Compositions and methods of making a modified gamma-delta t-cell
Modified CAR-expressing γδ T cells, engineered to target CD70, CD38, CD33, or TGFβRII using CRISPR and AAVs, address the interference issues in current cancer treatments, achieving effective cancer cell targeting without GvHD.
Patent Information
- Application Number
- PCT/US2024/059195
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-08
- Filing Date
- 2024-12-09
- Publication Date
- 2025-06-12
AI Technical Summary
Current immunotherapeutic agents for cancer treatment face interference from CD70, CD38, CD33, and TGFβRII expressions on T-cells and NK cells, which reduces their efficacy in targeting cancer cells.
Development of modified Gamma Delta T cells (γδ T cells) expressing chimeric antigen receptors (CARs) that target CD70, CD38, CD33, or TGFβRII, using CRISPR Cas/RNP and Adenovirus-associated Viral Vectors (AAVs) for gene editing, while knocking out interfering genes to prevent Graft versus Host Disease (GvHD).
The modified CAR-expressing γδ T cells effectively target cancer cells without inducing GvHD, enhancing cancer treatment efficacy while minimizing adverse immune responses.
Smart Images

Figure US2024059195_12062025_PF_FP_ABST
Abstract
Description
ATTORNEY DOCKET NO.10935-032WO1 COMPOSITIONS AND METHODS OF MAKING A MODIFIED GAMMA-DELTA T- CELL CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional Application No.63 / 608,159, filed on December 8, 2023, which is incorporated herein by reference in its entirety. SEQUENCE LISTING
[0002] A Sequence Listing conforming to the rules of WIPO Standard ST.26 is hereby incorporated by reference. Said Sequence Listing has been filed as an electronic document via PatentCenter in XML. The electronic document, created on December 9, 2024, is entitled “10935- 032WO1_SEQ”, and is 2,903 bytes in size. BACKGROUND
[0003] There are multiple markers, such as for example, CD70, CD38 or CD33 on many cancer stem cells. These markers can be used to target cancer cells that escape recognition when using common surface antigen that are downregulated in cancer stem cells. However, CD70 expression on T-cells, CD38 expression on NK cells and CD33 expression on both NK and T cells, cause interferences with the efficacy of antibodies targeting the respective markers. What are needed are new immunotherapeutic agents for cancer treatment. The cells, compositions, and methods disclosed herein address these needs and more. SUMMARY
[0004] The present invention relates to a method of generating a CAR-expressing γδ T cell for the use of treating cancer without the onset of Graft versus Host Disease (GvHD) thereof. The present disclosure addresses at least a portion of the problems described above through the use of CAR-expressing γδ T cell, and methods of making and using the inventive CAR-expressing γδ T cell.
[0005] In one aspect, the present invention provides modified chimeric antigen receptor (CAR)- expressing, Gamma Delta T cells (γδ T cells) (including, but not limited to γ1δ9 or a γ2δ9 T cells) comprising CRISPR Cas / RNP (such as, for example, Cas9, Cas3, Cas12, or a derivative thereof) and Adenovirus-associated Viral Vectors (AAVs).
[0006] Also disclosed herein, are CAR expressing γδ T-cell of any preceding aspect, wherein the CAR-expressing γδ T-cell comprises a knock-out (KO) of CD70, CD38, CD33, or TGFβRII.ATTORNEY DOCKET NO.10935-032WO1
[0007] In some aspects, the CAR targets CD70, CD38, CD33, or TGFβRII. Thus, in one aspect, disclosed herein, the are CAR expressing γδ T-cell of any preceding aspect, wherein the CAR-expressing γδ T-cell comprises knock-in (KI) of CD70 CAR, CD38 CAR, CD33 CAR, or TGFβRII CAR carried by an AAV plasmid construct.
[0008] In one aspect, disclosed herein are modified CAR-expressing γδ T-cells of any preceding aspect, comprising the integration of the CD70, CD38, CD33, or TGFβRII CAR-AAV construct into an adenovirus-associated virus integration site 1 (AAVS1) safe harbor site or into one or more exons of the CD70, CD38, CD33, or TGFβRII gene thereby causing the knockout of the CD70, CD38, CD33, or TGFβRII gene. In some aspects, the serotype of the AAV comprises AAV6. As disclosed herein, the γδ T cells can be electroporated and in some embodiments, post electroporation at least 2 million γδ T cells per condition were transduced with a site directed AAV. In some embodiments, the AAV serotype is AAV6. In some embodiment, the AAV6 carries a TT954-2 mCherry-600bp-AAVS1 construct. In some embodiments, the γδ T cells are transduced with TT954-2 mCherry-600bp-AAVS1-AAV6 with a Multiplicity of Infection (MOI) of at least 1k and in some embodiments, complete growth media was added to the γδ T cells, post transduction. In some embodiments, the time post transduction is at least 24 hours. As disclosed herein, the method of generating expanded CD70 CAR-expressing γδ T cells, post-transduction, occurs in at least 14 days.
[0009] Also disclosed herein are methods of generating CAR-expressing γδ T cell (such as, for example, γ1δ9 or a γ2δ9 T cells, including, but not limited to γδ T cells are isolated from human Peripheral Blood Mononuclear Cells (PBMCs) using immunomagnetic negative selection) comprising; a) expanding the γδ T cells to generate γδ T cells that are highly-susceptible to gene- editing; and b) editing of γδ T cells using a combination of CRISPR Cas / RNP (such as, for example Cas9, Cas3, Cas12 or a derivative thereof) and AAVs to generate highly efficient gene KO, site directed gene and CAR insertion in these cells; wherein the protein expressed by the gene being knocked out and the target of the CAR are the same protein. In some aspects, the γδ T cells were seeded on to culture plates coated with an anti-CD3 antibody or equivalent and / or anti-CD28 antibody or equivalent, in complete growth medium. In some aspects, the expansion step comprises a period of stimulation wherein the stimulation time is at least 2 days.
[0010] As disclosed herein, are methods of generating CAR-expressing γδ T cells of any preceding aspect, wherien the γδ T cells are expanded at least a 2:1 ratio with feeder cells that comprise membrane bound (mb) IL21 on the cell surface. In some embodiments, the mbIL21ATTORNEY DOCKET NO.10935-032WO1 feeder cells further comprise membrane bound 4-1BBL. In some embodiments, the feeder cells are K562 cells (such as, for example CSTX-002 cells). In some embodiments, during expansion, γδ T cells are supplemented with 100IU IL2. In some embodiments, the γδ T cells are supplemented with 100IU IL2 at least every 48 hours and in some embodiments the γδ T cells were expanded for at least 7 days. In some embodiments, at least 21 days after isolation of γδ T cells, at least 3 million γδ T cells / condition were electroporated with Cas / RNP complexes targeting AAVS1 safe harbor site or targeting one or more exons of the CD70, CD38, CD33, or TGFβRII gene. Thus, in one aspect, disclosed herein are methods of generating CAR-expressing γδ T cells wherein the method comprises knocking out CD70, CD38, CD33, or TGFβRII from the γδ T cells while simultaneously integrating a CD70, CD38, CD33, or TGFβRII from the γδ T cells CAR construct into the AAVS1 safe-harbor site or one or more exons of the CD70, CD38, CD33, or TGFβRII gene.
[0011] Also disclosed herein are methods of treating, decreasing, reducing, inhibiting, ameliorating, and / or preventing a cancer and / or metastasis without the onset of Graft versus Host Disease (GvHD) comprising administrating to a subject the CAR-expressing the γδ T cells wherein the γδ T cells comprises a CRISPR Cas / RNP (such as, for example Cas9, Cas3, Cas12 or a derivative thereof) and Adenovirus-associated Viral Vectors (AAVs)(including, but not limited to AAV6 serotype AAVs).
[0012] In one aspect disclosed herein are methods of treating, decreasing, reducing, inhibiting, ameliorating, and / or preventing a cancer and / or metastasis of any preceding aspect, wherein the γδ T cell comprises a knock-out (KO) of CD70, CD38, CD33, or TGFβRII and a knock-in (KI) of CD70, CD38, CD33, or TGFβRII CAR carried by an AAV plasmid construct. In some aspects the method comprises the integration of the CD70, CD38, CD33, or TGFβRII CAR-AAV construct into an adenovirus-associated virus integration site 1 (AAVS1) safe harbor site or into one or more exons of the CD70, CD38, CD33, or TGFβRII gene thereby causing the knockout of the CD70, CD38, CD33, or TGFβRII gene.
[0013] Also disclosed herein are methods of treating, decreasing, reducing, inhibiting, ameliorating, and / or preventing a cancer and / or metastasis of any preceding aspect, wherein the CAR-expressing γδ T cells comprise an allogenic immunotherapy.
[0014] In one aspect, disclosed herein are methods of making γδ T cells susceptible to gene editing comprising culturing the γδ T cells with feeder cells (such as, for example, K562 cells including, but not limited to CSTX-002 cells) that comprise membrane bound (mb) IL21 on the cell surface. In some aspects, the mbIL21 feeder cells further comprise membrane bound 4-1BBL.ATTORNEY DOCKET NO.10935-032WO1
[0015] Also disclosed herein are methods of making γδ T cells susceptible to gene editing of any preceding aspect, wherein the γδ T cells are expanded with at least a 2:1 ratio with mbIL21- expressing feeder cells. In some aspects, during expansion, γδ T cells are supplemented with 100IU IL2. In some aspects, the γδ T cells are supplemented with 100IU IL2 at least every 48 hours. In some aspects, the γδ T cells were expanded for at least 7 days.
[0016] Additional aspects and advantages of the disclosure will be set forth, in part, in the detailed description and any claims which follow, and in part will be derived from the detailed description or can be learned by practice of the various aspects of the disclosure. The advantages described below will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the disclosure. BRIEF DESCRIPTION OF THE FIGURES
[0017] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate certain examples of the present disclosure and together with the description, serve to explain, without limitation, the principles of the disclosure. Like numbers represent the same elements throughout the figures.
[0018] Figures 1A and 1B show γδ T Cell Isolation, Stimulation, and Proliferation. Figure 1A shows γδ T-Cell growth curve from day one till 2 weeks after isolation. Figure 1B shows flow cytometry to identify the purity and subsets of expanded γδ T cells.
[0019] Figures 2A and 2B show γδ T-Cell Electroporation Optimization. Figure 2A shows live and dead staining 72 hours after transduction with TT954-2 mCherry-600bp-AAVS1-AAV6 using different electroporation program (EO-115, CM-137, and EH-115). Figure 2B shows the mean fluorescent Intensity for mCherry in γδ T cell transduced with TT954-2 mCherry-600bp-AAVS1- AAV6 using different electroporation program (EO-115, CM-137, and EH-115).
