, a subject assayed to have increased severity of kidney interstitial fibrosis, reduced renal function, and / or an increased likelihood of delayed graft function, or assayed to have, (or an increased likelihood of developing or possessing,) the kidney fibrosis or the chronic kidney disease, is treated with a standard-of-care medication or treatment. Exemplary standard of care medications for transplant recipients include immunosuppressants, e.g., calcineurin inhibitors: Tacrolimus (Prograf), cyclosporine (Neoral,4866-7185-2533.5Page 17 of 53 065472-000904WOPTGengraf); antimetabolites: Mycophenolate mofetil (CellCept, Myfortic), azathioprine (Imuran); mTOR inhibitors: Sirolimus (Rapamune), everolimus (Zortress); and / or corticosteroids: Prednisone. Exemplary standard of care medications for kidney injury patients include steroids; vasopressors; angiotensin-converting enzyme (ACE) inhibitors; angiotensin II receptor blocker (ARB); D vitamin supplementation; antagonist of Smoc2; diuretics such as furosemide; or potassium binders such as sodium zirconium cyclosilicate (Lokelma) and patiromer (Veltassa). An exemplary standard of care treatment for patients having kidney fibrosis or chronic kidney disease is dialysis.

[0076] In some embodiments, a subject assayed to have increased severity of kidney interstitial fibrosis, reduced renal function, and / or an increased likelihood of delayed graft function, or assayed to have an increased likelihood of developing or possessing the fibrotic kidney disease or the chronic kidney disease, is treated with an anti-fibrotic agent. Exemplary anti-fibrotic agents are nintedanib, pirfenidone, PRM-151, epigallocatechin gallate, or a combination thereof. Preferably, the anti-fibrotic agents are conjugated with (or modified with), or co-administered with, a CDH6-specific antibody or a CDH6-targeted molecule. More preferably, an anti-fibrotic agent is directed to CDH6-positive cells or tissue in the treatment methods.

[0077] In various embodiments, a CDH6 inhibitor or an anti-CDH6 antibody is administered. In some embodiments, a CDH6 inhibitor or antibody is administered, whereas an anti-fibrotic agent is not administered. Exemplary CDH6 inhibitors include but are not limited to DS-6000 (Daiichi Sankyo Co Ltd), AMT-707 (OnCusp Therapeutics), AMT-707 (OnCusp Therapeutics), AMT-707 (Multitude therapeutics Inc), BCG-101 (Medicinal Bioconvergence Research Center), BCG-102 (Medicinal Bioconvergence Research Center), and NOV-13 (Novartis AG).

[0078] Suitable controls are discussed above in relation to the detection / assay methods.

[0079] In various treatment methods, the subject does not have a cancer. In various embodiments, the subject does not have a kidney cancer. In some embodiments, the subject does not have ovarian cancer. In additional embodiments, the subject does not have Alzheimer or Alzheimer’s dementia. Monitoring Methods and more

[0080] Various embodiments of the invention provide methods for determining a risk of developing fibrotic tissue or a fibrotic tissue disease (fibrosis) in a subject receiving a medication, wherein the methods include measuring a CDH6 level and / or a WNT2B level in a biological sample obtained from the subject, and diagnosing or determining that the subject has4866-7185-2533.5Page 18 of 53 065472-000904WOPTan increased likelihood of developing fibrotic disease if the measured CDH6 level and / or WNT2B level is higher than a control, or determining that the subject does not have an increased likelihood of developing fibrosis if the measured CDH6 level and / or WNT2B level is not higher than a control.

[0081] In various aspects, the control in these methods may be a respective CDH6 level and / or WNT2B level measured before starting the medication. In other aspects, the control may be a CDH6 level and / or WNT2B level in a reference subject free from the fibrosis, who is not taking an anti-fibrotic agent.

[0082] Additional embodiments of the aforementioned methods further include discontinuing administration of the medication to the subject if the measured level is higher than the control, and / or continuing administration of the medication to the subject if the measured level is not higher than the control.

[0083] Some embodiments provide methods for assaying or monitoring a subject receiving a medication for improving kidney (allograft) function, such as a calcineurin inhibitor, and the methods include detecting a CDH6 level and / or WNT2B level in a biological sample (e.g., a tissue specimen of a graft kidney) obtained from the subject, and discontinuing administration of the medication if the detected CDH6 and / or WNT2B level is higher than a control or continuing administration of the medication to the subject if the detected CDH6 and / or WNT2B level is not higher than the control. In various aspects, a control may be the respective level in the subject prior to receiving the calcineurin inhibitor. In other aspects, the control is respective level in a reference subject not having a renal disease and / or not taking a kidney medication.

[0084] Exemplary calcineurin inhibitors are tacrolimus, cyclosporine, or a combination thereof. Others

[0085] Kits are also provided for detecting CDH6, or both CDH6 and Wnt ligands. In some embodiments, a kit is provided including an agent capable of binding a gene transcript of CDH6, an agent capable of binding the CDH6 protein, or an agent capable of binding a soluble fragment of CDH6 protein, wherein the kit can be used for a subject having had a kidney transplant or an acute kidney disease. In additional embodiment, a kit may further include an agent capable of binding a gene transcript or binding a protein of WNT2B and / or WNT4.

[0086] An agent capable of binding a gene transcript may be an oligonucleotide sequence capable of hybridizing with at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%,4866-7185-2533.5Page 19 of 53 065472-000904WOPT75%, or 70% of a target gene transcript, or may be a primer for the target gene sequence. An agent capable of binding a protein or protein fragment may include an antibody or antibody fragment specific for the target protein or target protein fragment. EXAMPLES

[0087] The following examples are provided to better illustrate the claimed invention and are not to be interpreted as limiting the scope of the invention. To the extent that specific materials are mentioned, it is merely for purposes of illustration and is not intended to limit the invention. One skilled in the art may develop equivalent means or reactants without the exercise of inventive capacity and without departing from the scope of the invention. Example 1. SOX9 switch links regeneration to fibrosis at the single-cell level in mammalian kidneys. (Cadherin 6 status determines the fate of scarring at the single-cell level in mammalian kidneys.)

[0088] The steps governing healing with or without fibrosis within the same microenvironment are unclear. After acute kidney injury (AKI), injured proximal tubular epithelial cells activate SOX9 for self-restoration. Using a multimodal approach for a head-to- head comparison of injury-induced SOX9-lineages, we identified a dynamic SOX9 switch in repairing epithelia. Lineages that regenerated epithelia silenced SOX9 and healed without fibrosis (SOX9on-off). By contrast, lineages with unrestored apicobasal polarity maintained SOX9 activity in sustained efforts to regenerate, which were identified as a SOX9on-onCadherin6poscell state. These reprogrammed cells generated single-cell WNT activity to provoke a fibroproliferative response in adjacent fibroblasts, driving AKI to chronic kidney disease. Transplanted human kidneys displayed similar SOX9 / CDH6 / WNT2B responses. Thus, we have uncovered a sensor of epithelial repair status, the activity of which determines regeneration with or without fibrosis.

[0089] We first tested our hypothesis that the descendants of Sox9+cells would silence Sox9 upon regeneration, whereas persistence of Sox9 activity was predicted for the Sox9 lineage with features of unrestored epithelia. If true, then this would provide an opportunity to conduct head-to-head, spatiotemporal examination of the regenerated lineage compared with the progeny that could not fully restore the epithelia right from the onset of a single-inciting insult within with same microenvironment.

[0090] Identification of a dynamic SOX9 / CDH6 switch within the repairing epithelia

[0091] First, injury-induced SOX9+cells were fate-mapped, using validated Sox9IRES-CreERT2 / +: R26RtdT / +animals in a model of long-term survival–compatible4866-7185-2533.5Page 20 of 53 065472-000904WOPTbilateral ischemia reperfusion injury (IRI) that induced AKI to progress to CKD. In human AKI, return of serum creatinine (a biochemical marker of kidney function) to normal baseline level reflects recovery from acute tubular necrosis through regeneration of tubular epithelial cells. In our model, serum creatinine returned to near normal levels by day 10. Therefore, the day 10 damaged tissue microenvironment, which correlated with clinically meaningful kidney function recovery, was investigated first (Fig.1A). A strong basolateral expression of sodium- potassium ATPase ion pumps (ATP1A1basolateral / high) and a thick, apical lotus tetragonoglobus lectin–enriched brush border (LTLthick) characterized uninjured proximal tubular epithelia. Injured epithelial cells with disrupted basolateral polarity activated SOX9, with tdT+cells reporting such cells at 48 hours after IRI (Fig.1A). On day 10 after injury, the initially labeled tdT+cells had expanded, and nearly the entire Sox9 lineage, which regenerated the epithelia marked by restoration of apicobasolateral polarity, had silenced SOX9 (tdT+Sox9neg; Fig. 1A, 6B, 6A). Conversely, the Sox9 lineage that exhibited unrestored epithelia, marked by cytoplasmic flattening and disrupted apicobasolateral polarity, maintained the SOX9+state, thereby demonstrating sustained Sox9 activity (IRI day 10: SOX9+tdT+; Fig. 1A; fig.6A). The unrestored lineages were mainly observed within the proximal tubules of the outer medullary region, which undergo relatively extensive cell loss due to exaggerated susceptibility to injury. A subset of such lineages displayed morphological features typically associated with tubulogenesis, such as prominent cytoplasmic projections with elongated nuclei suggestive of filopodia formation, likely reflecting an attempt to repopulate the extensively denuded tubule, as well as luminal clusters with long cellular axis oriented in all directions (Fig. 1A). Similar to IRI-induced AKI, we observed distinct Sox9 lineages with dynamic Sox9 activity tightly linked to their restorative status in rhabdomyolysis-induced AKI (rhabdo-AKI), another distinct and clinically relevant model of toxic AKI (fig.7). Therefore, hereafter, the terms Sox9on, Sox9on-off, and Sox9on-onwill be used to describe the following cells: Sox9onfor the initially injured proximal tubular epithelial cells (PTECs) that activated SOX9 at 48 hours after injury, Sox9on-offfor the Sox9onlineage that regenerated the epithelia, and Sox9on-onfor the counterpart that weren’t able to restore the epithelia by day 10 after AKI.

[0092] To study the Sox9onand Sox9on-oncells, we performed single-cell RNA sequencing (scRNA-seq) 48 hours and 10 days after IRI (Fig.1B). After confirming cell-type- specific distinct clustering of single-cell datasets (Fig.1B), we focused on the proximal tubule. Single-cell analysis showed heterogeneous Sox9+cells at 48 hours, whereas the day 10 population demonstrated relative homogeneity. Gene ontology (GO) term analysis of the differentially expressed genes showed enrichment of terms related to the formation of proximal4866-7185-2533.5Page 21 of 53 065472-000904WOPTtubular epithelia and function in Sox9+cells at 10 days versus 48 hours (Fig.1C). For example, in the category “cellular component,” the terms “lamellipodium,” “fascia adherens,” and “catenin complex” were enriched, in addition to “microvillus,” the latter a characteristic of PTECs. The cadherin-catenin-actin complex and lamellipodium are essential for the formation and maturation of epithelia (Fig. 1C and fig. 8B). In addition to Ctnn1a and Ctnnb1, Cdh6, which encodes cadherin 6 (k-cadherin), also contributed to the enriched term “catenin complex” (Fig. 1C-1C). Cdh6 is essential for the formation of a fully polarized nephron epithelium during nephrogenesis. Spatiotemporal mapping confirmed that CDH6 expression was restricted to IRI day 10 SOX9+cells and to the Sox9 lineage with Sox9on-onactivity, which exhibited disrupted or absent apicobasolateral polarity (Fig. 1E-1F). Consistent with the observed LTLlow / absent apical brush border of Sox9on-oncells, our single-cell analysis also predicted low Lrp2 (encoding the apical brush border component megalin) status of Cdh6+cells (fig.8B). The presence of CDH6+LRP2lowcells was confirmed at day 10 after injury (fig.8A). Additionally, the genes associated with apicobasolateral polarity (Fat1, Myo9a), both linked with proximal tubule formation and function, were enriched in Sox9on-onversus Sox9oncells (fig.8A). Complementing the GO category cellular component, the biological processes terms linked with nephrogenesis (Bmp4, Ctnnb1, and Pax8) were enriched within Sox9on-onversus Sox9oncells (Fig.1D). Haploinsufficiency of SOX9, BMP4, CTNNB1, and PAX8, respectively, led to murine and human kidney hypoplasia and / or malformations. We validated Bmp4 enrichment within Sox9on-oncells.

