Methods for absolute RNA quantification
By employing chemically synthesized, substantially pure control RNA molecules that are highly identical to test RNA molecules, the method enhances the precision and accuracy of absolute RNA quantification in RT-qPCR assays, addressing the limitations of existing technologies.
Patent Information
- Application Number
- PCT/US2024/058615
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-07
- Filing Date
- 2024-12-05
- Publication Date
- 2025-06-12
AI Technical Summary
Current methods for absolute RNA quantification using recombinant RNA as a calibration tool are prone to interference from impurities and require long sequences, making them less precise for short RNA sequences.
The method involves using calibration samples with a chemically synthesized, substantially pure control RNA molecule that is at least 95% identical to the test RNA molecule in full-length sequences and 100% identical in primer- and probe-annealing portions, allowing for precise absolute quantification of test RNA by RT-qPCR.
This approach enables more precise and accurate absolute quantification of test RNA by minimizing the impact of impurities and ensuring efficient annealing of primers and probes, thereby improving the reliability of RNA quantification results.
Smart Images

Figure US2024058615_12062025_PF_FP_ABST
Abstract
Description
ZP000491 METHODS FOR ABSOLUTE RNA QUANTIFICATION FIELD OF THE INVENTION
[0001] This invention is generally of the field of quantification of RNA. BACKGROUND
[0002] Real-time PCR / qPCR assays have become the tool of choice for the rapid and sensitive determination and quantitation of nucleic acid in various biological samples, with diverse applications such as gene expression analysis, the detection of genetically modified organisms in food, and cancer phenotyping.
[0003] In research laboratories, qPCR assays are widely used for the quantitative measurement of gene copy number (gene dosage) in transformed cell lines or the presence of mutant genes. In combination with reverse-transcription PCR (RT-PCR), qPCR assays can be used to quantitate changes in gene expression, for example, an increase or decrease in expression in response to different environmental conditions or drug treatment, by measuring changes in cellular mRNA levels.
[0004] Currently, scientists use recombinant RNA (or recRNA) as a calibration tool for absolute RNA quantification, but the presence of impurities may interfere with the precision of the quantification. In addition, recRNA requires relatively long sequences as short sequences may be more difficult to purify before using the resulting RNA as the calibration tool. SUMMARY OF INVENTION
[0005] This disclosure provides an improvement in a method of quantifying the amount of a test RNA molecule in a test sample by RT-qPCR, the improvement comprising: a) providing one or more calibration samples with known quantity of a control RNA molecule, wherein the sequence of the full-length control RNA molecule is at least 95% percent identical to the sequence of the full-length test RNA molecule, and wherein the sequences of the test RNA molecule and the control RNA molecule are 100% identical in the respective primer- and probe-annealing portions, wherein said control RNA molecule 75-150 bases long, wherein said control RNA is chemically synthetized and substantially pure;b) conducting RT-qPCR on said one or more calibration samples in parallel with RT- qPCR on said test sample; and c) determining the amount of an amplification product in the test sample based on the amount of an amplification product in the one or more calibration samples. BRIEF DESCRIPTION OF THE DRAWINGS (AYUB, SEE THE END OF THE FILE)
[0006] Fig.1 is a representative mass-spectrometry profile of a substantially pure RNA according to the invention.
[0007] Fig.2 is RT-qPCR Amplification plot using RNA standards.
[0008] Fig.3 is a standard curve illustrating detection limit of the FeMV RNA standard. DETAILED DESCRIPTION
[0009] The term “substantially pure” as applied to the control RNA molecule refers to a composition consisting essentially of the control RNA molecule and a pharmaceutically acceptable carrier. Preferably, when analyzed by mass-spectrometry, the profile of the substantially pure mRNA should only demonstrate one peak of the intended molecular weight and, optionally, one or more minor peaks within about 500 Da of the intended molecular weight, representing salt or minor impurities. See, e.g., Fig.1.
[0010] The term “RT-qPCR” refers to reverse-transcription quantitative -polymerase chain reaction.
[0011] The term “test RNA” refers to the RNA which needs to be quantified.