[0020] Figures 3A, 3B, and 3C show γδ T-Cell gene Knock In (CD70 CAR). Figure 3A shows CD70 expression on the surface of γδ T cells. Figure 3B shows flow cytometry to identify the CD70 gene knockout efficiency on the surface of γδ T cells. Figure 3C shows flow cytometry for assessment of CD70 CAR γδ T cells generation.ATTORNEY DOCKET NO.10935-032WO1 DETAILED DESCRIPTION General Description
[0021] The following description of the disclosure is provided as an enabling teaching of the disclosure in its best, currently known embodiment(s). To this end, those skilled in the relevant art will recognize and appreciate that many changes can be made to the various embodiments of the invention described herein, while still obtaining the beneficial results of the present disclosure. It will also be apparent that some of the desired benefits of the present disclosure can be obtained by selecting some of the features of the present disclosure without utilizing other features. Accordingly, those who work in the art will recognize that many modifications and adaptations to the present disclosure are possible and can even be desirable in certain circumstances and are a part of the present disclosure. Thus, the following description is provided as illustrative of the principles of the present disclosure and not in limitation thereof.
[0022] Reference will now be made in detail to the embodiments of the invention, examples of which are illustrated in the drawings and the examples. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. A. Definitions
[0023] As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a pharmaceutical carrier” includes mixtures of two or more such carriers, and the like.
[0024] Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that when a value is disclosed that “less than or equal to” the value, “greater than or equal to the value” and possible ranges between values are also disclosed, as appropriately understood by the skilled artisan. ForATTORNEY DOCKET NO.10935-032WO1 example, if the value “10” is disclosed the “less than or equal to 10”as well as “greater than or equal to 10” is also disclosed. It is also understood that the throughout the application, data is provided in a number of different formats, and that this data, represents endpoints and starting points, and ranges for any combination of the data points. For example, if a particular data point “10” and a particular data point 15 are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
[0025] In this specification and in the claims which follow, reference will be made to a number of terms which shall be defined to have the following meanings:
[0026] “Optional” or “optionally” means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.
[0027] An "increase" can refer to any change that results in a greater amount of a symptom, disease, composition, condition or activity. An increase can be any individual, median, or average increase in a condition, symptom, activity, composition in a statistically significant amount. Thus, the increase can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% increase so long as the increase is statistically significant.
[0028] A "decrease" can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% decrease so long as the decrease is statistically significant.
[0029] "Inhibit," "inhibiting," and "inhibition" mean to decrease an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the complete ablation of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between as compared to native or control levels.ATTORNEY DOCKET NO.10935-032WO1
[0030] By “reduce” or other forms of the word, such as “reducing” or “reduction,” is meant lowering of an event or characteristic (e.g., tumor growth). It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to. For example, “reduces tumor growth” means reducing the rate of growth of a tumor relative to a standard or a control.
[0031] By “prevent” or other forms of the word, such as “preventing” or “prevention,” is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed.
[0032] The term “subject” refers to any individual who is the target of administration or treatment. The subject can be a vertebrate, for example, a mammal. In one aspect, the subject can be human, non-human primate, bovine, equine, porcine, canine, or feline. The subject can also be a guinea pig, rat, hamster, rabbit, mouse, or mole. Thus, the subject can be a human or veterinary patient. The term “patient” refers to a subject under the treatment of a clinician, e.g., physician.
[0033] The term “therapeutically effective” refers to the amount of the composition used is of sufficient quantity to ameliorate one or more causes or symptoms of a disease or disorder. Such amelioration only requires a reduction or alteration, not necessarily elimination.
[0034] The term “treatment” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder.ATTORNEY DOCKET NO.10935-032WO1
[0035] The terms "cell," "cell line" and "cell culture" include progeny. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Variant progeny that have the same function or biological property, as screened for in the originally transformed cell, are included. The "host cells" used in the present invention generally are prokaryotic or eukaryotic hosts.
[0036] As used herein, the term, “deletion”, also called gene deletion, deficiency, or deletion mutation, refers to part of a chromosome or a sequence of DNA being left out during DNA replication. Deletion, or gene deletions can cause any number of nucleotides to be deleted from a single base to an entire piece of chromosome.
[0037] A DNA sequence that "encodes" a particular RNA is a DNA nucleic acid sequence that is transcribed into RNA. A DNA polynucleotide may encode an RNA (mRNA) that is translated into protein (and therefore the DNA and the mRNA both encode the protein), or a DNA polynucleotide may encode an RNA that is not translated into protein (e.g. tRNA, rRNA, microRNA (miRNA), a "non-coding" RNA (ncRNA), a guide RNA, etc.).
[0038] The term "gene" or "gene sequence" refers to the coding sequence or control sequence, or fragments thereof. A gene may include any combination of coding sequence and control sequence, or fragments thereof. Thus, a "gene" as referred to herein may be all or part of a native gene. A polynucleotide sequence as referred to herein may be used interchangeably with the term "gene”, or may include any coding sequence, non-coding sequence or control sequence, fragments thereof, and combinations thereof. The term "gene" or "gene sequence" includes, for example, control sequences upstream of the coding sequence (for example, the ribosome binding site).
[0039] "Biocompatible" generally refers to a material and any metabolites or degradation products thereof that are generally non-toxic to the recipient and do not cause significant adverse effects to the subject.
[0040] "Comprising" is intended to mean that the compositions, methods, etc. include the recited elements, but do not exclude others. "Consisting essentially of'' when used to define compositions and methods, shall mean including the recited elements, but excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives, and the like. "Consisting of'' shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions provided and / or claimed in this disclosure. Embodiments defined by each of these transition terms are within theATTORNEY DOCKET NO.10935-032WO1 scope of this disclosure.
[0041] A “control” is an alternative subject or sample used in an experiment for comparison purposes. A control can be "positive" or "negative."
[0042] “Effective amount” of an agent refers to a sufficient amount of an agent to provide a desired effect. The amount of agent that is “effective” will vary from subject to subject, depending on many factors such as the age and general condition of the subject, the particular agent or agents, and the like. Thus, it is not always possible to specify a quantified “effective amount.” However, an appropriate “effective amount” in any subject case may be determined by one of ordinary skill in the art using routine experimentation. Also, as used herein, and unless specifically stated otherwise, an “effective amount” of an agent can also refer to an amount covering both therapeutically effective amounts and prophylactically effective amounts. An “effective amount” of an agent necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.
[0043] A "pharmaceutically acceptable" component can refer to a component that is not biologically or otherwise undesirable, i.e., the component may be incorporated into a pharmaceutical formulation provided by the disclosure and administered to a subject as described herein without causing significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the formulation in which it is contained. When used in reference to administration to a human, the term generally implies the component has met the required standards of toxicological and manufacturing testing or that it is included on the Inactive Ingredient Guide prepared by the U.S. Food and Drug Administration.
[0044] "Pharmaceutically acceptable carrier" (sometimes referred to as a “carrier”) means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic and includes a carrier that is acceptable for veterinary and / or human pharmaceutical or therapeutic use. The terms "carrier" or "pharmaceutically acceptable carrier" can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil / water or water / oil emulsion) and / or various types of wetting agents. As used herein, the term "carrier" encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as described further herein.
[0045] “Pharmacologically active” (or simply “active”), as in a “pharmacologically active”ATTORNEY DOCKET NO.10935-032WO1 derivative or analog, can refer to a derivative or analog (e.g., a salt, ester, amide, conjugate, metabolite, isomer, fragment, etc.) having the same type of pharmacological activity as the parent compound and approximately equivalent in degree.
[0046] “Therapeutic agent” refers to any composition that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition (e.g., a non-immunogenic cancer). The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like. When the terms “therapeutic agent” is used, then, or when a particular agent is specifically identified, it is to be understood that the term includes the agent per se as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc.
[0047] “Therapeutically effective amount” or “therapeutically effective dose” of a composition (e.g. a composition comprising an agent) refers to an amount that is effective to achieve a desired therapeutic result. In some embodiments, a desired therapeutic result is the control of type I diabetes. In some embodiments, a desired therapeutic result is the control of obesity. Therapeutically effective amounts of a given therapeutic agent will typically vary with respect to factors such as the type and severity of the disorder or disease being treated and the age, gender, and weight of the subject. The term can also refer to an amount of a therapeutic agent, or a rate of delivery of a therapeutic agent (e.g., amount over time), effective to facilitate a desired therapeutic effect, such as pain relief. The precise desired therapeutic effect will vary according to the condition to be treated, the tolerance of the subject, the agent and / or agent formulation to be administered (e.g., the potency of the therapeutic agent, the concentration of agent in the formulation, and the like), and a variety of other factors that are appreciated by those of ordinary skill in the art. In some instances, a desired biological or medical response is achieved following administration of multiple dosages of the composition to the subject over a period of days, weeks, or years.
[0048] The term "polynucleotide" refers to a single or double stranded polymer composed of nucleotide monomers.
[0049] The term "polypeptide" refers to a compound made up of a single chain of D- or L- amino acids or a mixture of D- and L-amino acids joined by peptide bonds.ATTORNEY DOCKET NO.10935-032WO1
[0050] A “vector” as used herein refers to any particle or composition used as a vehicle to artificially carry a foreign nucleic acid sequence into another cell, where it can be replicated and / or expressed. Examples of vectors include plasmids, viral vectors, cosmids, and artificial chromosomes.
[0051] As used herein a “viral vector” refers to a tool used in molecular biology to deliver genetic material (including DNA, RNA, and any other nucleic acid variations thereof) into a cell. This process is performed either inside a living organism or in cell culture. The viral genome is engineered to incorporate a desired gene or gene product, and following transduction, or transfer, of the virus into the host, said gene or gene product is expressed within the host.
[0052] Throughout this application, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this pertains. The references disclosed are also individually and specifically incorporated by reference herein for the material contained in them that is discussed in the sentence in which the reference is relied upon. B. Modified Chimeric Antigen Receptor (CAR)-expressing, Gamma Delta T cell (γδ T cell):
[0053] Disclosed are the components to be used to prepare the disclosed compositions as well as the compositions themselves to be used within the methods disclosed herein. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular modified γδ T cell is disclosed and discussed and a number of modifications that can be made to a number of molecules including the modified γδ T cell are discussed, specifically contemplated is each and every combination and permutation of modified γδ T cell and the modifications that are possible unless specifically indicated to the contrary. Thus, if a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning combinations, A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered disclosed. Likewise, any subset or combination of these is also disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E would be considered disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed it is understoodATTORNEY DOCKET NO.10935-032WO1 that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed methods.
[0054] Disclosed herein is a modified chimeric antigen receptor (CAR)-expressing, Gamma Delta T cell (γδ T cell) (including, but not limited to γ1δ9 or a γ2δ9 T cells) comprising CRISPR Cas / RNP (such as, for example, Cas9, Cas3, Cas12, or a derivative thereof) and Adenovirus- associated Viral Vectors (AAVs)
[0055] As used herein, “T cell” refers to a type of lymphocyte that is one of the most important white blood cells of the immune system. T cells can be distinguished from other lymphocytes by the presence of a T-cell receptor (TCR) on their cell surface. The immune-mediated cell death function of T cells is carried by two major subtypes: CD8+“killer” T cells and CD4+“helper” T cells.