[0093] Next, we fate-mapped Sox9on-oncells by injecting tamoxifen at day 10 after IRI. Consistent with the results of a co-immunoanalysis study (Fig. 1E), ~90% of the initially labeled cells were CDH6+. Two weeks later, at least a subset of Sox9on-oncells regenerated the epithelia, consistent with the “ongoing attempt to regenerate” prediction of the scRNAseq analysis (fig. 9A-9B). Although the proportion of regenerated tubules in the damaged outer medullary region was smaller compared with the outer and inner cortices, the regenerated lineage silenced SOX9 / CDH6 activity. Therefore, this finding supports a continuous, dynamic SOX9 / CDH6 axis despite the interstitium becoming progressively fibrotic and inflamed. A similar dynamic activity was also observed in rhabdo-AKI (fig.10A-10B). Further, on similar lines, in vitro replicating subconfluent cells lacking cell-cell contact activated SOX9 and CDH6, which returned to baseline upon quiescent, confluent, monolayer formation, the latter characterized by acquisition of ZO-1, a tight junction protein (Sox9on-offcell state; Fig.1G).

[0094] We also leveraged published databases that used single-nuclear sequencing to cross-validate the Sox9 / Cdh6 switch. Consistent with our scRNAseq analysis, single-nuclear4866-7185-2533.5Page 22 of 53 065472-000904WOPTtrajectory analysis of Sox9+nuclei demonstrated distinct Sox9 lineages. One Sox9 lineage restored the transcriptome back to normal PTECs and switched off Sox9. By contrast, another lineage, which was marked by sustained Sox9 activity, acquired a distinct transcriptome characterized by Cdh6+nuclei. Thus, snRNA-seq analysis further substantiated our findings. We have therefore identified a dynamic Sox9 / Cdh6 switch tightly linked with the restorative status of the proximal tubule epithelia, with Sox9on-oncell state (SOX9posCDH6pos) most probably highlighting ongoing attempts to regenerate the epithelia.

[0095] SOX9posCDH6poscells form a central hub of myofibroblast generation and maintenance

[0096] In IRI- and rhabdo-induced AKI to CKD models, head-to-head comparison between the two lineages showed that most of the αSMA+myofibroblasts were conspicuously located adjacent to Sox9on-oncells (fig. 11A-11C). A similar robust, intimate association was observed with the CDH6poslineage (Fig.2A). The outer medullary region exhibited most of the αSMA response paralleling Sox9on-onactivity (fig.11A-11C). Substantial juxtaposition at single-cell spatial distance was confirmed by Sox9IRES-CreERT2 / +:R26RtdT / +: Acta2-GFP [Acta2 encoding αSMA, green fluorescent protein (GFP)] animals (Fig. 2A, fig. 11B). To ascertain whether a distinct Acta2negativeprofibrotic cell type, for example, ACTA2neg COL1A1+cells, might encase the CDH6neg cells, we searched our scRNAseq datasets. Consistent with known responses in fibrotic kidneys, Acta2-, Col1a1-, and Col3a1-expressing cells were observed within the Pdgfrb+interstitial cluster, the latter signature predominantly contributed by the day 10 Pdgfrb+cells. Unlike the lung, no distinct Acta2negCol1a1+or Col3a1+demarcated cell clusters were observed. These findings were cross-validated by searching published snRNA- seq datasets of post-AKI kidneys. Co-immunoanalysis confirmed that interstitial cells co- expressed ACTA2 and COL1A1, with a marked paucity of COL1A1+cells around the regenerated lineage. Up to 88% of Pdgfrb+cells that activated αSMA were the resident Pdgfrb+fibroblasts located within single-cell distance of Sox9on-oncells. The above findings highlight that Sox9on-offlineages heal without fibrosis and implicate the CDH6poslineage (SOX9posCDH6pos) as a possible cell state that generates myofibroblasts through a short-range secretory ligand.

[0097] To identify the secretory ligand(s), we next performed RNA-seq–based profiling of IRI day 14 tdT+versus 48 hour tdT+cells, with Slc34a1+tdT+cells serving as normal, uninjured control PTECs (Fig. 2B). Sox9 transcripts were enriched within both tdT+populations versus normal control PTECs (~3-fold and ~13-fold), respectively (Fig. 2B). Quantitative polymerase chain reaction (qPCR) validated Sox9 enrichment and confirmed4866-7185-2533.5Page 23 of 53 065472-000904WOPTCdh6 activation specifically within IRI day 14 tdT+cells versus 48 hour tdT+cells (Fig.2C), demonstrating the fidelity of the Sox9 reporter animals for Sox9 activity. Genes such as Ctnnb1, Ctnnd1, Pou3f3, and Smad7, which contributed to the topmost enriched GO terms in single day 10 Sox9+cells (Fig.1D), were also enriched within IRI day 14 tdT+versus 48 hour tdT+cells. The GO analysis enriched term “kidney development” showed Sox11 enrichment within IRI day 14 tdT+versus 48 hour tdT+cells. The renal role of Sox11 is relatively unknown, except for its role in human and murine nephrogenesis. scRNA-seq analysis revealed that Sox11+cells constituted a subset of the Cdh6pospopulation. Thus, the above validatory studies confirmed that our bulk Sox9 cell-type–specific RNA-seq study could be used reliably to identify possible secretory ligands that might engage the adjacent fibroblast.

[0098] The Wnt signaling pathway, consisting of Wnt ligands, was among the top enriched GO terms within IRI day 14 tdT+cells versus 48 hour tdT+cells, although it was conspicuously devoid of the canonical Wnt-β catenin pathway activity reporter Axin2 (Fig. 2D). Mammalian Wnt proteins are a family of lipid-modified glycoproteins that signal within a typical range of just one or two cells in a juxtracrine or autocrine manner. Integration with scRNA-seq datasets identified single cells with de novo activation of Wnt4, and Wnt7b specifically within Cdh6poscells, including a Cdh6+Sox11+subset that also expressed Wnt4 (Fig. 2E). qPCR and RNA-scope studies confirmed Wnt4+induction within CDH6poscells, thus validating RNA-seq findings (Fig.2F). Using a previously validated and published WNT4 antibody, co-immunostainings substantiated the RNA scope studies. A strong WNT4 expression was strictly restricted to Sox9on-oncells, with such cells displaying a single-cell spatial and tight association with GFPposmyofibroblasts, indicating that Sox9on-oncells maintain biologically active Wnt niches during the progression of post-AKI fibrosis (fig.12A and 12B). Thus, the SOX9posCDH6poscell state might be the secretory cells that generate and maintain Wnt-enriched niches after AKI.

[0099] Next, we used Axin2CreERT2 / +:R26RmT / mGanimals, in which Axin2 activity reports cells with ongoing canonical Wnt signaling, to ascertain the identity of Wnt-responsive cells (WRCs). In a healthy adult kidney, a subset of interstitial αSMAnegPDGFRB+cells residing within the inner medulla region expressed membrane GFP (mGFP), demarcating resident WRCs. Contrary to the previous report; no resident WRCs were detected within the nephron epithelia of the cortices and outer medulla. After AKI, the animals treated with only corn oil (the vehicle for tamoxifen) did not demonstrate mGFP+cells, confirming tamoxifen dependence and ruling out injury-induced spontaneous Cre activation. The kidneys of the tamoxifen-treated animals showed that subsets of αSMA+myofibroblasts mounted Axin24866-7185-2533.5Page 24 of 53 065472-000904WOPTactivity, as shown by mGFP. By contrast, the resident Axin2+cells remained αSMAneg. Thus, myofibroblasts represent de novo WRCs after injury. To determine the spatiotemporal relationship between the earliest WRCs, CDH6poscells and myofibroblasts, we scrutinized Axin2CreERT2 / +:R26RtdT / +:Acta2-GFP mice. Examination uncovered subsets of CDH6poscells forming a biologically active Wnt niche at the single-cell level (Fig.2G).

[0100] Genetic lineage studies showed that the descendants of Axin2+cells formed the bulk of the scar tissue by4 weeks after IRI. Nearly half of the replicating myofibroblasts were Axin2+. Further, comparative blinded analysis of the β-catenin–deficient lineage of the earliest αSMA+myofibroblasts (Ctnnb1-cKO) versus the lineage with intact β-catenin activity (Ctnnb1-wt, controls) showed that Ctnnb1-cKO displayed significantly less expansion (P < 0.01) and lacked the intense αSMA response at day 28 after IRI. Moreover, the characteristic strong αSMA response adjacent to Sox9on-oncells was conspicuously deficient in most of the Ctnnb1-cKO cells (8.3 ± 2.4% versus 79.2 ± 2.6%, Ctnnb1-cKO versus Ctnnb1-wt, P < 0.01). Thus, canonical β-catenin signaling is essential for the maintenance of αSMA+activity within the myofibroblasts after AKI.

[0101] To determine whether SOX9on-onCDH6poscells secrete Wnt and drive fibrosis, we performed a head-to-head comparison between tdT-demarcated Sox9+cells lacking Wls versus and the intact Wls secretory apparatus (Fig. 3A). Wls encodes Wntless, a highly conserved, transmembrane protein essential for Wnt secretion and function. Successful recombination of the floxed Wls allele was confirmed by two different approaches. Blinded analysis revealed a substantial reduction in αSMA response around the tdT+SOX9: Wls-cKO versus controls (tdT+SOX9: Wls-Het; Fig. 3A). Both groups had a similar proportion of SOX9on-oncells (Fig.3B). Further scrutiny of Sox9: Wls-cKO animals showed that a proportion of SOX9+cells underwent successful recombination, as shown by tdT expression, thus generating a microenvironment mosaic for Wls activity: SOX9+tdTpos(Wls-cKO) and SOX9+tdTneg(Wls-WT) cells, respectively. Leveraging the observed mosaicism, a direct- blinded comparison for αSMA activity around SOX9+tdTposand SOX9+tdTnegtubules revealed a significant (P < 0.01) reduction in myofibroblasts around the SOX9+tdTpostubules compared with their SOX9+tdTnegcounterparts (Fig. 3C). Macrophages could be a collateral source of Wnts. We did not detect Wnt7b, Wnt9b, Wnt11, or Wnt4 induction in fluorescence-activated cell sorting (FACS)–purified LyzM Cre-derived tdT+F4 / 80+cells compared with uninjured resident tdT+F4 / 80+cells despite an ~5-fold increase in F4 / 80+cells (fig.13A, 13B). Consistent with this finding, blinded analysis for αSMA+myofibroblasts or overall fibrotic responses showed no effect of Wls removal within the LyzM Cre-derived immune cells (fig. 13C).4866-7185-2533.5Page 25 of 53 065472-000904WOPTAlthough kidney stromal cells express Wnts, removal of Wnt4 within these cells had no effect on overall fibrosis, thus ruling out stromal Wnt4 as the main driver of post-AKI fibrosis. The above findings reveal the SOX9posCDH6poscell state as the central source of continuous, biologically active Wnt signal driving fibrosis after AKI.

