TCR recognizing g12v mutated ras and uses thereof

Engineered TCRs specifically targeting G12V mutated RAS peptides in the HLA-A*11 context address the challenge of treating difficult-to-treat cancers by enhancing cytotoxic activity against cancer cells while minimizing cross-reactivity, offering a promising therapeutic solution for cancers like pancreatic ductal adenocarcinoma.

WO2025125590A2PCT designated stage expired Publication Date: 2025-06-19GENOVIE
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2024/086261
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-05
Filing Date
2024-12-13
Publication Date
2025-06-19

AI Technical Summary

Technical Problem

There is a need for specific and safe T cell receptors (TCRs) that can effectively target G12V mutated RAS peptides in cancer therapy, particularly for difficult-to-treat cancers like pancreatic ductal adenocarcinoma, without causing cytotoxicity towards non-targeted cells or wild-type RAS peptides.

Method used

Development of engineered TCRs that specifically recognize G12V mutated human RAS peptides, such as KRAS, HRAS, or NRAS, presented in the HLA-A*11 context, with high affinity and specificity, and are engineered to minimize cross-reactivity with other HLA-presented peptides.

Benefits of technology

The engineered TCRs demonstrate high sensitivity and specificity for G12V mutated RAS peptides, reducing cross-reactivity and enhancing cytotoxic activity against cancer cells, while avoiding cytotoxicity towards non-targeted cells, thus providing a promising therapeutic approach for cancers like pancreatic ductal adenocarcinoma.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000005_0001
    Figure IMGF000005_0001
  • Figure IMGF000110_0001
    Figure IMGF000110_0001
  • Figure IMGF000121_0001
    Figure IMGF000121_0001
Patent Text Reader

Abstract

The invention relates to a selection of verified targets for T-cell receptors (TCR) against mutated human rat sarcoma (RAS) peptides as well as to several new T-cell receptors (TCR), which are isolated and / or expressed in an engineered cell, and which specifically recognize a G12V mutated human rat sarcoma (RAS) peptide, wherein the peptide is a mutated human Kirsten RAS (KRAS) peptide, a mutated human Harvey RAS (HRAS) peptide, or a human neuroblastoma RAS (NRAS) peptide, which consists of VVVGAVGVGK (SEQ ID NO: 1) or VVGAVGVGK (SEQ ID NO:2) presented in a HLA- A*11 complex, and wherein the individual TCR comprises a paired TCR alpha- and TCR beta-chain. The invention further relates to engineered cells and vectors expressing said TCRs and medical uses of the same for treating cancer patients.
Need to check novelty before this filing date? Find Prior Art

Description

Technical fieldThe present invention relates to the field of treating cancer patients who express mutated RAS variant. Herein disclosed is a selection of verified targets forT cell receptors (TCR) against mutated human rat sarcoma (RAS) peptides, as well as novel T cell receptors (TCR) which are isolated and / or expressed in an engineered cell, and which specifically recognize a specific G12V mutated human rat sarcoma (RAS) peptide, wherein the peptide can be a mutated human Kirsten RAS (KRAS) peptide, a mutated human Harvey RAS (HRAS) peptide, or a human neuroblastoma RAS (NRAS) peptide, and wherein the peptide consists of VWGAVGVGK (SEQ ID NO: 1) or VVGAVGVGK (SEQ ID NO:2) and is presented in HLA-A*11.BackgroundAdoptive cell transfer (ACT) therapies using engineered T cells (TCR-Ts) or chimeric antigen receptor (CAR)-T cells, have gained much traction in recent years. The use of CAR-T in the treatment of B cell malignancies has demonstrated to be very effective (Weber et al 2020), however this efficacy is not replicable in the treatment of solid tumours. TCR-T-based immunotherapy holds much promise for patients with difficult-to-treat cancers where there are currently no alternative treatment options. A great advantage of TCR-T-based therapy relates to T cells being able to recognise a much larger number of antigenic targets and from all cellular compartments than chimeric antigen receptors. The TCR-antigen-HLA interaction is the core component of the targeting mechanism that allows T cells to kill cancer cells. TCRs also have lower epitope density requirement for activation compared to chimeric antigen receptors. An important consideration when designing TCR-T-based therapy is the Human Leucocyte Antigen (HLA) restriction, as any given TCR can only be used to treat patients with the corresponding HLA genetic background to avoid tissue rejection. This restriction needs to be taken into consideration when developing a therapeutic TCR and when using such a TCR in engineered T cells.There remains an unmet need in the art for obtaining specific and safe TCRs for difficuIt-to-treat cancers.The T cell Receptor (TCR)The TCR is the component of the T cell responsible for interacting with and sensing the targets of T cell adaptive immunity. In general terms, the TCR is comprised of aheterodimeric protein complex presented on the cell surface. Each of the two TCR chains are composed of two extracellular domains, being the variable (V)-region and the constant (C)-region, both of the immunoglobulin superfamily (IgSF) domain, forming antiparallel p-sheets. These are anchored in the cell membrane by a type-1 transmembrane domain, which adjoins a short cytoplasmic tail. The quality of the T cells to adapt and detect diverse molecular constituents arises from variations in the TCR chains that are generated during T cell genesis. This variation is generated by somatic recombination in a similar manner to antibody genesis in B cells.TCR chain diversityThe T cell pool consists of several functionally and phenotypically heterogeneous subpopulations. However, T cells may be broadly classified as ap or yb according to the somatically rearranged TCR isoform they express at their surface. There exist two TCR chain pair isoforms; TCR alpha (TRA) and TCR beta (TRB) pairs; and TCR gamma (TRG) and TCR delta (TRD) pairs. T cells expressing TRA:TRB pairs are referred to as ap T cells, while T cells expressing TRG:TRD pairs are referred to as yb T cells.TCRs of both ap and yb forms are responsible for the recognition of diverse ligands, or ‘antigens’, and each T cell generates ap or yb receptor chains de novo during T cell maturation. These de novo TCR chain pairs achieve diversity of recognition through generation of receptor sequence diversity in a process called somatic V(D)J recombination after which each T cell expresses copies of a single distinctly rearranged TCR. At the TRA and TRG loci, a number of discrete variable (V) and functional (J) gene segments are available for recombination and juxtaposed to constant (C) gene segments, thus referred to as VJ recombination. Recombination at the TRB and TRD loci additionally includes a diversity (D) gene segment and is referred to as VDJ recombination.Each recombined TCR possesses potential for unique ligand specificity, determined by the structure of the ligand-binding site formed by the a and p chains in the case of ap T cells or y and b chains in the case of yb T cells. The structural diversity of TCRs is largely confined to three short hairpin loops on each chain, called complementarity-determining regions (CDR), and termed CDR1, CDR2 and CDR3 respectively. Three CDRs are contributed from each chain of the receptor chain pair, and collectively these six CDR loops sit at the membrane-distal end of the TCR extracellular domain to form the antigen-HLA binding sites.Sequence diversity in each TCR chain is achieved in two modes. First, the random selection of gene segments for recombination provides basal sequence diversity. For example, TRB recombination occurs between 47 unique V, 2 unique D and 13 unique Jgermhne gene segments. In general, the V gene segment contributes both the CDR1 and CDR2 loops and are thus germline encoded. The second mode to generate sequence diversity occurs within the hypervariable CDR3 loops, which are generated by random deletion of template nucleotides and addition of non-template nucleotides, at the junctions between recombining V, (D) and J gene segments.Human Leukocyte Antigen (HLA) class I and IIHLAs are complexes on cell surface, encoded by HLA family of genes. They can also be refered to as Major Histocompatibility Complexes (MHC), for simplicity both the gene and MHC will collectively be referred to herein as HLAs.There are two forms of classical HLA complexes: HLA class I (HLAI) and HLA class II (HLAII). There are three classical HLAI genes: HLA-A, HLA-B, HLA-C. These genes encode a membrane-spanning a-chain, which associates with an invariant beta-2-microglobulin (b2M) chain. The HLAI a-chain is composed of three domains with an immunoglobulin fold: a1, a2 and a3. The a3 domain is membrane-proximal and largely invariant, while the a1 and a2 domains together form the polymorphic membrane-distal antigen-binding cleft. There are six classical HLAII genes: HLA-DPA1, HLA-DPB1, HLA- DQA1, HLA-DQB1, HLA-DRA, and HLA-DRB1. These genes encode paired DP, DQ and DR heterodimeric HLA complexes comprising a a-chain and a p-chain. Each chain has two major structural domains with an immunoglobulin fold, where the a2 and p2 domain comprise membrane-proximal and largely invariant modules similar to that of the HLAI a3 domain. The HLAII a2 and p2 domains together form the membrane-distal antigen-binding cleft and are regions of high polymorphism.The antigen-binding cleft of HLAI and HLAII comprises two anti-parallel a-helices on a platform of eight anti-parallel p-sheets. In this cleft the peptide antigen is bound and presented in an extended conformation. The peptide-contacting residues in HLAI and HLAII are the location of most of the sequence polymorphism, which constitutes the molecular basis of the diverse peptide repertoires presented by different HLA alleles. The peptide makes extensive contacts with the antigen-binding cleft and as a result each HLA allele imposes distinct sequence constraints and preferences on the presented peptides. A given peptide will thus only bind a limited number of HLAs, and reciprocally each allele only accommodates a particular fraction of the peptide collection from a given protein. The set of HLAI and HLAII alleles that is present in each individual is called the HLA genotype, each of the two chromosomes containing a linear haplotype that will, in the absence of recombination, be transmitted intact to progeny cells. The polymorphism of HLAI and HLAII genes and the co-dominant expression of inherited alleles drives very large diversity of HLA haplotypes across the human population, which when coupled to the enormoussequence diversity of op TCR, presents high obstacles to standardisation of analysis of these HLA-antigen-TCR interactions.aP TCR engagement of HLAI and HLAIIThe a3 TCRs recognize peptides as part of a mixed peptide-HLA (pHLA) binding interface formed by residues of both the HLA and the peptide antigen (altered self). HLAI complexes are presented on the surface of nearly all nucleated cells and are generally considered to present peptides derived from endogenous proteins. T cells can thus interrogate the endogenous cellular proteome of an HLAI-presenting cell by sampling pHLAI complexes of an interacting cell. Engagement of HLAI requires the expression of the TCR co-receptor CD8 by the interacting T cell, thus HLAI sampling is restricted to CD8+ ap T cells. In contrast, the surface presentation of HLAII complexes is largely restricted to professional APCs and are generally considered to present peptides derived from proteins exogenous to the presenting cell. An interacting T cell can therefore interrogate the proteome of the extracellular microenvironment in which the presenting cell resides. The engagement of HLAII requires the expression of the TCR co-receptor CD4 by the interacting T cell, and thus HLAII sampling is restricted to CD4+ aP T cells.TCR:CD3 ComplexMature ap and yb TCR chain pairs are presented on the cell surface in a complex with accessory CD3 subunits, denoted e, y, 5 and £. These subunits associate with ap or yb TCRs as three dimers (sy, sb, ¢¢). This TCR:CD3 complex (TCRsp) forms the unit for initiation of cellular signalling responses upon engagement of an ap or yb TCR with HLA-restricted antigen. The CD3 accessories associated as a TCR:CD3 complex contribute signalling motifs called immunoreceptor tyrosine-based activation motifs (ITAMs).CD3e, CD3y and CD3b each contribute a single ITAM while the CD3^ homodimer contains 3 ITAMs. The three CD3 dimers (sy, £b, ¢¢) that assemble with the TCR thus contribute 10 ITAMs. Upon TCR ligation with antigen, phosphorylation of the tandem tyrosine residues creates paired docking sites for proteins that contain Src homology 2 (SH2) domains, such as the critical ^-chain-associated protein of 70 kDa (ZAP- 70). Recruitment of such proteins initiate the formation of TCR:CD3 signalling complexes that are ultimately responsible for T cell activation and differentiation.ap T cellsaP T cells are generally more abundant in humans than their yb T cell counterparts. A majority of ap T cells interact with peptide antigens that are presented by complexes onthe cell surface. Peptide-HLA (pHLA)-recogmsing T cells were the first to be described and are by far the best characterised. More rare forms of op T cells have also been described. Mucosal-associated invariant T (MAIT) cells appear to have a relatively limited a and p chain diversity and recognise bacterial metabolites rather than protein fragments. The invariant natural killer T-cells (iNK T cells) and germline-encoded mycolyl-reactive T cells (GEM T cells) are restricted to recognition of glycolipids that are cross-presented by non-HLA molecules. iNK T cells are largely considered to interact with CD1 d-presented glycolipids, whereas GEM T cells interact with CD1b-presented glycolipids. Additional forms of T cells are thought to interact with glycolipids in the context of CD1a and CD1c, however, such cells are yet to be characterised in significant detail.Conventional a0 T cellsThe key feature of most ap T cells is the recognition of peptide antigens in the context of HLA molecules. These are often referred to as ‘conventional’ op T cells. Within an individual, self-HLA molecules present peptides from self and foreign proteins to T cells, providing the essential basis for adaptive immunity against malignancies and foreign pathogens, adaptive tolerance towards commensal organisms, foodstuffs, and self. The HLA locus that encodes HLA proteins is the most gene-dense and polymorphic region of the human genome, and there are in excess of 12,000 alleles described in humans. The high degree of polymorphism in the HLA locus ensures a diversity of peptide antigen presentation between individuals, which is important for immunity at the population level.RAS OncogenesMembers of the RAS super-family of proteins (KRAS / NRAS / HRAS) are involved in cellular signal transduction pathways, and mutation in RAS protein family members is a canonical driver of oncogenesis. The RAS family members have an identical amino acid sequence in positions 1 through to 86, and more than 99% of all cancer-associated mutations occur at positions 12, 13 or 61 (Prior et a / 2012). As these positions are in the domains responsible for GTP dephosphorylation into GDP, the mutations lead to constitutive activation of the RAS protein. Since they are a gain of function mutations, one mutated allele expressed at normal level is sufficient to support cancer establishment and growth. Predominant mutations in the RAS occur in KRAS (85%) but also in NRAS (11%) and HRAS (4%). KRAS mutation patterns are dominated by G to A transitions at the second base of codon 12 resulting in G12D mutations, and by G to T transitions at the same base leading to G12V mutations (COSMIC - Catalogue of Somatic Mutations In Cancer https: / / cancer.sanqer.ac.uk / cosmic / qene / analvsis?ln=KRAS). KRAS is frequently mutatedin a variety of hard-to-treat cancers, including pancreatic cancer (-90%), colon cancer (-43%), lung cancer (-30%), and melanoma (-50%).Pancreatic Ductal AdenocarcinomaPancreatic cancer is the fourth leading cause of cancer death in both the European Union (EU) and the United States (US), with incidences of 7.7 and 7.6 per 100,000 people, respectively (Rawia et al, 2019). Pancreatic ductal adenocarcinoma, an exocrine pancreatic cancer, accounts for 95% of all pancreatic cancers. KRAS mutation is the most frequent mutation (more than 90%) (Hobbs et al, 2013) and the initiating genetic event for PDAC. KRAS is found in primary tumours, metastatic tumours and even in pancreatic intraepithelial neoplasia, the earliest preneoplastic stage in PDAC progression.More than three-quarters of patients with pancreatic cancer present with advanced disease, of whom around half have distant metastases at diagnosis (Ducreux et al, 2015). The 5-year life expectancy for pancreatic cancer is about 5% and is essentially unchanged over the last 2 decades.Surgical resection is the only curative modality for PDAC but, at best, only a fifth of patients are considered operable and even in these cases, the 5-year survival is -20% (Ducreux et al, 2015). Phase 3 data supports the use of chemotherapy combination regimens, such as 5 fluorouracil (5 FU), irinotecan, and oxaliplatin (FOLFIRINOX), or gemcitabine and nab-paclitaxel (Abraxane®), as the preferred first-line treatment options for patients who can tolerate aggressive therapy. However, these combination regimens have been linked to cumulative toxicity, which often necessitates dose reductions or discontinuation of certain or all chemotherapeutic agents prior to disease progression. For example, in clinical practice, the FOLFIRINOX regimen is typically limited to 12 cycles (equivalent to 6 months) before therapy de-escalation, or a treatment hiatus is implemented to mitigate toxicity.For patients who demonstrate a positive or stable response after 4-6 months of first-line therapy, there are various treatment options available, ranging from continued indefinite therapy to complete cessation of treatment.In PDAC, the dominant KRAS mutations are G12V and G12D. Clinical experience targeting cell surface expressed mutated KRAS pHLA complexes includes the recent report of autologous T cells genetically transduced to express 2 allogeneic TCRs targeting mutated KRAS G12D-HLA-C*08:02 in an adult with relapsed metastatic PDAC (Leidneret al, 2022).TCR-T-based immunotherapy targeted towards RAS-mutations holds much promise for patients with difficult to treat cancers where there are currently no alternative treatment options such as but not limited to PDAC, colorectal cancer, non-small cell lung cancer and melanoma . Still, there is a need for validating optimal targets and isolating TCRs that recognize these suitable targets with high affinity and specificity without displaying cytotoxicity towards e.g., suboptimal targets or wild-type RAS.Summary of the inventionIn general, the identification of TCRs that have a particularly suitable profile for therapeutic use is not straightforward and typically has a high attrition rate. The current invention thus for the first time discloses several verified suitable RAS targets as well as TCRs that have been stringently de-risked and are therefore suitable therapeutic candidates for use in cancer therapy.The current invention relates to several new T cell receptors (TCR), which are isolated and / or expressed in an engineered cell, and which specifically recognize a G12V mutated human rat sarcoma (RAS) peptide, wherein the peptide is a mutated human Kirsten RAS (KRAS) peptide, a mutated human Harvey RAS (HRAS) peptide, or a human neuroblastoma RAS (NRAS) peptide, which consists of WVGAVGVGK (SEQ ID NO: 1) or WGAVGVGK (SEQ ID NO:2) presented in HLA-A*11, and wherein the individual TCR comprises a paired TCR alpha- and TCR beta-chain, wherein the TCR alpha chain variable domain comprises SC1alpha-CDR1alpha-SC2alpha-CDR2alpha-SC3alpha-CDR3alpha-SC4alpha-SC5alpha, and the TCR beta chain variable domain comprises SC1beta-CDR1 beta-SC2 beta-CDR2 beta-SC3beta-CDR3beta-SC4beta-SC5beta, wherein SC is a scaffold region and CDR is a complementarity determining region.In one embodiment, as exemplified in the experimental section, the TCR according to the current invention is a TCR, which, when expressed in an engineered cell, does not have detectable cross-reactivity towards any somatically expressed HLA-presented peptide other than a G12V mutated human rat sarcoma (RAS) peptide, which consists of VWGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO: 2) and which is presented in HLA-A*11 in a cross-reactivity assay.In aspects, TCRs according to the invention have a higher sensitivity towards SEQ ID NO:1 and / or SEQ ID NO:2 when presented in a HLA-A*11 complex than does a known TCR. Such sensitivity is determined in a cell-cell contact assay wherein peptide-pulsed eAPCs are contacted with TCR-expressing eTPCs, wherein the eTPCs present the TCR to be assessed and wherein the eTPCs have been engineered to contain a ResponseElement used to asses the sensitivity in combination with CD3 downregulation. Such an assay is described in Example 3 in more detail.In aspects, the sensitivity is at least 1.10 fold, such as at least 1.15 fold, such as at least 5 1.2 fold, such as at least 1.25 fold, such as at least 1.3 fold, such as at least 1.35 fold ,such as at least 1.4 fold, such as at least 1.45 fold, such as at least 1.5 fold, such as at least 1.6 fold, such as at least 1.65 fold higher than that of a known TCR.10 A TCR disclosed herein typically comprises:a. a TCR alpha chain CDR3 sequence with at least 75%, such