[0056] Gamma delta T cells (γδ T cells) are T cells that have a γδ T-cell receptor (TCR) on their surface. In some embodiments, T cells are αβ (alpha beta) T cells with the TCR composed of two glycoprotein chains called α (alpha) and β (beta) TCR chains. However, in some embodiments, γδ T cells have a TCR that is made up of one γ (gamma) chain and one δ (delta) chain. This group of T cells is usually less common than αβ T cells. Their highest abundance is in the gut mucosa, within a population of lymphocytes known as intraepithelial lymphocytes (IELs). The antigenic molecules that activate γδ T cells are largely unknown. γδ T cells are peculiar in that they do not seem to require antigen processing and major-histocompatibility-complex (MHC) presentation of peptide epitopes, although in some embodiments, the γδ T cells recognize MHC class Ib molecules. In some embodiments, γδ T cells may be considered a component of adaptive immunity in that they rearrange TCR genes to produce junctional diversity and can develop a memory phenotype. Human γδT cells are divided into two major structural subsets according to their TCR δ chain usage: Vδ1 and Vδ2 T cells. In terms of TCR γ chain usage, Vδ1 T cells are predominantly associated with the VγI gene family (Vγ2 / 3 / 4 / 5 / 8), whereas the majority of Vδ2 T cells coexpress VγII (Vγ9). In some embodiment, the γδ T-cell in a human is Vγ9 / Vδ2. In some embodiments, T cells are capable of phagocytosis, a function previously exclusive to innate myeloid lineage cells such as, for example, neutrophils, monocytes and dendritic cells. As disclosed herein, in some embodiments, the modified chimeric antigen receptor (CAR)-expressing γδ T-cell is a γ1δ9 or a γ2δ9 T cell.
[0057] A “chimeric antigen receptor” (CAR) is an artificial TCR used for immunotherapy. CAR are protein receptors that have been engineered to give immune cells (e.g., T cells, NK cells, NKT cells, B cells, or macrophages) an enhanced ability to target a specific protein. CAR receptors areATTORNEY DOCKET NO.10935-032WO1 chimeric because the antigen binding and cell activating functions have been combined into a single receptor.Methods of genetic engineering, using a transportation system such as, for example, a viral vector, are used to insert and integrate the CARs into T cells.
[0058] Adeno-associated virus is a type of viral vector is based on an adeno-associated virus (AAV). This defective parvovirus is a preferred vector because it can infect many cell types and is nonpathogenic to humans. AAV type vectors can transport about 4 to 5 kb and wild type AAV is known to stably insert into chromosome 19. Vectors which contain this site specific integration property are preferred. An especially preferred embodiment of this type of vector is the P4.1 C vector produced by Avigen, San Francisco, CA, which can contain the herpes simplex virus thymidine kinase gene, HSV-tk, and / or a marker gene, such as the gene encoding the green fluorescent protein, GFP.
[0059] In another type of AAV virus, the AAV contains a pair of inverted terminal repeats (ITRs) which flank at least one cassette containing a promoter which directs cell-specific expression operably linked to a heterologous gene. Heterologous in this context refers to any nucleotide sequence or gene which is not native to the AAV or B19 parvovirus.
[0060] Typically the AAV and B19 coding regions have been deleted, resulting in a safe, noncytotoxic vector. The AAV ITRs, or modifications thereof, confer infectivity and site-specific integration, but not cytotoxicity, and the promoter directs cell-specific expression. United states Patent No.6,261,834 is herein incorporated by reference for material related to the AAV vector.
[0061] In general, clustered regularly interspaced short palindromic repeat (CRISPR), “CRISPR system” or “CRISPR integration system” refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated “Cas” genes. In some embodiments, one or more elements of a CRISPR system is derived from a type I, type II, or type III CRISPR system. CRISPR systems are known in the art. See, e.g., U.S. Patent NO.8,697,359, incorporated by reference herein in its entirety.
[0062] The term “Cas protein” or “Cas” refers to a polypeptide encoded by a Cas (CRISPR- associated) gene. A Cas protein includes proteins encoded by a gene in a cas locus and includes adaptation molecules as well as interference molecules. An interference molecule of a bacterial adaptive immunity complex includes endonucleases. A Cas endonuclease described herein comprises one or more nuclease domains. Examples, of a Cas endonuclease include, Cas9, Cas3, Cas12 or a derivative thereof.
[0063] Endonuclease / RNPs (for example, a Cas9 / RNP) are comprised of three components, recombinant endonuclease protein (for example, a Cas9 endonuclease) complexed with a CRISPRATTORNEY DOCKET NO.10935-032WO1 loci. The endonuclease complexed to the CRISPR loci can be referred to as a CRISPR / Cas guide RNA. The CRISPR loci comprises a synthetic single-guide RNA (gRNA) comprised of a RNA that can hybridize to a target sequence complexed complementary repeat RNA (crRNA) and trans complementary repeat RNA (tracrRNA). Accordingly, the CRISPR / Cas guide RNA hybridizes to a target sequence within the genomic DNA of the cell. In some cases, the class 2 CRISPR / Cas endonuclease is a type II CRISPR / Cas endonuclease. In some cases, the class 2 CRISPR / Cas endonuclease is a Cas9 polypeptide and the corresponding CRISPR / Cas guide RNA is a Cas9 guide RNA. These Cas9 / RNPs are capable of cleaving genomic targets with higher efficiency as compared to foreign DNA-dependent approaches due to their delivery as functional complexes. Additionally, rapid clearance of Cas9 / RNPs from the cells can reduce the off-target effects such as induction of apoptosis.
[0064] To make the RNP complex, crRNA and tracrRNA can be mixed at a 1:1, 2:1, or 1:2 ratio of concentrations between about 50 μM and about 500 μM (for example, 50 μM, 60 μM, 70 μM, 80 μM, 90 μM, 100 μM, 125 μM, 150 μM, 175 μM, 200 μM, 225 μM, 250 μM, 275 μM, 300 μM, 325 μM, 350 μM, 375 μM, 400 μM, 425 μM, 450 μM, 475 μM, or 500 μM), preferably between 100 μM and about 300 μM, most preferably about 200 μM at 95 °C for about 5 min to form a crRNA:tracrRNA complex (i.e., the guide RNA). The crRNA:tracrRNA complex can then be mixed with between about 20 μM and about 50 μM (for example 21 μM, 22 μM, 23 μM, 24 μM, 25 μM, 26 μM, 27 μM, 28 μM, 29 μM, 30 μM, 31 μM, 32 μM, 33 μM, 34 μM, 35 μM, 36 μM, 37 μM, 38 μM, 39 μM, 40 μM, 41 μM, 42 μM, 43 μM, 44 μM, 45 μM, 46 μM, 47 μM, 48 μM, 49 μM, or 50 μM) final dilution of a Cas endonuclease (such as, for example, Cas9).
[0065] Once bound to the target sequence in the target cell, the CRISPR loci can modify the genome by introducing into the target DNA insertion or deletion of one or more base pairs, by insertion of a heterologous DNA fragment (e.g., the donor polynucleotide), by deletion of an endogenous DNA fragment, by inversion or translocation of an endogenous DNA fragment, or a combination thereof. Thus, the disclosed methods can be used to generate knock-outs, or knock-ins when combined with DNA for homologous recombination. It is shown herein that transduction via Adeno-associated viral (AAV) of Cas9 / RNPs is a relatively efficient method that overcomes previous constraints of genetic modification in cells (such as, for example, T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells, and / or muscle cells).
[0066] The CRISPR / Cas9 system has recently been shown to facilitate high levels of precise genome editing using Adeno-associated viral (AAV) vectors to serve as donor template DNAATTORNEY DOCKET NO.10935-032WO1 during homologous recombination (HR). An “adeno-associated virus” or an “AAV” as used herein refers to a small virus belonging to the genus Dependoparvovirus which are replicative defective, non-enveloped viruses with linear single-stranded DNA. These viruses are commonly used for creating viral vectors for gene therapy, wherein said viruses can infect dividing and quiescent cells and persist in an extrachromosomal state without integrating into the host genome. AAVs can be engineered to express desired genes or gene products such as mRNA, shRNA, or miRNAs to overexpress or silence a target gene. In some embodiments the serotype of the AAV is AAV1, AAV2, AAV4, AAV5, AAV7, AAV8, or AAV9.
[0067] The CAR polypeptide can also comprise a transmembrane domain (such as, for example, an NKG2D transmembrane domain, a KLRK1 transmembrane domain, a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, and / or a CD3 signaling and transmembrane domain) and a co-stimulatory domain (such as, for example, a 2B4 domain, a CD28 co-stimulatory domain, a signaling CD3z domain, a 4-1 BB co-stimulatory domain, or any combination of a 2B4 domain, a CD28 co-stimulatory domain and / or a 4-1 BB co- stimulatory domain). For example, in some embodiments, the CAR polypeptide comprises a IgG4 hinge domain, a CD4 transmembrane domain, a CD28 co-stimulatory domain, a signaling CD3zeta polypeptide, and a single-chain variable fragment (scFV) that specifically binds to a receptor on a target cell including, but not limited to, a cancer cell expressing a target antigen (for example, CD70). In some embodiments, the CAR polypeptide comprises a IgG4 hinge domain, a NKG2D transmembrane domain, a 2B4 domain, a signaling CD3zeta polypeptide, and a single-chain variable fragment (scFV) that specifically binds to a receptor on a target cell including, but not limited to, a cancer cell expressing a target antigen (for example, CD70).
[0068] In aspects, disclosed herein are CAR expressing γδ T-cells wherein the CAR targets CD70, CD38, CD33, or TGFβRII. Thus, in one aspect, disclosed herein, the are CAR expressing γδ T-cell, wherein the CAR-expressing γδ T-cell comprises knock-in (KI) of CD70 CAR, CD38 CAR, CD33 CAR, or TGFβRII CAR carried by an AAV plasmid construct (such as for example AAV6). In some aspects CAR expressing γδ T-cell, wherein the CAR-expressing γδ T-cell further comprises a knock-out (KO) of CD70, CD38, CD33, or TGFβRII.
[0069] In some aspects, the knockout of the CD70 and integration of the CAR do not occur in the same reaction. That is, the CD70 is disrupted and the CAR is integrated into a different site. One example, is the disruption of CD70 and using AAVS1 as a target site for integration of the disclosed nucleic acids. AAVS1 is a “safe harbor gene” and allows stable, long-term transgene expression in many cell types. As disruption of PPP1R12C is not associated with any knownATTORNEY DOCKET NO.10935-032WO1 disease, the AAVS1 locus is often considered a safe-harbor for transgene targeting. While AAVS1 is used for exemplary purposes here, it is understood and herein contemplated that other “safe harbor genes” can be used with equivalent results and can be substituted for AAVS1 if more appropriate given the particular cell type being transfected or the transgene. Examples of other safe harbor genes, include but are not limited to C-C chemokine receptor type 5 (CCR5), the ROSA26 locus, and TRAC.
[0070] In other examples, the gene being knocked out is disrupted by the integaration of the CAR. Accordingly, disclosed herein are modified CAR-expressing γδ T-cells, comprising the integration of the CD70, CD38, CD33, or TGFβRII CAR-AAV construct into an adenovirus- associated virus integration site 1 (AAVS1) safe harbor site or into one or more exons of the CD70, CD38, CD33, or TGFβRII gene thereby causing the knockout of the CD70, CD38, CD33, or TGFβRII gene. In some aspects, the gene being knocked our encodes the protein that is the target of the CAR. For example, a modified CAR expressing γδ T cell comprising a knock-in (KI) of a CD70 CAR also has a knockout (KO) of a CD70 gene (CD70KICAR / CD70KOγδ T cell). Thus, in one aspect, disclosed herein are CD70KICAR / CD70KOγδ T cells, CD33KICAR / CD33KOγδ T cells, CD38KICAR / CD38KOγδ T cells, and TGFβRIIKICAR / TGFβRIIKOγδ T cells.