[0102] Next, we sought to determine whether Sox9on-onactivity per se is the essential component of such profibrotic niches in vivo. Our previous work highlighted the essential role of Sox9 activation in PTEC regeneration. Proximal tubule–specific removal of Sox9 before injury led to impaired tubular repair and renal function recovery compared with animals with intact Sox9 activity. Based on the findings of our scRNA-seq and Sox9+cell-type-specific bulk RNA-seq studies, we hypothesized that SOX9posCDH6poscells with Sox9on-onlikely recruited essential downstream proregenerative programs by day 10 after AKI. Therefore, it might be feasible to remove Sox9on-onactivity during the progression of AKI to CKD. The precise molecular signature of early WRCs after AKI remains unknown. Therefore, to determine whether removal of Sox9on-onactivity leads to the abrogation of fibrosis and the obliteration of Wnt niches, we established a molecular signature of WRCs.

[0103] To this end, we used Axin2CreERT2 / +:R26RtdT / +: Acta2-GFP animals (Fig. 3D). Comparison of the transcriptome between the earliest WRCs (tdTposGFPpos) versus other myofibroblasts (tdTnegGFPpos) cells confirmed the Wnt signaling pathway activation as one of the top-most enriched GO terms within the tdTposcells; Axin2, Lef1, Nkd1, and Lgr6 were enriched, whereas Fzd7, encoding Frizzled 7, a Wnt receptor, was down-regulated (Fig.3E to 3G), indicating that Fzd7 might be the Wnt-sensing receptor activating Pdgfrb+cells. Other top enriched GO terms included “response to fibroblast growth factor” and “regulation of mitotic cell cycle,” indicating that the early Axin2+myofibroblast subset may have greater proliferative properties compared with other myofibroblast populations, consistent with lineage-tracing and Ki67-based co-immunoanalysis studies (Fig. 3F). qPCR validated Axin2 enrichment within tdTposGFPposversus tdTnegGFPposcells (Fig. 3H). Our scRNA-seq study analysis not only further endorsed induction of Axin2 activity within the same cluster containing Acta2+Col1a1+Col3a1+Pdgfrb+cells at day 10 after IRI, but consistent with the above findings, also showed induction of Nkd1+cells specifically restricted to the above day 10 post-IRI cluster. Nkd2, reported as a marker of terminal myofibroblasts in a previous study (27) and in our molecular profiling study of AKI to CKD, was also enriched in early Acta2+Col1a1+Pdgfrb+cluster. Thus, these findings not only validated the Axin2 reporter but also established a molecular signature of early WRCs.4866-7185-2533.5Page 26 of 53 065472-000904WOPT

[0104] To remove Sox9on-onactivity during the transition from AKI to CKD, doxycycline injections to Sox9 knock-out (Sox9-cKO) and control wild-type (Sox9-WT, Ctrl) animals were administered 1 week after AKI. The tdT+cells highlighted cells with successful recombination. First, doxycycline dependence of the system was confirmed. Further, in the absence of doxycycline, Sox9-cKO animals displayed an injury-induced, early SOX9 activation response, with nearly half of SOX9+cells expressing Ki67 akin to animals with intact Sox9 activity, thus ruling out spontaneous injury-induced Cre activation and preservation of early Sox9 repair responses. Doxycycline led to obliteration of Sox9on-onactivity in the Sox9- cKO (tdT+Sox9KO) animals; by contrast, Sox9-WT animals displayed intact Sox9on-onactivity (tdT+Sox9+).

[0105] To ensure rigorous comparison between similar damaged tissue microenvironments, a blinded, head-to-head comparison between Havcr1+(also called kidney injury molecule-1, Kim1) regions of Sox9-cKO and Sox9-WT animals was performed. The kidneys lacking Sox9on-onactivity displayed a significantly reduced fibrotic signature, including αSMA+myofibroblasts (Kim1+Sox9WTversus Kim1+Sox9KO, 69.0 ± 3.6% versus 28.2 ± 5.8%, respectively, P < 0.01; Fig.3I-3J). Before the removal of Sox9on-onactivity, the proportions of SOX9 and αSMA cells were similar in Sox9-WT and Sox9-cKO animals. Using previously validated shRNA to knock down Sox9 (28), we found a marked reduction in Wnt4 in primary nephron tubular epithelial cells in Sox9 knock down cells versus controls (Fig.3L- 3M). Next, we confirmed Sox9-Wnt4 link in vivo (Fig.3N-3O). The outer medulla region, the predominant site of Sox9on-onactivity and the main site of de novo injury-induced Wnt4 response, displayed maximal blunting of the Wnt4 response upon removal of Sox9on-onactivity. These findings provided further evidence for Sox9on-onactivity in generating biologically active Wnt4 niches. The resident Wnt4 expression within the papilla and inner medulla region (a region with no Sox9on-on cells) remained intact and thus served as a robust, internal positive control (Fig. 3N). Further, in addition to the panel of profibrotic genes, the herein identified early molecular signature of injury-induced WRCs (Axin2, Nkd1, and Nkd2) showed reductions in Sox9-cKO versus Sox9-WT animals (Fig. 3O). Genetic fate mapping of the Sox9on-on- deficient cells revealed that a significantly (P < 0.01) larger proportion of Sox9on-on-deficient cells had restored polarity compared with their counterparts with intact activity (fig.14). This finding indicates that the reduced fibrosis secondary to the removal of Sox9on-onactivity might serve as a relatively favorable milieu for the epithelium to restore itself. Thus, Sox9on-on activity transforms the SOX9posCDH6poscell state into Wnt-secreting cells, a central hub for myofibroblast formation and maintenance.4866-7185-2533.5Page 27 of 53 065472-000904WOPT

[0106] The SOX9on-onCDH6poscell state highlights sustained efforts to regenerate the epithelium by attaining a progenitor-like cell state

[0107] Having identified the biological relevance of Sox9on-onactivity, we next aimed to better define and understand the epigenetic features of the Sox9on-oncell state. To this end, we generated single-nuclei assay for transposase-accessible chromatin sequencing (snATAC- seq) profiles of day 10 Sox9 descendants after injury. To ensure sufficient availability of single Sox9on-onnuclei for meaningful analysis, we dissected the inner cortices and outer medulla region, the site of predominant Sox9on-oncells, and the single-nuclei isolated from freshly enriched lineage-traced tdTposcells were subjected to snATAC-seq. Integration of snATAC- seq with the scRNA-seq profile demonstrated that the nuclei subclustered in a nephron cell- type-specific manner based on differentially open or closed chromatin accessibility state (Fig. 4). The differential chromatin accessibility of Sox9 led to the clustering of lineage-traced tdTposnuclei into “Sox9on-on” and “Sox9on-off” nuclei.

[0108] The Sox9on-offnuclei exhibited a relatively open chromatin accessibility state of Hnf4a and its downstream gene, Lrp2, the markers of mature functional PTECs, thus providing strong evidence that the Sox9 lineage regenerates functional PTECs. By contrast, the Sox9on-onnuclei demonstrated a relatively open chromatin accessibility state of Cdh6, Wnt4, and Wnt7b, in addition to Sox11, further showing the Sox9on-onCdh6poscell state to be Wnt enriched. Consistent with scRNAseq analysis (Fig.1B), snATACseq analysis also provided evidence for UMOD+thick ascending limb of Loop of Henle and AQP2+collecting duct epithelial cells to activate SOX9 after injury. To uncover the transcriptional regulators that characterize the distinct outcomes of Sox9-descendants, the on-on and on-off nuclei were subjected to trajectory analysis. Transcriptional regulators with an essential role in nephrogenesis, such as Sox11, Nfat5, Maz, and Pax8, displayed dynamic transcriptional changes along the pseudotime in the Sox9on-oncell state. The dynamic reparative process was associated with cell proliferation, with ~22% of Sox9on-ondescendants in the S-phase of the cell cycle. Moreover, consistent with the prediction of snATAC-seq pseudotemporal analysis, the expression of both SMARCC1 and RUNX1 was restricted to the Sox9on-onlineage compared with its on-off counterpart. Smarcc1, an ATP-dependent chromatin-remodeling complex, maintains proliferation, pluripotency, and self-renewal of embryonic stem cells, whereas Runx1 drives muscle regeneration and hematopoietic stem and progenitor cell specification. Thus, these findings not only validated snATAC-seq pseudotemporal analysis, but also identified them as potential candidates upstream of Sox9on-onactivity.4866-7185-2533.5Page 28 of 53 065472-000904WOPT

[0109] snATAC-seq analysis of the inner cortices and outer medulla region revealed a sufficient population of Sox9on-onnuclei. Therefore, Sox9 CUT&RUN genomic occupancy assay in the day 10 lineage versus its parent Sox9oncells (48 hours after injury) provided an opportunity to examine the direct effects of sustained Sox9 activity within its lineage in vivo. We conducted a time-resolved, lineage-specific SOX9 CUT&RUN genomic occupancy assay. An H3K4me3 genomic occupancy assay was used as a control. Because of the technical challenges involved in isolating high-quality, >90% viable fragile tdTpos-enriched cells under low-flow FACS conditions and the limited labeling possible by a single tamoxifen injection, a pellet of ~30,000 to 100,000 cells was subjected to a genomic occupancy assay / antibody / time point. The cell pellet was expected to contain Sox9on-off cells, therefore, to reduce these cells, the lineage cells were enriched from the IC / OM region.

[0110] Despite these limitations, (i) validation of appropriate insert size for a transcription factor, (ii) distinct time- and antibody-specific clustering of biological samples using Pearson correlation approaches and UMAP (uniform manifold approximation and projection) approaches, (iii) signal of SOX9 peak relative to the transcription start site, and (iv) significant optimal Sox9 motif enrichment with Sox9 antibody versus input (P < 1E-300 at day 10, P < 0.02 at 48 hours) or versus H3K4me3 antibody (P < 1E-300 at day 10) indicated that the data could be reliably mined for meaningful biological conclusions with respect to SOX9- specific target binding. Consistent with the previous studies of genome-wide chromatin binding by SOX9, 10 to 15% of SOX9-bound regions occurred within transcriptional start or promoter sites. Indeed, the enriched GO terms across both time points showed that the significantly bound region and the corresponding significantly called peaks and genes compared with their respective inputs [false discovery rate (FDR)–adjusted P value < 0.01), were linked with the biological processes involved in epithelial regeneration in Sox9 48 hour and day 10 cells, consistent with the genetic-lineage tracing studies and scRNA-seq analysis of such cells (Fig. 1C). Calmodulin binding was one of the top GO enriched “molecular function” terms. SOX factors are known to contain a calmodulin-binding domain, and this calcium ion–enabled interaction imports SOX9 to the nucleus, with subsequent target gene activation. Most Sox9 target genes were specific either to 48 hours (91.2%) or day 10 (85.11%) after injury, indicative of distinct time-dependent genomic occupancy. The top enriched GO terms at both time points showed links with epithelial development processes consistent with its role in epithelial restoration. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis revealed the top terms linked with the RhoGTPase, calcium, and epidermal growth factor receptor (EGFR) pathways, whereas by day 10, metabolic pathways were uncovered as the top pathway.4866-7185-2533.5Page 29 of 53 065472-000904WOPTIndeed, Sox9 is a critical mediator of metabolic processes in chondrogenic cells and regulates components of the EGFR pathway in malignant cells. The maintenance of the pluripotent stem cell state, along with chromatin organization, appeared in day 10 SOX9+cells as shown by both KEGG pathway and GO analysis, thus directly implicating sustained Sox9 activity in endogenous reprogramming to a progenitor-like state in at least a subset of Sox9on-oncells.