as at least 80% identity to a TCR alpha chain CDR3 sequence selected from the group consisting of SEQ ID NO: 88, SEQ ID NO: 90, and SEQ ID NO: 98, and SEQ ID NO: 141, and SEQ ID NO: 143, and15 b. a TCR beta chain CDR3 sequence with at least 75%, such as at least 80%identity to a TCR beta chain CDR3 sequence selected from the group consisting of SEQ ID NO: 89, SEQ ID NO: 91, and SEQ ID NO: 99, and SEQ ID NO 142, and SEQ ID NO 144.20 In embodiments, the TCR according to the current invention comprises:a. a TCR alpha chain CDR3 sequence with a TCR alpha chain CDR3 sequence selected from the group consisting of SEQ ID NO: 88, SEQ ID NO: 90, and SEQ ID NO: 98, and SEQ ID NO: 141, and SEQ ID NO: 143, and25 b. a TCR beta chain CDR3 sequence with a TCR beta chain CDR3 sequenceselected from the group consisting of SEQ ID SEQ ID NO: 89, SEQ ID NO: 91, and SEQ ID NO: 99, and SEQ ID NO 142, and SEQ ID NO 144.In a currently preferred embodiment of the invention the TCR alpha and beta chain 30 variable domain scaffold regions or CDRs of the TCR comprises and / or consists of one of the sequences selected from the group consisting of :SEQSEQSEQSEQSEQSEQSEQID NOID NOID NOID NOID NOID NOID NOSCIalpha1820281261281820CDRIalpha6062701351376062SC2alpha3234421291313234CDR2alpha7476841381407476SC3alpha4648561321344648CDR3alpha8890981411438890SC4alpha791512312579SC5alpha104104104104104104104SCIbeta192129127301921CDRIbeta616371136726163SC2beta333543130443335CDR2beta757785139867577SC3beta474957133584749CDR3beta8991991421448991SC4beta8101612412810SC5beta10510510610610651625162or sequences having at least 90% such as at least 95%, at least 97% or at least 99%, or 100% identity to said respective sequences.In currently preferred embodiments, the TCR alpha chain variable, domain scaffold5 regions, and / or or CDRs comprise and / or consist of one of the sequences selected from the group consisting of SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 117, SEQ ID NO: 145 and SEQ ID NO: 147, wherein the beta chain variable, domain scaffold regions, and / or or CDRs comprise and / or consist of one of the sequences selected from the group consisting of SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 118, SEQ ID NO: 146 and10 SEQ ID NO: 148.A TCR according to the current invention can be selected from the group comprising chimeric, humanized and human TCRs.15 A TCR according to the invention can comprise constant regions of the alpha and beta chains which have been modified to include cysteine residues to allow covalent connection by di-sulphide bridges or comprise constant regions of the alpha and beta chains which allow non covalent connections between said paired alpha and beta chains. In embodiments, the alpha and / or beta chain comprise(s) a constant region of a TCR-20 chain of another mammal, such as, but not limited to, a mouse chimeric constant region(s). Further, the alpha and / or beta chain can have been modified to include cysteine residues to allow di-sulphide bridges.In aspects, the TCR comprises a TCR alpha chain (TRA) and a TCR beta chain (TRB)25 which are covalently linked, such as through a linker peptide. The TCR alpha chain and / or the TCR beta chain can further be covalently linked to a moiety, and the linked moiety cancomprise an affinity tag or a label. In embodiments, the tag is selected from the group consisting of a CD34 enrichment tag, glutathione-S-transferase (GST), calmodulin binding protein (CBP), protein C tag. Myc tag, Halo tag, HA tag, Flag tag, His tag, biotin tag, and V5 tag. In embodiments, the label is a fluorochrome or a fluorophore such as a fluorescent protein.In aspects, the covalently linked moiety is selected from the group consisting of an inflammatory agent, cytokine, toxin, cytotoxic molecule, radioactive isotope, an enzyme that catalyses a cell wall sorting reaction, and an antibody or antigen-binding fragment thereof.The current invention in one aspect relates to a soluble TCR and / or a conjugated soluble TOR according to the current invention. In aspects, the TCR is a bi-specific T cell engager (such as BiTE), or it is an immune mobilizing monoclonal T cell receptor.The invention further relates to a pharmaceutical composition comprising a soluble protein consisting of all or a functional part of a TCR as disclosed and / or defined herein and at least one pharmaceutically acceptable excipient, carrier and / or stabilizer.A pharmaceutical composition of the current invention comprises a soluble TCR, a conjugated soluble TCR, a cell expressing a TCR and / or a composition comprising a TCR, wherein the TCR is a TCR according to the current invention. Said soluble TCR can been conjugated to a radionuclide, a chemotherapeutic agent, a toxin or another therapeutically active component, and at least one pharmaceutically acceptable excipient, carrier or stabilizer.In one aspect, the invention relates to a method of treating a disorder characterized by G12V mutated human RAS expression in a subject comprising administering to said subject a therapeutically effective amount of genetically engineered cells that express a TCR as disclosed and / or defined herein, or a pharmaceutical composition disclosed and / or defined herein, wherein said disorder is a solid or haematological malignancy expressing the peptide of VWGAVGVGK (SEQ ID NO: 1) and / or VVGAVGVGK (SEQ ID NO: 2), wherein said engineered cell is a T cell, T cell progenitor cell, NK cell, NK progenitor cell or a differentiated stem cell and which is either autologous or allogenic, and wherein about 104 to about 1010 engineered cells are infused systemically into said subject or injected or pumped directly into a solid tumour, into a blood vessel that feeds a tumour and / or into the volume surrounding a solid tumour.Said method can be used for treating a disorder in a subject wherein said subject carries an HLA allele selected from HLA-A*01, HLA-A*02, HLA-A*03, HLA-AM1, HLA-A*23, HLA-A*24, HLA-A*25, HLA-A*26, HLA-A*29, HLA-A*30, HLA-A*31, HLA-A*32, HLA-A*33, HLA-A*34, HLA-A*66, HLA-A*68, HLA-A*80, HLA-B*07, HLA-B*08, HLA-B*13, HLA-B*14, HLA-B*15, HLA-B*18, HLA-B*27, HLA-B*35, HLA-B*37, HLA-B*38, HLA-B*40, HLA-B*44, HLA-B*49, HLA-B*50, HLA-B*51, HLA-B*52, HLA-B*53, HLA-B*54, HLA-B*55, HLA-B*57, HLA-B*58, HLA-C*01, HLA-C*02, HLA-C*03, HLA-C*04, HLA-C*05, HLA-C*06, HLA-C*07, HLA-C*08, HLA-C*12, HLA-C*14, HLA-C*15, HLA-C*16, HLA-E*01, optionally wherein the HLA allele is selected from the group consisting of HLA-A*01-01, HLA-A*01-02, HLA-A*01-03, HLA-A*02-01, HLA-A*02:02, HLA-A*02:03, HLA-A*02:04, HLA-A*02:05, HLA-A*02:06, HLA-A*02:07, HLA-A*03:01, HLA-A*11:01, HLA-A*11:02, HLA-A*11:03, HLA-A*11:04, HLA-A*11:05, HLA-A*11:09, HLA-A*23:01, HLA-A*24:02, HLA-A*24:03, HLA-A*24:04, HLA-A*24:07, HLA-A*24:10, HLA-A*24:17, HLA-A*25:01, HLA-A*26:01, HLA-A*29:02, HLA-A*30:01, HLA-A*30:02, HLA-A*31:01, HLA-A*32:01, HLA-A*33:01, HLA-A*33:03, HLA-A*34:02, HLA-A*66:01, HLA-A*66:02, HLA-A*68:01, HLA-A*68:02, HLA-A*80:01, HLA-B*07:02, HLA-B*07:05, HLA-B*08:01, HLA-B*13:01, HLA-B*13:02, HLA-B*14:01, HLA-B*14:02, HLA-B*15:01, HLA-B*15:02, HLA-B*15:03, HLA-B*18:01, HLA-B*27:05, HLA-B*35:01, HLA-B*35:02, HLA-B*35:03, HLA-B*35:05, HLA-B*35:08, HLA-B*35:12, HLA-B*37:01, HLA-B*38:01, HLA-B*40:01, HLA-B*40:02, HLA-B*44:02, HLA-B*44:03, HLA-B*49:01, HLA-B*50:01, HLA-B*51:01, HLA-B*51:02, HLA-B*52:01, HLA-B*53:01, HLA-B*54:01, HLA-B*55:01, HLA-B*57:01, HLA-B*58:01, HLA-C*01:02, HLA-C*02:02, HLA-C*03:03, HLA-C*03:04, HLA-C*04:01, HLA-C*05:01, HLA-C*06:02, HLA-C*07:01, HLA-C*07:02, HLA-C*08:01, HLA-C*08:02, HLA-C*12:02, HLA-C*12:03, HLA-C*14:02, HLA-C*15:02, HLA-C*16:01, HLA-E*01:01, HLA-E*01:03. In in an embodiment the HLA allele is HLA-A*11, such as HLA-A*11:01.In addition, said method can be used for treating a said subject, wherein said subject carries an alternate subform of HLA-A*11 other than HLA-A*11:03 or HLA-A*11:04, which alternate subform of HLA-A*11 is capable of specifically presenting the peptide of SEQ ID NO: 1 or SEQ ID NO: 2 and which is specifically recognized by the TOR according to the current invention, such as wherein said subject carries a different HLA-A, HLA-B or HLA-C allele than HLA-A*11:01, that is capable of specifically presenting the peptide of SEQ ID NO: 1 or SEQ ID NO: 2 and which is recognized by the TOR according to the current invention.Said method is in particular intended for treating a disorder in a subject, wherein said subject carries an HLA-A*11 allele. In addition, said method can be used for treating a said subject, wherein said subject carries an alternate subform of HLA-A*11 other thanHLA-A 11:03 or HLA-A 11:04, which alternate subform of HLA-A 11 is capable of specifically presenting the peptide of SEQ ID NO: 1 or SEQ ID NO: 2 and which is specifically recognized by the TOR according to the current invention, or wherein said subject carries a different HLA-A, HLA-B or HLA-C allele than HLA-A*11, that is capable of specifically presenting the peptide of SEQ ID NO: 1 or SEQ ID NO: 2 and which is recognized by the TOR according to the current invention.In one aspect, the current invention relates to a TCR disclosed, described and / or defined herein for use as a medicament In particular, the current invention relates to a TCR disclosed, described and / or defined herein for use in the treatment of a cancer in a patient carrying HLA-A*11, comprising administering to said patient said TCR or a pharmaceutical composition comprising said TCR, wherein said cancer is a solid or haematological malignancy expressing the peptide of SEQ ID NO: 1 or SEQ ID NO: 2, and wherein said TCR or a pharmaceutical composition comprising said TCR is infused systemically into said patient or injected or pumped directly into a solid tumour, into a blood vessel that feeds a tumour and / or into the volume surrounding a solid tumour in said patient.In aspects, said treatment comprises administering to said patient an engineered cell, wherein said engineered cell is a T cell, T cell progenitor cell, NK cell, NK progenitor cell or differentiated stem cell and which is either autologous or allogenic, and wherein about 104 to about 1010 engineered cells are infused systemically into said patient or injected or pumped directly into a solid tumour, into a blood vessel that feeds a tumour and / or into the volume surrounding a solid tumour.Typically, the use related to herein is for treating a disorder in a subject, wherein said subject carries a subform of HLA-A*11 capable of specifically presenting the peptide of SEQ ID NO: 1 or SEQ ID NO: 2 and thus is recognized by a TCR according to the current invention.In an aspect a TCR according to the invention is capable of specifically recognising both of SEQ ID NO: 1 and SEQ ID NO: 2 when either is presented in a HLA-A*11 complex, thereby allowing for treatment of patients wherein either or both peptides are presented in the HLA-A*11 context.Typically, the use related to herein is for treating a disorder in a subject, wherein said subject carries an alternate subform of HLA-A*11, which alternate subform of HLA-A*11 is capable of specifically presenting the peptide of SEQ ID NO: 1 or SEQ ID NO: 2 and thus is recognized by a TCR disclosed, described and / or defined herein, such as wherein saidsubject carries a different HLA-A, HLA-B or HLA-C allele than HLA-A 11, that is capable of specifically presenting the peptide of SEQ ID NO: 1 or SEQ ID NO: 2 and which is recognized by the TCR according to the current invention.Typically, the use related to herein is for treating a disorder in a subject, wherein said subject carries an alternate subform of HLA-A*11 other than HLA-A*11:03 or HLA-A*11:04, which alternate subform of HLA-A*11 is capable of specifically presenting the peptide of SEQ ID NO: 1 or SEQ ID NO: 2 and thus is recognized by a TCR disclosed, described and / or defined herein,In one aspect, the invention relates to a nucleic acid encoding a TCR comprising a paired TCR alpha- and TCR beta-chain as disclosed, described and / or defined herein.In another aspect, the invention relates to a vector comprising a nucleic acid encoding a TCR comprising a paired TCR a - and TCR b chain as disclosed, described and / or defined herein. Said vector can be selected from the group consisting of an expression vector, a cloning vector, viral vector or a non-viral vector. In certain aspects, said vector further comprises a nucleic acid sequence encoding CD8a and / or CD8p that can be operably linked to a nucleic acid encoding a tag, such as, but not limited to, wherein the nucleic acid encoding a tag is at the 5’ upstream of the nucleic acid sequence encoding TCR a and / or TCR p and / or wherein the tag is a truncated CD34 molecule representing a cell surface enrichment tag. The isolated nucleic acid according to the current invention and the nucleic acid sequence encoding CD8a and / or CD8P can optionally be interconnected with an internal ribosome entry site or a nucleic acid sequence encoding a self-cleaving peptide, such as selected from the group consisting of P2A, E2A, F2A and T2A.In aspects of the invention, the vector disclosed, described and / or defined herein is a nucleic acid vector, viral vector or a nanoparticle vector, wherein the nucleic acid vector comprising one or more nucleic acid sequences encoding a TCR comprising a paired TCR alpha- and TCR beta-chains as but are not limited to, linear or circular double stranded DNA, or linear or circular single stranded DNA, that may or may not be chemically modified DNA, linear or circular double stranded RNA, or linear or circular single stranded RNA, that may or may not be chemically modified RNA. The RNA vector may contain a 5’ CAP, 5’ UTR, 3’ UTR and 3’ poly(A) tail and Internal Ribosome Entry Site (IRES), and may contain substituted nucleotides such as pseudouridine, and may contain replication-directing elements for self-amplification and / or may be circularized. In aspects, the viral vector comprises a packaged nucleic acid payload within one or more surfaceenvelope receptors that bind to a ligand on a target cell, heterologous viral envelope glycoproteins, fusion glycoproteins, T cell activation or co-stimulation molecules, cytokines or cytokine-based transduction enhancers, and / or transmembrane proteins comprising a mitogenic domain and / or cytokine-based domain exposed on the surface and / or conjugated to the surface of the viral vector. The tropism of the vector can further be retargeted by pseudotyping with a Cocal or a Nipah virus envelope protein, and the Nipah envelope protein can be engineered to bind EpCAM, CD3, CD5, CD4, or CD8 or other marker suitable for targeted cellular delivery of a encapsulated nucleic acidvector. Such viral vectros may be used both ex vivo and in vivo to direct the mRNA payload to a desired immune cell type. In certain aspects, a nucleic acid payload according to the current invention is encapsulated within a nanoparticle vector such as lipid nanoparticle (LNP) comprising ionizable cationic lipid, a sterol, a phospholipid, a non-functionalized PEG-lipid, and a functionalized PEG-lipid wherein the functionalized PEG-lipid may have been conjugated with a binding moiety, and wherein the LNP encapsulates a payload of mRNA. The mRNA payload may contain a linear expression construct with 5’ cap, 5’ UTR, 3’ UTR, poly-A features and IRES, and may contain substituted nucleotides such as pseudouridine, and may contain replication-directing elements for self-amplification. The mRNA payload may also be circular. The LNP can be targeted (tLNP) to deliver payload to cell types based on expression of cell surface markers (Tombacz et al 2021; Breda et al 2023) for example LNP may be conjugated to anti-CD5, or anti-CD3, or anti-CD4, or anti -CD8 targetting molecules for targeting CD8+ and CD4+ T cells (Wada (2018); Dalloul, (2009), Lee (2021)) or CD16 or NK1.1 for targeting NK cells, EpCAM as a targeting epithelial cells targeting molecule or to another marker or a functional ligand thereof that targets cellular delivery to specific target cells . Such tLNP particles may be used both ex vivo and in vivo to direct the mRNA payload to a desired immune cell type.In aspects, such vectors may be used for ex vivo manufacture of cell therapy products for infusion and / or targeted delivery of vectors in vivo for TCR expression in targeted cell populations. For ex vivo manufacture and cellular manipulation, vectors may be delivered to cells maintained in culture as encapsulated LNPs, as tLNPs, by combination with agents that promote uptake of nucleic acids such as lipofectamine, by electroporation or by inclusion in a viral-genome derived backbone so as to form a viral-like particle (VLP) capable of mediating both integrative or non-integrative manipulation of target cells.Several viral vector systems, modified viruses designed to deliver genetic material into cells, are suitable for such manipulations and include viral vector systems derived from retroviruses such as lentivirus (LV) and gammaretrovirus, systems which are typically used for ex vivo manipulation and manufacture. Viral systems incorporatingvectors may also be used for in vivo delivery of target payloads, typically derived from adeno-associated virus (AAV).A further aspect of the invention relates to an engineered cell expressing the TCR as disclosed, described and / or defined herein and / or the isolated nucleic acid disclosed, described and / or defined herein and / or which comprises a vector disclosed, described and / or defined herein.Optionally, the engineered cell according to the current invention comprises a chromosomal gene knock out of one or more TCR gene(s), one or more HLA gene(s), or both, such as wherein the engineered cell comprises a knockout of an HLA gene selected from the group consisting of an a-1-macroglobulin gene, a-2-macroglobulin gene, a-3-macroglobulin gene, b-1-microglobulin gene, b-2-microglobulin gene, and combinations thereof, or such as, wherein the engineered cell comprises a knockout of a TCR gene selected from a TCR alpha variable region gene, TCR beta variable region gene, TCR constant region gene, and combination thereof. An engineered cell according to the current invention can express CD8a and / or CD8b, and, optionally, the CD8a and / or CD8 b is fused to a truncated CD34 enrichment tag. The engineered cells can be enriched using the truncated CD34 enrichment tag.Typically, the engineered cell disclosed, described and / or defined herein, is a hematopoietic progenitor cell, peripheral blood mononuclear cell (PBMC), cord blood cell, or immune cell. In an embodiment, the immune cell is a T cell, cytotoxic lymphocyte, cytotoxic lymphocyte precursor cell, cytotoxic lymphocyte progenitor cell, cytotoxic lymphocyte stem cell, CD4+ T cell, CD8+ T cell, CD4 / CD8 double negative T cell, gamma delta (gd) T cell, natural killer (NK) cell, NK-T cell, dendritic cell, or a combination thereof. In one embodiment, the cell is derived from a hematopoietic stem cell (HSC) or an induced pluripotent stem cell (IPSC). The T cell can be a naive T cell, central memory T cell, effector memory T cell, or a combination thereof, or a primary T cell or a cell of a T cell line.In a currently preferred embodiment, the engineered cell disclosed, described and / or defined herein does not express or has a lower surface expression of an endogenous TCR and is capable of producing a cytokine or a cytotoxic molecule when contacted with a target cell that presents a G12V mutated human rat sarcoma (RAS) peptide, wherein the peptide is a mutated human Kirsten RAS (KRAS) peptide, a mutated human Harvey RAS (HRAS) peptide, or a human neuroblastoma RAS (NRAS) peptide, wherein thepeptide consists of VWGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEO ID NO:2) presented in a HLA-A*11 context.In embodiments, the engineered cell according to the current invention is capable of producing TNF-alpha, IL-2, and / or IFN-gamma, and / or a perforin and / or a granzyme, such as granzyme B. An engineered cell according to the current invention can be contacted with a target cell in vitro or ex vivo and is preferably capable of producing a higher level of cytokine or a cytotoxic molecule when contacted with a target cell with a heterozygous expression of human RAS, such as an at least 1.05-fold higher level of cytokine or a cytotoxic molecule.In embodiments, the engineered cell according to the current invention is capable of killing a target cell that presents a G12V mutated human rat sarcoma (RAS) peptide, wherein the peptide is a mutated human Kirsten RAS (KRAS) peptide, a mutated human Harvey RAS (HRAS) peptide, or a human neuroblastoma RAS (NRAS) peptide, wherein the peptide consists of VWGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO:2) presented in a HLA-A*11 context. The killing is determined by a killing assay and the ratio of the engineered cell and the target cell in the killing assay is from 1:64 to 1:1, wherein the target cell is a target cell pulsed with a range of between 0.1 pM and 1 mM of a G12V mutated human rat sarcoma (RAS) peptide, wherein the peptide is a mutated human Kirsten RAS (KRAS) peptide, a mutated human Harvey RAS (HRAS) peptide, or a human neuroblastoma RAS (NRAS) peptide, wherein the peptide consists of VWGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO:2) presented in a HLA-A*11 context.The engineered cell of the current invention does not induce T cell expansion, cytokine release, or cytotoxic killing when in contact with a target cell that presents a peptide selected from the group consisting of VWGAGGVGK (SEQ ID NO: 3) presented in HLA-A*11 context, or VVGAGGVGK (SEQ ID NO: 4) presented in HLA-A*11 context.In an embodiment, the engineered cell disclosed, described and / or defined herein is