[0071] As disclosed herein, the γδ T cells can be electroporated and in some embodiments, post electroporation at least 2 million γδ T cells per condition were transduced with a site directed AAV. In some embodiments, the AAV serotype is AAV6. In some embodiment, the AAV6 carries a TT954-2 mCherry-600bp-AAVS1 construct. In some embodiments, the γδ T cells are transduced with TT954-2 mCherry-600bp-AAVS1-AAV6 with a Multiplicity of Infection (MOI) of at least 1k and in some embodiments, complete growth media was added to the γδ T cells, post transduction. In some embodiments, the time post transduction is at least 24 hours. As disclosed herein, the method of generating expanded CD70 CAR-expressing γδ T cells, post-transduction, occurs in at least 14 days. C. Method of generating modified Chimeric Antigen Receptor (CAR)-expressing, Gamma Delta T cell (γδ T cell):
[0072] Disclosed herein, is a method of generating CAR-expressing γδ T cell, comprising; first, expanding the γδ T cells to generate γδ T cells that are highly-susceptible to gene-editing, then, editing of γδ T cells using a combination of CRISPR Cas / RNP and AAVs to generate highly efficient gene KO, site directed gene and CAR insertion in these cells; wherein the proteinATTORNEY DOCKET NO.10935-032WO1 expressed by the gene being knocked out and the target of the CAR are the same protein. The method of generating CAR-expressing γδ T cell (such as, for example, γ1δ9 or a γ2δ9 T cells, including, but not limited to γδ T cells are isolated from human Peripheral Blood Mononuclear Cells (PBMCs) using immunomagnetic negative selection) comprises a) expanding the γδ T cells to generate γδ T cells that are highly-susceptible to gene-editing; and b) editing of γδ T cells using a combination of CRISPR Cas / RNP (such as, for example Cas9, Cas3, Cas12 or a derivative thereof) and AAVs to generate highly efficient gene KO, site directed gene and CAR insertion in these cells. In some aspects, the step of editing the γδ T cell comprises a) obtaining a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with a corresponding CRISPR / Cas guide RNA (including, but not limited to a guide RNA that targets CD70) and an AAV vector comprising a plasmid or other nucleic acid comprising a polynucleotide sequence encoding a chimeric antigen receptor (CAR); b) introducing the polynucleotide sequence encoding the CAR polypeptide and the RNP complex into a cell; wherein the plasmid or other nucleic acid is introduced into the cell via infection with the Adeno- associated virus (AAV) into the cell; wherein in the ribonucleoprotein (RNP) complex hybridizes to a target sequence within the genomic DNA of the cell, and the cell’s DNA repair enzymes insert the polynucleotide encoding the CAR into the host genome at the target sequence, thereby creating the engineered cell. In some aspects, the guide RNA targets the CD70 gene or a fragment thereof.
[0073] Prior to the transduction of the T cells, the T cell can be incubated in a media suitable for the propagation of the T cells. It is understood and herein contemplated that the culturing conditions can comprise the addition of cytokines, antibodies, and / or feeder cells. Thus, in one aspect, disclosed herein are methods of genetically modifying T cell, further comprising incubating the T cells for at least 1, 2, 3, 4, 5, 6,7 ,89, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days prior to transducing the T cells in media that supports the propagation of T cells; wherein the media further comprises cytokines, antibodies, and / or feeder cells. For example, the media can comprise IL-2, IL-7, IL-12, IL-15, IL-18, and / or IL-21. In one aspect, the media can also comprise anti-CD3, or CD28 antibody or combinations thereof.
[0074] In one aspect, the T cells can be primary T cells from a donor source, such as, for example, an allogeneic donor source for an adoptive transfer therapy or an autologous donor source (i.e., the ultimate recipient of the modified cells), a T cell line, or from a source of expanded T cells derived a primary T cell source or T cell line. In another aspect, in an adult human, the γδ T cell population represents 1–5% of all CD3+cells. In peripheral blood of healthy human subjects, T-cells expressing Vγ9Vδ2 TCR can account for up 95% of γδ T-cells and render between 1 andATTORNEY DOCKET NO.10935-032WO1 10% of all blood T-cells. Conversely, Vδ1 T-cells represent only 10–30% of γδ T-cells in peripheral blood of healthy human. In the lymphoid tissue and in the gut- and skin- associated lymphoid systems, γδ T-cells show a frequency similar to that detected in peripheral blood. As disclosed herein, the γδ T cells are isolated from human Peripheral Blood Mononuclear Cells (PBMCs) using negative immunomagnetic selection.
[0075] Negative immunomagnetic selection has been the method of choice for isolating immune cells for functional studies due to concerns that binding antibodies to the cell surface may induce cellular activation, block ligand-receptor interactions or result in immune clearance. Such as, for example, T cell selection from PBMCs comprises using antibodies against CD33, CD34, CD123, CD11c and CD36 markers to deplete myeloblasts.
[0076] As further disclosed herein, the isolated γδ T cells are seeded on to culture plates coated with an anti-CD3 antibody or equivalent and / or anti-CD28 antibody or equivalent, in complete growth medium. In some embodiments, anti-CD3 activates all T cells regardless of their antigen specificity by crosslinking the TCR-CD3 signaling machinery. In some embodiments, T cell activation triggers proliferation and expansion of the γδ T cells. In some embodiments the stimulation time is at least 6 hours. In some embodiments, the stimulation time is 1, 2, 3, 4, 5, 6, 7 days. In some embodiments, the stimulation time is at least 2 days. T cells can be further activated and proliferated by two established clinical-grade feeder systems are such as, for example, Epstein- Barr virus transformed lymphoblastoid cell lines and genetically engineered K562.mbIL21.4- 1BBL feeder cells including, but not limited to CStX-002 cells.
[0077] In one aspect, the feeder cells can be purified from feeder cells that stimulate T cells. For example, T cell stimulating feeder cells for use in the claimed invention, disclosed herein can be either irradiated autologous or allogeneic peripheral blood mononuclear cells (PBMCs) or nonirradiated autologous or PBMCs; RPMI8866; HFWT, K562; K562 cells transfected with membrane bound IL-15, and 41BBL, or IL-21 or any combination thereof; or EBV-LCL. In some aspects, the feeder cells provided in combination with a solution of IL-21, IL-15, and / or 41BBL. Feeder cells can be seeded in the culture of cells at a 1:2, 1:1, or 2:1 ratio. In some embodiments, the media can comprise IL-2, IL-7, IL-12, IL-15, IL-18, and / or IL-21.
[0078] As disclosed herein, the γδ T cells are expanded with feeder cells that comprise membrane bound (mb) IL21 on the cell surface. In some embodiments, the mbIL21 feeder cells further comprise membrane bound 4-1BBL. In some embodiments the feeder cells are K562 cells. In some embodiments the feeder cell line is CSTX-002. In some embodiments, the γδ T cells are expanded with at least a 2:1 ratio with mbIL21-expressing feeder cells. In some embodiments,ATTORNEY DOCKET NO.10935-032WO1 during expansion, γδ T cells are supplemented with 100IU IL2. As disclosed herein, the γδ T cells are supplemented with 100IU IL2 at least every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, or 48 hours.
[0079] As disclosed herein, γδ T cell expansion can take between 1 to 21 days (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21. In some embodiments γδ T cell expansion takes at least 21 days after isolation of γδ T cells. Further disclosed herein, is that at least 21 days after isolation of γδ T cells, at least 3 million γδ T cells / condition were electroporated and transduced with Cas / RNP complexes targeting AAVS1 safe harbor site. In some embodiments, as disclosed herein, 2 million γδ T cells per condition were transduced with a site directed AAV, wherein, the serotype of the AAV comprises AAV6 and wherein, the AAV6 carries a TT954-2 mCherry-600bp-AAVS1 construct. In some embodiments, the method disclosed herein comprises transducing the γδ T cell with a range of MOI of TT954-2 mCherry-600bp-AAVS1-AAV6 from about 1 to about 1000K MOI (e.g., about 5 to 500K MOI) of AAV. For example, the method disclosed herein comprises infecting the T cell with at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, or 500 MOI of AAV. It is understood and herein contemplated that the period of culturing of the CD70 CAR-expressing γδ T cells can be between 1- and 14-days post AAV infection (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days).
[0080] In some embodiments, the method disclosed herein, comprises knocking out CD70, CD38, CD33, or TGFβRII from the γδ T cells while simultaneously integrating a CD70, CD38, CD33, or TGFβRII from the γδ T cells CAR construct into the AAVS1 safe-harbor site to generate a modified CAR-expressing γδ T cell, comprising a knock-out (KO) of CD70, CD38, CD33, or TGFβRII and a knock-in (KI) of CD70, CD38, CD33, or TGFβRII CAR carried by an AAV plasmid construct. D. Methods of treatment
[0081] The modified CAR-expressing γδ T cells and the method of making it, as disclosed herein can be used to treat, inhibit, reduce, decrease, ameliorate, and / or prevent any disease where uncontrolled cellular proliferation occurs such as cancers. A representative but non-limiting list of cancers that the disclosed compositions can be used to treat is the following: lymphomas such as B cell lymphoma and T cell lymphoma; mycosis fungoides; Hodgkin’s Disease; myeloid leukemiaATTORNEY DOCKET NO.10935-032WO1 (including, but not limited to acute myeloid leukemia (AML) and / or chronic myeloid leukemia (CML)); bladder cancer; brain cancer; nervous system cancer; head and neck cancer; squamous cell carcinoma of head and neck; renal cancer; lung cancers such as small cell lung cancer, non- small cell lung carcinoma (NSCLC), lung squamous cell carcinoma (LUSC), and Lung Adenocarcinomas (LUAD); neuroblastoma / glioblastoma; ovarian cancer; pancreatic cancer; prostate cancer; skin cancer; hepatic cancer; melanoma; squamous cell carcinomas of the mouth, throat, larynx, and lung; cervical cancer; cervical carcinoma; breast cancer including, but not limited to triple negative breast cancer; genitourinary cancer; pulmonary cancer; esophageal carcinoma; head and neck carcinoma; large bowel cancer; hematopoietic cancers; testicular cancer; and colon and rectal cancers. Thus, disclosed herein are methods of treating, decreasing, reducing, inhibiting, ameliorating, and / or preventing a cancer and / or metastasis (such as, for example, acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), hairy cell leukemia (HCL), and / or myelodysplastic syndromes (MDS)) in a subject comprising administering to a subject with a cancer any of modified CAR-expressing γδ T cells disclosed herein. For example, disclosed herein are methods of treating, decreasing, reducing, inhibiting, ameliorating, and / or preventing a cancer and / or metastasis (such as, for example, acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), hairy cell leukemia (HCL), and / or myelodysplastic syndromes (MDS)) in a subject comprising administering to the subject a therapeutically effective amount of an engineered γδ T cells.