[0111] Two well-known SOX9 target genes showed distinct time-specific binding. At 48 hours but not at day 10, Sox9 bound Col1a1; by contrast, Col2a1 was bound at day 10 but not at 48 hours. Fgf / Fgfr / Sox9 forms a feed-forward loop to maintain cell identity and growth. Conversely, our data showed that Fgfr1 was targeted at both time points, and a higher engagement was observed by day 10. In day 10–specific target gene analysis, the Wnt signaling pathway, consisting of genes such as Wnt2, Wnt5a, Wnt5b, Tcf7, and Tcf7l2, and others, featured among the top pathways. Tcf7 and Tcf7l2 are known to cooperate with β-catenin in committed nephron progenitor cells. To confirm whether Wnt2 represents a direct transcriptional target of SOX9, we examined the effect of removal of Sox9on-onactivity on Wnt2 mRNA expression. Wnt2 mRNA was markedly reduced in Sox9on-oncKO versus intact Sox9on-onactivity. These findings validate the CUT&RUN SOX9 genomic occupancy assay and uncover a direct Sox9 / Wnt2 link, which might contribute to maintaining fibroproliferative response after AKI. Thus, we have provided further evidence for the direct role of Sox9on-onactivity in the generation and maintenance of Wnt-enriched niches.

[0112] Integration of HOMER analysis of consensus sequence motifs associated with sites targeted by SOX9 CUT&RUN assay and transcription regulators uncovered by pseudotime trajectory analysis in our snATAC-seq datasets revealed top cofactors operating specifically in the Sox9on-oncell state. These include binding motifs for Yy1, Nfat5, Sp1, Arnt::Hif1a, and Tcf4. Yy1, a structural regulator of enhancer-promotor loops and gene expression, is essential for embryonic stem cell viability, and Nfat5 is essential for nephrogenesis and protects against stress. Tcf4, which is essential for skin epithelia repair and homeostasis, was noted to be co-enriched with Wnt4 in nephron progenitors, and Hif1a-Sox9 axis is involved in chondrogenesis. Thus, our findings indicate that Sox9on-onactivity might cooperate with these factors to regulate downstream gene expression.

[0113] CDH6posWNT2Bposcells marks fibrotic foci in human kidneys

[0114] To determine the clinical relevance of our findings, we studied transplanted human kidneys. Immediately after kidney transplantation, ischemia reperfusion injury–induced AKI frequently leads to delayed graft function, which is an independent predictor of subsequent renal allograft loss and dysfunction. Renal allograft biopsies from such patients (n = 3, day 74866-7185-2533.5Page 30 of 53 065472-000904WOPTafter kidney transplantation) and pre-implantation biopsies obtained from the same allograft (controls) demonstrated a marked increase in SOX9+cells within the AQP1+PTECs. This was also confirmed at the transcriptional level in protocol biopsies obtained after reperfusion (Fig. 5A).

[0115] Further, a stratification of kidney allograft protocol biopsies performed 1 year after transplantation showing SOX9 levels demonstrated that patients with persistent SOX9 expression displayed increased interstitial fibrosis and reduced renal function compared with the cohort that displayed return of Sox9 activity to baseline levels (Fig. 5B-5D). SOX9 and CDH6 levels correlated with the transition from AKI to CKD in transplant biopsies (Fig.5E). In the same kidney transplant cohort, protocol biopsies obtained 3 and 12 months after transplantation revealed CDH6 as the topmost gene correlated with SOX9 activity (Fig. 5F). Such strong correlation was also noted with fibrosis-associated genes such as COL1A1 and ACTA2. Although strong correlation was noted with WNT4, the correlation was more pronounced with other members of the WNT family in humans, particularly with WNT2B. Patients with a low immunological risk profile were uniformly managed in a single center using a protocol comprising tacrolimus-, mycophenolate mofetil–, and prednisone-based 31mmune- suppression. Rejection episodes were rare.

[0116] To obtain single-cell-level resolution of the above observed responses, we leveraged scRNA-seq datasets involving 16 kidney transplant biopsies. scRNA-seq showed that SOX9 / CDH6 / WNT2B–expressing cells predominantly resided in the same cluster (cluster 8), which also contained HAVCR1+cells. This cluster demonstrated significant correlation with fibrosis (P < 0.05) (Fig.5G), and time-resolved PTECs showed de novo emergence of cluster 8 after transplantation. Unlike Wnt2, Wnt2b did not exhibit a significant reduction upon removal of Sox9on-onactivity. Cluster 8 displayed dynamic activity and greater latent time compared with other PTEC clusters. Further, in another unbiased analysis to identify the driver gene that confers cluster-specific dynamic behavior, CDH6 was found to be the gene with the second-highest likelihood of underlying dynamic activity in HAVCR1+cluster 8. Akin to our findings in mice, CDH6posLTLlowPTECs and persistent SOX9 activity displayed intimate association with αSMA+myofibroblasts. Thus, these findings validated the identified dynamic axis in human kidneys at the single-cell level and revealed WNT2B as the likely WNT that may drive human fibrosis.

[0117] Akin to mouse PTECs, subconfluent primary human PTECs mounted SOX9 activity, which subsided upon tight monolayer formation, further emphasizing the tight link of SOX9 activity with cell-cell contact status (Fig. 5H). Our transcriptomic profiling and4866-7185-2533.5Page 31 of 53 065472-000904WOPTspatiotemporal mapping studies involving both murine and human kidneys uncovered a robust link between dynamic Sox9on-onactivity and Cdh6 response. Because cell-cell contact and / or adhesion disruption leads to Sox9 activation, with silencing of Sox9 upon cell-cell contact restoration, it would make biological sense that in the setting of prolonged cell-cell contact disruption, the persistent Sox9 transcriptional activity would induce a cadherin in its attempt to restore cell-cell adhesion. Therefore, we verified that Cdh6 not only demarcates Sox9on-oncells but might also be regulated by Sox9. We detected significant reduction of CDH6poscells and Cdh6 mRNA (P < 0.01) in Sox9-cKO kidneys compared with the WT (Fig.5I-5J). Thus, SOX9posCDH6poscells demarcate cells with SOX9on-onactivity–driven WNT signaling niches and fibrosis after human AKI.

[0118] Overall, by establishing a model system that facilitated head-to-head comparison between the two initially committed lineages to regenerate the injured proximal tubular nephron epithelia but with divergent outcomes (one that expeditiously regenerated tissue versus the other that was unable to do so), we identified the unifying mechanism underpinning scarless versus fibrotic tissue repair at the single-cell level within the same microenvironment. We also identified how precisely Wnt-enriched niches are formed and maintained after injury. Until now, despite the prominent link between Wnt and tissue fibrosis after injury, this question has remained unanswered. For example, in the setting of lung injury, the Wnt-inducing factor was highlighted as the “unknown factor”. Our study highlights the potential for abrogating fibrotic responses through a cell-state-specific intervention, even when introduced 1 week after injury, during the progression of AKI to CKD. This was illustrated by precise cell-state-specific genetic perturbation of Sox9on-onactivity or removal of Wntless within the Sox9on-oncells.

[0119] Our data shows that the Soxon-onCDH6poscell state signifies an ongoing regenerating phase during the transition from AKI to CKD. This was supported by (i) enrichment of biological and cellular processes linked with PTEC formation at the single-cell level; (ii) integrated analysis of scRNA-seq and Sox9 lineage-specific snATAC-seq datasets, unveiling a cascade of transcriptional regulators linked to nephrogenesis in the Sox9on-onnuclei; and (iii) distinct, time-specific SOX9 genomic occupancy within its lineage, indicating direct involvement in activating programs for nephron epithelia formation. Indeed, it would make biological sense for Sox9 in its sustained attempt to regenerate the unrestored epithelia to recruit Wnts, specifically Wnt4. Unexpectedly, Wnt2, which is essential for murine lung development but understudied in nephrogenesis, emerged as direct target gene of sustained SOX9 activity. Wnt2 was substantially decreased upon Sox9 activity removal, highlighting the4866-7185-2533.5Page 32 of 53 065472-000904WOPTdirect role of Sox9on-onin provoking fibrosis during a sustained effort to regenerate the epithelia. WNT2B demonstrated stronger correlation with sustained SOX9 activity in transplanted human kidneys then did than WNT2. These findings hint at differential deployment of paralogous Wnt2 genes in the progression from AKI to CKD between humans and mice. Therefore, we have uncovered a link that explains how the tissue regeneration process culminates in fibrosis.

[0120] The SOX9posCDH6poscell state contrasts with other known maladaptive cell types implicated in postinjury organ fibrosis, including senescent, partial epithelial to mesenchymal, or cell-cycle-arrested cells. However, it remains a possibility that with time these cell states might be subsequently attained due to the secondary effects of severely fibrotic adverse milieu. Sox9-expressing myofibroblasts have been linked with renal fibrosis. Our study, which used varied orthogonal approaches, did not reveal such cells in post-AKI fibrotic kidneys, although this does not completely rule out the possibility that this population exists.

[0121] Across phyla, damage-induced repair response represents a fundamental tissue survival mechanism. How does an injured tubular epithelial cell temporally sense its reparative state in vivo in damaged-tissue microenvironment that lacks resident stem or progenitor cell population? Is there a unifying, central “on-off” molecular switch? For example, in yeast, a single transcriptional control mechanism enables cells to respond to fluctuating nutrient concentrations. Herein, we identified SOX9 as a dynamic, fundamental, intrinsic transcriptional link between loss of epithelial integrity and regenerative response in vivo. We found that the Sox9on-oncell state is Bmp4 / Smads enriched (Fig.1D) and is a subset attaining a nephron progenitor-like cell state with time. It is tempting to speculate that an enhanced receptivity to the as-yet elusive signaling proteins in such disrupted epithelial cells drives Sox9 activity and resulting in a distinct cell state. However, how precisely such disruption might regulate Sox9 remains to be established. Further, we conceive a pharmacological approach to perturb the identified pathway and drug discovery processes are feasible based on our discovery.

[0122] In the present study, we have shown that the duration of the regeneration response is a key determinant of healing with or without fibrosis, with the SOX9posCDH6poscell state interconnecting the transition from AKI to CKD.

[0123] The datasets generated during this study are available in the Gene Expression Omnibus (GEO) database under accession no. GSE249781. These include single-cell sequencing (scRNA-seq) datasets (GSE196929); Sox9 cell-type-specific bulk RNAseq datasets (GSE249778); Axin2CreERT2 / +: R26RtdT / +:Acta2-GFP cell-type-specific bulk RNAseq4866-7185-2533.5Page 33 of 53 065472-000904WOPTdatasets (GSE249777); Sox9-lineage specific, time-resolved genomic occupancy assay datasets (GSE249776); and Sox9-lineage specific snATACseq data (GSE249780). Accession codes of the published data in GEO used in this study are as follows: RNAseq data for human kidney transplant biopsies: GSE126805 and single-nuclei RNAseq: GSE151167, GSE139107, and GSE163863). The accession codes for the published human scRNAseq data have been deposited in the European repository Biostudies under accession code E-MTAB-12051.