[0012] In a general aspect, this application provides an improvement in a method of quantifying the amount of a test RNA molecule in a test sample by RT-qPCR, wherein the improvement comprises: a) providing one or more calibration samples with known quantity of a control RNA molecule, wherein the sequence of the full-length control RNA molecule is at least 95% percent identical to the sequence of the full-length test RNA molecule, and wherein the sequences of the test RNA molecule and the control RNA molecule are 100% identical in the respective primer-and probe-annealing portions, wherein said control RNA molecule 75-150 bases long, wherein said control RNA is chemically synthetized and substantially pure; b) conducting RT-qPCR on said one or more calibration samples in parallel with RT-qPCR on said test sample; and c) determining the amount of an amplification product in the test sample based on the amount of an amplification product in the one or more calibration samples.
[0013] The use of a short (75-150, or more preferably about 100 to about 130 bases, or more preferably about 115 to 125 bases) substantially pure control RNA allows for a more precise absolute quantification of the test RNA. The full length of the control RNA and the corresponding portion of the test RNA should be at least 95% identical (e.g., at least 96% identical, at least 97% identical, at least 98% identical or at least 99% identical), but the control RNA must be 100% identical to the test RNA in the portions of the respective sequences that bind primers (both forward and reverse) and the probe. In the portions that do not bind primers and probe, the test and control RNA can be at least 90% percent identical (including, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical or at least 99% identical). The 100% identity in the primer- and probe-binding portions ensures that the annealing between the template and the primer and / or probe are equally efficient for test RNA versus control RNA.
[0014] In general, in vitro / in vivo transcribed RNA sequences are capped. Caps known in the art include different 5’- modifications, such as 7-methylguanosine cap, NAD cap, FAD cap, and UDP- glycose caps. In contrast, the chemically synthesized control RNA used according to the methods of the invention are not capped.
[0015] One advantage of using the chemically synthesized substantially pure test RNA molecule is that a single control reaction entailing the use of test RNA of a given concentration is possible: the inventors have discovered linear relationship between the starting amount of the test RNA and the output of the RT-qPCR reaction if the starting amount of the test RNA was about 2.8x102molecules per reaction (ct value of 38.7). The upper detection limit was about 3x108molecules at ct value of 15). Accordingly, in certain embodiments, the amount of the template RNA for the control reaction varies between about 280 and about 3 X 108copies per reaction.
[0016] The RT-qPCR reactions have been well known in the art and the invention does not change any underlying mechanisms or art-accepted conditions in different implementations of RT-qPCR methods, other than the parallel use of the chemically synthetized test PCR as described above, as a calibration tool and the use of a single control reaction due to the linear relationship between the amount of the control RNA at the beginning of the method and the output (e.g., light intensity emitted or quenched by the probe).
[0017] Different samples of test RNA are suitable for the improvements disclosed herein. In certain embodiments, the test RNA is a part of a genome of an RNA virus, including, without limitations, coronaviruses, influenza viruses, picornaviruses and other (+)ssRNA, (-)ssRNA or dsRNA viruses. These viruses may be present in animals samples such as blood, serum, urine, saliva, etc. In other embodiments, the viruses may be present in (and isolated from) food samples water samples, air samples, surface swabs, and sewer samples. Methods of collecting samples, isolating viruses or viral RNA from the samples or viruses are well known in the art and do not need to be explained to persons of ordinary skill.
[0018] Suitable non-liming examples of RNA viruses include, without limitations, SARS, MERS, Covid-19, Dengue Virus, Hepatitis C virus, Hepatitis E virus, West Nile virus, Ebola virus, Rabies virus, Polio virus, Mumps virus, and Measles virus, and Human immunodeficiency virus (HIV).
[0019] The invention will now be described in the following non-limiting examples. EXAMPLES Example 1: Feline Morbilivirus
[0020] Feline Morbillivirus (FeMV) is a single-stranded linear RNA genome of negative polarity. A substantially pure RNA fragment of 115 nucleotide (uucagggccagagagaauugagucuauauccaucugaaguggcacuaguugacaacaaaaaucgcuuggcuaaugacccua auaucaaagucuuguucaaugguaagccagaguc (SEQ ID NO: 1)) was chemically synthesized representing the RNA polymerase encoding the gene L sequence of FeMV. This fragment with known nucleotide sequence, molecular weight and quantified amount was used to precisely calculate copy number of the fragment. The mass-spectrometry profile is provided in Fig. 1. Calculated molecular weight of SEQ ID NO: 1 is 36953 g / mol. The profile shows a major peak corresponding to 36954 g / mol and several minor peaks within about 500 Daltons of thecalculated molecular weight (average weight of one nucleotide is about 520 daltons), representing salts or minor impurities.