[0082] In some aspects, disclosed herein is a method of treating, inhibiting, reducing, decreasing, ameliorating, and / or preventing minimal residual disease (MRD) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the engineered cell disclosed herein. In some embodiments, the engineered cell comprises a nucleic acid sequence encoding chimeric antigen receptor (CAR) comprising a single-chain variable fragment (scFV) that specifically binds to a target molecule (e.g., CD70 CAR, C38 CAR, C33 CAR, or TGFβRII CAR), wherein the modified γδ T comprising a CD70KICAR / CD70KOγδ T cells, CD33KICAR / CD33KOγδ T cells, CD38KICAR / CD38KOγδ T cells, and TGFβRIIKICAR / TGFβRIIKOγδ T cells. In some aspects the method comprises the integration of the CD70, CD38, CD33, or TGFβRII CAR-AAV construct into an adenovirus-associated virus integration site 1 (AAVS1) safe harbor site or into one or more exons of the CD70, CD38, CD33, or TGFβRII gene thereby causing the knockout of the CD70, CD38, CD33, or TGFβRII gene.ATTORNEY DOCKET NO.10935-032WO1
[0083] Exemplary cancers include, but are not limited to, acoustic neuroma, adenocarcinoma, adrenal gland cancer, anal cancer, angiosarcoma (e.g., lymphangiosarcoma, lymphangioendotheliosarcoma, hemangiosarcoma), appendix cancer, benign monoclonal gammopathy, biliary cancer (e.g., cholangiocarcinoma), bladder cancer, breast cancer (e.g., adenocarcinoma of the breast, papillary carcinoma of the breast, mammary cancer, medullary carcinoma of the breast), brain cancer (e.g., meningioma; glioma, e.g., astrocytoma, oligodendroglioma; medulloblastoma), bronchus cancer, carcinoid tumor, cervical cancer (e.g., cervical adenocarcinoma), choriocarcinoma, chordoma, craniopharyngioma, colorectal cancer (e.g., colon cancer, rectal cancer, colorectal adenocarcinoma), epithelial carcinoma, ependymoma, endotheliosarcoma (e.g., Kaposi's sarcoma, multiple idiopathic hemorrhagic sarcoma), endometrial cancer (e.g., uterine cancer, uterine sarcoma), esophageal cancer (e.g., adenocarcinoma of the esophagus, Barrett's adenocarcinoma), Ewing's sarcoma, eye cancer (e.g., intraocular melanoma, retinoblastoma), familiar hypereosinophilia, gall bladder cancer, gastric cancer (e.g., stomach adenocarcinoma), gastrointestinal stromal tumor (GIST), head and neck cancer (e.g., head and neck squamous cell carcinoma, oral cancer (e.g., oral squamous cell carcinoma (OSCC), throat cancer (e.g., laryngeal cancer, pharyngeal cancer, nasopharyngeal cancer, oropharyngeal cancer)), hematopoietic cancers (e.g., leukemia such as acute lymphocytic leukemia (ALL) (e.g., B-cell ALL, T-cell ALL), acute myelocytic leukemia (AML) (e.g., B-cell AML, T-cell AML), chronic myelocytic leukemia (CML) (e.g., B-cell CML, T-cell CML), and chronic lymphocytic leukemia (CLL) (e.g., B-cell CLL, T-cell CLL); lymphoma such as Hodgkin lymphoma (HL) (e.g., B-cell HL, T-cell HL) and non-Hodgkin lymphoma (NHL) (e.g., B-cell NHL such as diffuse large cell lymphoma (DLCL) (e.g., diffuse large B-cell lymphoma (DLBCL)), follicular lymphoma, chronic lymphocytic leukemia / small lymphocytic lymphoma (CLL / SLL), mantle cell lymphoma (MCL), marginal zone B-cell lymphomas (e.g., mucosa-associated lymphoid tissue (MALT) lymphomas, nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma), primary mediastinal B-cell lymphoma, Burkitt lymphoma, lymphoplasmacytic lymphoma (i.e., “Waldenstrom's macroglobulinemia”), hairy cell leukemia (HCL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma and primary central nervous system (CNS) lymphoma; and T-cell NHL such as precursor T-lymphoblastic lymphoma / leukemia, peripheral T- cell lymphoma (PTCL) (e.g., cutaneous T-cell lymphoma (CTCL) (e.g., mycosis fungiodes, Sezary syndrome), angioimmunoblastic T-cell lymphoma, extranodal natural killer T-cell lymphoma, enteropathy type T-cell lymphoma, subcutaneous panniculitis-like T-cell lymphoma, anaplastic large cell lymphoma); a mixture of one or more leukemia / lymphoma as described above; andATTORNEY DOCKET NO.10935-032WO1 multiple myeloma (MM)), heavy chain disease (e.g., alpha chain disease, gamma chain disease, mu chain disease), hemangioblastoma, inflammatory myofibroblastic tumors, immunocytic amyloidosis, kidney cancer (e.g., nephroblastoma a.k.a. Wilms' tumor, renal cell carcinoma), liver cancer (e.g., hepatocellular cancer (HCC), malignant hepatoma), lung cancer (e.g., bronchogenic carcinoma, small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), adenocarcinoma of the lung), leiomyosarcoma (LMS), mastocytosis (e.g., systemic mastocytosis), myelodysplastic syndrome (MDS), mesothelioma, myeloproliferative disorder (MPD) (e.g., polycythemia Vera (PV), essential thrombocytosis (ET), agnogenic myeloid metaplasia (AMM) a.k.a. myelofibrosis (MF), chronic idiopathic myelofibrosis, chronic myelocytic leukemia (CML), chronic neutrophilic leukemia (CNL), hypereosinophilic syndrome (HES)), neuroblastoma, neurofibroma (e.g., neurofibromatosis (NF) type 1 or type 2, schwannomatosis), neuroendocrine cancer (e.g., gastroenteropancreatic neuroendoctrine tumor (GEP-NET), carcinoid tumor), osteosarcoma, ovarian cancer (e.g., cystadenocarcinoma, ovarian embryonal carcinoma, ovarian adenocarcinoma), papillary adenocarcinoma, pancreatic cancer (e.g., pancreatic adenocarcinoma, intraductal papillary mucinous neoplasm (IPMN), Islet cell tumors), penile cancer (e.g., Paget's disease of the penis and scrotum), pinealoma, primitive neuroectodermal tumor (PNT), prostate cancer (e.g., prostate adenocarcinoma), rectal cancer, rhabdomyosarcoma, salivary gland cancer, skin cancer (e.g., squamous cell carcinoma (SCC), keratoacanthoma (KA), melanoma, basal cell carcinoma (BCC)), small bowel cancer (e.g., appendix cancer), soft tissue sarcoma (e.g., malignant fibrous histiocytoma (MFH), liposarcoma, malignant peripheral nerve sheath tumor (MPNST), chondrosarcoma, fibrosarcoma, myxosarcoma), sebaceous gland carcinoma, sweat gland carcinoma, synovioma, testicular cancer (e.g., seminoma, testicular embryonal carcinoma), thyroid cancer (e.g., papillary carcinoma of the thyroid, papillary thyroid carcinoma (PTC), medullary thyroid cancer), urethral cancer, vaginal cancer and vulvar cancer (e.g., Paget's disease of the vulva).
[0084] As noted throughout the present disclosure, the disclosed the engineered or modified γδ T cells are ideally suited for use in immunotherapy such as the adoptive transfer of the engineered or modified cells (i.e., engineered CAR-expressing γδ T cells) to a subject in need thereof. Thus, in one aspect, disclosed herein are methods of adoptively transferring a modified γδ T cell to a subject in need thereof said method comprising a) obtaining a cell to be engineered; b) obtaining a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) complexed with a corresponding CRISPR / Cas guide RNA and an AAV vector comprising a plasmid comprising a transgene (such as, for example, a chimeric antigen receptor for a tumorATTORNEY DOCKET NO.10935-032WO1 antigen); and c) introducing the transgene and the RNP complex into the cell; wherein the transgene is introduced into the cell via infection with the Adeno-associated virus (AAV) into the cell; wherein the RNP complex hybridizes to a target sequence within the genomic DNA of the cell and the cell’s DNA repair enzymes insert the transgene into the host genome (for example, by homologous repair) at the target sequence within the genomic DNA of the target cell thereby creating an engineered cell; and d) transferring the engineered cell into the subject. In one aspect the transgene can be comprised on the same plasmid as the Cas9 endonuclease or encoded on a second plasmid in the same or different AAV vector. In one aspect, the target cell can be transduced with the RNP complex via electroporation before or concurrently with the infection of the cell with the transgene comprising AAV.
[0085] In one aspect, disclosed herein are a plasmid, an AAV vector or a modified cell as disclosed herein for use as a medicament. Also disclosed herein are a use of a plasmid, an AAV vector or a modified cell as disclosed herein for the manufacture of a medicament.
[0086] Also disclosed herein are a plasmid, an AAV vector or a modified cell as disclosed herein for use in the treatment of cancer. Also disclosed herein are a use of a plasmid, an AAV vector, or a modified cell as disclosed herein for the manufacture of a medicament for the treatment of cancer.
[0087] Also disclosed herein are a CAR cell created by using a method of creating a chimeric antigen receptor (CAR) γδ T cell as disclosed herein, for use in the treatment of cancer. Also disclosed herein are a use of a CAR cell (e.g., engineered γδ T cell), created by using a method of creating a chimeric antigen receptor (CAR) engineered γδ T cell as disclosed herein, for the manufacture of a medicament for the treatment of cancer.