[0124] Materials and Techniques

[0125] All animal procedures were approved by the Cedars-Sinai Medical Center Institutional Animal Care and Use Committee, and institutional review board–approved human kidney biopsies were used. To induce the IRI-induced transition from AKI to CKD, 9- to 12- week-old weight-matched (25 to 30 g) mice were subjected to long-term survival compatible bilateral renal IRI surgery. To induce the transition from rhabdo-AKI to CKD, adult anesthetized mice (9 to 12 weeks old) were administered an intramuscular injection of 50% hypertonic glycerol solution in each quadriceps muscle (total dose, 8 mg / kg). For induction of CreERT2 protein, mice were injected with tamoxifen dissolved in corn oil through an intraperitoneal injection. For induction of doxycycline-inducible Cre protein, mice were injected with doxycycline dissolved in 0.9% normal saline intraperitoneally. Enzymatic digestion, which was conducted on ice to isolate cells from the kidney for RNA or nuclei extraction studies, used B. Licheniformis Cold Active Protease, Dnase1, and Liberase TL. Cell- type-specific bulk RNAseq libraries were constructed using the Universal plus mRNA-seq with NuQuant kit from NuGEN. Sample libraries were sequenced on the NovaSeq platform (Illumina) using 150–base pair paired-end sequencing. Single-cell RNA libraries were obtained using the Chromium platform. Sox9-lineage–specific single nuclei for snATAC-Seq studies were isolated according to the 10xGe-nomics protocol using the low-input version and with a 1:5 diluted lysis buffer in nuclease-free water. Isolated cell samples were immediately processed with a Chromium Next GEM Single Cell ATAC Kit v2 (10xGenomics). Cell pellets of ~100,000 FACS-enriched Sox9 lineage cells were subjected to Sox9 genomic occupancy assay, and the libraries generated from the immune-enriched DNA samples using the Illumina kit were analyzed using Partek Flow software v10. RNAscope based in situ hydridization assay was performed on 12-μm-cut, optimal cutting temperature (OCT)– embedded cryosections according to the manufacturer’s protocol. Most of the imaging was performed on the Zeiss 780 confocal system. Unpaired, two-sided Student’s t test was used to compare two independent groups.4866-7185-2533.5Page 34 of 53 065472-000904WOPT

[0126] All mice were on a C57BL / 6 background except Wifl / fl. The wild-type C57BL / 6 mice were obtained from Charles River, MA (USA). Only adult male Cre-drivers were used to generate Cre containing animals. Sox9IRES-CreERT2 / +, Axin2CreERT2 / +, Pdgfr-bCreERT2 / +mice, were crossed with reporter R26RtdTomato / tdTomato(hereafter referred to as R26RtdT / tdT) mice to obtain corresponding Sox9IRES-CreERT2 / + : R26RtdT / +, Axin2CreERT2 / +: R26RtdT / +, Pdgfr- bCreERT2 / +: R26RtdT / +mice for lineage tracing studies. Sox9IRES-CreERT2 / + : R26RtdT / +, Axin2CreERT2 / +: R26RtdT / +Pdgfr-bCreERT2 / +: R26RtdT / +mice, respectively, were crossed with reporter : Acta2-GFP mice to obtain corresponding Sox9IRES-CreERT2 / + : R26R tdT / + : Acta2-GFP, Axin2CreERT2 / +: R26R tdT / + : Acta2-GFP, Pdgfr-bCreERT2 / +: R26RtdT / +:Acta2-GFP to ascertain the spatiotemporal relationship of the lineages with Acta2-GFP+myofibroblast populations. Axin2CreERT2 / +mice were crossed with reporter R26RmTmG / mTmG(hereafter referred to as R26RmTmG / +) mice to obtain Axin2CreERT2 / +: R26R mTmG / + mice for lineage tracing studies. To label uninjured, normal adult proximal tubular epithelial cells, Slc34a1CreERT2 / +mice were crossed with R26RtdT / tdTanimals to obtain Slc34a1CreERT2 / +: R26RtdT / + animals. To generate tamoxifen-inducible, Acta2-specific, b-catenin knock-out mice that also enabled scrutiny of cells with successful recombination, first, Ctnnb1fl / fl : R26RtdT / tdTmice were obtained via breeding Ctnnb1fl / flcrossed to R26RtdT / tdT. Acta2CreER / + : Ctnnb1fl / + : R26RtdT / +were then obtained by crossing Acta2CreER / +to Ctnnb1fl / fl : R26RtdT / tdT. Acta2CreER / + : Ctnnb1fl / + : R26RtdT / + were bred with Ctnnb1fl / fl : R26RtdT / tdT animals to generate Acta2CreER / +;Ctnnb1fl / fl;R26RtdT / +knock-out animals. The Acta2CreER / +: Ctnnb1+ / +: R26RtdT / + served as controls. On similar lines,Sox9IRES-CreERT2 / +:Wisfl / fl: R26RtdT / +(Sox9-cell specific Wntless knock out mice) andSox9IRES-CreERT2 / +;Wntlessfl / +;R26RtdT / +control animals were generated. Here, the control animals retained a single active Wntless allele, as controls (SOX9:Wis-Het). Similar breeding strategy was employed to obtain LyzM-lineage specific, Wis-cKO (LyzMCre;WIfl / fl;R26RtdT / +) animals and corresponding wild-type control animals (LyzMCre;Wis+ / +;R26RtdT / +).

[0127] To generate doxycycline-inducible, nephron epithelia specific Sox9 knock-out mice which will also enable demarcation of cells with successful recombination, Sox9fl / fl : R26RtdT / tdTmice were obtained via breeding Sox9fl / flcrossed to R26RtdT / tdTand Pax8rTA:tetOCreanimals were generated by crossing Pax8rTAand tetOCreanimals. Sox9fl / fl : R26RtdT / tdTwere bred to Pax8rTA:tetOCreanimals to generate Pax8rtTA:tetOCre;Sox9fl / +;R26RtdT / +animals. The progeny crossed to Sox9fl / fl : R26RtdT / tdT to generate Pax8rtTA:tetOCre:Sox9fl / fl:R26RtdT / +(Sox9 conditional knock out) and Pax8rtTA;tetOCre;Sox9+ / +;R26RtdT / +(control, Sox9-WT) animals.4866-7185-2533.5Page 35 of 53 065472-000904WOPT

[0128] For induction of CreERT2 protein, mice were injected with tamoxifen (Sigma, #T5648) dissolved in corn oil (Sigma, #C8267) via an intra-peritoneal (i.p.) route. Briefly, tamoxifen was dissolved in corn oil at 20 mg / ml by continuous stirring in a glass silver-foil wrapped scintillation vial on a heated platform at 42°C for 2 hours. The stock solution (20mg / ml) was stored at 4°C for no more than one week. Prior to administration, tamoxifen solution was warmed for 10 min at 37°C. The dosing schedule, frequency, and timing of the administration are documented in the results. All animals underwent tamoxifen, 2 mg / injection unless otherwise stated.

[0129] For induction of doxycycline-inducible Cre protein, mice were injected with doxycycline (Sigma, #T5648) dissolved in 0.9% normal saline via an intra-peritoneal (i.p.) route. The dosing schedule, frequency, and timing of the administration are documented in the results. All animals underwent doxycycline, 2 mg / injection unless otherwise stated.

[0130] Acute kidney injury to chronic kidney disease models

[0131] Ischemia reperfusion injury-induced AKI model: Age- (9 – 12 weeks old) and weight –matched male (25 – 30 g) male mice were subjected to bilateral renal ischemia reperfusion injury (IRI) surgery. Briefly, mice were anesthetized with an intraperitoneal injection of ketamine / xylazine cocktail. The kidneys were approached via a midline abdominal incision, and both the renal pedicles were clamped for 19 minutes using non-traumatic microaneurysm clamps (Roboz Surgical Instrument Co.). A return to their original color after removal of the clamps indicated successful restoration of the blood flow. Sham-operated mice underwent a similar surgical intervention except for the clamping of the renal pedicles. The body temperature was maintained at 36°C throughout the procedure. The mice were euthanized at the desired study end-point. All surgeries were conducted between 2 pm and 7:30 pm.

[0132] Rhabdomyolysis injury-induced AKI model: Briefly, adult male mice (25 – 30 g, 9-12 weeks old) were anesthetized with an intraperitoneal injection of ketamine / xylazine cocktail, and AKI was induced by intramuscular injection of 50% hypertonic glycerol solution (Sigma) in phosphate buffered saline (PBS), injected in each quadriceps muscle of mice using insulin syringe (total dose, 8 mg / kg). Animals were euthanized at the desired study end-point.

[0133] Serum creatinine analysis

[0134] Serum creatinine levels were measured using an automated blood analyzer.

[0135] Mouse primary renal cortex epithelial cell culture

[0136] C57BL / 6J adult (10- to 12-week-old) male mice were euthanized as per the approved IACUC protocol and immediately perfused with cold PBS through the left heart ventricle. Kidneys were excised and placed in cold PBS in a 6 mm petri dish on ice for immediate4866-7185-2533.5Page 36 of 53 065472-000904WOPTprocessing. Kidney capsules were removed using sterile fine forceps. Cortices were dissected and thoroughly minced in warm DMEM / F12 medium using sterile fine forceps. The minced tissue was transferred to a nuclease-free 15 ml conical tube and resuspended in fresh 3 ml warm DMEM / F12 medium supplemented with 150 mg / ml Liberase TL (Roche), and incubated at 370C with continuous orbital shaking at 160 rpm. Tissue suspension was mixed by pipetting with a 1 mL pipette every 10 minutes until tissues were completely dissociated to form a single cell suspension. The enzymatic reaction was stopped using DMEM / F12 medium + 10% Fetal Bovine Serum. Cell suspension. Subsequently, the cell suspension was filtered through a 40 μm cell strainer (BD Biosciences). The filtrate was then centrifuged at 300 g for 5 min at 40C, and the pellet was resuspended in DMEM / F12 medium + 10% FBS. For confluency experiments, 2 million cells / well were transferred to a 6-well plate followed by a medium change after 48 hours. For sub confluent (40 – 50% confluency) and confluent (95 – 100%, tight monolayer formation) analyses, cells were collected at day 4 and day 7, respectively. A day before harvesting confluent cells, the cells were serum starved for 24 hours.

[0137] Human primary renal proximal tubular epithelia cells (ATCC #PCS-400-010), cultured in renal epithelial cell basal medium (ATCC #PCS-400-030) supplemented with renal epithelial cell growth kit (ATCC #PCS-400-040), at 37°C, 5% CO2 were cultured to either sub-confluent (40 – 50% confluency) or confluent (95 – 100%, tight monolayer formation) state.

[0138] In vitro recombination cell experiment

[0139] For in vitro recombination, 1.3 µM 4OH-TAM (Sigma-Aldrich #H7904) or equal volume of vehicle (methanol) was administered to cells 48 hours after isolation. Cells were analyzed 48 hours post treatment.

[0140] Bone marrow macrophage

[0141] For in vitro validation of LyzMCre;WIfl / fl;R26RtdT / +knock out mice, bone marrow cells were flushed from femurs and tibiae of LyzMCre;WIfl / fl;R26RtdT / +knock out or LyzMCre;WI+ / +;R26RtdT / +control mice using cold RPMI-1640 (Corning #10-041-CV) and 31G needle-syringe (BD). Cells were passed through syringe multiple times followed by a 70 µm cell strainer (Fisher Scientific #08-771-2) to obtain a single cell suspension, washed, and counted. Cells were then seeded at a density of 2 x 106per well of a 6-well plate (Nunc #140675) and were cultured in complete RPMI-1640, supplemented with 10% fetal bovine serum, 1x penicillin-streptomycin (Millipore Sigma #P4333), and 50 ng / ml recombinant human M-CSF (PeproTech #300-25). On day 4, culture medium was changed with fresh complete medium, and cells were collected by trypsinization after 7 days of culture and used for assays.4866-7185-2533.5Page 37 of 53 065472-000904WOPT

[0142] Masson’s Trichrome (MTC) staining

[0143] Mouse kidneys were perfused with ice-cold PBS and fixed overnight in 4% paraformaldehyde (PFA) at 4°C. Tissues were processed and embedded in paraffin using Leica ASP300S machine according to the routine histology protocols. 4 μm thick paraffin sections were cut using Leica RM2255 machine and slides containing tissue sections were stained for MTC staining as per standard protocols. Briefly, tissue sections were deparaffinized by incubating at 60°C for 1 hour and subjected to serial order of Xylene and decreasing ethanol concentration (100% to 50%) for 5 min each step. Slides were washed in water and incubated for 1 hour in Bouin solution at 60°C. Slides were then cooled to room temperature, washed with running water and 1% Ammonium hydroxide in 70% ethanol. Slides were then incubated with different staining solutions serially with Weigert’s Hematoxylin (10 min), Biebrich Scarlet- Fuchsin acid solution (2 min), Phosphomolybdic acid solution (12 min), Aniline blue in acetic acid (8 min) and washed with running water after each step. All chemicals were purchased from Sigma. Slides were dehydrated and mounted with mounting medium (Richard-Allan Scientific #4112) and dried overnight under the chemical hood. Images were acquired using slide scanner (Zeiss Axioscan.Z1).