capable of killing a higher number of target cells when the target cells have heterozygous expression of a G12V mutated human rat sarcoma (RAS) peptide, wherein the peptide is a mutated human Kirsten RAS (KRAS) peptide, a mutated human Harvey RAS (HRAS) peptide, or a human neuroblastoma RAS (NRAS) peptide, wherein the peptide consists of VWGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO:2) presented in a HLA-A*11 complex. Typically, the cell killing is at least 1.05-fold higher in the target cellsthat present WVGAVGVGK (SEQ ID NO: 1) and / or VVGAVGVGK (SEQ ID NO:2) in HLA-A*11.In aspects, the target cell is a cell line or a primary cell, such as selected from the group consisting of a cancer cell line, a primary cancer cell line, a transformed cell line, and an immortalized cell line, such as a HEK293-, ARH-77-, COR-L23-, NCI-H441-, SW620-, QGP-1-, or IGR-1- derived cell lines. Such cell lines may be modified to stably express HLA-A*11 and / or luciferase reporters.The current invention also relates to a population of engineered cells disclosed, described and / or defined herein as well as to a pharmaceutical composition comprising any one or more of the engineered cells or vectors of the current invention, such as wherein the vectors are selected from the group consisting of viral vectors, non-viral vectors, LNPs or any other carrier comprising the nucleic acid sequence described, disclosed and / or defined herein.Abbreviations and definitionsIt is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention which will be limited only by the appended claims.It must be noted that as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise.AbbreviationsaAMAnalyte antigenic moleculeaAPXAnalyte antigen-presenting complexAPCAntigen-presenting cellAPXAntigen-presenting complexB-cellB lymphocytesp2MBFPBeta 2 MicroglobulinBlue fluorescent proteinCARChimeric antigen receptorCAR-TCAR T cellCD1bCluster of differentiation 1bCD1dCluster of differentiation 1dCD3Cluster of differentiation 3CDRComplementarity-determining regionsCMCargo moleculesCMVCytomegalovirusC-regionD-region DAMPSConstant regionDiversity regionDanger associated molecular patternsDCDendritic cellsDNADeoxyribonucleic aciddsDNADouble stranded DNAeAPCEngineered antigen-presenting celleAPC-aEngineered antigen-presenting cell expressing an analyte antigenic moleculeeAPC-pEngineered antigen-presenting cell that present an analyte antigen-presenting comple:Engineered antigen-presenting cell that presents an analyte antigen-presentingeAPC-pa eAPCScomplex and analyte antigenic moleculeEngineered antigen-presenting cell systemeTPCEngineered TCR-presenting celleTPC-tEngineered TCR-presenting cell that present full-length TCR pairseTPCSEngineered TCR-presenting cell systemFABAntibody fragment antigen bindingFACSFluorescence-activated cell sortingFLFull lengthFRTGEM T-Flippase recognition targetcellsGerm line-encoded mycolyl lipid-reactive T-cellsGFPGreen fluorescent proteinHCMVHuman CytomegalovirusHDRHomology directed recombinationHIVHuman immunodeficiency virusHLAHuman leukocyte antigenHLAIHLA class 1HLAIIHLA class IIIgSFINK T-cellsImmunoglobulin superfamilyInvariant natural killer T-cellsIRESInternal ribosome entry siteITAMImmunoreceptor tyrosine-based activation motifJ-donorJoining donorJ-regionJoining regionLNP MACS MAGE MAITMG MHCMR1 mRNA NCBPNK T-cells odeCDR3 ORF PAMPS PCR PDAC pHLA pMHC PMSA RFP RMCERNA RTSH2T cells TAA TALEN TCR TCRsp tLNP TORESTRATRBTRD TRGUFDV-C entry vector V (-region)Lipid NanoparticleMagnetic-activated cell sortingMelanoma associated antigenMucosal-associated invariant TMinigeneMajor Histocompatability ComplexMajor histocompatibility complex class l-related gene proteinMessenger ribonucleic acidNon-cell based particlesNatural killer T cellsOligonucleotide duplex encoding CDR3Open reading framePathogen-associated molecular patternsPolymerase chain reactionPancreatic ductal adenocarcinomaPeptide HLAPeptide MHCProstate-specific membrane antigenRed fluorescent proteinRecombinase mediated cassette exchangeRibonucleic acidReverse TranscriptionSrc homology 2T lymphocytesTumour-associated-antigensTranscription activator-like effector nucleasesT-cell ReceptorTCR surface proteins in complex with CD3Targeted Lipid NanoparticleTCR ORF Reconstitution and Engineering SystemTCR alphaTCR betaTCR deltaTCR gammaUbiquitin fusion domainVariable-Constant entry vectorVariable regionZAP-70 ^-chain-associated protein of 70 kDaDefinitionsaAM: Analyte antigenic molecule. Generally, a protein but could also be a metabolite that is expressed by a cell from their genomic DNA and / or a specific introduced genetic sequence. The AM is expressed in the cell and a fragment can then be presented on the cell surface by an APX as cargo or on its own. Either as cargo or not, the AM can then be the target of T-cell receptor bearing cells or related affinity reagents.Adaptive immunity: A subsystem of the overall immune system that is composed of highly specialized, systemic cells and processes that eliminate pathogens or prevent their growth.AdjuvantsAdjuvant - substance, which when administered prior, together or after administration of an antigen accelerates, prolong and / or enhances the quality and / or strength of an immune response to the antigen in comparison to the administration of the antigen alone.Adjuvants can increase the magnitude and duration of the immune response induced by vaccination.A pair of complementary TCR chains: Two TOR chains wherein the translated proteins are capable of forming a TCRsp on the surface of a TCR presenting cell when expressed with the CD3 components.Affinity: Kinetic or equilibrium parameter of an interaction between two or more molecules or proteinsAffinity Reagent: Any reagent that is prepared as analyte to probe TCRsp binding and / or stimulation at the cell surface of the eTPC-t in an eTPC:A systemAllele: Variant form of a given geneAlloreactivity: Significant activity of a TCR to an HLA other than that for which it was selected; "off-HLA” reactivityAmplicon: a piece of DNA or RNA that is the source and / or product of artificial amplification using various methods including PCRAnalyte: an entity that is of interest to be identified and / or measured and / or queried in the combined systemAntibody: Affinity molecule that is expressed by specialized cells of the immune system called B-cells and that contains of two chainsAntigen: any molecule that may be engaged by a TCR and results in a signal being transduced within the T cellAnalyte antigen: collectively the eTPC:Antigen system (eTPC:A) representing any entity presenting an antigen for analytical determinationAntibody Drug Conjugates: (ADCs) consist of antibodies, toxic drugs, and linkers. The antibody moiety targets the antigen on the tumour, once bound the ADCs are internalised into the tumour and release the drugs in lysosomes to kill the tumour cellsAntigen-binding cleft: long cleft or groove that is the site at which peptide antigens bind to the MHC-I moleculeAPC: Antigen-presenting cell. A cell capable of presenting antigen on its cell surface, generally in the context of an HLAaAPX: Analyte antigen-presenting complex. A protein that is expressed and presented on the cell surface by nucleated cells from genes / ORF encoding genomic DNA and / or a specific introduced genetic sequence. The APX presents a cargo, being either a peptide or other metabolite molecules.Autoimmunity: Is the system of immune responses of an organism against its own healthy cells and tissues.Avidity: the sum total of the strength of binding of two molecules to one another at multiple sites, eg taking into account the valency of each interactionBi-Specific T cell engager: artificial bispecific monoclonal antibodies that direct T cell’s cytotoxic activity against cancer or a target cellC (-region): Constant gene segment. One of the gene segments that is used to assemble the T-cell receptor. The c-region is a distinct segment that rather than driving diversity of the TCR, defines its general function in the immune system.Cargo-loading machinery: Cellular set of proteins that generate and load cargo molecules on APX from proteins or other presented molecules found in the cell.C cloning fragment: Constant Cloning fragment. Also referred to as a C gene segment cloning fragment. A construct carrying a portion of a C gene segment used to construct a V-C entry vector.CD3: a multi-protein complex of 6 chains, that associate with T cell receptor as three dimers (sy, sb, ¢¢). This TCR:CD3 complex forms the unit for initiation of cellular signalling responses upon engagement of a ap or yb TCR with antigen. The CD3 accessories associated as a TCR:CD3 complex contribute signalling motifs called immunoreceptor tyrosine-based activation motifs (ITAMs).CDR: complementarity-determining regions. Short sequences on the antigen-facing end of TCRs and antibodies that perform most of the target binding function. Each antibody and TCR contains six CDRs and they are generally the most variable part of the molecules allowing detection of a large number of diverse target molecules.CAR: Chimeric Antigen Receptor. A fusion protein engineered to contain 2 or more amino acid sequences linked together in a way that does not occur naturally or does not naturally occur in a host cell, which fusion protein can function as a receptor when present on a surface of a cell.Cis-acting element: regions of non-coding DNA that regulate the transcription of nearby ORFs.C-part: Constant part. A small portion of Constant gene segment sequence carried by a J receiving cassette fragment, J receiving cassette and J donor vector to standardise overhang sequences for operation of the TORES to reconstitute TCR ORFs.CM: Cargo molecules. Peptide or metabolite that is presented by an antigen-presenting complex for example a HLA I or HLA II. The CM can be expressed by the cell intrinsically from the genomic DNA, introduced into the culture medium or expressed from a specifically introduced genetic sequence.Cognate Antigen: An antigen, often presented by an HLA, that is recognised in a particular TCR. TCR and antigen are cognate objects.Copy-number: The whole number occurrence of a defined sequence encoded within the genome of a cell.Cross-reactivity: cytotoxic activity of a T cell for a somatically expressed HLA-presented peptide other than the desired target HLA-presented peptideCytogenetic: The study of inheritance in relation to the structure and function of chromosomes, i.e. determine the karyotype of a cellCytotoxic / Cytotoxicity: Process in which a T cells releases factors that directly and specifically damage a target cell.D (-region): Diversity gene segment. One of the gene segments that is used to assemble the T-cell receptor. Each individual has a large number of different variations of these regions making it possible for each individual to arm T cells with a very large variety of different TCR.Dimer: is an oligomer consisting of two structurally similar monomers joined by bonds that can be either strong or weak, covalent or intermolecular.DNA: Desoxyribonucleic acid. Chemical name of the molecule that forms genetic material encoding genes and proteins.eAPC / eAPC-p / eAPC-pa: Engineered antigen-presenting cell, as described in WO 2017 / 083316. -p indicates that that the cell presents an antigen-presenting complex, and -pa indicates that the cell presents an antigen presented in an antigen-presented complex.EC50: Half maximal effective concentration, concentration effective in producing 50% of the maximal responseEndogenous: Substance that originated from within a cellEukaryotic conditional regulatory element: A DNA sequence that can influence the activity of a promoter, which may be induced or repressed under defined conditionsEukaryotic Promoter: A DNA sequence that encodes a RNA polymerase biniding site and response elements. The sequence of the promoter region controls the binding of the RNA polymerase and transcription factors, therefore promoters play a large role in determining where and when your gene of interest will be expressed.Eukaryotic terminator / Signal terminator: A DNA sequence that are recognized by protein factors that are associated with the RNA polymerase II and which trigger the termination process of transcription. It also encodes the poly-A signalEngineered Cell: A cell wherein the genome has been engineered through genetic modification modified.Epitope: An epitope, also known as antigenic determinant, is the part of an antigen that is recognized by the immune system, specifically by antibodies, B cells, orT cells. For example, the epitope is the specific piece of the antigen to which an antibody binds.Epigenetic insulator sequence: DNA element that disrupts the communication between a regulatory sequence, such as an enhancer or a silencer, and a promoter.eTPC system: eTPCS, the system by which eTPC-t cells, or libraries thereof, are prepared for combination in the eAPC:eTPC systemFACS / Flow Cytometry: Fluorescence-activated cell sorting. Flow cytometry is a technique by which individual cells can be analyzed en masse for the expression of specific cell surface and / or intracellular markers. A variation of that technique, cell sorting, allows cells that carry a defined set of markers to be retrieved for further analysis.Family of APX: A set of several similar genes that encode functionally related proteins, which constitute an antigen presentation complexFlp Recombinase: A recombinase (Flippase, Flp) derived from the 2 pm plasmid of baker's yeast Saccharomyces cerevisiae.Fluorescent (protein) marker: Molecule that has specific extinction and emission characteristics and which can be detected by Microscopy, FACS and related techniques.Germline gene segments: (TCR) Gene segments that are naturally occurring in humans.Gene cis-acting elements: are present on the same molecule of DNA as the gene they regulate whereas trans-regulatory elements can regulate genes distant from the gene from which they were transcribed. Cis-regulatory elements are often binding sites for one or more trans-acting factors.Genetic barcoding: DNA barcoding is a taxonomic method that uses a short genetic marker in an organism's DNA to identify it as belonging to a particular species.Genomic donor vector: matched to genomic receiver site, designed to deliver donor genetic materialGenomic Receiver Site: A site within the genome for targeted integration of donor genetic material encoded within a Genetic Donor Vector.Genomic Receiver Site Recycling: The reversion of an occupied genomic receiver site back to the conformation wherein a new analyte (TCR) ORF can be integratedHaplotype: a physical arrangement of genomic variants that tend to be inherited together.HLA haplotype: a linear arrangement of HLA alleles along an individual chromosomeHeterospecific recombinase sites: A DNA sequence that is recognized by a recombinase enzyme to promote the crossover of two DNA molecules.HLA I: Human Leukocyte Antigen class I. A gene that is expressed in humans in all nucleated cells and exported to the cell surface where it presents as cargo short fragments, peptides, of internal proteins to T-cell receptors. As such it presents fragments of potential ongoing infections along with intrinsic proteins. The HLA I can additionally present as cargo peptides that are added to the culture medium, generated from proteins expressed form introduced genetic elements or generated from proteins that are taken up by the cell. HLA class I genes are polymorphic meaning that different individuals are likely to have variation in the same gene leading to a variation in presentation. Related to HLA class II.HLA II: Human Leukocyte Antigen Class II. A gene that is expressed in humans in specific cells that are coordinating and helping the adaptive immune response for example dendritic cells. Related to HLA class I. HLA class II proteins are exported to the cell surface where they present as cargo short fragments, peptides, of external proteins to T-cell receptors. As such it presents fragments of potential ongoing infections along with intrinsic proteins. The HLA II can additionally present as cargo peptides that are added to the culture medium, generated from proteins expressed form introduced genetic elements or generated from proteins that are taken up by the cell. HLA class II genes are polymorphic meaning that different individuals are likely to have variation in the same gene leading to a variation in presentation.Homologous arms: A stretch of DNA that has near identical sequence identity to a complement homologous arm and therefore promote the exchange of two DNA molecules by the cellular process, homology directed repair.ImmTACs: Immune mobilising monoclonal T-cell receptors Against Cancer. These bispecifics are designed to activate T cells against cancer and virus-infected cells. An ImmTAC is specific to both MHC-peptides (pHLA) located on the surface of the tumor and CD3s located on T cells. The ImmTAC is thus able to directly activate CD3 and its corresponding pathways in activated T cells.Immune surveillance: Process in which the immune system detects and becomes activated by infections, malignancies or other potentially pathogenic alterations.Immunotherapy: a type of treatment that boosts the body's natural defenses to fight a disease. It uses substances made by the body or in a laboratory to improve or restore immune system function.Insulator: A DNA sequence that prevents a gene from being influenced by the activation or repression of nearby genes. Insulators also prevent the spread of heterochromatin from a silenced gene to an actively transcribed gene.Integration: The physical ligation of a DNA sequence into a chromosome of a cellIntegration vector: The product of TORES containing TCR ORFs, and matched to genomic receiver sites, containing genetic elements at the 5’ and 3’ ends to enable integration.Integration couple: matched integration vector and genomic receiver siteInternal ribosome entry site (IRES): A DNA sequence that once transcribed encodes a RNA element that allows the initiation of translation in a cap-independent mannerIsoform: any of two or more functionally similar proteins that have a similar but not identical amino acid sequence and are either encoded by different genes or by RNA transcripts from the same gene which have had different exons removed.J (-region): Joining segment. One of the gene segments that is used to assemble the T-cell receptor. Each individual has a large number of different variations of these regions making it possible for each individual to arm T cells with a very large variety of different TCR.J donor backbone: Joining donor backbone. The vector backbone into which a J receiving cassette fragment is inserted to create a J receiving cassette vector.J donor vector: The vector of the two-component vector system that carries the J TCR segment, and donates this segment to the V-C entry vector during reconstitution of a full-length TCR ORF.J receiving cassette fragment: Joining receiving cassette fragment. A cloning fragment that carries a C-part used to construct a J receiving cassette vector.J receiving cassette vector: Joining receiving cassette vector. The vector, carrying a C-part, into which a J segment part is inserted to create a J donor vector.J segment part: Joining segment part. A DNA construct carring a portion of a J gene segment that is inserted into a J receiving cassette vector to generate a J donor vector.Karyotype: a complete set of chromosomesKozak Sequence: Short sequence required for the efficient initiation of translationLipid nanoparticle: Small spherical particles composed of Iipid. Used to deliver a payload into a target cellMajor HLA class I: a Family of APX that comprise of the genes HLA-A, HLA-B and HLA-CMatched: When two components encode genetic elements that direct and restrict the interaction between the complemented componentsMeganuclease recognition site: A DNA sequence that is recognized by a endodeoxyribonuclease, commonly referred to as a meganucleaseMetabolite: A molecule created or altered through metabolic pathways of the cellMHC: Major Histocomaptability Complex. Large locus on vertebrate DNA containing a set of closely linked polymorphic genes that code for cell surface proteins essential for the adaptive immune system.Mobile genetic element: A DNA sequence that can permit the integration of DNA with the activity of transposases enzymesMonoclone cell line: A defined group of cells produced from a single ancestral cell by repeated cellular replicationmRNA splice acceptor site: At the 5' end the DNA nucleotides are GT [GU in the premessenger RNA (pre-mRNA)]; at the 3' end they are AG. These nucleotides are part of the splicing sites. DONOR-SPLICE: splicing site at the beginning of an intron, intron 5' left end. ACCEPTOR-SPLICE: splicing site at the end of an intron, intron 3' right end.Multimer: A protein complex consisting of muitipie identicai monomers. Often used in context of HLA muitimer reagent.Native: an entity that is naturally occurring in the cellNegative Selection Marker: A selectable marker that confers negative selection of a vector and / or of host organism carrying said marker-bearing vectorNon-cell-based Particle: (NCBP) acts in a similar manner to an affinity reagent, inasmuch that the particle presents an analyte antigen or other entity that is to be assessed for TCRsp engagement at the surface of a eTPC-t within and eTPC:A system. However, an NCBP is considered as a larger entity that can further carry genetic or other information that is to act as an identifier, either directly or by proxy, of the presentedanalyte antigen or other binding entity. A typical example of an NCBP would be a bacteriophage in a phage-display scenarioNon-coding