[0088] It is understood and herein contemplated that the disclosed treatment regimens can used alone or in combination with any anti-cancer therapy known in the art including, but not limited to Abemaciclib, Abiraterone Acetate, Abitrexate (Methotrexate), Abraxane (Paclitaxel Albumin- stabilized Nanoparticle Formulation), ABVD, ABVE, ABVE-PC, AC, AC-T, Adcetris (Brentuximab Vedotin), ADE, Ado-Trastuzumab Emtansine, Adriamycin (Doxorubicin Hydrochloride), Afatinib Dimaleate, Afinitor (Everolimus), Akynzeo (Netupitant and Palonosetron Hydrochloride), Aldara (Imiquimod), Aldesleukin, Alecensa (Alectinib), Alectinib, Alemtuzumab, Alimta (Pemetrexed Disodium), Aliqopa (Copanlisib Hydrochloride), Alkeran for Injection (Melphalan Hydrochloride), Alkeran Tablets (Melphalan), Aloxi (Palonosetron Hydrochloride), Alunbrig (Brigatinib), Ambochlorin (Chlorambucil), Amboclorin Chlorambucil), Amifostine, Aminolevulinic Acid, Anastrozole, Aprepitant, Aredia (Pamidronate Disodium), ArimidexATTORNEY DOCKET NO.10935-032WO1 (Anastrozole), Aromasin (Exemestane),Arranon (Nelarabine), Arsenic Trioxide, Arzerra (Ofatumumab), Asparaginase Erwinia chrysanthemi, Atezolizumab, Avastin (Bevacizumab), Avelumab, Axitinib, Azacitidine, Bavencio (Avelumab), BEACOPP, Becenum (Carmustine), Beleodaq (Belinostat), Belinostat, Bendamustine Hydrochloride, BEP, Besponsa (Inotuzumab Ozogamicin) , Bevacizumab, Bexarotene, Bexxar (Tositumomab and Iodine I 131 Tositumomab), Bicalutamide, BiCNU (Carmustine), Bleomycin, Blinatumomab, Blincyto (Blinatumomab), Bortezomib, Bosulif (Bosutinib), Bosutinib, Brentuximab Vedotin, Brigatinib, BuMel, Busulfan, Busulfex (Busulfan), Cabazitaxel, Cabometyx (Cabozantinib-S-Malate), Cabozantinib-S-Malate, CAF, Campath (Alemtuzumab), Camptosar , (Irinotecan Hydrochloride), Capecitabine, CAPOX, Carac (Fluorouracil--Topical), Carboplatin, CARBOPLATIN-TAXOL, Carfilzomib, Carmubris (Carmustine), Carmustine, Carmustine Implant, Casodex (Bicalutamide), CEM, Ceritinib, Cerubidine (Daunorubicin Hydrochloride), Cervarix (Recombinant HPV Bivalent Vaccine), Cetuximab, CEV, Chlorambucil, CHLORAMBUCIL-PREDNISONE, CHOP, Cisplatin, Cladribine, Clafen (Cyclophosphamide), Clofarabine, Clofarex (Clofarabine), Clolar (Clofarabine), CMF, Cobimetinib, Cometriq (Cabozantinib-S-Malate), Copanlisib Hydrochloride, COPDAC, COPP, COPP-ABV, Cosmegen (Dactinomycin), Cotellic (Cobimetinib), Crizotinib, CVP, Cyclophosphamide, Cyfos (Ifosfamide), Cyramza (Ramucirumab), Cytarabine, Cytarabine Liposome, Cytosar-U (Cytarabine), Cytoxan (Cyclophosphamide), Dabrafenib, Dacarbazine, Dacogen (Decitabine), Dactinomycin, Daratumumab, Darzalex (Daratumumab), Dasatinib, Daunorubicin Hydrochloride, Daunorubicin Hydrochloride and Cytarabine Liposome, Decitabine, Defibrotide Sodium, Defitelio (Defibrotide Sodium), Degarelix, Denileukin Diftitox, Denosumab, DepoCyt (Cytarabine Liposome), Dexamethasone, Dexrazoxane Hydrochloride, Dinutuximab, Docetaxel, Doxil (Doxorubicin Hydrochloride Liposome), Doxorubicin Hydrochloride, Doxorubicin Hydrochloride Liposome, Dox-SL (Doxorubicin Hydrochloride Liposome), DTIC- Dome (Dacarbazine), Durvalumab, Efudex (Fluorouracil--Topical), Elitek (Rasburicase), Ellence (Epirubicin Hydrochloride), Elotuzumab, Eloxatin (Oxaliplatin), Eltrombopag Olamine, Emend (Aprepitant), Empliciti (Elotuzumab), Enasidenib Mesylate, Enzalutamide, Epirubicin Hydrochloride , EPOCH, Erbitux (Cetuximab), Eribulin Mesylate, Erivedge (Vismodegib), Erlotinib Hydrochloride, Erwinaze (Asparaginase Erwinia chrysanthemi) , Ethyol (Amifostine), Etopophos (Etoposide Phosphate), Etoposide, Etoposide Phosphate, Evacet (Doxorubicin Hydrochloride Liposome), Everolimus, Evista , (Raloxifene Hydrochloride), Evomela (Melphalan Hydrochloride), Exemestane, 5-FU (Fluorouracil Injection), 5-FU (Fluorouracil--Topical), Fareston (Toremifene), Farydak (Panobinostat), Faslodex (Fulvestrant), FEC, Femara (Letrozole),ATTORNEY DOCKET NO.10935-032WO1 Filgrastim, Fludara (Fludarabine Phosphate), Fludarabine Phosphate, Fluoroplex (Fluorouracil-- Topical), Fluorouracil Injection, Fluorouracil--Topical, Flutamide, Folex (Methotrexate), Folex PFS (Methotrexate), FOLFIRI, FOLFIRI-BEVACIZUMAB, FOLFIRI-CETUXIMAB, FOLFIRINOX, FOLFOX, Folotyn (Pralatrexate), FU-LV, Fulvestrant, Gardasil (Recombinant HPV Quadrivalent Vaccine), Gardasil 9 (Recombinant HPV Nonavalent Vaccine), Gazyva (Obinutuzumab), Gefitinib, Gemcitabine Hydrochloride, GEMCITABINE-CISPLATIN, GEMCITABINE-OXALIPLATIN, Gemtuzumab Ozogamicin, Gemzar (Gemcitabine Hydrochloride), Gilotrif (Afatinib Dimaleate), Gleevec (Imatinib Mesylate), Gliadel (Carmustine Implant), Gliadel wafer (Carmustine Implant), Glucarpidase, Goserelin Acetate, Halaven (Eribulin Mesylate), Hemangeol (Propranolol Hydrochloride), Herceptin (Trastuzumab), HPV Bivalent Vaccine, Recombinant, HPV Nonavalent Vaccine, Recombinant, HPV Quadrivalent Vaccine, Recombinant, Hycamtin (Topotecan Hydrochloride), Hydrea (Hydroxyurea), Hydroxyurea, Hyper- CVAD, Ibrance (Palbociclib), Ibritumomab Tiuxetan, Ibrutinib, ICE, Iclusig (Ponatinib Hydrochloride), Idamycin (Idarubicin Hydrochloride), Idarubicin Hydrochloride, Idelalisib, Idhifa (Enasidenib Mesylate), Ifex (Ifosfamide), Ifosfamide, Ifosfamidum (Ifosfamide), IL-2 (Aldesleukin), Imatinib Mesylate, Imbruvica (Ibrutinib), Imfinzi (Durvalumab), Imiquimod, Imlygic (Talimogene Laherparepvec), Inlyta (Axitinib), Inotuzumab Ozogamicin, Interferon Alfa- 2b, Recombinant, Interleukin-2 (Aldesleukin), Intron A (Recombinant Interferon Alfa-2b), Iodine I 131 Tositumomab and Tositumomab, Ipilimumab, Iressa (Gefitinib), Irinotecan Hydrochloride, Irinotecan Hydrochloride Liposome, Istodax (Romidepsin), Ixabepilone, Ixazomib Citrate, Ixempra (Ixabepilone), Jakafi (Ruxolitinib Phosphate), JEB, Jevtana (Cabazitaxel), Kadcyla (Ado- Trastuzumab Emtansine), Keoxifene (Raloxifene Hydrochloride), Kepivance (Palifermin), Keytruda (Pembrolizumab), Kisqali (Ribociclib), Kymriah (Tisagenlecleucel), Kyprolis (Carfilzomib), Lanreotide Acetate, Lapatinib Ditosylate, Lartruvo (Olaratumab), Lenalidomide, Lenvatinib Mesylate, Lenvima (Lenvatinib Mesylate), Letrozole, Leucovorin Calcium, Leukeran (Chlorambucil), Leuprolide Acetate, Leustatin (Cladribine), Levulan (Aminolevulinic Acid), Linfolizin (Chlorambucil), LipoDox (Doxorubicin Hydrochloride Liposome), Lomustine, Lonsurf (Trifluridine and Tipiracil Hydrochloride), Lupron (Leuprolide Acetate), Lupron Depot (Leuprolide Acetate), Lupron Depot-Ped (Leuprolide Acetate), Lynparza (Olaparib), Marqibo (Vincristine Sulfate Liposome), Matulane (Procarbazine Hydrochloride), Mechlorethamine Hydrochloride, Megestrol Acetate, Mekinist (Trametinib), Melphalan, Melphalan Hydrochloride, Mercaptopurine, Mesna, Mesnex (Mesna), Methazolastone (Temozolomide), Methotrexate, Methotrexate LPF (Methotrexate), Methylnaltrexone Bromide, Mexate (Methotrexate), Mexate-ATTORNEY DOCKET NO.10935-032WO1 AQ (Methotrexate), Midostaurin, Mitomycin C, Mitoxantrone Hydrochloride, Mitozytrex (Mitomycin C), MOPP, Mozobil (Plerixafor), Mustargen (Mechlorethamine Hydrochloride) , Mutamycin (Mitomycin C), Myleran (Busulfan), Mylosar (Azacitidine), Mylotarg (Gemtuzumab Ozogamicin), Nanoparticle Paclitaxel (Paclitaxel Albumin-stabilized Nanoparticle Formulation), Navelbine (Vinorelbine Tartrate), Necitumumab, Nelarabine, Neosar (Cyclophosphamide), Neratinib Maleate, Nerlynx (Neratinib Maleate), Netupitant and Palonosetron Hydrochloride, Neulasta (Pegfilgrastim), Neupogen (Filgrastim), Nexavar (Sorafenib Tosylate), Nilandron (Nilutamide), Nilotinib, Nilutamide, Ninlaro (Ixazomib Citrate), Niraparib Tosylate Monohydrate, Nivolumab, Nolvadex (Tamoxifen Citrate), Nplate (Romiplostim), Obinutuzumab, Odomzo (Sonidegib), OEPA, Ofatumumab, OFF, Olaparib, Olaratumab, Omacetaxine Mepesuccinate, Oncaspar (Pegaspargase), Ondansetron Hydrochloride, Onivyde (Irinotecan Hydrochloride Liposome), Ontak (Denileukin Diftitox), Opdivo (Nivolumab), OPPA, Osimertinib, Oxaliplatin, Paclitaxel, Paclitaxel Albumin-stabilized Nanoparticle Formulation, PAD, Palbociclib, Palifermin, Palonosetron Hydrochloride, Palonosetron Hydrochloride and Netupitant, Pamidronate Disodium, Panitumumab, Panobinostat, Paraplat (Carboplatin), Paraplatin (Carboplatin), Pazopanib Hydrochloride, PCV, PEB, Pegaspargase, Pegfilgrastim, Peginterferon Alfa-2b, PEG-Intron (Peginterferon Alfa-2b), Pembrolizumab, Pemetrexed Disodium, Perjeta (Pertuzumab), Pertuzumab, Platinol (Cisplatin), Platinol-AQ (Cisplatin), Plerixafor, Pomalidomide, Pomalyst (Pomalidomide), Ponatinib Hydrochloride, Portrazza (Necitumumab), Pralatrexate, Prednisone, Procarbazine Hydrochloride , Proleukin (Aldesleukin), Prolia (Denosumab), Promacta (Eltrombopag Olamine), Propranolol Hydrochloride, Provenge (Sipuleucel-T), Purinethol (Mercaptopurine), Purixan (Mercaptopurine), Radium 223 Dichloride, Raloxifene Hydrochloride, Ramucirumab, Rasburicase, R-CHOP, R-CVP, Recombinant Human Papillomavirus (HPV) Bivalent Vaccine, Recombinant Human Papillomavirus (HPV) Nonavalent Vaccine, Recombinant Human Papillomavirus (HPV) Quadrivalent Vaccine, Recombinant Interferon Alfa-2b, Regorafenib, Relistor (Methylnaltrexone Bromide), R-EPOCH, Revlimid (Lenalidomide), Rheumatrex (Methotrexate), Ribociclib, R-ICE, Rituxan (Rituximab), Rituxan Hycela (Rituximab and Hyaluronidase Human), Rituximab, Rituximab and , Hyaluronidase Human, ,Rolapitant Hydrochloride, Romidepsin, Romiplostim, Rubidomycin (Daunorubicin Hydrochloride), Rubraca (Rucaparib Camsylate), Rucaparib Camsylate, Ruxolitinib Phosphate, Rydapt (Midostaurin), Sclerosol Intrapleural