[0144] Analysis, co-immunoanalysis and histological evaluation of renal fibrosis

[0145] The degree of interstitial fibrosis was evaluated by a board-certified renal pathologist (MY) in a blinded manner on Masson’s trichrome-stained slides as follows: 0: <5% fibrosis, 0.5: 5% to 10% fibrosis, 1: 10% to 25% fibrosis, 2: 25% to 50% fibrosis, and 3: >50% fibrosis. All the study animals were coded, and all data were generated using at least n=3 biological replicates unless stated otherwise. The precise numbers of animals included in each group or intervention are stated in the respective legend section and no datapoints were excluded in the analysis. All the quantifications involving the coded control and knock out animals were conducted via a blinded analysis. Blinded whole scanned kidney images in certain instances, for example, from Sox9-Ctrl and Sox9-cKO animals were examined. It was ensured that the sections that contain the entire longitudinal section of the kidney highlighted by the presence of outer / inner medulla were interrogated. Such sections were randomly selected and random representative images of the regions were attained. Quantification that involved interrogation of cells of interest for example tdTposcells, random images were taken of fields containing such cells of interest. For Cdh6 negative lineage: Random images of the lineage-traced cells that were Cdh6 negative thus demarcating the Sox9on-offstate (regenerated lineage, tdTposCdh6neg) were interrogated for adjacent aSMA myofibroblast response. Vice versa, Sox9on-onCdh6poscells4866-7185-2533.5Page 38 of 53 065472-000904WOPTwould highlight unresolved regenerated lineage. For comparing two independent groups, unpaired, 2-sided Student’s t-test was utilized.

[0146] Kidney cell isolation for Fluorescence Activated Cell Sorting (FACS) and single-cell sequencing (modified cold enzymatic digestion protocol)

[0147] Mice were euthanized as per the approved IACUC protocol and immediately perfused with cold PBS through left heart ventricle. Kidneys were then excised and placed in cold PBS in a 6 mm petri dish on ice for further processing. Kidney capsules were removed using sterile fine forceps. Cortices and outer medulla regions of the kidney were dissected and thoroughly minced in 1 ml cold DMEM / F12 medium using sterile fine forceps. The minced tissue was transferred to a nuclease-free 15 ml tube and resuspended in fresh 1ml DMEM / F12 medium supplemented with 7.5 mg / ml of B. Licheniformis Cold Active Protease (Creative enzymes), 125 U / ml Dnase1 (Stem cell technologies) and 0.1mg / ml Liberase TL (Roche) and continuously kept on ice for 1 hour with frequent pipetting using 1 ml pipette every 10 min. After complete dissociation of tissues into single cells (an aliquot of cell suspension was taken every 20 min to check dissociation of the tissue under the microscope), the enzymatic reaction was stopped using cold DMEMF12 medium + 10% FBS. The cell suspension was filtered through a 40 μm cell strainer. The filtrate was then centrifuged at 300 g for 5 min and transferred to 5 ml Polystyrene Round-Bottom FACS tubes (BD Biosciences). Cells were washed in PBS and resuspended in 1.5 ml of FACS sorting buffer containing 1 mg / ml DAPI (1:1000, Life Technologies) or APC / Cyanine7 anti mouse F4 / 80 antibody (1:20, Biolegend #132118), when required. Cell sorting was performed using the FACSAria III cell sorter (BD Biosciences). Cell populations were gated to exclude debris and doublets using FACSDiva software (BD Biosciences). Cells were collected from relevant gated cell populations in 1.5mL collection tubes (Eppendorf) containing collection buffer. Sorted cells were immediately centrifuged at 300g for 10 minutes at 4 degrees Celsius. Cell pellets were resuspended in RLT buffer (Qiagen) for RNA isolation using Rneasy Micro Kit (Qiagen). FlowJo software (Tree Star) was used for further analysis and live cells were gated as DAPI negative population after excluding doublets using FSC-H and SSC-H gates.

[0148] shRNA lentiviral vectors and infection

[0149] Mouse Sox9 shRNA vectors pLKO.1-sh-mSox9-5 (28) (Addgene #40646), non- hairpin control pLKO.1-TRC control (Addgene #10879), packaging vector psPAX2 (Addgene #12260) and envelope vector pMD2.G (Addgene #12259) were purchased from Addgene. shRNA vectors pLKO.1-sh-mSox9-5 and pLKO.1-TRC plasmids were digested using BamHI (NEB #R3101S) and KpnI (NEB R3142S) to remove puromycin resistant gene and to insert4866-7185-2533.5Page 39 of 53 065472-000904WOPTeGFP reporter. Lentivirus Production: HEK293T cells (ATCC CRL-11268), cultured in DMEM supplemented with 10% FBS, at 37°C, 5% CO2, were seeded at ~90% confluency in T-75 flask the day before transfection. On the day of transfection, 10.2 µg pLKO.1-shRNA plasmid, 7.8 µg psPAX2 plasmid and 5.1 µg pMD2.G plasmid were co-transfected into HEK293T cells using Transporter 5 transfection reagent (Polysciences #26008-5) according to the manufacturer’s instructions. Medium was replaced 18 hours post transfection. Viral supernatant was harvested at 24, 48, and 72 hours post transfection, centrifuged, and filtrated through a 0.45 um filter. The filtrated viral supernatant was then concentrated using Lenti-X concentrator (Takara #631232) according to the manufacturer’s instructions, aliquoted and stored in -80°C. Lentivirus Transduction: Before lentivirus transduction, mouse primary cells were cultured to ~30% confluency. On the day of transduction, the medium was changed to fresh DMEM / F-12 with 10% FBS containing 8 µg / mL polybrene and lentivirus (MOI=30). The second transduction was performed 24 hours post the first transduction.24 hours post 2ndtransduction, the cells were cultured in fresh medium and were ready for analysis 96 hours post 1sttransduction.

[0150] Table 1. Primers used for plasmid construction Name Sequence BAMHI-EGFP-F TCCGGATCCACCGGAGCTTACCATGGTGAGCAAGGGC (SEQ ID NO:1) KPNI-EGFP-R ACCGGTACCTTACTTGTACAGCTCGTC (SEQ ID NO:2)

[0151] Quantitative PCR

[0152] Rneasy Mini Kit (QIAGEN #74104) was used to isolate total RNA from cultured cells or RNAlater (Life Technologies #AM7020) preserved tissues. Rneasy Micro Kit (QIAGEN #74004) was used to isolate total RNA from FACS sorted cells. cDNAs were synthesized using SuperScript VILO cDNA Synthesis Kit (Life Technologies #11754050) according to the manufacturer’s instructions. Quantitative PCR (qPCR) was performed using PowerUp SYBR Green Master Mix (Life Technologies #A25742) on a QuantStudio 3 real-time PCR system. For cultured cells or RNAlater preserved tissues, 5 ng of cDNA, and for sorted cells 0.25 ng cDNA was used in each reaction. For sorted cells, 0.25 ng cDNA was used in each reaction. See table S5 for primers used for qPCR.

[0153] Western Blot

[0154] Cells were homogenized in cold RIPA buffer (ThermoScientific #89900) supplemented with phosphatase inhibitors PhosStop tablet (Roche #04906837001), Complete protease inhibitor (Sigma #11697498001) and PMSF (Sigma #93482-50ml-F), directly in the cell4866-7185-2533.5Page 40 of 53 065472-000904WOPTculture dish on ice. The cell extract was then incubated on ice for 30 minutes with intermittent vortexing and then centrifuged at maximum speed of 14000 rpm for 12 minutes at 4°C. Supernatant containing proteins was collected and quantified using Pierce BCA protein estimation kit (Thermo Scientific).15mg protein of interest was resuspended in 6X Laemmli SDS Sample buffer (Bioland Scientific LLC #SAB03-02), boiled for 5 min at 95°C and kept on ice for further processing. Proteins were separated by SDS-PAGE (Invitrogen) and transferred onto nitrocellulose membranes (0.2 mm, Biorad) overnight using wet transfer apparatus (Invitrogen). The membranes were blocked with 5% BSA (Sigma) in PBS for 2 hours at room temperature and detected using the primary antibodies against ACTB (1:1000, Cell Signaling Technology #4967S), SOX9 (1:1000, Abcam#AB185230), and CDH6 (1:500, Sigma #HPA007047) diluted in 2.5% BSA in 0.1% PBS-Tween. All primary antibodies were incubated overnight at 4°C. All secondary antibodies were used at 1:3000 and incubated for 1 hour at room temperature. Freshly prepared SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific) was used to visualize the proteins simultaneously by Chemi / infrared detection using the Li-Cor Odyssey Imaging System. Bands were quantified with ImageJ software (NIH).

[0155] Immunofluorescence Staining

[0156] Ice-cold PBS perfused kidneys were fixed for 1.5 hours in 4% PFA (Santa Cruz #SC-281692) at 4 degree Celsius, incubated overnight in 30% sucrose in PBS and cryoblocked in OCT (VWR #25608-930). The cryoblocks were then sectioned to 6-micron sections using a Leica CM3050S Cryostat and mounted on Superfrost slides. Cryo sections were incubated with primary antibodies.

[0157] At the day of IF staining, cryosections were brought to room temperature from - 80 freezer and washed using PBS to remove OCT. The sections were then permeabilized using PBST (PBS with 0.1% Triton X-100) and blocked for 2 hours in blocking buffer (PBST with 3% BSA and 5% Donkey / Goat serum). After blocking, sections were incubated with primary antibodies diluted in blocking buffer at 4°C overnight. The next day, the sections were incubated with secondary antibodies at room temperature for 1 hour and then with 1 mg / ml DAPI in PBS for 10 minutes. Finally, the sections were mounted using fluorescence mounting medium (Agilent Technologies, #S302380) and sealed with nail polish (Electron Microscopy Sciences, #72180). Images were acquired using confocal (Carl Zeiss 780 LSM), and / or slide scanner (Zeiss Axioscan.Z1). Videos were acquired using confocal Leica Sp8 X microscope.

[0158] Secondary antibodies used in the study are detailed in table S7. Images were acquired using confocal (Carl Zeiss 780 LSM), and / or slide scanner (Zeiss Axioscan.Z1).

[0159] RNAscope4866-7185-2533.5Page 41 of 53 065472-000904WOPT

[0160] RNAscope based in situ hybridization (ISH) assay was performed on 12 µm cut kidney OCT-embedded cryosections following the RNAscope RNA-Protein Co-detection Ancillary Kit (Advanced cell diagnostics (ACD), Cat# 323180) and Multiplex Fluorescent Reagent Kit v2 kit (ACD, Cat# 323100) as per the kit protocol (document number: MK51-150 TN and document number: 323100-USM). Briefly, cryosections (12 µm) were taken out from - 80°C freezer and fixed with fresh 4% PFA overnight at 4°C. Next day, sections were processed with alcohol-gradient based dehydration and antigen retrieval steps and incubated with primary antibody of interest overnight at 4°C after the pretreatment steps. The following day, sections were washed with PBS and incubated with specific probes for 2 hours. Sox9-C1 probe was used as diluent for Wnt4-C2 (1:75), and Bmp4-C2 (1:50). RNAscope Multiplex fluorescent v2 assay protocol was followed hereafter for the development of fluorescent signal and the signal for RNA was detected using 1:750 dilution of Opal dyes-570 (Akoya Biosciences; cat# FP1488001KT) and Opal dyes-690 (Akoya Biosciences; cat# FP1497001KT) for the respective C1 or C2 probe channel. Thereafter, sections were incubated with Alexa Fluor conjugated secondary antibody- 488 (ThermoFisherScientific) for the antibody co-detection. The negative control (without any RNA probe) and the positive control Slc12a3 was treated with the similar protocol (but without antibody detection) and run alongside the experimental sections. RNA probes were purchased from ACD. Transcript quantifications in the images was performed using the ‘spots’ algorithm of the Bitplane Imaris 9.3.1. software. Briefly, diameter was chosen for each spot using the ‘spots’ algorithm and applied automatically to each image with a set threshold and the total number of spots per image per volume were quantified per channel. It was then normalized to the number of DAPI positive nuclei quantified with the same algorithm in the same image and presented as the average of 1215 images per mice in each group.