[0021] Serial dilution of the fragment was then prepared and subjected to a qPCR assay along with an oligonucleotide primer set of SEQ ID NOs 2 (5’-TGGCTTACCATTGAACAAGACTTTG-3’) and 3 (5’-GCCAGAGAGAATTGAGTCTATATC-3’) and a labeled probe (5’- CAACAAAAATCGCTTGGCTAATGACCCTAA / ABkFQ-3’ (SEQ ID NO: 4) with 6-carboxyfluorescein (6- FAM) at the 5’ end and ABkFQ at the 3’ end). A standard curve was plotted against the GTCTATATC-3’threshold cycle values. The linear dynamic range was determined to be 300 copies (Ct =38.7) to 3x108copies (Ct=15). This qPCR approach could be used to quantify FeMV virus in viral cell culture, vaccine or any biological fluid that contain the virus. In addition, such RNA standard could be designed and synthesized for any RNA virus.
[0022] All publications cited in the specification, both patent publications and non-patent publications, are indicative of the level of skill of those skilled in the art to which this invention pertains. All these publications are herein fully incorporated by reference to the same extent as if each individual publication were specifically and individually indicated as being incorporated by reference.
[0023] Although the invention herein has been described with reference to particular embodiments, it is to be understood that these embodiments are merely illustrative of the principles and applications of the present invention. It is therefore to be understood that numerous modifications may be made to the illustrative embodiments and that other arrangements may be devised without departing from the spirit and scope of the present invention as defined by the following claims.
Claims
CLAIMS 1. An improvement in a method of quantifying the amount of a test RNA molecule in a test sample by RT-qPCR, the improvement comprising: a) providing one or more calibration samples with known quantity of a control RNA molecule, wherein the sequence of the full-length control RNA molecule is at least 95% percent identical to the sequence of the full-length test RNA molecule, and wherein the sequences of the test RNA molecule and the control RNA molecule are 100% identical in the respective primer- and probe-annealing portions, wherein said control RNA molecule 75-150 bases long, wherein said control RNA is chemically synthetized and substantially pure; b) conducting qRT-PCR on said one or more calibration samples in parallel with RT- qPCR on said test sample; c) determining the amount of an amplification product in the test sample based on the amount of an amplification product in the one or more calibration samples.
2. The improvement according to claim 1, wherein the amplification product of the RT- qPCR is 100-130 bases long.
3. The improvement according to any one of claims 1-3, wherein the sequence of the full- length control RNA molecule is at least 99% identical to the sequence of the full-length test RNA molecule.
4. The improvement according to any one of claims 1-3, wherein the full length sequence of the amplification product in the test sample is identical to the full length sequence of the amplification product in the one or more calibration samples.
5. The improvement according to claim 1 or claim 2, wherein the sequence of the full- length control RNA molecule is identical to the sequence of the full-length test RNA molecule.
6. The improvement according to any one of claims 1-5, wherein the test RNA molecule is of eucaryotic origin.
7. The improvement according to any one of claims 1-5, wherein the test RNA molecule is from a genome of an RNA virus.
8. The improvement according to claim 7, wherein the RNA virus is selected from the group consisting of Influenza, SARS, MERS, Covid-19, Dengue Virus, Hepatitis C virus, Hepatitis E virus, West Nile virus, Ebola virus, Rabies virus, Polio virus, Mumps virus, and Measles virus, and Human immunodeficiency virus (HIV).
9. The improvement according to claim 9, wherein the RNA virus is Feline Morbilivirus (FeMV) and the amplification product in the test sample is at least 95% identical to SEQ ID NO:
1.
10. The improvement according to any one of claims 1-9 wherein said sample is a food sample.
11. The improvement according to any one of claims 1-9 wherein said sample is a water sample.
12. The improvement according to any one of claims 1-9 wherein said sample is a sewer sample.
13. The improvement according to any one of claims 1-12, wherein one calibration sample with the known quantity of the control RNA molecule is provided and wherein the amount of the amplification product in the test sample is determined based on the amount of the amplification product in the one calibration sample.
Citation Information
Patent Citations
RT-PCR technology for analyzing ARHGDIB gene expression quantity by using ACTB gene
CN101760523A
Fluoroscopic RT-PCR examination technique for EV71 virus
CN101760561A
Paramyxovirus and its uses
CN104471064B