Aerosol (Talc), Siltuximab, Sipuleucel-T, Somatuline Depot (Lanreotide Acetate), Sonidegib, Sorafenib Tosylate, Sprycel (Dasatinib), STANFORD V, Sterile Talc Powder (Talc), Steritalc (Talc), Stivarga (Regorafenib), Sunitinib Malate, Sutent (Sunitinib Malate),ATTORNEY DOCKET NO.10935-032WO1 Sylatron (Peginterferon Alfa-2b), Sylvant (Siltuximab), Synribo (Omacetaxine Mepesuccinate), Tabloid (Thioguanine), TAC, Tafinlar (Dabrafenib), Tagrisso (Osimertinib), Talc, Talimogene Laherparepvec, Tamoxifen Citrate, Tarabine PFS (Cytarabine), Tarceva (Erlotinib Hydrochloride), Targretin (Bexarotene), Tasigna (Nilotinib), Taxol (Paclitaxel), Taxotere (Docetaxel), Tecentriq , (Atezolizumab), Temodar (Temozolomide), Temozolomide, Temsirolimus, Thalidomide, Thalomid (Thalidomide), Thioguanine, Thiotepa, Tisagenlecleucel, Tolak (Fluorouracil--Topical), Topotecan Hydrochloride, Toremifene, Torisel (Temsirolimus), Tositumomab and Iodine I 131 Tositumomab, Totect (Dexrazoxane Hydrochloride), TPF, Trabectedin, Trametinib, Trastuzumab, Treanda (Bendamustine Hydrochloride), Trifluridine and Tipiracil Hydrochloride, Trisenox (Arsenic Trioxide), Tykerb (Lapatinib Ditosylate), Unituxin (Dinutuximab), Uridine Triacetate, VAC, Vandetanib, VAMP, Varubi (Rolapitant Hydrochloride), Vectibix (Panitumumab), VeIP, Velban (Vinblastine Sulfate), Velcade (Bortezomib), Velsar (Vinblastine Sulfate), Vemurafenib, Venclexta (Venetoclax), Venetoclax, Verzenio (Abemaciclib), Viadur (Leuprolide Acetate), Vidaza (Azacitidine), Vinblastine Sulfate, Vincasar PFS (Vincristine Sulfate), Vincristine Sulfate, Vincristine Sulfate Liposome, Vinorelbine Tartrate, VIP, Vismodegib, Vistogard (Uridine Triacetate), Voraxaze (Glucarpidase), Vorinostat, Votrient (Pazopanib Hydrochloride), Vyxeos (Daunorubicin Hydrochloride and Cytarabine Liposome), Wellcovorin (Leucovorin Calcium), Xalkori (Crizotinib), Xeloda (Capecitabine), XELIRI, XELOX, Xgeva (Denosumab), Xofigo (Radium 223 Dichloride), Xtandi (Enzalutamide), Yervoy (Ipilimumab), Yondelis (Trabectedin), Zaltrap (Ziv-Aflibercept), Zarxio (Filgrastim), Zejula (Niraparib Tosylate Monohydrate), Zelboraf (Vemurafenib), Zevalin (Ibritumomab Tiuxetan), Zinecard (Dexrazoxane Hydrochloride), Ziv- Aflibercept, Zofran (Ondansetron Hydrochloride), Zoladex (Goserelin Acetate), Zoledronic Acid, Zolinza (Vorinostat), Zometa (Zoledronic Acid), Zydelig (Idelalisib), Zykadia (Ceritinib), and / or Zytiga (Abiraterone Acetate). The treatment methods can include or further include checkpoint inhibitors including, but are not limited to antibodies that block PD-1 (such as, for example, Nivolumab (BMS-936558 or MDX1106), pembrolizumab, cemiplimab , CT-011, MK-3475), PD- L1 (such as, for example, atezolizumab, avelumab, durvalumab, MDX-1105 (BMS-936559), MPDL3280A, or MSB0010718C), PD-L2 (such as, for example, rHIgM12B7), CTLA-4 (such as, for example, Ipilimumab (MDX-010), Tremelimumab (CP-675,206)), IDO, B7-H3 (such as, for example, MGA271, MGD009, omburtamab), B7-H4, B7-H3, T cell immunoreceptor with Ig and ITIM domains (TIGIT)(such as, for example BMS-986207, OMP-313M32, MK-7684, AB-154, ASP-8374, MTIG7192A, or PVSRIPO), CD96, B- and T-lymphocyte attenuator (BTLA), V- domain Ig suppressor of T cell activation (VISTA)(such as, for example, JNJ-61610588, CA-170),ATTORNEY DOCKET NO.10935-032WO1 TIM3 (such as, for example, TSR-022, MBG453, Sym023, INCAGN2390, LY3321367, BMS- 986258, SHR-1702, RO7121661), LAG-3 (such as, for example, BMS-986016, LAG525, MK- 4280, REGN3767, TSR-033, BI754111, Sym022, FS118, MGD013, and Immutep). E. Methods of making γδ T cells susceptible to genetic modification
[0089] As disclosed herein, is an allogenic immunotherapy of treating cancer without the onset of Graft versus Host Disease (GvHD) comprising administrating to a subject the CAR-expressing the γδ T cells wherein the γδ T cells comprises a CRISPR Cas / RNP and Adenovirus-associated Viral Vectors (AAVs). In some embodiments the subject is a human.
[0090] Prior to the present disclosures, genetic modification of γδ T cells presented a significant challenge. The disclosure herein solved that problem in ht emanner in which the cells are expanded prior to genetic manipulation. In one aspect, disclosed herein are methods of making γδ T cells susceptible to gene editing comprising culturing the γδ T cells with feeder cells (such as, for example, K562 cells including, but not limited to CSTX-002 cells) that comprise membrane bound (mb) IL21 on the cell surface. In some aspects, the mbIL21 feeder cells further comprise membrane bound 4-1BBL.
[0091] Also disclosed herein are methods of making γδ T cells susceptible to gene editing, wherein the γδ T cells are expanded with at least a 2:1 ratio with mbIL21-expressing feeder cells. In some aspects, during expansion, γδ T cells are supplemented with 100IU IL2. In some aspects, the γδ T cells are supplemented with 100IU IL2 at least every 48 hours. In some aspects, the γδ T cells were expanded for at least 7 days. EXAMPLES
[0092] To further illustrate the principles of the present disclosure, the following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compositions, articles, and methods claimed herein are made and evaluated. They are intended to be purely exemplary of the invention and are not intended to limit the scope of what the inventors regard as their disclosure. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperatures, etc.); however, some errors and deviations should be accounted for. Unless indicated otherwise, temperature is °C or is at ambient temperature, and pressure is at or near atmospheric. There are numerous variations and combinations of process conditions that can be used to optimize product quality and performance. Only reasonable and routine experimentation will be required to optimize such process conditions.ATTORNEY DOCKET NO.10935-032WO1 EXAMPLE 1
[0093] Developed protocols for the large-scale ex vivo expansion and gene manipulation of γδ T cells. γδ T-Cells Isolation
[0094] PBMCs are isolated from buffy coat purchased from RedCross using a density gradient centrifugation. Each buffy coat that was separated into 15mL aliquots into 50mL Falcon tubes. Each aliquot was diluted with 15ml PBS1x. The solution was carefully layered on top of 15mL of Ficol in a new 50mL Falcon tube. The Falcon tubes were centrifuged at 500g for 30min (ACC-5; DEC-0). After the spin, the middle layer of gradient (containing PBMCs) was collected and transferred to a new 50 ml falcon tube. The PBMCs were washed with PBS1x (400g for 10min ACC-9 DEC-5). The cells were counted, and a single cell suspension was prepared in supplemented cell culture medium at a concentration of 5 x 10^7 cells / mL. Following their resuspension, StemCells EasySep™ Human Gamma / Delta T Cell Isolation Kit (cat# 19255) was used to isolate γδ T-Cells based on an immunomagnetic negative selection. The cell suspensions were added to 5 mL (12 x 75 mm) polystyrene round-bottom tubes and 50 ul / ml of Isolation Cocktail was added to samples. The samples were mixed and incubated at room temperature for 15 min. The Magnetic Particles were vortexed for 30 seconds and then 50ul / ml was added to the samples, mixed, and incubated for 10 min. After incubation, 2.5mL of supplemented media was added to the top of the sample and mixed. The polystyrene tube (without lid) was placed into the magnet and incubated for 5min. The magnet was picked up, and in one continuous motion inverted so the enriched cell suspension was transferred into a new 5 ml tube. The addition of magnetic particles was repeated in the enriched cell suspension with a volume of 37.5ul, incubated for 5mins, placed into the magnet for 5min, and inverted to the new 5ml tube. The isolated cells were ready to use. Since γδ T-Cells account for less than 1% of circulating white blood cells, therefore 700,000 γδ T-Cells were isolated from 20,000,000 PBMCs. γδ T-Cells Expansion
[0095] 350,000 cells were seeded in completed RPMI (Fisher Scientific cat# SH30096FS or equivalent) (10% Fetal Bovine Serum (GenClone cat# 25-514H or equivalent), 1% Penicillin- Streptomycin (Fisher Scientific cat # 15-140-122 or equivalent), 1% GlutaMax (Fisher Scientific cat# 35-050-061 or equivalent), and 1% HEPES (Fisher Scientific cat# MT25060CI or equivalent)) and supplemented with 100IU IL2 on an anti CD3 (Tonbo Bioscience cat# 40-0038-U100 or equivalent) and anti CD28 (Tonbo Bioscience cat# 40-0289-U100 or equivalent) coated plate forATTORNEY DOCKET NO.10935-032WO1 their stimulation. Two days post-stimulation, cells were counted and expanded at a 2:1 ratio with mbIL21 K562 feeder cells (CSTX002). During expansion, cells were counted and supplemented with 100IU IL2 every other day, media was added as necessary. Cells were expanded every 7 days.
[0096] Lastly, it should be understood that while the present disclosure has been provided in detail with respect to certain illustrative and specific aspects thereof, it should not be considered limited to such, as numerous modifications are possible without departing from the broad spirit and scope of the present disclosure as defined in the appended claims.
[0097] It will be apparent to those skilled in the art that various modifications and variations can be made in the present disclosure without departing from the scope or spirit of the invention. Other embodiments of the disclosure will be apparent to those skilled in the art from consideration of the specification and practice of the methods disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.