[0161] Bulk-RNA sequencing and bioinformatics analysis

[0162] Library construction was performed using Universal plus mRNA-seq with NuQuant kit from NuGEN. Briefly, total RNA samples were assessed for concentration using a Nanodrop (Nanodrop ND8000, Thermo Fisher Scientific, Carlsbad, CA) and quality using the TapeStation (4200 TapeStation, Agilent Technologies, Santa Clara, CA). Up to 30 ng of total RNA per sample was used for poly-A mRNA selection. Libraries for RNA-Seq were prepared with Nugen Universal plus mRNA-Seq Kit (part number: 0508) to generate strand-specific RNA- seq libraries. The workflow consists of poly(A) RNA selection, RNA fragmentation and double- stranded cDNA generation using a mixture of random and oligo(dT) priming, followed by end repair to generate blunt ends, adaptor ligation, strand selection, and PCR amplification to produce the final library. Different index adaptors were used for multiplexing samples in one sequencing4866-7185-2533.5Page 42 of 53 065472-000904WOPTlane. The concentration of the amplified library was measured with a Qubit fluorometer and an aliquot of the library was resolved on a Bioanalyzer. Sample libraries are multiplexed and sequenced on a NovaSeq GAP 285 platform (Illumina) using 150 bp paired-end sequencing. On average, about 30 million reads were generated from each sample. Data quality check was done on Illumina SAV. Demultiplexing was performed with Illumina Bcl2fastq2 v 2.19.1.403 program.

[0163] Bioinformatic analysis of RNA-seq of FACS sorted, labeled kidney cell- types

[0164] Raw sequencing data was demultiplexed and converted to fastq format by using bcl2fastq v2.20 (Illumina, San Diego, CA). Then reads were aligned to the transcriptome using STAR (version 2.6.1) (63) / RSEM (version 1.2.28) with default parameters, using a custom MOUSE GRCh38 transcriptome reference downloaded from www.gencodegenes.org, containing all protein coding and long non-coding RNA genes based on MOUSE GENCODE version 33 annotation. Expression counts for each gene in all samples were normalized by a modified trimmed mean of the M-values normalization method and the unsupervised PC analysis (PCA) was performed with DESeq2 Bioconductor package version 1.26.0 in R version 3.6.3. Each gene was fitted into a negative binomial generalized linear model, and the Wald test was applied to assess the differential expressions between two sample groups by DESeq2. Benjamini and Hochberg procedure was applied to adjust for multiple hypothesis testing, and differential expression gene candidates were selected with a false discovery rate less than 0.05. Further filtering of candidate differentially expressed genes to false discovery rate less than 0.01 and an absolute log 2-fold-change greater than 1 was applied to the studies comparing normal uninjured PTEC vs. Sox9:48h IRI vs. Sox9: day14 post IRI. GO term enrichment was conducted with DAVID retaining only terms with a p-value for enrichment less than 0.01. After manually merging redundant biological process GO terms, relevant terms among the top 20 were plotted using custom scripts in R and the ggplot2 (version 3.3.3) package. For visualization of coordinated gene expression in samples, a two-way hierarchical clustering with Pearson correlation distance matrix was performed with samples and DEG candidates using the Bioconductor g-plots package (version 3.0.3) in R. MA plots, and PCA plots were created using custom R scripts and the Bioconductor FactoMineR package (version 2.4).

[0165] Bioinformatic analysis of single cell RNA-sequencing

[0166] Sequencing library construction using the Chromium platform: Single-cell RNA-Seq libraries were prepared per the Single Cell 3′ v3 Reagent Kits User Guide (10X Genomics, Pleasanton, California). Cellular suspensions were loaded on a Chromium Controller4866-7185-2533.5Page 43 of 53 065472-000904WOPTinstrument (10X Genomics) to generate single-cell Gel Bead-In-Emulsions (GEMs). GEM-RT was performed in a Veriti 96-well thermal cycler (Thermo Fisher Scientific, Waltham, MA). GEMs were then harvested, and the cDNA amplified and cleaned up with SPRIselect Reagent Kit (Beckman Coulter, Brea, CA). Indexed sequencing libraries were constructed using Chromium Single-Cell 3′ Library Kit for enzymatic fragmentation, end-repair, A-tailing, adapter ligation, ligation cleanup, sample index PCR, and PCR cleanup. The barcoded sequencing libraries were quantified by quantitative PCR using the KAPA Library Quantification Kit for Illumina platforms (KAPA Biosystems, Wilmington, MA). Sequencing libraries were loaded on a NextSeq500 (Illumina, San Diego, CA) with a custom sequencing setting (26bp for Read 1 and 98bp for Read 2) to obtain a sequencing depth of ~200K reads per cell.

[0167] Data analysis: Raw sequencing data was demultiplexed and converted to FASTQ format using bcl2fastq v2.20. Cell Ranger v6.0.2 (10X Genomics) was used for barcode identification, read alignment, and UMI quantification with default parameters and aligning to the mouse reference genome GRCm38. In addition to the empty droplet filtering performed by Cell Ranger, poor-quality cells were removed by setting a maximum mitochondrial read percent (35%), minimum UMI count (1000), and an acceptable range of detected genes (min 300, max 7000). The samples were integrated together with Seurat v4.0.5 (64) in R v4.1.1 using the functions SCTransform() followed by FindIntegrationAnchors(). To obtain two-dimensional projections of the population’s dynamics, principal component analysis (PCA) was run on the SCTransformed gene-barcode matrix to reduce the number of feature dimensions. After running PCA, both UMAP and tSNE algorithms were applied on the top 20 principal components to further reduce these components and to visualize cells in a two-dimensional space. Following Louvain clustering of the cells, cell types were identified based on expression of known marker genes for kidney cell types. Clusters without common marker gene expression were annotated by mapping orthologous gene expression to the Azimuth Kidney reference. Differential expression analysis were conducted with Seurat using the function FindMarkers() on the normalized RNA expression matrix. Subsequent GO enrichment analysis were conducted using the R package ClusterProfileR with term annotations drawn from the R package org.Mm.eg.db. Single-cell tSNE and UMAP embeddings GO enrichment plots were created with custom R scripts.

[0168] Human Renal allograft RNA-seq.

[0169] Genome-wide gene expression profiling using RNA-seq was performed in kidney allograft recipients as previously described. Briefly, 42 patients were enrolled at the University4866-7185-2533.5Page 44 of 53 065472-000904WOPTHospitals of Leuven. Protocol biopsies were performed at four different time points: before implantation (kidney flushed and stored in ice), after reperfusion (at the end of the surgical procedure) and 3 and 12 months after transplantation. The library was prepared with Clontech SMARTer technology at the Genome Technology Access Center of the Washington University (St. Louis, Missouri, USA). The sequencing was performed in the same laboratory using the HiSeq 3000 system on the Illumina platform, with a target of 30 M reads per sample. The reads were aligned to the Ensembl top-level assembly with STAR version 2.0.4b. Gene correlation analysis, linear regression analysis and group comparisons were performed with Prism 9, Graphpad.

[0170] Analysis of published single-nuclear RNA-Seq (snRNA-Seq)

[0171] snRNA-Seq data were obtained from datasets previously described. Seurat v3.2.0 in R v4 was used for analyses, including normalization, scaling, and clustering of nuclei. First, we analyzed each data set separately and excluded nuclei with fewer than 150 or more than 8000 genes detected. We also excluded nuclei with a relatively high percentage of unique molecular identifiers mapped to mitochondrial genes (>1) and ribosomal genes (>1, for normal kidney sample; and >2, all other samples). We performed curated doublet removal based on known lineage-specific markers. The samples from different data sets were integrated to avoid batch effect using Seurat standard workflow splitting by data set. Following ScaleData, RunPCA, FindNeighbours, and FindCluster at a resolution of 0.5 were performed and cluster annotated based on standard markers. We focused our analysis on the proximal tubular compartment selecting 4 h, 12 h, 48 h, 64 h, and 14 day time points, which are covering the time points 48 h and 10 days extensively characterized in this paper. For data visualization, we used RunUMAP and FeaturePlot from Seurat. Trajectory analysis was performed using Slingshot setting PT cluster as staring point.

[0172] Single nuclei ATAC sequencing

[0173] TdTomato positive enriched sorted cells were processed following the manufacture instruction. Sorted cells nuclei were isolated as described in 10xGenomics protocol (CG000169 Nuclei Isolation for Single Cell ATAC Sequencing), following the low input version and with a 1:5 diluted Lysis Buffer in Nuclease-free water. Isolated cell samples were immediately processed with a Chromium Next GEM Single Cell ATAC Kit v2 (10xGenomics).

[0174] Bioinformatic processing

[0175] TdT+ filtered peak matrices were generated at the Genomic Core at Cedars-Sinai with Cell Ranger. Datasets were analyzed with ArchR and plots were postprocessed with4866-7185-2533.5Page 45 of 53 065472-000904WOPTggplot2. In brief, the summarized pipeline consisted in datasets quality check and basic filters were applied filtering doublets and cells considered of bad quality (low TSS enrichment and or number of fragments based on a combined bidimensional threshold function). For dimensional reduction and bach corrections iterative LSI and Harmony algorithms were applied with UMAP embedding generated over the harmony-derived matrix. Preliminary clustering was generated by graph-based clustering and cluster marker gene tested with Wilcoxon statistic approach. Chromatin accessibility enrichment was denoised by weight imputation based on Markov affinity-based graph imputation of cells diffusion matrix. Low quality clusters were filtered, and remaining cells reprocessed. Integration with scRNAseq datasets was used to define a preliminary cell type clustering which was refined based in the internal clustering of the scATACseq datasets. MACS2 was used for calling peaks and motif enrichment was defined using the CisBP motif set and chromVAR package. A supervised trajectory analysis (defined by the unsupervised trajectory determined in the scRNAseq datasets) was calculated and integrative pseudo-time analyses were carried out with the default parameters in ArchR in a subset of the snATACseq dataset corresponding to the Sox9On-Onpopulation lineage. CUT&RUN genomic occupancy assay Cells pellets of around 100.000 cells from 2 or 10 days post injury were lightly fixed in 0.2% PFA and frozen at –80 for storage until all samples were collected. Each sample was split into 3 aliquots to be processed with a Sox9 antibody (#AB5535, Millipore), as a positive control with H3K4me3 (#9751, Cell Signaling) or as an input control. CUT&RUN assays were carried out with the Cell Signaling assay kit and protocol (Catalog number #86652, Cell Signaling) and next-generation sequencing libraries were generated from the immuno-enriched DNA samples using the DNA Library Prep Kit for Illumina with the Multiplex Oligos for Illumina Systems (Dual Index Primers) kits (#56795 and #47538, Cell Signaling, respectively). The final library quality was assessed by fragment size in a TapeStation before sequencing. Bioinformatic processing

[0176] Libraries were analyzed with Partek Flow software v10. In brief, unaligned reads were filtered out of contaminants using default parameter in the Filter contaminants (Bowtie 2) - 2.2.5 Partek task and then aligned with the Bowtie 2.0.0 algorithm. Peaks calling was carried out using MACS3 using the input datasets as background peaks and a Cutoff q-value of 0.01 and the mm10 mouse genome version, additionally, scale was adjusted to the larger dataset in the Partek parameters for the MACS3 algorithm. Genomic regions were quantified with the defaults parameter in Partek flow and normalized to transcripts per million counts in each library to explore the samples with PCA analysis accounting by feature variability. Differential region4866-7185-2533.5Page 46 of 53 065472-000904WOPTenrichment was analyzed with Partek Flow’s version of the GSA algorithm. Motif enrichment was studied within the positively enriched regions of the GSA analysis at 10 and 2 days against the JASPAR vertebrate database of binding motifs with a following manual curation of transcript factor motifs present in mouse. The enriched genesets between 48 hours and 10 days Sox9 CUT&RUN datasets were used for pathway analysis against the Gene Ontology (GO) database on Partek. Expression of significatively enriched GO pathway terms gene sets was cross analyzed in the scRNAseq datasets between 48 hours and 10 days samples using Seurat software, genes included in the subsequent GO pathway heatmap were filtered by adjusted p value < 0.05.