gene: A non protein coding DNA sequence that is transcribed into functional non-coding RNA moleculesNucleases: enzymes that degrade nucleic acidsodeCDR3: oligonuclotide duplex encoding complementarity-determining regions. A synthetic construct carrying CDR3 genetic sequence with terminal overhangs, used in conjunction with the two-component vector system to reconstitute a full-length TCR ORF.Oncogenic driver mutations: mutations found in genes that encode for signalling proteins that are critical for maintaining cellular proliferation and survivalOrigin of replication: a particular sequence in a vector, plasmid or genome at which replication is initiated.ORF: Open reading frame. Stretch of genetic material that encodes a translation frame for synthesis of a protein (polypeptide) by the ribosomeOverhang: A single stranded sequence at the terminus of a double stranded nucleic acid molecule. Often referred to as sticky or cohesive ends.Para-reactivity: in the present context means reactivity towards an HLA that does not belong to the putative HLA but presents the relevant peptidePCR: Polymerase chain reaction in which a specific target DNA molecule is exponentially amplifiedPeptide: short string of amino acids between 6-30 amino acids in lengthPhenotypic analysis: Analysis of the observable characteristics of a cell.Plasmid: A genetic construct can replicate independently of the chromosomes, typically a small circular DNA strand in the cytoplasm of a bacterium or protozoan.pMHC: peptide bound to a Major Histocompatibility Class I Complex (p-MHC)Polymorphic: Present in different forms in individuals of the same species through the presence of different alleles of the same gene.Polypeptide: Protein consisting of a stretch of peptides, forming a three-dimensional structure.Positive Selection Marker: A selectable marker that confers positive selection of a vector and / or host organism carrying said marker-bearing vectorPrimer: Short DNA sequence that allows specific recognition of a target DNA sequence for example during a PCR.Professional APC: any nucleated cell capable of presenting an antigen for sampling by alpha beta and gamma delta T cells presented in HLAILPromoter: Regulatory DNA element for the controlled initiation of gene expression.Recombinase: Enzymes that mediate genetic recombination.Reporter Element: A genetic element that mediates a reported signal in the organism or vector bearing said element. May be used as a positive or negative selection maker.Restriction Enzyme Cleavage Sequence: The genetic sequence cleaved by a restriction enzyme, which can be extrinsic or intrinsic to the recognition sequence of said restriction enzyme.Restriction Enzyme Recognition Sequence: The genetic sequence recognised and engaged by a restriction enzyme.Selectable marker: A DNA sequence that confers a trait suitable for artificial selection methodsSensitivity: TCR sensitivity is an assesment of the activation of a TCR, when expressed by an enginered TCR-presenting cell, by a target peptide presented in the relevant HLA complex. The lower the numeric value is, the higher the sensitivity is.Specific cytotoxicity: killing of cells that express mutated KRAS G12V, but not wild type KRAS, by effector T cells expressing TCR specific for the mutated KRAS G12V peptide presented in an HLA molecule.Splice acceptor site: A DNA sequence at the 3' end of the intron AM, APX CM or affinity reagent for interaction with cells with TCRsp on the surface, or TCRsp based reagentsSplice donor site: A DNA sequence at the 5' end of the intronSoluble TCR: not membrane boundSomatic V(D)J recombination: process after which each T cell expresses copies of a single distinctly rearranged TCR. Refers to recombination at the TRB and TRD loci and additionally include a diversity (D) gene segment.Suicide gene: A gene that will mediate cell death within the host organism carrying said gene. May be used as a positive or negative selection marker.Synthetic: an entity that is artificially generated.Targeted endonucleases: nucleases that can make a double-strand break to the genome and may be used to insert material into the genomeTargeted lipid nanoparticle: A lipid nanoparticle targeted to deliver payload to specific cell types based on expression of surface markers. Used for both ex vivo or in vivo payload deliveryT cell: T lymphocyte. White blood cell that expresses a T-cell receptor on its surface. Selected by the immune system to not react with the own body but have the potential to recognize infections and malignancies as well as reject grafts from most members of the same species.T cell maturation: process that allows T cells to distinguish cells that belong to the body and are healthy from those that aren't healthy or don't belong to the body at all. Takes place in the thymusT cell repertoire: T cells distinct set of T cell receptorsTCR: T cell Receptor. Affinity molecule expressed by a subgroup of lymphocytes called T lymphocytes. In humans the TCR recognizes cargo presented by APX CM or APX AM, including fragments from virus or bacterial infections or cancerous cells. Therefore, the TCR recognition is an integral part of the adaptive immune system. The TCR consists of two chains that are paired on the cell surface. The TCR expressed on the surface of each cells is assembled at random from a large pool of varied genes (the v,d,j and c segments) and thus each individual has a pool of T cells expressing a very large and diverse repertoire of different TCRs.TCRsp: analyte pair of TCR chains that are expressed as TCR surface proteins in complex with CD3TCR Drug Conjugates (TDC): soluble TCR (instead of an antibody) used to target tumour-specific p-MHCs and deliver a toxic drug into tumour cellsTerminator element: is a section of nucleic acid sequence that marks the end of a gene or operon in genomic DNA during transcription. This sequence mediates transcriptional termination by providing signals in the newly synthesized mRNAthat trigger processes which release the mRNAfrom the transcriptional complex. These processes include the direct interaction of the mRNA secondary structure with the complex and / or the indirect activities of recruited termination factors. Release of the transcriptional complex frees RNA polymerase and related transcriptional machinery to begin transcription of new mRNAs. The termination element is in the template strand of DNA and consists of two inverted repeats separated by half a dozen bases and followed by a run of adenines (A’s).Thymic selection: Immature thymocytes undergo a process of selection, based on the specificity of their T-cell receptors. This involves selection of T cells that are functional (positive selection), and elimination of T cells that are autoreactive (negative selection). The medulla of the thymus is the site of T Cell maturation.tCD34: a truncated CD34 enrichment tag, i.e. a CD34 that is truncated so that the biological function of CD34 is reduced or removed. Cells can be enriched if they express such a truncated CD34 enrichment tag,Tumour associated antigens: Tumour antigen is an antigenic substance produced in tumour cells, i.e., it triggers an immune response in the host. Tumor antigens are useful tumour markers in identifying and quantifying tumour cells with diagnostic tests and are potential candidates for use in cancer therapy.TRA: TCR alpha encoding locus. One of the four different locus encoding genes that can form a VDJ recombined TCR chain. Translated TCR alpha chain proteins typically pair with translated TCR beta chain proteins to form alpha / beta TCRsp.TRB: TCR beta encoding locus. One of the four different locus encoding genes that can form a VDJ recombined TCR chain. Translated TCR beta chain proteins typically pair with TCR alpha chain proteins to form alpha / beta TCRsp.TRD: TCR delta encoding locus. One of the four different locus encoding genes that can form a VDJ recombined TCR chain. Translated TCR delta chain proteins typically pair with translated TCR gamma chain proteins to form gamma / delta TCRsp.TRG: TCR gamma encoding locus. One of the four different locus encoding genes that can form a VDJ recombined TCR chain. Translated TCR gamma chain proteins typically pair with translate TCR delta chain proteins to form gamma / delta TCRsp.Two-component vector system: a single V-C entry vector and a single J donor vector with desired sequences can be combined with a short DNA oligonucleotide duplex encoding CDR3 (odeCDR3) sequence to reconstitute a full length TCR ORF in vitro in a single-tube reaction, in a restriction enzyme and ligase dependent and PCR independent manner.Type I transmembrane domain: single-pass molecules anchored to the lipid membrane with a stop-transfer anchor sequence and their N-terminal domain targeted to the endoplasmic reticulum lumen during synthesis (and the extracellular space, if mature forms are located on the Plasmalemma).Type IIS Restriction Enzyme: restriction enzymes that recognize asymmetric DNA sequences and cleave outside of their recognition sequence.V (-region): Variable region. One of the gene segments that is used to assemble the T-cell receptor. Each individual has a large number of different variations of these regions making it possible for each individual to arm T cells with a very large variety of different TCR.V-C entry vector: The vector of the two-component vector system that carries the V and C TCR segments, and which receives sequences from the J donor vectors and odeCDR3 during reconstitution of a full-length TCR ORF.V cloning fragment: Variable Cloning fragment. Also referred to as a V gene segment cloning fragment. A construct carrying a portion of a V gene segment used to construct a V-C entry vector.Vector: A vector is a genetic construct that carries genetic information. In the present context vector usually describes plasmid DNA vectors. A vector can represent any such construct that can be propagated and selected in a host organism.Z-score: The z-score is the intensity of a specific peptide as compared to the intensity of all other peptides in the sample, in other words the formula for calculating z-scores takes the raw intensity score of the peptide and subtracts the population mean, and all is divided by the population standard deviation.Detailed description of inventionThe current invention discloses several verified suitable RAS targets as well as TCRs recognising these targets, and which have a particularly suitable profile for therapeutic use in cancer therapy.The present invention, for the first time, discloses a T cell receptor (TCR), which is isolated and / or expressed in an engineered cell, and which specifically recognizes a G12V mutated human rat sarcoma (RAS) peptide, wherein the peptide is a mutated human Kirsten RAS (KRAS) peptide, a mutated human Harvey RAS (HRAS) peptide, or a human neuroblastoma RAS (NRAS) peptide, and wherein the peptide consists of VWGAVGVGK (SEQ ID NO: 1) or VVGAVGVGK (SEQ ID NO:2) presented in a HLA-A*11 context.In one aspect, the invention relates to a method of treating a disorder characterized by G12V mutated human RAS expression in a subject, such as a human patient, comprising administering to said subject a therapeutically effective amount of genetically engineered cells that express a TCR as disclosed and / or defined herein, or a pharmaceutical composition disclosed and / or defined herein.In an aspect a TCR according to the invention is capable of specifically recognising both of SEQ ID NO: 1 and SEQ ID NO: 2 when either is presented in a HLA-A*11 complex, thereby allowing for treatment of patients wherein either or both peptides are presented in the HLA-A*11 context.G12V RASThe inventors of the present application have surprisingly found novel functional TCRs that are able to bind to productively engage with functionally presented targets such as RAS targets, a G12V mutated RAS 9-mer (SEQ ID NO: 2) and / or a G12V mutated RAS 10-mer (SEQ ID NO: 1) peptide in the context of HLA-A*11:01 with high affinity and specificity, wherein productive engagement of TCR with said targets triggers a signalling, cytotoxic response in a T cell expressing such TCR.It is appreciated that the G12V mutation in KRAS corresponds to similar mutations in other RAS proteins such as HRAS and NRAS. Thus, peptides comprising the G12V mutation presented in a HLA context may be derived from a mutated HRAS or mutated NRAS instead, so that the peptide in itself may not reveal whether it stems from a G12V mutated KRAS or a mutated HRAS or a mutated NRAS, regardless of whether thenumbering of the substituted G->V is in the same location as long as the surrounding amino acid residues are the same. Thus, TCRs according to the present invention may equally well bind peptides derived from mutated HRAS or mutated NRAS sharing the corresponding mutation. In such cases, the recognised peptide consists of VWGAVGVGK (SEQ ID NO: 1) or VVGAVGVGK (SEQ ID NO:2).In one embodiment, as demonstrated in the experimental section, the TCR according to the current invention is a TCR, which, when expressed in an engineered cell, has at the most 4% cross-reactivity towards any somatically expressed HLA-presented peptide other than a G12V mutated human rat sarcoma (RAS) peptide, which consists of VWGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO: 2) and which is presented in a HLA-A*11 complex in a cross-reactivity assay.A TCR disclosed herein typically comprises:a. a TCR alpha chain CDR3 sequence with at least 75% identity, such as at least 80%identity, to a TCR alpha chain CDR3 sequence selected from the group consisting of SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 98, SEQ ID NO: 141 and SEQ ID NO: 143.andb. a TCR beta chain CDR3 sequence with at least 75% identity , such as at least 80%identity,to a TCR beta chain CDR3 sequence selected from the group consisting of SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 99, SEQ ID NO: 142 and SEQ ID NO: 144.In embodiments, the TCR according to the current invention comprises:a. a TCR alpha chain CDR3 sequence with a TCR alpha chain CDR3 sequence selected from the group consisting of SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 98, SEQ ID NO: 141 and SEQ ID NO: 143.andb. a TCR beta chain CDR3 sequence with a TCR beta chain CDR3 sequence selected from the group consisting of SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 99, SEQ ID NO: 142 and SEQ ID NO: 144.In a currently preferred embodiment of the invention, the TCR alpha chain variable, domain scaffold regions, and / or CDRs comprise and / or consist of one of the sequences selected from the group consisting of SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 117, SEQ ID NO: 145 and SEQ ID NO: 147 and the beta chain variable, domain scaffoldregions, and / or or CDRs comprise and / or consist of one of the sequences selected from the group consisting of SEQ ID NO: 108, SEQ ID NO: 110, SEO ID NO: 118, SEO ID: 146 and SEQ ID NO: 148.In an even more preferred embodiment of the invention, the TOR comprises an alpha chain paired with a beta chain, wherein such pairs are selected from the group of alpha:beta chain pairs consisting of SEQ ID NO:107 and SEQ ID NO 108; SEQ ID NO: 109 and SEQ ID NO 110; SEQ ID NO: 117 and SEQ ID NO:118; SEQ ID NO: 145 and SEQ ID NO: 146; and SEQ ID NO: 147 and SEQ ID NO: 148.A TOR according to the current invention can be selected from the group comprising chimeric, humanized and / or human TCRs.A TOR according to the invention may comprise constant regions of the alpha and beta chains which have been modified to include disulphide bonds, either interchain disulfide bridge (Boulter et al 2003) which has been shown to enable high-yield production of stable, soluble protein from refolded inclusion bodies, or including additional TRA Constant domain : TRB Constant domain disulphides or stabilizing mutations on the surface of the constant domains (Robinson et al 2021). In embodiments, the alpha and / or beta TCR chain comprise(s) a constant region from another mammal, such as, but not limited to, a mouse chimeric constant region(s), wherein, the TCRs can comprise a mouse constant region comprising mouse constant region of an alpha chain and mouse constant region of beta chain, or both. Preferably, the TCR comprises both. It is appreciated by those skilled in the art that as well as replacing the constant region(s) with those from mouse, the constant domains of another mammal such as a rat, chimpanzee, gorilla, macaque or rhesus monkey may be used, which are alternative embodiments.In aspects, the TCR comprises a TCR alpha chain a TCR beta chain which are covalently linked, such as through a linker peptide. The TCR alpha chain and / or the TCR beta chain can further be covalently linked to a moiety, and the linked moiety can comprise an affinity tag or a label. In embodiments, the tag is selected from the group consisting of a CD34 enrichment tag, glutathione-S-transferase (GST), calmodulin binding protein (CBP), protein C tag. Myc tag, Halo tag, HA tag, Flag tag, His tag, biotin tag, and V5 tag. In embodiments, the label is a fluorochrome or a fluorophore such as a fluorescent protein. In aspects, the covalently linked moiety is selected from the group consisting of an inflammatory agent, cytokine, toxin, cytotoxic molecule, radioactive isotope, an enzyme that catalyses a cell wall sorting reaction, and an antibody or antigen-binding fragment thereof.The alpha / beta paired TCRs of the present description may have an introduced disulfide bond between their constant domains. Preferred TCRs of this type include those which have parts of a TRA constant domain sequence and a TRBI or TRB2 constant domain sequence replaced by cysteine residues, the said cysteines forming a disulfide bond between the TRA constant domain sequence and the TRBI or TRB2 constant domain sequence of the TCR. It is appreciated by those skilled in the art that there are few amino acid residues within the TRA and TRB1 / TRB2 sequence chains, respectively, that may be modified to cysteine so as to form a disulfide bond.With or without the introduced inter-chain bond mentioned above, the alpha / beta paired TCRs of the present description may have a TRA constant domain sequence and a TRB1 or TRB2 constant domain sequences, and the TRA constant domain sequence and the TRB1 orTRB2 constant domain sequences of the TCR may be linked by the native disulphide bond.The TCR can comprise a human / mouse chimeric TCR. In this regard, the TCR can comprise a mouse constant region of an alpha chain, a mouse constant region of a beta chain, or both mouse constant regions. Preferably, the TCR comprises both alpha and beta mouse constant regions. It is appreciated by those skilled in the art that, as well as replacing the constant region(s) with those from mouse, the constant domains of another mammal such as a rat, chimpanzee, gorilla, macaque or rhesus monkey may be used, which are alternative embodiments.Alternatively or additionally, the inventive human / mouse chimeric TCR can comprise any of the alpha chain CDR3s of the invention.Alternatively or additionally, the inventive human / mouse chimeric TCR can comprise any of the beta chain CDR3s of the invention.Specifically recognizingIn the context of the present specification, “specifically recognizing” means that a TCR recognises a target peptide presented by a specific HLA allele.The current invention relates to several new T cell receptors (TCR), which are isolated and / or expressed in an engineered cell, and which specifically recognize a G12V mutated human rat sarcoma (RAS) peptide, wherein the peptide is a mutated human Kirsten RAS (KRAS) peptide, a mutated human Harvey RAS (HRAS) peptide, or a human neuroblastoma RAS (NRAS) peptide, which consists of VWGAVGVGK (SEQ ID NO: 1) or WGAVGVGK (SEQ ID NO:2) presented in a HLA-A*11 complex, and wherein the individual TCR comprises a paired TCR alpha- and TCR beta-chain, wherein the TCRalpha chain variable domain comprises SC1alpha-CDR1alpha-SC2alpha-CDR2alpha-SC3alpha-CDR3alpha-SC4alpha-SC5alpha, and the TCR beta chain variable domain comprises SC1beta-CDR1beta-SC2 beta-CDR2 beta-SC3beta-CDR3beta-SC4beta-SC5beta, wherein SC is a scaffold region and CDR is a complementarity determining region.TCRs according to invention, when expressed in an engineered cell, do not cause specific cytotoxic activity towards cells not expressing a G12V mutated RAS peptide.TCRs according to the invention, when expressed in an engineered cell, do not cause specific cytotoxic activity towards cells expressing the wild type human RAS peptide, such as VWGAGGVGK (SEQ ID NO: 3) presented in a HLA-A*11 complex and / or VVGAGGVGK (SEQ ID NO: 4) presented in a HLA-A*11 complex.TCRs according to the invention, when expressed in an engineered cell, do not specifically recognize the G12V mutated human RAS peptide, wherein the peptide consists of WVGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO: 2) presented in an allelic variant of the human leukocyte antigen (HLA) molecule other than an allelic variant of the human leukocyte antigen (HLA) molecule selected from the group consisting of HLA-A*11, HLA-A*30:01, HLA-A*68:02, HLA-B*54:01, HLA-B*35:01, HLA-B*35:02, HLA-B*35:03, HLA-B*35:05, HLA-B*35:12, HLA-B*52:01, HLA-B*53:01, HLA-B*57:01 and HLA-B*58:01.Furthermore, when expressed in an engineered cell, a TCR according to the invention does not recognise allelic variants of the human leukocyte antigen (HLA) molecule other than one or more allelic variant of the human leukocyte antigen (HLA) molecule selected from the group consisting of HLA-A*68:02, HLA-B*54:01, HLA-B*35:01, HLA-B*35:02, HLA-B*35:03, HLA-B*35:12, HLA-B*57:01 and HLA-B*58:01.In one embodiment, TCRs according to the invention, when