[0098] Figure 1a. illustrates the proliferation of γδ T-cells 2 weeks post-isolation. To confirm the purity of γδ T-Cells that were isolated and expanded, we performed flow cytometry for anti- CD3, anti-TCR γδ, ΤCR Vδ1, and ΤCR Vδ2 (Figure 1b).98.8% of the expanded cells are CD3+ T cells and 98.4% are TCR γδ+. These γδ T cells were then sub-gated to analyze the subsets; 23.6% are Vδ1 and 58.3 % Vδ2 γδ T cells (Fig.1b). Electroporation Optimization for Gamma Delta T-Cells
[0099] To optimize the Electroporation for Gamma Delta T-Cells to get higher efficiency for CAR insertion, we tested different electroporation programs to insert mCherry into the AAVS1 locus using TT954-2 mCherry-600bp-AAVS1-AAV6.
[0100] 21 days after isolation gamma delta cells, 3e6 cells / condition were electroporated with Cas9RNP complexes targeting AAVS1 safe harbor site. Cells were resuspended in P3 buffer and electroporated with one of the following programs: EO-115, CM-137, and EH-115 in the 4D- Nucleofector™ System. Electroporated cell suspension was transferred into prewarmed media in a 12 well plate.20 minutes post electroporation the cells were counted and 2 million cells per condition were obtained to transduce with TT954-2 mCherry-600bp-AAVS1-AAV6 with the MOI of 75k.24 hours post transduction, 1 mL of 10% RPMI (1%p / s+1%Glutamax+1%HEPES) + 100IUIL2 was added to the transduced cells.72 hours after transduction cells were stained for viability and flow was run to quantify Live Cell mCherry positivity. As it is shown in Fig.2a., the CM-137 program has both the highest percent live and mCherry positive gamma delta T cells.ATTORNEY DOCKET NO.10935-032WO1 Mean fluorescent intensity is the highest in CM-137 among all the conditions (Fig.2b.) γδ T-Cells gene Knock-In (CD70 CAR)
[0101] CD70 CAR γδ T cells were generated 14 days after isolation and expansion. Flow staining prior to CAR generation showed a 97.1% expression of CD70 on the surface of γδ T cells (Fig.3a). To prevent fratricide, CD70 was knocked-out simultaneously with the integration of the CD70 CAR construct into the AAVS1 safe-harbor site. To test CD70 targeting gRNAs, we generated Cas9 / RNP complex using 200uM CD70 gRNA (AGCGTGGATGCACACCACG) and 6.2uM of Alt-R® S.p. HiFi Cas9 Nuclease V3 (cat# 1081061). The mixture was incubated for 20min in room temperature. The cells were resuspended in P3 electroporation buffer (Lonza) and electroporated using the 4D-Nucleofector system (Lonza) in the presence of 1uL of 100μM Cas9 Electroporation enhancer (IDT, cat#1075916), using Program EH-115. After electroporation, cells were kept in media for 48hours. Flow cytometry analysis on CD70 expression showed the high editing efficiency in the CD70 Knocked out γδ T cells (Figure 3b). Next, CD70CAR was knocked- in to the AAVS1 safe harbor site using AAV6 virus harboring CD70CAR containing homology arms for AAVS1 (TT826-4 CD70CAR Gen2). Virus was added 20 minutes following the electroporation of cas9 / RNP containing 200uM of CD70 (AGCGTGGATGCACACCACG) (SEQ ID NO: 1) and AAVS1 (GGGGCCACTAGGGACAGGAT) (SEQ ID NO: 2) targeting gRNAs plus 6.2uM of ALT-R® S.p. HiFi Cas9 Nuclease V3 (cat# 1081061) (incubated for 20 minutes), at an MOI of 75k.24 hours post transduction 500uLof media was added to the cells and 48 hours after transduction CD70CAR γδ T cell generation was confirmed by flow cytometry using Biotinylated Recombinant Protein L which binds to certain subtypes of kappa light chains. As shown in Fig.3c, we were able to generate CD70CAR in both Vδ1 and Vδ2 subsets of γδ T cells. SEQUENCES SEQ ID NO.1 CD70 gRNA AGCGTGGATGCACACCACG SEQ ID NO.2 AAVS1 GGGGCCACTAGGGACAGGAT
Claims
ATTORNEY DOCKET NO.10935-032WO1 CLAIMS What is claimed is:
1. A modified chimeric antigen receptor (CAR)-expressing, Gamma Delta T cell (γδ T cell) comprising CRISPR Cas / RNP and Adenovirus-associated Viral Vectors (AAVs).
2. The modified CAR-expressing γδ T-cell of claim 1, wherein the γδ T-cell is a γ1δ9 or a γ2δ9 T cell.
3. The modified CAR-expressing γδ T-cell of claim 1, wherein the Cas gene encodes an endonuclease comprising Cas9, Cas3, Cas12 or a derivative thereof.
4. The modified CAR-expressing γδ T-cell of claim 1, comprises a knock-out (KO) of CD70, CD38, CD33, or TGFβRII and a knock-in (KI) of CD70, CD38, CD33, or TGFβRII CAR carried by an AAV plasmid construct.
5. The modified CAR-expressing γδ T-cell any one of claims 1-4, comprises the integration of the CD70, CD38, CD33, or TGFβRII CAR-AAV construct into an adenovirus-associated virus integration site 1 (AAVS1) safe harbor site.
6. The modified CAR-expressing γδ T-cell of claims 1-5, wherein the serotype of the AAV comprises AAV6.
7. A method of generating CAR-expressing γδ T cell, comprising; a) expanding the γδ T cells to generate γδ T cells that are highly-susceptible to gene- editing; and b) editing of γδ T cells using a combination of CRISPR Cas / RNP and AAVs to generate highly efficient gene KO, site directed gene and CAR insertion in these cells; wherein the protein expressed by the gene being knocked out and the target of the CAR are the same protein.ATTORNEY DOCKET NO.10935-032WO1 8. The method of claim 7, wherein the Cas gene encodes an endonuclease comprising Cas9, Cas3, Cas12 or a derivative thereof.
9. The method of claims 7, wherein the γδ T cells are isolated from human Peripheral Blood Mononuclear Cells (PBMCs) using immunomagnetic negative selection.
10. The method of claims 7-9, wherein the γδ T cells were seeded on to culture plates coated with an anti-CD3 antibody or equivalent and / or anti-CD28 antibody or equivalent, in complete growth medium.
11. The method of claims 7-10, wherein stimulation time is at least 2 days.
12. The method of claims 8-11, wherein following stimulation γδ T cells are expanded with feeder cells that comprise membrane bound (mb) IL21 on the cell surface.
13. The method of claim 12, wherein the mbIL21 feeder cells further comprise membrane bound 4-1BBL.
14. The method of claims 12 or 13, wherein the feeder cells are K562 cells.
15. The method of claim 14, wherein the feeder cell line is CSTX-002.
16. The method of claims 12-15, wherein the γδ T cells are expanded with at least a 2:1 ratio with mbIL21-expressing feeder cells.
17. The method of claims 7-16, wherein during expansion, γδ T cells are supplemented with 100IU IL2.
18. The method of claim 17, wherein the γδ T cells are supplemented with 100IU IL2 at least every 48 hours.ATTORNEY DOCKET NO.10935-032WO1 19. The method of claims 7-18, wherein the γδ T cells were expanded for at least 7 days.
20. The method of claims 7-19, wherein, at least 21 days after isolation of γδ T cells, at least 3 million γδ T cells / condition were electroporated with Cas / RNP complexes targeting AAVS1 safe harbor site.
21. The method of claim 20, wherein the Cas gene encodes an endonuclease comprising Cas9, Cas3, Cas12 or a derivative thereof.
22. The method of claim 20, wherein the γδ T cells are electroporated.
23. The method of claims 7-22, wherein post electroporation at least 2 million γδ T cells per condition were transduced with a site directed AAV.
24. The method of claim 23, wherein the AAV serotype is AAV6.
25. The method of claims 7-24, wherein the AAV6 carries a TT954-2 mCherry-600bp-AAVS1 construct.
26. The method of claims 23-25, wherein the γδ T cells are transduced with TT954-2 mCherry- 600bp-AAVS1-AAV6 with a Multiplicity of Infection (MOI) of at least 1k 27. The method of claims 7-26, wherein a complete growth media was added to the γδ T cells, post transduction.
28. The method of claim 27, wherein the time post transduction is at least 24 hours.
29. The method of claims 7-28, wherein generating expanded CD70 CAR-expressing γδ T cells, post-transduction, occurs in at least 14 days.ATTORNEY DOCKET NO.10935-032WO1 30. The method of claims 7-29, wherein the method comprises knocking out CD70, CD38, CD33, or TGFβRII from the γδ T cells while simultaneously integrating a CD70, CD38, CD33, or TGFβRII from the γδ T cells CAR construct into the AAVS1 safe-harbor site.
31. A method of treating cancer without the onset of Graft versus Host Disease (GvHD) comprising administrating to a subject the CAR-expressing the γδ T cells of any of claims 1-6 or made by the method of any of claims 7-30.
32. A method of treating cancer without the onset of Graft versus Host Disease (GvHD) comprising administrating to a subject the CAR-expressing the γδ T cells wherein the γδ T cells comprises a CRISPR Cas / RNP and Adenovirus-associated Viral Vectors (AAVs).
33. The method of claim 32, wherein the Cas gene encodes an endonuclease comprising Cas9, Cas3, Cas12 or a derivative thereof.
34. The method of claim 32, wherein the γδ T cell comprises a knock-out (KO) of CD70, CD38, CD33, or TGFβRII and a knock-in (KI) of CD70, CD38, CD33, or TGFβRII CAR carried by an AAV plasmid construct.
35. The method of any one of claims 32-34, comprises the integration of the CD70, CD38, CD33, or TGFβRII CAR-AAV construct into an adenovirus-associated virus integration site 1 (AAVS1) safe harbor site.
36. The method of claims 32-35, wherein the serotype of the AAV comprises AAV6.
37. The method of claims 30-34, wherein the CAR-expressing γδ T cells comprise an allogenic immunotherapy.
38. The method of claims 30-35, wherein the subject is a human.ATTORNEY DOCKET NO.10935-032WO1 39. A method of making gamma delta T cells susceptible to gene editing comprising culturing the gamma delta T cells with feeder cells that comprise membrane bound (mb) IL21 on the cell surface.
40. The method of claim 39, wherein the mbIL21 feeder cells further comprise membrane bound 4-1BBL.
41. The method of claims 39 or 40, wherein the feeder cells are K562 cells.
42. The method of claim 41, wherein the feeder cell line is CSTX-002.
43. The method of claims 39-42, wherein the γδ T cells are expanded with at least a 2:1 ratio with mbIL21-expressing feeder cells.
44. The method of claims 39-43, wherein during expansion, γδ T cells are supplemented with 100IU IL2.
45. The method of claim 44, wherein the γδ T cells are supplemented with 100IU IL2 at least every 48 hours.
46. The method of claims 39-45, wherein the γδ T cells were expanded for at least 7 days.
Citation Information
Patent Citations
Genetically engineered t cell for cell therapy
WO2023178292A1