[0177] Table 2. Primers used for qPCR. Gene Forward Primer Sequence Reverse Primer Sequence Name Actb TATTGGCAACGAGCGGTTC (SEQ ID CCATACCCAAGAAGGAAGGCT (SEQ NO:3) ID NO:4) Sox9 GAGCCGGATCTGAAGAGGGA (SEQ GCTTGACGTGTGGCTTGTTC (SEQ ID NO:5) ID NO:6) Havcr1 ACATATCGTGGAATCACAACGAC ACAAGCAGAAGATGGGCATTG (SEQ (SEQ ID NO:7) ID NO:8) Wnt4 AGACGTGCGAGAAACTCAAAG (SEQ GGAACTGGTATTGGCACTCCT (SEQ ID NO:9) ID NO:10) Wnt7b TTTGGCGTCCTCTACGTGAAG (SEQ CCCCGATCACAATGATGGCA (SEQ ID NO:11) ID NO:12) Wnt9b CTGGTGCTCACCTGAAGCAG (SEQ ID CCGTCTCCTTAAAGCCTCTCTG NO:13) (SEQ ID NO:14) Wnt11 GCTGGCACTGTCCAAGACTC (SEQ ID CTCCCGTGTACCTCTCTCCA (SEQ NO:15) ID NO:16) Sfrp1 CAACGTGGGCTACAAGAAGAT (SEQ GGCCAGTAGAAGCCGAAGAAC ID NO:17) (SEQ ID NO:18) Axin2 TGACTCTCCTTCCAGATCCCA (SEQ TGCCCACACTAGGCTGACA (SEQ ID ID NO:19) NO:20) Col1a1 GCTCCTCTTAGGGGCCACT (SEQ ID CCACGTCTCACCATTGGGG (SEQ ID NO:21) NO:22) Col3a1 ACGTAGATGAATTGGGATGCAG (SEQ GGGTTGGGGCAGTCTAGTG (SEQ ID NO:23) ID NO:24) Acta2 GTCCCAGACATCAGGGAGTAA (SEQ TCGGATACTTCAGCGTCAGGA (SEQ ID NO:25) ID NO:26) Nkd1 AGGAAAGGCATCGAGGAGTG (SEQ TCGCTCAGTCTCTCCATTCTC (SEQ ID NO:27) ID NO:28) Nkd2 GAGCGGAAGAAACGGACCG (SEQ ID CCTTAGGGTCTCCATTGAGCA (SEQ NO:29) ID NO:30) Fdz7 CGGGGCCTCAAGGAGAGAA (SEQ ID GTCCCCTAAACCGAGCCAG (SEQ ID NO:31) NO:32) Lef1 TGTTTATCCCATCACGGGTGG (SEQ CATGGAAGTGTCGCCTGACAG (SEQ ID NO:33) ID NO:34) Fn1 ATGTGGACCCCTCCTGATAGT (SEQ GCCCAGTGATTTCAGCAAAGG (SEQ ID NO:35) ID NO:36)4866-7185-2533.5Page 47 of 53 065472-000904WOPTWnt2 CTCGGTGGAATCTGGCTCTG (SEQ ID CACATTGTCACACATCACCCT (SEQ NO:37) ID NO:38) Wnt2b CCGACGTGTCCCCATCTTC (SEQ ID GCCCCTATGTACCACCAGGA (SEQ NO:39) ID NO:40) Example 2. WNT2B as a biomarker for kidney fibrosis.

[0178] QPCR-based analysis of RNA isolated from paraffinized biopsy samples of transplanted human kidneys from patient 1, patient 2, and patient 3 revealed an elevation in WNT2B mRNA levels by 2.53-fold, 6.43-fold, and 8.47-fold, respectively, compared to the control sample. This observed upregulation aligned with the response seen in COL1A1 (a fibrosis marker) mRNA, which showed elevations of 3.48-fold, 27.62-fold, and 32.84-fold in these respective patients. (Figure 29.) Therefore, these findings unveil WNT2B, a secretory peptide, as a biomarker for kidney fibrosis. It can serve as a guide to customize calcineurin inhibitor-based immunosuppressive regimens and represents a therapeutic target for kidney fibrosis.

[0179] Various embodiments of the invention are described above in the Detailed Description. While these descriptions directly describe the above embodiments, it is understood that those skilled in the art may conceive modifications and / or variations to the specific embodiments shown and described herein. Any such modifications or variations that fall within the purview of this description are intended to be included therein as well. Unless specifically noted, it is the intention of the inventors that the words and phrases in the specification and claims be given the ordinary and accustomed meanings to those of ordinary skill in the applicable art(s).

[0180] The foregoing description of various embodiments of the invention known to the applicant at this time of filing the application has been presented and is intended for the purposes of illustration and description. The present description is not intended to be exhaustive nor limit the invention to the precise form disclosed and many modifications and variations are possible in the light of the above teachings. The embodiments described serve to explain the principles of the invention and its practical application and to enable others skilled in the art to utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated. Therefore, it is intended that the invention not be limited to the particular embodiments disclosed for carrying out the invention.

[0181] The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range.4866-7185-2533.5Page 48 of 53 065472-000904WOPTUnless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein.

[0182] While particular embodiments of the present invention have been shown and described, it will be obvious to those skilled in the art that, based upon the teachings herein, changes and modifications may be made without departing from this invention and its broader aspects and, therefore, the appended claims are to encompass within their scope all such changes and modifications as are within the true spirit and scope of this invention. It will be understood by those within the art that, in general, terms used herein are generally intended as “open” terms (e.g., the term “including” should be interpreted as “including but not limited to,” the term “having” should be interpreted as “having at least,” the term “includes” should be interpreted as “includes but is not limited to,” etc.). As used herein the term “comprising” or “comprises” is used in reference to compositions, methods, and respective component(s) thereof, that are useful to an embodiment, yet open to the inclusion of unspecified elements, whether useful or not. It will be understood by those within the art that, in general, terms used herein are generally intended as “open” terms (e.g., the term “including” should be interpreted as “including but not limited to,” the term “having” should be interpreted as “having at least,” the term “includes” should be interpreted as “includes but is not limited to,” etc.). Although the open-ended term “comprising,” as a synonym of terms such as including, containing, or having, is used herein to describe and claim the invention, the present invention, or embodiments thereof, may alternatively be described using alternative terms such as “consisting of” or “consisting essentially of.”4866-7185-2533.5Page 49 of 53 065472-000904WOPT

Claims

WHAT IS CLAIMED IS:

1. A method for assaying a biological sample obtained from a subject having received transplantation of a kidney allograft or having had an acute kidney injury (AKI), and optionally the subject being suspected of or desiring a determination regarding presence of a fibrotic kidney disease or a chronic kidney disease (CKD), the method comprising: detecting a cadherin-6 (CDH6) level, a wingless-type MMTV integration site (WNT) 2B (WNT2B) level, or both in the biological sample obtained from the subject.

2. The method of claim 1, wherein the detection is detecting a higher CDH6 level, a higher WNT2B level, or both in the biological sample obtained from the subject relative to a control.

3. The method of claim 2, wherein if the subject is one having received the transplantation, the subject detected with the higher CDH6 level, the higher WNT2B level, or both has increased severity of kidney interstitial fibrosis, reduced renal function, and / or an increased likelihood of delayed graft function, compared to a reference subject having received a renal transplantation and whose CDH6 and / or WNT2B level is not higher than the control, and wherein if the subject is one having had the AKI, the subject detected with the higher CDH6 level, the higher WNT2B level, or both has an increased likelihood of developing or possessing the fibrotic kidney disease or the CKD, compared to a reference subject having had an AKI and whose CDH6 and / or WNT2B level is not higher than the control.

4. The method of claim 1, wherein the biological sample comprises a renal allograft biopsy or a renal biopsy.

5. The method of claim 4, wherein the detected CDH6 level, WNT2B level, or both is in proximal tubule of the biological sample.

6. The method of claim 5, wherein the detected CDH6 level, WNT2B level, or both is in proximal tubular epithelial cells of the renal allograft biopsy or the renal biopsy.

7. The method of claim 1, wherein the biological sample comprises a blood or urine specimen.

8. The method of claim 1, wherein the detected level comprises protein expression level, mRNA level, or both.

9. The method of any one of claims 1-8, wherein the subject is one having received the transplantation, and the biological sample is obtained at least 3 months after the kidney4866-7185-2533.5Page 50 of 53 065472-000904WOPTtransplantation; or wherein the subject is one having had the AKI, and the biological sample is obtained at least 3 months after beginning of the AKI.

10. The method of claim 9, wherein the subject is the one having received the transplantation, and the biological sample is obtained about 12 months after the kidney transplantation.

11. The method of any one of claims 1-8, wherein the subject is one having received the transplantation, and the control is respective CDH6 level and / or WNT2B level of a living kidney donor immediately before, or within 2 weeks before, isolation from the donor.

12. The method of any one of claims 1-8, wherein the subject is one having received the transplantation, and the control is respective CDH6 level and / or WNT2B level of a reference subject having received a kidney transplantation and repaired kidney function, without transitioning to or developing chronic kidney injury in at least 12 months post-transplantation, or the control is respective level of a reference subject who does not have a fibrotic kidney disease.

13. The method of any one of claims 1-8, further comprising detecting an SRY-box transcription factor 9 (SOX9) level in the biological sample obtained from the subject.

14. The method of claim 13, wherein the subject is one having received the transplantation, the biological sample comprises a biopsy of the transplanted kidney, and wherein the detection of the SOX9 level is detecting a higher SOX9 level in the biopsy of the transplanted kidney obtained about 1 month after the transplantation relative to a baseline SOX9 level in a biopsy of the transplanted kidney before transplantation or before reperfusion of the transplanted kidney in the subject.

15. The method of any one of claim 1-8, wherein the subject receives a treatment therapy, and the detection detects the CDH6 level, the WNT2B level, or both in response to the treatment therapy.

16. A method for assaying or monitoring a subject receiving a medication, optionally the medication comprising calcineurin inhibitor, wherein the subject has an acute kidney injury or has a renal transplant, the method comprising: detecting a CDH6 level, a WNT2B level, or both in a biological sample obtained from the subject; and discontinuing administration of the medication to the subject if the detected CDH6 and / or WNT2B level is higher relative to a control, or continuing administration4866-7185-2533.5Page 51 of 53 065472-000904WOPTof the medication to the subject if the detected CDH6 and / or WNT2B level is not higher relative to the control, wherein the control is respective CDH6 and / or WNT2B level in the subject prior to receiving the medication, or the control is respective CDH6 and / or WNT2B level in a reference subject not having a renal disease and not receiving the medication.

17. The method of claim 16, wherein the medication comprises the calcineurin inhibitor, and the calcineurin inhibitor comprises tacrolimus, cyclosporin, or a combination thereof.

18. The method of claim 17, wherein the subject receives the calcineurin inhibitor after having received a renal transplant.

19. The method of claim 16, wherein the biological sample comprises a renal sample, and the detected CDH6 level, WNT2B level, or both is in proximal tubule of the renal sample.

20. The method of claim 16, wherein the detection comprises detecting a lower CDH6 level, a lower WNT2B level, or both the lower CDH6 level and the lower WNT2B level in the biological sample in response to the medication, and the method comprises the continuing administration of the medication to the subject.4866-7185-2533.5Page 52 of 53 065472-000904WOPT

Images