expressed in an engineered cell, do not specifically recognizes the G12V mutated human RAS peptide, wherein the peptide consists of WVGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO: 2) presented in an allelic variant of the human leukocyte antigen (HLA) molecule other than the HLA-A*11 and / or HLA-A*30:01.In one embodiment, TCRs according to the invention, when expressed in an engineered cell, do not specifically recognizes the G12V mutated human RAS peptide, wherein the peptide consists of WVGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO: 2)presented in an allelic variant of the human leukocyte antigen (HLA) molecule other than the HLA-A*11 and / or HLA-A*30:01 and / or HLA-A*68:02.In one embodiment, TCRs according to the invention, when expressed in an engineered cell, do not specifically recognizes the G12V mutated human RAS peptide, wherein the peptide consists of WVGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO: 2) presented in an allelic variant of the human leukocyte antigen (HLA) molecule other than the HLA-A*11 and / or HLA-B*54:01.In one embodiment, TCRs according to the invention, when expressed in an engineered cell, do not specifically recognizes the G12V mutated human RAS peptide, wherein the peptide consists of WVGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO: 2) presented in an allelic variant of the human leukocyte antigen (HLA) molecule other than the HLA-A*11 and / or HLA-B*35:01 and / or HLA-B*35:02 and / or HLA-B*35:03, and / or HLA-B*35:05 and / or HLA-B*35:12 and / or HLA-B*52:01 and / or HLA-B*53:01 and / or HLA-B*57:01 and / or HLA-B*58:01.In one embodiment, TCRs according to the invention, when expressed in an engineered cell, do not specifically recognizes the G12V mutated human RAS peptide, wherein the peptide consists of WVGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO: 2) presented in an allelic variant of the human leukocyte antigen (HLA) molecule other than the HLA-A*11.In one embodiment, TCRs according to the invention do not specifically recognize a G12V mutated human RAS peptide, wherein the peptide consists of VWGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO: 2) presented in a HLA-A*11:03 complex.In one embodiment, TCRs according to the invention do not specifically recognize a G12V mutated human RAS peptide, wherein the peptide consists of VWGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO: 2) presented in a HLA-A*11:03 and HLA-A*11:04 complex.In one embodiment, as exemplified in the experimental section, the TCR according to the current invention is a TCR, which, when expressed in an engineered cell, has at the most 4% cross-reactivity towards any somatically expressed HLA-presented peptide other than a G12V mutated human rat sarcoma (RAS) peptide, which consists of WVGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO: 2) and which is presented in a HLA-A*11 complex in a cross-reactivity assay.Alloreactivity off-HLA recognition by T cell.Alloreactivity in the context of the present invention means an undesirable reactivity of the TCR towards a peptide-free HLA not belonging to a putative HLA for that TCR, i.e., in the case of a TCR specific for mutated G12V KRAS, an HLA that does not belong to the HLA-A*11 supergroup and at the same time does not present a peptide.Para-reactivity “on-target-off-HLA” recognition by a T cellPara-reactivity in the present context means reactivity towards an HLA that does not belong to the putative HLA but presents the relevant peptide, i.e. in the present context an HLA not belonging to the HLA-A*11 supergroup but presenting a G12V mutated human RAS peptide, wherein the peptide consists of VWGAVGVGK (SEQ ID NO: 1) or VVGAVGVGK (SEQ ID NO: 2).Strong cytotoxic activityStrong cytotoxic activity in the current context means T cell cytotoxic activity towards a target cell population resulting in an increase in specific lysis of the target cell population that is increased more than 4.5-fold when target cells are co-cultured with T cells in a 1:1 ratio compared to a 1:16 or to a 1:64 T cell to target cell ratio.TCRs of the current inventionA TCR disclosed herein typically comprises:a. a TCR alpha chain CDR3 sequence with at least 80% identity to a TCR alpha chain CDR3 sequence selected from the group consisting of SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 98, SEQ ID NO: 141 and SEQ ID NO: 143.andb. a TCR beta chain CDR3 sequence with at least 80% identity to a TCR beta chain CDR3 sequence selected from the group consisting of SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 99, SEQ ID NO:142 and SEQ ID NO: 144.In embodiments, the TCR according to the current invention comprises:a. a TCR alpha chain CDR3 sequence with a TCR alpha chain CDR3 sequence selected from the group consisting of SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 98, SEQ ID NO: 141 and SEQ ID NO: 143.andb. a TCR beta chain CDR3 sequence with a TCR beta chain CDR3 sequence selected from the group consisting of SEQ ID NO: 89, SEQ ID NO: 91 ,SEQ ID NO: 99 and SEQ ID NO:142 and SEQ ID NO: 144.In a currently preferred embodiment of the invention the TCR alpha and beta chain variable domain scaffold regions or CDRs of the TCR comprises and / or consists of one of the sequences selected from the group consisting of SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 145 SEQ ID NO: 146 and SEQ ID NO:147 and SEQ ID NO:148.In a preferred embodiment the TCR comprises a paired alpha and beta chain, wherein the pairs are selected from the group consisting of SEQ ID NO: 107 and SEQ ID NO: 108; SEQ ID NO: 109 and SEQ ID NO: 110; SEQ ID NO: 117 and SEQ ID NO: 118; SEQ ID NO: 145 and SEQ ID NO: 146; and SEQ ID NO:147 and SEQ ID NO: 148. Such pairs may also encompass sequences having at least 80% sequence identity to said sequences; such as at least 90% sequence identity, such as at least 95% sequence identity, such as at least 98% sequence identity or more.A TCR according to the current invention can be selected from the group comprising chimeric, humanized and / or human TCRs.A TCR according to the invention can comprise constant regions of the alpha and beta chains which have been modified to include cysteine residues to allow covalent connection by di-sulphide bridges or comprise no covalent connections between said paired alpha and beta chains. In embodiments, the alpha and / or beta chain comprise(s) a constant region of another mammal, such as, but not limited to, a mouse chimeric constant region(s). Further, the alpha and / or beta chain may have been modified to include cysteine residues to allow di-sulphide bridges.In aspects, the TCR comprises a TCR alpha chain a TCR beta chain which are covalently linked, such as through a linker peptide. The TCR alpha chain and / or the TCR beta chain can further be covalently linked to a moiety, and the linked moiety can comprise an affinity tag or a label. In embodiments, the tag is selected from the group consisting of a CD34 enrichment tag, glutathione-S-transferase (GST), calmodulin binding protein (CBP), protein C tag. Myc tag, Halo tag, HA tag, Flag tag, His tag, biotin tag, and V5 tag. In embodiments, the label is a fluorochrome or a fluorophore such as a fluorescent protein. In aspects, the covalently linked moiety is selected from the group consisting of an inflammatory agent, cytokine, toxin, cytotoxic molecule, radioactive isotope, an enzymethat catalyses a cell wall sorting reaction, and an antibody or antigen-binding fragment thereof.The current invention in one aspect relates to a soluble TCR and / or a conjugated soluble5 TCR according to the current invention. In aspects, the TCR is a bi-specific T-cell engager (BITE), or it is an immune mobilizing monoclonal T-cell receptor.The TCR in one aspect TCR comprises a paired TCR alpha- and TCR beta-chain comprising a complete assembly of combinations of the following sequences:SEQID NOSEQID NOSEQID NOSEQID NOSEQID NOSEQID NOSEQID NOSCIalpha1820281261281820CDRIalpha6062701351376062SC2alpha3234421291313234CDR2alpha7476841381407476SC3alpha4648561321344648CDR3alpha8890981411438890SC4alpha791512312579SC5alpha104104104104104104104SCIbeta192129127301921CDRIbeta616371136726163SC2beta333543130443335CDR2beta757785139867577SC3beta474957133584749CDR3beta8991991421448991SC4beta8101612412810SC5beta1010510510610610651625162or sequences having at least 90% such as at least 95%, at least 97% or at least 99%, or 100% identity to said respective sequences.In one aspect the TCR comprises a paired TCR alpha- and TCR beta-chain comprising the following combination of sequences:TCR# SC1CDR1 SC2CDR2 SC3 CDR3 SC4 SC5TCR-1SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQalphaNO: 18NO: 60NO: 32IDIDIDIDIDNO:NO:NO:NO:NO:7446887104TCR-2SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQalphaNO: 20NO: 62NO: 34IDIDIDIDIDNO:NO:NO:NO:NO:7648909104TCR-6SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQalphaNO: 28NO: 70NO: 42IDIDIDIDIDNO:NO:NO:NO:NO:84569815104TCR-9SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQalphaNO: 126NO: 135NO:IDIDIDIDID129NO:NO:NO:NO:NO:138132141123104TCR-SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQ10NO: 128NO: 137NO:IDIDIDIDIDalpha131NO:NO:NO:NO:NO:140134143125104TCR-1SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQbetaNO: 19NO: 61NO: 33IDIDIDIDIDNO:NO:NO:NO:NO:7547898105TCR-1SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQbetaNO: 19NO: 61NO: 33IDIDIDIDIDNO:NO:NO:NO:NO:75478985162TCR-2SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQbetaNO: 21NO: 63NO: 35IDIDIDIDIDNO:NO:NO:NO:NO:77499110105TCR-2SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQbetaNO: 21NO: 63NO: 35IDIDIDIDIDNO:NO:NO:NO:NO:774991105162TCR-6SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQbetaNO: 29NO: 71NO: 43IDIDIDIDIDNO:NO:NO:NO:NO:85579916106TCR-9SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEbetaNO: 127NO: 136NO:IDIDIDIDID130NO:NO:NO:NO:NO:139133142124106TCR-SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQ10NO: 30NO: 72NO: 44IDIDIDIDIDbetaNO:NO:NO:NO:NO:865814412106or sequences having at least 90% such as at least 95%, at least 97% or at least 99%, or 100% identity to said respective sequences.In one aspect the alpha and beta chain CDRs have the following sequences:CDRIalphaCDR2CDR3CDRIbetCDR2CDR3alphaalphaabetabetaSEQ ID NO:SEQ IDSEQ IDSEQ IDSEQ IDSEQ ID60NO: 74NO: 88NO: 61NO: 75NO: 89SEQ ID NO:SEQ IDSEQ IDSEQ IDSEQ IDSEQ ID62NO: 76NO: 90NO: 63NO: 77NO: 91SEQ ID NO:SEQ IDSEQ IDSEQ IDSEQ IDSEQ ID70NO: 84NO: 98NO: 71NO: 85NO: 99SEQ ID NO:SEQ IDSEQ IDSEQ IDSEQ IDSEQ ID135NO: 138NO: 141NO: 136NO: 139NO: 142SEQ ID NO:SEQ IDSEQ IDSEQ IDSEQ IDSEQ ID137NO: 140NO: 143NO: 72NO: 86NO: 144In one aspect the alpha and beta chain CDR3s have the following sequences:CDR3 alpha CDR3 betaSEQ ID NO: 88 SEQ ID NO: 89SEQ ID NO: 90 SEQ ID NO: 91SEQ ID NO: 98SEO ID NO: 141SEQ ID NO: 143SEQ ID NO: 99SEQ ID NO: 142SEQ ID NO: 144Nucleic acid sequencesIn one aspect, the invention relates to one or more nucleic acid sequences encoding a TOR comprising a paired TOR alpha- and TOR beta-chain as disclosed, described and / or defined herein.The nucleic acids of the invention are recombinant As used herein, the term "recombinant" refers to (i) molecules that are constructed outside living cells by joining natural and / or synthetic nucleic acid segments to nucleic acid molecules that can replicate in a living cell, or (ii) molecules that result from the replication of those described in (i) above. For purposes herein, the replication can be in vitro replication or in vivo replication.A desirable method of modifying the DNA encoding the polypeptide of the description employs the polymerase chain reaction as disclosed by Saiki R K, et al. (Saiki et al., 1988). This method may be used for introducing the DNA into a suitable vector, for example by engineering in suitable restriction sites, or it may be used to modify the DNA in other useful ways as is known in the art.Nucleic acid sequences encoding a TCR comprising a paired TCR alpha- and TCR betachains may be but are not limited to, linear or circular double stranded DNA, or linear or circular single stranded DNA. Such a sequence may contain replication-directing elements for self-amplification and / or may be circularized. The DNA may or may not be chemically modifedAlternatively, nucleic acid sequences encoding a TCR comprising a paired TCR alpha-and TCR beta-chains may be but are not limited to linear or circular single stranded RNA. Such RNA may or may not be chemically modified.A nucleic acid sequence encoding a TCR may be comprised in or by an RNA vector. Such an RNA vector may contain a 5’ CAP, 5’ UTR, 3’ UTR and 3’ poly(A) tail and Internal Ribosome Entry Site (IRES), and may contain substituted nucleotides such as pseudouridine. An RNA vector may contain replication-directing elements for selfamplification and / or may be circularized.Identity vs similarityBy an amino acid sequence having an amino acid sequence that is at least, for example 95% identical to a reference amino acid sequence, is intended that the amino acid sequence of e.g., the TCR, or CDR3, is identical to the reference sequence, except that the amino acid sequence may include up to 5 point mutations and / or deletions per each 100 amino acids of the reference amino acid sequence. In other words, to obtain a TCR, or CDR3 having an amino acid sequence that is at least 95% identical to a reference amino acid sequence, up to 5% of the amino acids in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids. In an amino acid sequence that is at least 95% identical to a reference amino acid sequence up to 5% of the amount of total amino acids in the reference sequence may be inserted and / or added into the reference sequence. The mutations and / or insertions of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among amino acids in the reference sequence or in one or more contiguous groups within the reference sequence.In the present invention, a local algorithm program is best suited to determine identity. Local algorithm programs, (such as Smith Waterman) compare a subsequence in one sequence with a subsequence in a second sequence and find the combination of subsequences and the alignment of those subsequences, which yields the highest overall similarity score. Internal gaps, if allowed, are penalized. Local algorithms work well for comparing two or more multi domain proteins, which have a single domain, or just a binding site in common.Methods to determine identity and similarity are codified in publicly available programs. Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to BLASTX, BLASTP, BLASTN, and FASTA (Altschul et al 1990). The BLAST programs are publicly available from NCBI and other sources (BLAST Manual, Altschul et al, 1990). Each sequence analysis program has a default scoring matrix and default gap penalties. In general, a molecular biologist would be expected to use the default settings established by the software program used.VectorsIn aspects of the invention, the vector disclosed, described and / or defined herein is a nucleic acid vector, viral vector or a nanoparticle vector. In another aspect, the invention relates to a vector system directing the expression of a payload comprising one or more nucleic acid sequences encoding a TCR comprising a paired TCR alpha- and TCR betachains as disclosed, described and / or defined herein.Said nucleic acid vector can be selected from the group consisting of expression vector, a cloning vector, phagemid, cosmid, transposon, episome, artificial chromosome or RNA. The invention relates to a nucleic acid vector comprising one or more nucleic acid sequences encoding a TCR comprising a paired TCR alpha- and TCR beta-chains as but are not limited to, linear or circular double stranded DNA, or linear or circular single stranded DNA, that may or may not be chemically modified DNA, linear or circular double stranded RNA, or linear or circular single stranded RNA, that may or may not be chemically modified RNA. The RNA vector may contain a 5’ CAP, 5’ UTR, 3’ UTR and 3’ poly(A) tail and IRES, and may contain substituted nucleotides such as pseudouridine, and may contain replication-directing elements for self-amplification and / or may be circularized.In case of a viral vector, can be selected from the group consisting of viruses that package the nucleic acid sequences encoding at least a TCR comprising a paired TCR alpha- and TCR beta-chains that comprise of, but are not limited to, double stranded DNA, single stranded DNA, double stranded RNA or single stranded RNA. Examples of viral vectors are adenoviruses, adeno-associated viruses, retroviruses, lentiviruses, and herpes simplex viruses. The viral vector comprises one or more cell surface receptors that bind to a ligand on a target cell and aid transduction; heterologous viral envelope glycoproteins; fusion glycoproteins; T cell activation or co-stimulation molecules, cytokines or cytokinebased transduction enhancers; and / or transmembrane proteins comprising a mitogenic domain and / or cytokine-based domain exposed on the surface and / or conjugated to the surface of the viral vector. Lentiviral viruses are known to effectively transduce mammalian cells. To alter their tropism, lentiviruses may be pseudotyped with various heterologous viral envelopes, the most common one being the envelope glycoprotein from vesicular stomatitis virus (VSV-G) (Joglekar et al 2017). The vector can further be pseudotyped by exchanging the VSV-G for other heterologous viral envelopes glycoproteins, such as those from the Measles virus, Baboon endogenous retrovirus, Cocal virus, Nipah virus or Sendai virus (Gutierrez-Guerrero et al 2020). The Nipah envelope protein can be engineered to bind EpCAM, CD4, or CD8 (Bender et al 2016), CD3, CD5 or other markers suitable for targeted cellular delivery of a TCR-encoding nucleic acid vector.Said nanopartical vector can be selected from the group consisting of lipid nanoparticles (LNPs) or nanoparticles (NPs), cationic liposome complexes, cationic polymer complexes, cationic liposome-polymer complexes, exosomes, liposomes, and inorganic nanoparticles. In certain aspects, a nanoparticle vector according to the current invention is a LNPcomprising ionizable cationic lipid, a sterol, a phospholipid, a non-functionahzed PEG-lipid, and a functionalized PEG-lipid wherein the functionalized PEG-lipid has been conjugated with a binding moiety. The nanoparticle vector encapsulates a payload in the form a of nucleic acid, such as mRNA, for the purpose of transfecting a target cell. The mRNA payload may contain a linear expression construct with 5’ cap, 5’ UTR, 3’ UTR and poly-A features, IRES, and may contain substituted nucleotides such as pseudouridine, and may contain replication-directing elements for self-amplification. The mRNA payload may also be circular. The LNP can be targeted (tLNP) to deliver payload to cell types based on expression of cell surface markers (Tombacz et al. (2021), Breda et al. (2023)) for example LNP may be conjugated to CD5, CD3, CD4, CD8 amongst others, to be used for targeting CD8+ and CD4+ T cells (Wada (2018); Dalloul, (2009), Lee (2021)) or CD16 or NK1.1 for targeting NK cells, EpCAM for targeting epithelial cells or to another marker or a functional ligand thereof that targets cellular delivery to specific target cells. Such tLNP particles may be used both ex vivo and in vivo to direct the mRNA payload to a desired immune cell type (Parayath N et al (2020), Siebart J et al (2024), Vavassori V et al (2023)).In certain aspects, said vector further comprises a nucleic acid sequence encoding CD8a and / or CD8p. In certain aspects, said vector further and / or alternatively comprises a nucleic acid sequence encoding a truncated CD34 enrichment tag. The isolated TCR nucleic acid according to the current invention and the nucleic acid sequence encoding CD8a and / or CD80 and / or CD34 can operably be encoded within a single expression unit interconnected with an internal ribosome entry site or a nucleic acid sequence encoding a self-cleaving peptide, such as selected from the group consisting of P2A, E2A, F2A and T2A. In certain aspects the isolated TCR nucleic acid according to the current invention and the nucleic acid sequence encoding CD8a and / or CD80 and / or CD34 can be encoded by more than one expression unit with their own promoter and polyadenylation sequence.In aspects, such vectors may be used for ex vivo manufacture of cell therapy products for infusion and / or targeted delivery of vectors in vivo for TCR expression in targeted immune cell populations. For ex vivo manufacture and cellular manipulation, vectors may be delivered to cells maintained in culture as encapsulated LNPs, as tLNPs, by combination with agents that promote uptake of nucleic acids such as lipofectamine, by electroporation or by inclusion in a viral-genome derived backbone so as to form a viral-like particle (VLP) capable of mediating both integrative or non-integrative manipulation of target cells.Several viral vector systems, modified viruses designed to deliver genetic material into cells, are suitable for such manipulations and include viral vector systems derived from retroviruses such as lentivirus (LV) and gammaretrovirus, systems which are typically used for ex vivo manipulation and manufacture. Viral systems incorporating vectors may also be used for in vivo delivery of target payloads, typically derived from adeno-associated virus (AAV).In certain aspects, said vector further comprises a nucleic acid sequence encoding element to promote stable integration the nucleic acid into the host cell genome, including but are not limited to; homologous directed arms (HDR), long terminal repeat (LTR) and inverted terminal repeats (ITR).In the current context, a " nucleic acid vector", is any molecule or composition that has the ability to carry a nucleic acid sequence into a suitable host cell where synthesis of the encoded polypeptide can take place in vivo. Recombinant expression vectors designed to maintain the recombinant DNA in bacteria are also included. Delivery vectors include but are not limited to liposomes genetically attenuated live carriers such as viruses and bacteria, biodegradable microcapsules, immune-stimulating complexes (ISCOMs) may also be used to deliver nucleic acid.Typically, and preferably, a vector comprises a nucleic acid sequence that has been engineered, using recombinant DNA techniques that are known in the art, to incorporate a desired nucleic acid sequence (e.g., a nucleic acid sequence of the invention). Desirably, the vector is comprised of any type of nucleotides, including, but not limited to DNA and RNA, which can be single-stranded or double stranded, synthesized or obtained in part from natural sources, and which can contain natural, non-natural or altered nucleotides. The vectors of the invention are not naturally-occurring as a whole. However, parts of the vectors can be naturally-occurring. Preferably, the non-naturally occurring or altered nucleotides or internucleotide linkages do not hinder the transcription or replication of the vector.The recombinant expression vector of the invention can be any suitable recombinant expression vector and can be used to transform or transfect any suitable host cell. Suitable vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses, and are well known to those skilled in the art, as are methods to construct and use them. In a preferred embodiment, the recombinant expression vectors used include a nucleic acid vector, e.g., linear or circular double stranded DNA, or linear or circular single stranded DNA, or linear or circular RNA used totransduce a host cell during the production of a pharmaceutical preparation, as well as recombinant expression vectors designed to maintain the recombinant DNA in bacteria. Such vectors may direct transient or stable expression. Stable expression can be achieved by integration of nucleic acid construct into the host cell genome, or maintainence of expression vector nucleic acid in episomal or other structures that achieve nucleic acid maintenance and TCR-encoding construct expression.Desirably, a vector according to the current invention comprises regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host (e.g., bacterium, fungus, plant, or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA- or RNA-based. The alpha and beta paired chains of a TCR of the present invention may be encoded by one or more nucleic acid sequences located in separate vectors, or may be encoded by polynucleotides located in the same vector. In preferred embodiments, TCR-alpha and TCR-beta chains of the introduced TCR may be cloned into bicistronic constructs in a single vector.Optionally, the nucleic acid sequence of the vector may be modified such that it contains codon triplets designed for optimal transcription and translation, and which are optimised for use in host cells, such as, but not limited to insect, bacteria, yeast or human cells.The vector can include one or more marker genes, which act as markers of integration. Marker of integration include genes encoding the likes of green fluorescent protein (GFP), red fluorescent protein (RFP) and blue fluorescent protein (BFP), EGFP as well as other fluorescent proteins, Streptavidin Binding Protein (SBP), b-galactosidase or chloramphenicol acetyltransferase (CAT). In addition, or alternatively, the recombinant expression vector can include one or more marker genes, which are selected from antibiotic resistance genes, deficiency markers. In some embodiments, selection markers are expressed with a polynucleotide that encodes a gene product of interest (eg a binding protein encompassed by the present invention, such as TCR). In one aspect, the recombinant expression vector includes marker genes, such as the truncated CD34 (CD34t) and / or CD19 that marks the transduced host T cells and acts as a selection marker of recovery. In a preferred embodiment, a truncated CD34t and / or CD19 molecule is expressed alongside the TCR of interest within the human cell.The vectors of the current invention can be designed for transient expression, for stable expression, or for both. Also, the recombinant expression vectors can be designed for constitutive expression or for inducible expression.A vector as described herein can comprise a native or synthetic promoter operably linked to the nucleotide sequence encoding the TCR, polypeptide, or protein (including functional portions and functional variants thereof), or to the nucleotide sequence which is complementary to or which hybridizes to the nucleotide sequence encoding the TCR, polypeptide, or protein. The selection of promoters, e.g., strong, weak, inducible, tissuespecific and developmental-specific, is within the ordinary skill of the artisan. Similarly, the combining of a nucleotide sequence with a promoter is also within the skill of the artisan. The promoter can be a non-viral promoter or a viral promoter. Preferably strong promoters are used, such as retroviral long terminal repeats (LTRs), cytomegalovirus (CMV), murine stem cell virus (MSCV) U3, phosphoglycerate kinase (PGK), P-actin, ubiquitin, elongation factor (EF)-la (Tsuji et al., 2005), and a simian virus 40 (SV40) / CD43 composite promoter (Cooper et al., 2004; Jones et al., 2009), and the spleen focus forming virus (SFFV) promoter (Joseph et al., 2008), HCMV IE1 promoter. In a preferred embodiment, the promoter is heterologous to the nucleic acid being expressed.A vector as described herein can comprise transacting genetic element, such as a microRNA, shRNA and / or IcRNA sequence is designed to modulate a endogenous transcript with the target cell. A vector as described here in can further comprise further open reading frames that benefit cellular persistence, disease trafficking, metabolic fitness, evasion of immunosuppressive tumour microenvironment or other functional characteristics of a therapeutic cell product.Host Cells (Engineered cells)Host cells according to the current invention are cells that have been engineered to contain the nucleic acids and expression vectors as described herein. As described herein but not limited to, the host cells may be primary cells derived from a donor, may be engineered, and may be used for immunotherapy (immunotherapy host cell, TCR-T cells), or they may be cultured mammalian cells. Such cultured cells may be engineered, and may e.g. be engineered TCR presenting cells (eTPC). eTPCs may be an adherent cell or a suspended cell, i.e., a cell that grows in suspension. Preferred suitable host cells are of human origin and are known in the art, for instance Jurkat cells. For purposes of amplifying or replicating the recombinant expression vector, the host cell is preferably a prokaryotic cell, e.g., a DH5a cell. Other eukaryotic host cells may include yeast and insect cells.The present description also relates to a host cell with the integration of a functional TCR that is capable of being expressed from the introduced recombinant vector in the host cell.In a preferred embodiment, the host cell comprising a TCR of the invention is a human T cell of the CD8+ and / or CD4+ subtype. In some embodiments, the host cell is selected from the group consisting of a CD8+ T cell, a CD4+ T cell, T cell progenitor cell, NK cell, NK progenitor cell or differentiated stem cell. The host cells can be allogeneic, autologous, or engineered. In a preferred embodiment, the host cell used is an autologous human CD8+ T cell.The T cells used according to the current invention can come from any source known in the art. For example, T cells can be differentiated in vitro from a hematopoietic stem cell population, or T cells can be obtained from a subject, who may or may not be the patient who is intended to be treated. T cells can be obtained from, e.g., peripheral blood mononuclear cells (PBMCs), bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In addition, the T cells can be derived from one or more T cell lines available in the art. T cells can also be obtained from blood collected from a subject using any number of techniques known to the skilled artisan, such as, but not limited to, density gradient centrifugation, FICOLL™ separation and / or apheresis.In one embodiment, the primary immune cells comprising a TCR (TCR-T also referred to as effector cells) of the invention are activated and / or expanded in vitro. Methods for activating and expanding T cells are known in the art. Generally, such methods include contacting PBMC or isolated T cells with a stimulatory agent and costimulatory agent, such as anti-CD3 and anti-CD28 antibodies, generally attached to a bead or other surface, in a culture medium with appropriate cytokines, such as IL-2. Anti-CD3 and anti-CD28 antibodies attached to the same bead serve as a "surrogate" antigen presenting cell (APC). One example is the Dynabeads® system, a CD3 / CD28 activator / stimulator system for physiological activation of human T cells.A further aspect of the invention relates to an immortalized engineered cell expressing the TCR as disclosed, described and / or defined herein and / or the isolated nucleic acid sequence disclosed, described and / or defined herein, and / or which comprises a vector disclosed, described and / or defined herein.Optionally, the engineered cell according to the current invention comprises a chromosomal gene knock out of one or more TCR gene(s), one or more HLA gene(s), or both, such as wherein the engineered cell comprises a knockout of an HLA gene selected from the group consisting of an a-1-macroglobulin gene, a-2- macroglobulin gene, a-3-macroglobulin gene, b-1-microglobulin gene, b-2-microglobulin gene, and combinations thereof, or such as wherein the engineered cell comprises a knockout of a TCR geneselected from a TCR alpha variable region gene, TCR beta variable region gene, TCR constant region gene, and combinations thereof.An engineered cell according to the current invention can express CD8a and / or CD8b. Optionally the CD8 alpha and / or CD8 beta is fused to a truncatedCD34 enrichment tag. The engineered cells can be enriched using the truncatedCD34 enrichment tag.Typically, the engineered cell disclosed, described and / or defined herein, originates from a hematopoietic progenitor cell, peripheral blood mononuclear cell (PBMC), cord blood cell, or immune cell. In an embodiment, the such immune cell is a T cell, cytotoxic lymphocyte, cytotoxic lymphocyte precursor cell, cytotoxic lymphocyte progenitor cell, cytotoxic lymphocyte stem cell, CD4+ T cell, CD8+ T cell, CD4 / CD8 double negative T cell, gamma delta (gd) T cell, natural killer (NK) cell, NK-T cell, dendritic cell, or a combination thereof. In one embodiment, the engineered cell is derived from a hematopoietic stem cell (HSC) or an induced pluripotent stem cell (iPSC). The T cell can be a naive T cell, central memory T cell, effector memory T cell, or a combination thereof, or a primary T cell or a cell of a T cell line.In a currently preferred embodiment, the engineered cell disclosed, described and / or defined herein does not express, or has a lower surface expression of, an endogenous TCR and is capable of producing a cytokine or a cytotoxic molecule when contacted with a target cell that presents a G12V mutated human rat sarcoma (RAS) peptide, wherein the peptide is a mutated human Kirsten RAS (KRAS) peptide, a mutated human Harvey RAS (HRAS) peptide, or a human neuroblastoma RAS (NRAS) peptide, wherein the peptide consists of VWGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO:2) presented in a HLA-A*11 complex.In embodiments, the engineered cell according to the current invention is capable of producing TNF-alpha, IL-2, and / or IFN-gamma, and / or a perforin and / or a granzyme, such as granzyme B. An engineered cell according to the current invention can be contacted with a target cell in vitro or ex vivo and is preferably capable of producing a higher level of cytokine or a cytotoxic molecule when contacted with a target cell with a heterozygous expression of human RAS, such as an at least 1.05-fold higher level of cytokine or a cytotoxic molecule.In embodiments, the engineered cell according to the current invention is capable of killing a target cell that presents a G12V mutated human rat sarcoma (RAS) peptide, wherein the peptide is a mutated human Kirsten RAS (KRAS) peptide, a mutated human HarveyRAS (HRAS) peptide, or a human neuroblastoma RAS (NRAS) peptide, wherein the peptide consists of VWGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEO ID NO:2) presented in a HLA-A*11 complex. The killing is determined by a killing assay and the ratio of the engineered cell and the target cell in the killing assay is from 1:64 to 1:1, wherein the target cell is a target cell pulsed with a range of between 1x103 nM and 0.1 nM of a G12V mutated human rat sarcoma (RAS) peptide, wherein the peptide is a mutated human Kirsten RAS (KRAS) peptide, a mutated human Harvey RAS (HRAS) peptide, or a human neuroblastoma RAS (NRAS) peptide, wherein the peptide consists of VWGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO:2) presented in a HLA-A*11 complex. In particular the target cell is a cell monoallelic for HLA-A*11.The engineered cell of the current invention does not induce T cell expansion, cytokine release, or cytotoxic killing when in contact with a target cell that presents a peptide selected from the group consisting of VWGAGGVGK (SEQ ID NO: 3) presented in a HLA-A*11 complex, or VVGAGGVGK (SEQ ID NO: 4) presented in a HLA-A*11 complex.In an embodiment, the engineered cell disclosed, described and / or defined herein is capable of killing a higher number of target cells when contacted with target cells with a heterozygous expression of a G12V mutated human rat sarcoma (RAS) peptide, wherein the peptide is a mutated human Kirsten RAS (KRAS) peptide, a mutated human Harvey RAS (HRAS) peptide, or a human neuroblastoma RAS (NRAS) peptide, wherein the peptide consists of VWGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO:2) presented in a HLA-A*11 complex. Typically, the cell killing is at least 1.05-fold higher.In aspects, the target cell is a cell line or a primary cell, such as selected from the group consisting of a cancer cell line, a primary cancer cell line, a transformed cell line, and an immortalized cell line, such as HEK293-, ARH -77-, COR-L23-, NCI-H441-, SW620-, QGP-1-, or IGR-1- derived cell lines. Such cell lines may be modified to stably express HLA-A*11 and / or luciferase reporters.The current invention also relates to a population of engineered cells disclosed, described and / or defined herein as well as to a pharmaceutical composition comprising any one or more of the engineered cells or vectors of the current invention, such as wherein the vectors are selected from the group consisting of viral vectors, non-viral vectors, LNPs or any other carrier comprising the nucleic acid sequence described, disclosed and / or defined herein.The engineered cells of the invention can substantially cross-react with cells and kill cells that express a polypeptide that contains the natural amino acid sequence of the peptides, such as G12V mutated RAS 10-mer (SEQ ID NO: 1) and 9-mer (SEQ ID NO: 2), as defined in the aspects of the description. As can be derived from the scientific literature and databases (Rammensee et al 1999), certain positions of HLA binding peptides are typically anchor residues forming a core sequence fitting to the binding motif of the HLA receptor, which is defined by polar, electrophysical, hydrophobic and spatial properties of the polypeptide chains constituting the binding groove. In an aspect, one skilled in the art would have the ability given the teachings of the description to modify the amino acid sequence of a TCR, by modulation of the TCR CDR regions whilst maintaining recognition of the known anchor residues, and would be able to determine whether such TCR variants maintain the ability to bind bind MHC class I or II molecules / G12V mRAS 10-mer (SEQ ID NO: 1) and 9-mer (SEQ ID NO: 2) complexes.In one embodiment, a soluble TCR of the invention can be produced and used. In this embodiment the host cell can be a cultured mammalian cell. The mammalian host cell can be an adherent cell or a suspended cell, i.e., a cell that grows in suspension. Preferred suitable host cells are from human and are known in the art, for instance HEK293 cells and ARH-77 cells. For purposes of amplifying or replicating the recombinant expression vector, the host cell is preferably a prokaryotic cell, e.g., a DH5a cell. Other eukaryotic host cells may include yeast and insect cells.Transformation of appropriate cell hosts with a DNA construct of the present description is accomplished by well-known methods that typically depend on the type of vector used. With regard to transformation of prokaryotic host cells, see, for example, Cohen et al. (Cohen et al., 1972) and (Green and Sambrook, 2012). Electroporation is also useful for transforming and / or transfecting cells and is well known in the art for transforming yeastcells, bacterial cells, insect cells and vertebrate cells.Successfully transformed cells, i.e., cells that contain a DNA construct of the present description, can be identified by well-known techniques such as polymerase chain reaction (PCR). Alternatively, the presence of protein encoded by such a DNA construct in the supernatant can be detected using antibodies.Soluble TCR and / or a conjugated soluble TCRThe current invention in one aspect relates to a soluble TCR and / or a conjugated soluble TCR according to the current invention. In aspects, the TCR is a bi-specific monoclonalantibody (such as T cell engager (BiTE)), or it is an immune mobilizing monoclonal T-cell receptor against cancer (such as ImmTAC).The invention further relates to a pharmaceutical composition comprising a soluble protein consisting of all or a functional part of a TCR as disclosed and / or defined herein and at least one pharmaceutically acceptable excipient, carrier or stabilizer.A pharmaceutical composition of the current invention comprises a soluble TCR, a conjugated soluble TCR, a cell expressing a TCR, or a composition comprising a TCR, wherein the TCR is a TCR according to the current invention. Said soluble TCR can been conjugated to a radionuclide, a chemotherapeutic agent, a toxin, or another therapeutically active component, and at least one pharmaceutically acceptable excipient, carrier or stabilizer.Pharmaceutical compositionsA "pharmaceutical composition" is a composition suitable for administration to a human being in a medical setting. Preferably, a pharmaceutical composition has minimal bioburden and is produced according to GMP guidelines.The TCRs, nucleic acids, recombinant expression vectors, and host cells (including populations thereof) according to the present invention, can be formulated into a pharmaceutical composition. In preferred embodiment, the invention provides a pharmaceutical composition comprising any of the TCRs and functional variants thereof, nucleic acids, expression vectors, host cells such as, but not limited to, TCR-Ts (including populations thereof), and a pharmaceutically acceptable carrier. Alternatively, the pharmaceutical composition can comprise a TCR-T material according to the present invention in combination with another pharmaceutically active agents or drugs, such as a chemotherapeutic agent, e.g., asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, vincristine, etc.In a preferred embodiment, the pharmaceutical composition is an autologous, transduced CD8+ and / or CD4+ T cell, infused into a patient following pre-treatment with a conditioning regime, which may include one or more of cyclophosphamide, fludarabine, decitabine or azacytidine.The pharmaceutical composition of the present description may also include cryoprotective agents (CPAs) such as small-molecular-weight penetrating CPAs (e.g.,dimethyl sulphoxide [DMSO], glycerol, ethylene glycol, and propylene glycol) and high-molecular-weight non-penetrating agents (e.g., sucrose, polyvinylpyrrolidone, and hydroxyethyl starch). In preferred embodiment the CPA is DMSO or is derived from DMSO.In a preferred embodiment the pharmaceutical composition has minimal bioburden and is produced according to GMP guidelines.Pharmaceutical compositions of the present description may include at least one host cell expressing a TCR of the present description (TCR-T), in a pharmaceutically acceptable carrier.Pharmaceutical compositions of the present description may also include pharmaceutically acceptable excipients and / or stabilizers.In preferred embodiment, the composition is selected for parenteral delivery or for injection / pumping directly into a solid tumour, into a blood vessel that feeds a tumour or into the volume surrounding a solid tumour. The preparation of such pharmaceutically acceptable compositions is within the ability of one skilled in the art. In certain embodiments, buffers are used to maintain the composition at physiological pH or at a slightly lower pH, typically within a pH range of from about 5 to about 8. In certain embodiments, when parenteral administration is contemplated, the composition is in the form of a pyrogen-free, parenterally acceptable aqueous solution comprising a composition described herein, with or without additional therapeutic agents, in a pharmaceutically acceptable vehicle. In certain embodiments, the vehicle for parenteral injection is sterile distilled water in which composition described herein, with or without at least one additional therapeutic agent, is formulated as a sterile, isotonic solution, properly preserved. In certain embodiments, the preparation involves the formulation of the desired molecule with polymeric compounds (such as polylactic acid or polyglycolic acid), beads or liposomes, that provide for the controlled or sustained release of the product, which are then delivered via a depot injection. In certain embodiments, implantable drug delivery devices are used to introduce the desired molecule.Injectable formulations are in accordance with the invention. The requirements for effective pharmaceutical carriers for injectable compositions are well-known to those of ordinary skill in the art (see, e.g., Pharmaceutics and Pharmacy Practice, J. B. Lippincott Company, Philadelphia, Pa., Banker and Chalmers, eds., pages 238-250 (1982), andASHP Handbook on Injectable Drugs, Trissei, 4th ed., pages 622- 630 (1986)).Preferably, when administering cells, e.g., T cells, the cells are administered via injection.Preferably, the carrier is a pharmaceutically acceptable carrier. With respect to pharmaceutical compositions, the carrier can be any of those conventionally used and is limited only by chemico-physical considerations, such as solubility and lack of reactivity with the active compound(s), and by the route of administration. The pharmaceutically acceptable carriers described herein, for example, vehicles, adjuvants, excipients, and diluents, are well-known to those skilled in the art and are readily available to the public. It is preferred that the pharmaceutically acceptable carrier be one which is chemically inert to the active agent(s) and one which has no detrimental side effects or toxicity under the conditions of use.The choice of carrier will be determined in part by the particular TCR, as well as by the particular method used to administer the TCR. Accordingly, there are a variety of suitable formulations of the pharmaceutical composition of the invention.Uses of the TCRs, nucleic acids and / or vectors and pharmaceutical compositions comprising the sameIn one aspect, the current invention relates to a TCR disclosed, described and / or defined herein for use as a medicament. In particular, the current invention relates to a TCR disclosed, described and / or defined herein for use in the treatment of a cancer in a patient carrying HLA-A*11, comprising administering to said patient said TCR or a pharmaceutical composition comprising said TCR, wherein said cancer is a solid or haematological malignancy expressing the peptide of SEQ ID NO: 1 or SEQ ID NO: 2, and wherein said TCR or a pharmaceutical composition comprising said TCR is infused systemically into said patient or injected or pumped directly into a solid tumour, into a blood vessel that feeds a tumour or into the volume surrounding a solid tumour in said patient.In aspects, said treatment comprises administering to said patient an engineered cell expressing the TCR, wherein said engineered cell is a T cell, T cell progenitor cell, NK cell, NK progenitor cell or differentiated stem cell and which is either autologous or allogenic, and wherein about 104 to about 1010 engineered cells are infused systemically into said patient or injected or pumped directly into a solid tumour, into a blood vessel that feeds a tumour or into the volume surrounding a solid tumour.Typically, the use related to herein is for treating a disorder in a subject, wherein said subject carries HLA-A*11:01, however it can also be used for treating a disorder in a subject that carries an alternate subform of HLA-A*11, the use related to herein is fortreating a disorder in a subject, wherein said subject carries an alternate subform of HLA-A*11. The use related to herein may typically be for treating a disorder in a subject, wherein said subject carries an alternate subform of HLA-A*11 other than HLA-A*11:03, which alternate subform of HLA-A*11 is capable of specifically presenting the peptide of SEQ ID NO: 1 or SEQ ID NO: 2 and wherein the HLA when presenting the peptide is recognized by a TOR disclosed, described and / or defined herein, such as wherein said subject carries a different HLA-A, HLA-B or HLA-C allele than HLA-A*11, that is capable of specifically presenting the peptide of SEQ ID NO: 1 or SEQ ID NO: 2, and which is recognized by the TOR according to the current invention. In addition the use related to herein may treating a disorder in a subject, wherein said subject carries an alternate subform of HLA-A*11 other than HLA-A*11:04. Whether a specific TOR is suitable for use in a subject thus depends on the HLA allotypes carried by the subject. Table 25 provides an overview of included and excluded HLAs for TCRs according to the invention.Medical TreatmentsIn one aspect, the invention relates to a method of treating a disorder characterized by G12V mutated human RAS expression in a subject comprising administering to said subject a therapeutically effective amount of genetically engineered cells that express a TCR as disclosed and / or defined herein, or a pharmaceutical composition disclosed and / or defined herein, wherein said disorder is a solid or haematological malignancy expressing the peptide of VWGAVGVGK (SEQ ID NO: 1) and / or VVGAVGVGK (SEQ ID NO: 2), wherein said engineered cell is a T cell, T-cell progenitor cell, NK cell, NK progenitor cell or a differentiated stem cell and which is either autologous or allogenic, and wherein about 104 to about 1010 engineered cells are infused systemically into said subject or injected or pumped directly into a solid tumour, into a blood vessel that feeds a tumour and / or into the volume surrounding a solid tumour.Said method is in particular intended for treating a disorder in a subject, wherein said subject carries an HLA-A*11 allele capable of specifically presenting the peptide of SEQ ID NO: 1 or SEQ ID NO: 2 and which is recognized by the TCR according to the current invention. In addition, said method can be used for treating a said subject, wherein said subject carries an alternate subform of HLA-A*11 other than HLA-A*11:03 or HLA-A*11:04, which alternate subform of HLA-A*11 is capable of specifically presenting the peptide of SEQ ID NO: 1 or SEQ ID NO: 2 and which is recognized by the TCR according to the current invention, or wherein said subject carries a different HLA-A, HLA-B or HLA-C allele than HLA-A*11, that is capable of specifically presenting the peptide of SEQ ID NO: 1 or SEQ ID NO: 2 and which is recognized by the TCR according to the current invention. Table 25 provides suitable HLAs for TCRs according to the present invention.In another embodiment the TCRs, the nucleic acid or the expression vector of the description are used in medicine. For example, the medicament can be used in the treatment of a cancer in a patient possessing HLA-A*11:01 comprising administering to said patient said TCR or a pharmaceutical composition comprising said TCR, wherein said cancer is a solid or haematological malignancy expressing the peptide of G12V mutated RAS 10-mer (SEQ ID NO: 1) and 9-mer (SEQ ID NO: 2), and wherein said TCR or a pharmaceutical composition comprising said TCR is infused systemically into said patient or injected or pumped directly into a solid tumour, into a blood vessel that feeds a tumour or into the volume surrounding a solid tumour in said patient.In aspects a pharmaceutical composition comprises a soluble protein consisting of all or a functional part of one or more TCR(s) or one or more engineered cell(s) or one or more vector(s). In aspects the invention relates to one or more compositions each comprising a soluble protein consisting of all or a functional part of one or more TCR(s) or one or more engineered cell(s) or one or more vector(s). Thus, treatment may comprise mono- or multiplexed TCR-T cell therapy. In particular the invention relates to combination therapies with 9-mer- and 10-mer-reactive TCRs, as well as the TCRs of the invention being included in a larger set of TCRs targeting HLA / peptides for individual patients.The terms "treat," and "prevent" as well as words stemming therefrom, as used herein, do not necessarily imply 100% or complete treatment or prevention. Rather, there are varying degrees of treatment or prevention of which one of ordinary skill in the art recognizes as having a potential benefit or therapeutic effect. In this respect, the inventive methods can provide any amount of any level of treatment or prevention of cancer in a mammal. Furthermore, the treatment or prevention provided by the inventive method can include treatment or prevention of one or more conditions or symptoms of the disease, e.g., cancer, being treated or prevented. Also, for purposes herein, "prevention" can encompass delaying the onset of the disease, or a symptom or condition thereof.TCRs, nucleic acids and host cells of the present description, and pharmaceutical compositions thereof, may be administered to a subject in need thereof by routes known in the art, and may vary depending on the type of cancer to be treated.TCRs of the present description may comprise a detectable label selected from the group consisting of a radionuclide, a fluorophore and biotin. TCRs of the present description may be conjugated to a therapeutically active agent, such as a radionuclide, a chemotherapeutic agent, or a toxin.In preferred embodiments, compositions of the present description are administered to a subject using a single dose.Effective doses of host cells expressing TCRs of the present invention include, for example at least about 104, at least about 105, at least about 106, at least about 107, at least about 108, at least about 109, at least about 1010 host cells per dose. In one embodiment, host cells of the present description are administered in a dose of between about 104 to about 1010 cells per dose, preferably in a dose of between about 105 to about 109 cells per dose. In preferred embodiments, a single dose is administered.In aspects, TCRs according to the present invention are used in personalised cancer immunotherapy, such as, but not limited to, being administered in combination with a vaccine. In particular the invention relates to a combination of a tumour vaccine with a TCR-T cell therapy.MedicamentIn one aspect, the invention relates to a method of treating a disorder characterized by G12V mutated human RAS expression in a subject comprising administering to said subject a therapeutically effective amount of genetically engineered cells that express a TCR as disclosed and / or defined herein, or a pharmaceutical composition disclosed and / or defined herein, wherein said disorder is a solid or haematological malignancy expressing the peptide of VWGAVGVGK (SEQ ID NO: 1) and / or VVGAVGVGK (SEQ ID NO: 2), wherein said engineered cell is a T cell, T cell progenitor cell, NK cell, NK progenitor cell or a differentiated stem cell and which is either autologous or allogenic, and wherein about 104 to about 1010 engineered cells in combination with a vaccine are infused systemically into said subject or injected or pumped directly into a solid tumour, into a blood vessel that feeds a tumour and / or into the volume surrounding a solid tumour. Alternatively, the vaccine may be administered concomitantly with, before, or after administration of the engineered cells.In general, the following vaccine compositions may be used as a medicament to prime T cells responses within a subject.The invention in another aspect relates to a method of treating a disorder characterized by G12V mutated human RAS expression in a subject comprising administering to said subject a therapeutically effective dose regime of a pharmaceutical composition consisting of a soluble protein that is a hybrid of the variable domains of a TCR as disclosed and / ordefined herein and an activation domain, and where the pharmaceutical composition is administered in combination with a vaccine.In general, the following vaccine compositions may be used as a medicament to prime and support T cell responses within a subject:a) Vaccine contains sequence(s), delivered by RNA, DNA or peptide compositions, including liponanoparticles, in vivo electroporation, incorporation into viral particles, and antibody-mediated trafficking amongst other options, designed to enable either or both of MHC class I and class II presentation of the same target epitope, and hence stimulation of therapeutic CD8 cells as well as helper CD4 cells against the same target, respectively. It is appreciated by those skilled in the art that different formulations and designs of vaccines can be optimised to balance and direct MHC class I vs class II responses, that different routes of administration can be exploited to balance responses, that different timings of prime / boost strategy can be exploited alongside TCR cell therapy, and that different immune-cell tropisms can be designed and exploited to maximise effects.Presentation of MHC class I epitopes including on professional APCs would be expected to support direct expansion of therapeutic cells, which would be beneficial for directing the initial extent of T cell engraftment and expansion. Such an effect may be important in prophylactic or adjuvant settings, where tumour cell levels may be low as compared to a primary or metastatic setting.Presentation of MHC class II epitopes on professional APCs would be expected to support the expansion of CD4+ T cells directed to the same target epitope, which would be expected to be a key mechanism. CD4+ T cells are known to promote antitumor immunity by numerous mechanisms including enhancing antigen presentation, co-stimulation, T cell homing, T cell activation, and effector function (Nelde et al, 2021). These effects are mediated at sites of T cell priming and at the tumor microenvironment (Meissen and Slingluff, 2017). CD4+ T cells harbor a crucial role for effective antitumor immunity and could further improve and sustain T cell reactivity (Bijker et al, 2007) and tumor clearance (Zwaveling et al, 2002). CD4+ T helper cells induce and intensify more permanent tumor immune control (Spitzer et al, 2017), epitope spreading (Hu et al, 2014), CD8+ T cell expansion and survival (Giuntoli et al 2002), as well as tumor immune cell infiltration (Bos and Sherman 2010). In addition, CD4+ T cells also exhibit direct antitumor effector function (Quezda et al, 2010).b) Vaccine contains sequence(s), delivered by RNA, DNA or peptide compositions (including liponanoparticles, in vivo electroporation, incorporation into viral particles, and antibody-mediated trafficking amongst other options), designed to enable either or both of MHC class I and class II presentation of the additional target epitopes, and hence stimulation of therapeutic CD8+ cells as well as helper CD4+ cells against complementary targets. For example, a vaccine encoding patient-tumour specific neoantigens, or other antigens known to be over-expressed in the specific tumour type of interest, may be used to support a targeted T cell therapy.Conceptually, such a vaccine in the form of, for example, a polyvalent mRNA expression construct formulated in an LNP particle, could be administered both prior to, or alternatively subsequent to, a TCR-T, using a prime-boost schedule.c) Further designs and administration schedules using vaccines that encode both tumourspecific neoantigens as well as KRAS mutations can be administered.Experimental sectionThe present invention is further illustrated by the following non-limiting experiments.Figure legendsFigure 1: Summary of a TCR discovery platform focused on delivering clinically safe TCRsThe figure summarizes the Key Platform Units (left column) and the platform processes (middle column) that are used for discovery of clinically viable TCRs. A key biological discovery achieved at each step is shown (right column).Step 1. Antigen Discovery - Unbiased mass spectrometry (MS) is used for identification of peptides presented by mono-allelic HLA antigen presenting cells (eAPCs). This approach allows unbiased HLA-restricted mapping for discovery of biologically relevant, processed and presented peptides.Step 2. TCR discovery - The antigen identified in Step 1 is used for T cell enrichment, target-dependent isolation, and paired TCR sequencing, allowing for selective capture of TCR clonotypes and identification of TCR clonotypes’ capability of binding target peptides. Step 3. TCR antigen validation - eAPC and (engineered TCR-presenting cell) eTPC cell contact assays are used for functional evaluation of pHLA / TCR sensitivity. TCR and HLA-restricted peptides are validated and the TCRs are ranked based on functional sensitivity in defined cell-cell functional contact assays. TCRs with low sensitivity are removed from further analysis. The discovered TCRs can in turn be used to validate the target antigen presented by the eAPC lines as well as in orthogonal cancer cell lines.Step 4. TCR-T - Candidate TCRs are integrated into primary T cells to create TCR-Ts and TCR-T potency assays are performed, demonstrating that the TCR-Ts are functional and that they possess selective cytotoxic activity.Step 5. TCR safety assessment- this step in the TCR discovery platform ensures that only de-risked, clinically viable TCRs progress to the clinic. Cross-reactive epitopes within the human genome are predicted from fingerprint profiles of the TCRs using a computer algorithm. The identified cross-reactive epitopes (hits) are then presented on monoallelic eAPCs and defined cell-cell functional contact assays are performed. TCRs with no identified cross-reactive hits are selected and a defined set of potential allo-reactive HLA alleles is determined by screening against a library of monoallelic HLA-expressing cell lines covering 86 most common HLA haplotypes. All the above steps ensure that the endproducts of the TCR discovery platform are clinically viable TCRs.Figure 2: Detection of G12V mutated KRAS peptidesThe mean intensities of peptides released from affinity purified A*11:01 pHLA complexes, as measured by unbiased mass spectrometry on a BrukerTIMS-TOF2 instrument, are shown, with z-scores relative to the mean (-) of all observations in the sample shown for specific observations of nonamer- (9-mer, indicated by a full circle) and decamer- (10-mer, indicated by a full square) peptides derived from G12V mutated KRAS (NQ - the particular peptides were detected but not quantified). G12V_FL: A*11:01 monoallelic eAPCs expressing a full-length version of inactivated KRAS protein with G12V mutations (SEQ ID NO: 6); G12V_MG-UFD: A*11:01 monoallelic eAPCs expressing a minigene with the candidate epitope +1- up to 9 amino acids of flanking sequence (SEQ ID NO: 5). COR-L23 lung cancer cell line: cell line COR-L23 natively expressing mutated KRAS G12V and with lentivirally transduced affinity-tagged HLA-A*11:01. Intensity is plotted on Y-axis, against the sample on X-axis.Figure 3: Selective expansion of TCRs specific for G12V mutated KRAS peptides. Frequency distribution of TCR clonotypes enriched from G12V mutated KRAS peptide-stimulated expansions, using tetramers specific for the 10-mer and 9-mer peptides. A) 10-mer-specific TCR clonotypes (X axis) (n=54) are plotted against the percentage frequency for each particular clonotype observed (Y-axis). Clonotypes which were counted at least 3 times were considered enriched. TCRs are shown as black bars, * TCR-1 and ** TCR-2, and have been marked retrospectively. B) A number of 9-mer-specific TCR clonotypes (n=13) which were enriched at least 3 times (X axis) are plotted against the percentage frequency of the particular clonotype observed (Y-axis). ***TCR-6, *TCR-9 and **TCR-10, are shown as black bars, and have been marked retrospectively.Figure 4: Functional evaluation of sensitivity of identified G12V mutated KRAS 10-mer- and 9-mer-sensitive TCRsSensitivity of the identified G12V mutated KRAS 10-mer and 9-mer specific TCRs was functionally evaluated in eTPC-eAPC cell co-culture assays. Briefly, engineered TCR presenting cell (eTPC) lines as described in WO 2018 / 083317 were generated to present the G12V mutated KRAS 10-mer and 9-mer sensitive TCRs (eTPC-t) and were cocultured with engineered antigen presenting cells (eAPC) expressing monoallelic HLA-A*11:01 loaded with a concentration range of the G12V mutated KRAS 10-mer or 9-mer peptides, was measured by detection of the RFP (RFP+) signal in combination with CD3 decrease (CD3|OW) as described in Materials and Methods. Figures 4 A-C show flow panel validation and the gating strategy used for detection of activated RFP+CD3|OW cells. A) Shows a representative of an “on target 10-mer-specific TCR” unstimulated with G12V mutated KRAS 10-mer peptide (left panel) or stimulated with G12V mutated KRAS 10-mer peptide (right panel). eTPC cells co-cultured with monoallelic eAPC without the KRAS peptide loaded (i.e. unpulsed) eAPC HLA-A*11:01 cells were used to define the flow gates that capture activated cells i.e., those that showed low CD3 staining with the CD3 antibody and positive RFP signal. Therefore, in panel A, the eTPC cells were not activated and are shown below the set gates, they are RFP negative (RFP') except for some cells with autofluorescence, and CD3h'9h (Left panel). Following co-culture of pulsed eAPC HLA-A*11:01 with the G12V mutated KRAS 10-mer peptide and the eTPCs, the eTPC cells were activated which was observed by increase in RFP+, and decrease in CD3 (CD3|OW) (right panel) and therefore most of the cell population was found within the gates set for defining the RFP+CD3|OW population. B) A TCR that reacts with the HLA allele presented on the eAPCs (i.e., HLA-A*11:01) without the target peptide is a representative of a “HLA-reactive TCR”. The RFP / CD3 profile does not change upon stimulation with the G12V mutated KRAS 10-mer (right panel), it is always RFP+CD3|OW. C) Shown is a representative of an “unresponsive TCR”, (RFP'CD3high) in both unstimulated (left panel) and stimulated cells (right panel). D and E) Flow cytometric data was used to construct sigmoidal curves from which the half maximal effective concentration (EC50) values were obtained. The sensitivity of the TCRs was based on the EC50 values. D) shows EC50 (nM) distribution obtained from the RFP+CD3low values of the G12V mutated KRAS 10-mer-responsive TCRs (n=54) (X-axis) plotted against each TCR. 10-mer G12V mutated KRAS-responsive TCRs, TCR-1 and TCR-2, are marked by full circle, retrospectively. E) Shows EC50 (nM) distribution obtained from the RFP+CD3|OW values of the G12V mutated KRAS 9-mer-responsive TCRs (n=13) (X-axis) against each TCR (Y-axis). 9-mer G12V mutated KRAS-responsive TCRs, TCR-6, TCR-9 and TCR are marked by full circle, retrospectively.Figure 5: Functional evaluation of sensitivity and specificity of the G12V mutated KRAS TCRs pulsed with target peptidesIn further examination of the TOR sensitivity, the ability of the 10-mer-specific TCRs to specifically recognize and bind the 9-mer peptides and vice versa was analyzed. The figure shows representative sigmoidal curve profiles of two 10-mer- and three 9-mer-specific TCRs. The sensitivity of the 10-mer-specific TCRs towards the 9-mer peptide and vice versa, as well as to the wild type G12 KRAS peptide, are compared. eTPCs expressing the TCR-1 (A) or TCR-2 (B) were co-cultured with monoallelic HLA-A*11:01 eAPCs- pulsed with a titration range of G12V mutated KRAS 10-mer, G12V mutated KRAS 9-mer, or corresponding G12 KRAS WT peptides. Percentage response (Y-Axis) of activation, as measured by RFP+ CD3|OW, is plotted against the peptide concentration in nM (X-axis). TCR-1 recognized G12V mutated KRAS 10-mer peptide with high specificity and sensitivity (full triangle), only weakly recognized the 9-mer G12V mutated KRAS peptide (full circle), and did not recognize the WT G12 KRAS peptide (full square). B) TCR-2 recognized 10-mer G12V mutated KRAS peptide with high sensitivity and specificity (full triangle) and did not recognize the G12V mutated KRAS 9-mer peptide (full circle), or the WT G12 KRAS peptide (full square). To check the sensitivity of the 9-mer-specific TCRs, eTPCs expressing TCR-6 (C), TCR-9 (D) or TCR-10 (E) were co-cultured with monoallelic HLA-A*11:01 eAPCs pulsed with a titration range of G12V 10-mer, G12V 9-mer and WT 9-mer peptides. Specific activation was again measured by detection of RFP signal in combination with CD3 downregulation. C-E) TCR-6, TCR-9 and TCR-10 show specificity and sensitivity towards the G12V mutated KRAS 9-mer peptide (full circle) and to some extent the G12V mutated KRAS 10-mer peptide (full triangle), but not to the WT G12 KRAS peptide (full square). F) A sensitivity of a reference TCR (SEQ ID NO: 5164) towards a mutated KRAS 10-mer peptide (full circle), mutated KRAS 9-mer peptide (full triangle) and a wild type KRAS peptide (full square) measured by detection of RFP signal in combination with CD3 down regulation.Figure 6: Evaluation of G12V mutated KRAS-10-mer- and 9-mer-responsive TCRs to constitutively expressed target peptidesTo further validate the interaction between the 10-mer- and 9-mer-sensitive TCRs and their target peptides, we utilized the monoallelic eAPCs that constitutively express the target peptides and measured the response in the eTPCs expressing the 10-mer- or the 9-mer-specific TCRs. A) Response of G12V mutated KRAS 10-mer-responsive TCRs (n=54) co-cultured with the monoallelic HLA-A*11:01 eAPCs or the monoallelic HLA-A*11:01 eAPCs constitutively expressing the G12V mutated KRAS peptide as a minigene (MG-UFD) (SEQ ID NO: 5) or a full length (FL) (SEQ ID NO: 6) construct. Percentage response was measured by RFP+CD3|OW signal. KRAS G12V 10-mer specific TCRsTCRs are shown as black square (TCR-1) and black triangle (TCR-2). B) Response of G12V mutated KRAS 9-mer-responsive TCRs (n=13) co- cultured with the monoallelic HLA-A*11:01 eAPCs or the monoallelic HLA-A*11:01 eAPCs constitutively expressing the G12V KRAS peptide as a minigene (MG-UFD) (SEQ ID NO: 5) or a full-length (FL) (SEQ ID NO: 6) construct. Percentage response was measured by RFP+CD3|OW staining. The KRAS G12V 9-mer specific TCRs are shown as an upside-down triangle (TCR-6), a diamond (TCR-9) and a hexagon (TCR-10).Figure 7: G12V mutated KRAS 10-mer- and 9-mer-specific TCRs mediate potent T cell killing of cells presenting the G12V mutated KRAS peptide presented by HLA-A*11:01Cytotoxic lysis mediated by the 10-mer-sensitive TCRs, (A) TCR-1 - two different KARS G12V MG constructs were used to test the killing potential of the TCR-1. KRAS G12V MG-UFD (SEQ ID NO: 5) in the right panel and KRAS G12V MG-native (SEQ ID NO: 179) in the left panel, (B) TCR-2, and 9-mer-sensitive TCRs (C) TCR-6, (D) TCR-9 and (E) TCR-10, quantified as loss of luciferase activity after 24 hour co-culture with target eAPC-pa cells. Target cells are monoallelic eAPC-pa constitutively expressing HLA-A*11.01 in combination with G12V mutated KRAS full length (FL) (SEQ ID NO: 6) peptide or eAPCs expressing HLA-A*11:01_KRAS minigene (MG) (SEQ ID NO: 5) or HLA-A*11:01 only eAPCs (used as off-target control). Y-axis shows % specific lysis, while X-axis shows the effector (TCR-T) to Target ratios. F) Cytotoxic activity of TCR-T cells expressing the TCR-1 (TCR-Ttcfm) against a panel of cancer cell lines expressing the mutated KRAS G12V in the HLA-A*11:01 (COR-L23, NCI-H441, SW620, QGP-1), as determined by Luciferase Assay. Cancer cells expressing wt KRAS with or without the HLA-A*11:01 expression (IGR-1_KRASwt-A11 or IGR-1_KRASwt, respectively), were used as controls. The Y-axis shows % specific lysis, while X-axis shows the effector (TCR-T TCR-1) to Target cell ratios. All test conditions were prepared in duplicates. Percentage killing = 100 - ((RLUtest condition) / (RLUtarget only)*100); RLU = relative luminescence units. G) Longituidnal measurement of cytotoxic activity using Incucyte® live-imaging measurements. Effector TCR-Ttcr'1 cells were added 24 hours after seeding of the target cancer cells (dashed line). Proliferation and disappearance of the GFP-expressing target cancer cells was measured as the fold-change in GFP+ objects over time after the addition of effector TCR Ttcr-1 ce||s anc| comparec| to the growth of target cancer cells only. H) COR-L23 cells expessing HLA-A*11:01 and G12V are shown with and without the addition of effector TCR-Ttcr'1 cells over 96 hours.Target cell killing was imaged by Incucyte® live-imaging at 2, 48 and 96 hour time points. Live cancer cells are green, TCR-Ttcr'1 cells are grey and dying cancer cells are red.Figure 8: Fingerprinting profile of G12V mutated KRAS 10-mer- and 9-mer-sensitive TCRsFingerprinting profile of the G12V mutated KRAS 10-mer- and 9-mer-sensitive TCRs. eTPC-t cell lines expressing the G12V mutated KRAS 10-mer- or 9-mer- sensitive TCRs, were stimulated with a library of monoallelic eAPCs stably expressing HLA-A*11:01 as well as the mutated version of the G12V KRAS peptide (eAPC-pa epitope mutagenesis library). Each cell line expressed a point mutation in a certain position. The Y-axis represents the amino acid substitution and the X-axis the peptide position where the substitution has been introduced. Activation of the eTPC-ts is measured by RFP+CD3|OW signal. A) Peptide scan of the KRAS G12V 10-mer- sensitive TCR, TCR-1; B) Peptide scan of the KRAS G12V 10-mer- sensitive TCR-2; C-E) Peptide scan of the KRAS G12V 9-mer- sensitive TCR-6, TCR-9 and TCR-10; F) Peptide scan of the KRAS G12V 10-mer-sensitive TCR, TCR-5, used here as a TCR that did not pass the selection process. The darker the colour, the higher the % response due to that particular amino acid substitution in the peptide sequence.Figure 9: Cross-reactive profiling of the G12V mutated KRAS 10-mer- and 9-mer-sensitive TCRsThe fingerprint profiles from Figure 8 were analysed by a computer algorithm that generates a fingerprint score which when screened against the whole human proteome allows the prediction of cross-reactive hits (CX). A) Predicted cross-reactive hits for the 10-mer-sensitive TCRs, TCR-1 and TCR-2, and two less sensitive TCRs which are shown for comparison, TCR-3 and TCR-4. Based on the Fingerprint score (Y-axis), many cross-reactive hits were predicted for TCR-1, while no cross-reactive hits were predicted for the TCR-2. The less sensitive TCRs, TCR-3 and TCR-4, showed some predicted hits based on their fingerprint score. B) The sequences of the predicted cross-reactive hits were subsequently used to generate MG constructs that were inserted into the HLA-A*11:01 presenting cells (eAPC-pa Cross-reactive library). These cells were then contacted with the eTPC cells expressing the TCRs (eTPC-t), TCR-1, TCR-2, as well as TCR-3 and TCR-4, for 18 hours. The response of the eTPC-ts was analysed by flow cytometry by measuring RFP+CD3|OW signals. Although a number of cross-reactive hits were predicted for TCR-1, no actual cross-reactivity was detected in the cell-cell cross-reactive contact assay. TCR-2 had no predicted cross-reactive hits, therefore both TCRs were considered as de-risked TCRs. TCR-3 and TCR-4 showed some predicted hits based on their fingerprint score and some were also confirmed in the functional cell-cell cross-reactive assay. TCRs that showed response in RFP+CD3|OW signal above the 4% threshold in the cell-cell contact assays were onsidered as cross-reactive and therefore based on these results they were considered as unsafe for use in the clinic. A similar analysis wasperformed for the G12V 9-mer-sensitive TCRs. C) Predicted cross-reactive hits for the 9-mer-sensitive TCRs, TCR-6, TCR-9 and TCR-10. Two less sensitive TCRs, TCR-7 and TCR-8, are shown for comparison. D) Based on the Fingerprint score (Y-axis), no cross-reactive hits were predicted for the TCR-6. TCR-9 and TCR-10 showed some predicted hits based on their fingerprint score but were not confirmed in the functional cell-cell cross-reactive assay. TCR-7 and TCR-8 showed some predicted hits based on their fingerprint score.Figure 10: Allo- and para-reactivity profiles of the G12V mutated KRAS 10-mer- and 9-mer- sensitive TCRsTo assess the alloreactivity of the TCRs, functional cell-cell contact assays were applied again, wherein the responder cell lines (eTPC-t expressing TCR-1, TCR-2, TCR-6, TCR-9 or TCR-10) were co-cultured with a library of monoallelic HLA-expressing cell lines (eAPC-p alloreactive library) covering the most common haplotypes. 86 different HLA alleles were tested. The read-out of the interaction was TCR-activation, i.e., flow cytometric analysis of RFP+CD3|OW signal. Para-reactivity was assessed by pulsing the library with the G12V mutated KRAS 10-mer peptide in case of TCR-1 and TCR-2, and G12V mutated KRAS 9-mer peptide in case of TCR-6, TCR-9 and TCR-10. A) Alloreactivity and para- reactivity profiles of the two G12V 10-mer-sensitive TCRs, TCR-1 (left panel) and TCR-2 (right panel). Y-axis shows the HLA alleles tested, X-axis is the RFP+CD3|OW signal in the absence (NP= no peptide) or presence (G12V) of the G12V mutated 10-mer KRAS peptide. TCR-1 showed no alloreactivity and showed parareactivity only when the peptide was added to members of the HLA-A*11 group (01,02, 03, 04, 05 and 09) and weakly para-reactive with HLA-A*30:01. TCR-2 showed some alloreactivity to HLA-A*68:02 and para-reactivity to members of the HLA-A*11 group (01, 02, 05 and 09) and weak para-reactivity to HLA-A*30:01 and HLA-A*68:02. B) Alloreactivity and para-reactivity profiles of the G12V mutated KRAS 9-mer-sensitive TCRs, TCR-6 and TCR-9. Y-axis shows the HLA alleles tested, X-axis is the RFP+CD3|OW signal in the absence (NP= no peptide) or presence (G12V) of the G12V mutated KRAS 9-mer peptide. TCR-6 showed very weak alloreactivity (below 4%) to HLA-B*54:01 (NP), and in the presence of G12V mutated KRAS 9-mer peptide signal was detected from members of the HLA-A*11 group (01, 02, 04, 05 and 09) and weakly (below 4%) from HLA-B*54:01. TCR-9 showed alloreactivity to HLA-B*35:01, HLA-B*35:02, HLA-B*35:03, HLA-B*35:12, HLA-B*57:01 and HLA-B*58:01. In the presence of the peptide, signal was detected from HLA-A*11 group (01,02, 05, 09), HLA-B*35 group (01,02, 03, 05, 12), HLA-B*52:01, HLA-B*53:01, HLA-B*57:01 and HLA-B*58:01.C) TCR-10 showed no alloreactivity and in the presence of peptide, signal from members of the HLA-A*11 group (01, 02, 05 and 09) was detected.Figure 11. Integration ofTCR-1 into primary T cells leads to eradication of KRAS G12V positive tumour cells in a human lung cancer xenograft model.Human lung cancer cells, COR-L23, naturally expressing the KRAS G12V mutation were retrovirally transduced to express HLA-A*11:01 and firefly luciferase (CORL-L23_A*11) and served as human tumour in vivo model. The CORL-L23_A*11 cells were injected intravenously into the tail vein of NSG mice. Tumour burden was monitored using non-invasive in vivo bioluminescence imaging (BLI) and mice were allocated into three groups with equal distribution of tumor burden in the lungs. Mice were treated with 10 million primary CD8 T cells transduced either with TCR-1 (TCR-Ttcfm, n=10) or with a negative control TCR (TCR-TNY'ES0, n=10) by intravenous tail vein injections. A group of control mice did not receive any TCR-T cells (untreated, n=10). Mice were sacrificed when showing signs of suffering. A) Schematic overview of the TCR-1 efficacy study using a CORL-23 human lung tumour in vivo model. B) Representative BLI images of CORL-23 bearing mice at baseline 2 days before treatment to 63 days after treatment. Images showing baseline data are representative images of mice prior to allocation of mice into different treatment groups. C) Median photon intensity per treatment group from baseline to 63 days after treatment. D) Survival analysis of mice after TCR-T treatment.Figure 12.Generation of Combinatorial mutagenesis library of the CDR3 regions of the alpha or beta TCR chains of TCR-1.The CDR3 nucleotide sequences from T cell receptor alpha (TRA) and T cell receptor beta (TRB) chains of the parental TCR (TCR-1) were used as a base sequence to generate the diversified CDR3 libraries. A-C) Flow plots representing the gating strategy for the response observed in parental TCR-1 A) and respective alpha (TRA) B) and beta (TRB) C) CDR3 libraries after overnight co-culture with eAPC line presenting KRAS WT MG peptide in HLA-A*11:01 (MG KRAS) (middle panels) or eAPC line presenting KRAS G12V mutated MG peptide in HLA-A*11:01 (MG G12V) (right panels). The represented responses correspond to the percentage of cells inside the sorting gate RFP+CD3|OW. The eAPC-HLA-A*11:01 cells without the KRAS wild type or mutated peptide (Null) were used to quantify the background signal (left panels) and set the RFP+CD3lowgate correctly. D) Summary of the response observed in A-C parental TCR-1 and respective alpha (TRA) and beta (TRB) CDR3 libraries after overnight co-culture with eAPC-HLA-A*11:01 line (Null), eAPCs presenting KRAS WT MG peptide in HLA-A*11:01 (MG KRAS) or eAPCs presenting mutated KRAS G12V MG in HLA-A*11:01 (MG G12V). The represented responses correspond to the percentage of cells inside the sorting gate RFP+CD3|OW. The experiment was performed in duplicate (parental TCR) and in triplicate (TRA and TRB CDR3 libraries).Figure 13. Sequence logo analysis of diversified and selected TRA and TRB CDR3 regions of TCR-1The CDR3 sequences from Example 7 were subjected to sequence logo analysis. Panels A (alpha) and C (beta) demonstrate the diversification at positions 4-12 (alpha) and 4-13 (beta). Panel B (alpha) demonstrates that arginine (R) was found to be absent at positivion 6, and lysine (K) to be absent from position 8 in all alpha sequences. Panel D (beta) demonstrates similarly the amino acid residues at positions 6 to 9 and 11 found to be absent in the specified alpha sequences.Figure 14. Schematic for alignment of scaffold nomenclature used in the specification with TCR chain structure. SC = scaffold, CDR = complementary determining region. SC1, CDR1, SC2, and CDR2 together may be referred together as the variable region, CDR3 is referred to as CDR3, SC4 may be referred to as joining region, and SC5 may be referred to as constant region. The use of the terms “alpha” and “beta” specify the relevant TCR chain.Materials and MethodsCell EngineeringGeneration of eAPC-p and eAPC-pa by recombinase-mediated cassette exchange (RMCE)Generation of eAPC-p and eAPC-pa lines was achieved by RMCE as described previously in detail in WO2018-083316, with the exception of the insertion of a different open reading frame (ORF) including the gene of interest (GOI).The cells of this specification were generated as described bellow. Briefly, ARH-77 HLA-null line was generated using vectors containing the heterospecific recombinase sites flanking a marker (described in Table 1), (SEQ ID NO: 181 and SEQ ID NO: 182). The monoallelic HLA line (eAPC-p) was constructed by RMCE by electroporation with a vector (SEQ ID NO: 183) containing HLA.A*11:01 as a GOI (in the HLA monoallelic library construction described in Example 5 other HLAs were as GOI). After electroporation, cells were incubated in culture medium RPMI 1640 with Glutamax-I + 10% FBS (37°C, 5% CO2) for two days, before analysis. To generate eAPC-pa lines, eAPC-p were further electroporated with a cassette containing the antigen ORFs as GOI 2 (SEQ ID NO: 5-6, 149 and 179).eAPC-pa cell lines were generated to be employed in subsequent cell : cell co-culture assays (also interchangibly referred to as cell : cell contact assays or responder assaysthroughout this specification). eAPC-pa lines produced were designed to express either the full lentgh KRAS G12V peptide (G12V_FL) or the wild type full length KRAS peptide (KRAS_FL) or a shortened version of the KRAS G12V peptide referred to as the Minigene (G12V_MG). The MG contains candidate epitope + / - up to 9 amino acids of flanking sequence. More specifically, MG expressing cell lines were generated by using different constructs depending on whether or not Ubiquitin fusion degradation substrates (Ub-UFD (MG-UFD) or none (MG-native)) were present.eAPC-pa cell lines were also used to generate the Epitope Mutagenesis Library wherein each eAPC-pa cell line expresses a mutant variant of a target peptide antigen (Example 5), or for producing the Cross-Reactive Library (Example 5) where each cell line expresses a putative cross-reactive antigen determined by the TCRs unique fingerprinting.Electroporation conditionsFor each reaction, 4x10$ cells were electroporated in 500 ml RPMI 1640 with GlutaMAX™ using the Gene Pulser Xcell™ (Bio-Rad) with the following setting: Square Wave 285V, pulse length 12.5 ms and 2 pulses with 1s interval. The cells were electroporated with vectors according to Table 1. For eAPC-p, the DNA concentrations used for the gene of interest (GOI- HLA) encoding vector (SEQ ID NO: 183) was 57mg, 13mg for the Flp vector (CMVpro_FLPo_Sv40pA_V2) and 5mg for the reporter gene vector (pcDNA 3.1 turbo / pMax GFP). For eAPC-pa, eAPC-p lines were additionally electroporated with 57mg of a second GOI containing vector (SEQ ID NO: 1-6 and 141). Following electroporation, the cells were transferred to culture vessels and grown in RPMI 1640 with GlutaMAX™+10% FBS (catalogue number 10500064, Gibco) and 37°C, 5% CO2.Table 1. Vectors used for DNA delivery by electroporation.VectorDescriptionF14-GOI-1-F15 (SEQ ID NO:181)RMCE site 1FRT-GOI-2-F3 (SEQ ID NO: 182)RMCE site 2FRT-GOI-2-F3 (SEQ ID NO: 183)Vector carrying the HLA ORF of the genetic sequence to be integratedFRT-GOI-2-F3 (SEQ ID NO: 5-6, 149 and 179)Vector carrying the KRAS ORF of the genetic sequence to be integratedCMVpro_FLPo_Sv40pA_V2Described in WO2018-083316Flp vector encoding an optimized FLIP recombinasepcDNA 3.1 turbo / pMax GFPDescribed in WO2018-083316Vector encoding a reporter gene used to assess DNA delivery efficiency and as a selection marker of integrationSorting of polyclonal GFP-expressing cellsCells electroporated with the GOI or the pcDNA 3.1 turbo / pMax GFP were sorted for transient GFP expression. Cells were harvested (3-4 M cells per electroporation), centrifuged at 200 x g for 5 min, and the supernatant removed. The cell pellet was washed once with DPBS 1X (Gibco) and resuspended in DPBS 1X +2%FBS (Gibco) before sorting in RPMI 1640 with Glutamax-I + 20% FBS +1% Antibiotic Antimycotic solution (cat. number 15240-062, Gibco) in Influx™ instrument (BD Biosciences). Cells positive for the reporter gene (GFP+) were sorted as a polyclonal population into 5 mL polypropylene round-bottom tubes FACS tubes containing culture medium. Following sorting, the cell suspension was centrifuged at 200 x g for 5 min, and the supernatant removed.Depending on the number of sorted cells, cells were transferred into a suitable vessel containing appropriate volume of culture medium (RPMI 1640 medium with Glutamax-I +10% FBS (Gibco)), and grown at 37°C, 5% CO2.Single cell sorting based on stable GOI integrationTo obtain a population of cells constitutively expressing the integrated protein or marker, cells were sorted 9 to 11 days after the first GFP+ selection. At that stage, the cells that have successfully integrated the GOI become negative for the pre-existing gene cassettes (BFP‘ or c-Myc or RFP’), and positive for the integrating cassette (SBP+ and GOI (HLA)). Next, about 0.5-2 million ARH-77 cells were centrifuged at 200 x g for 5 min, washed once with cold staining buffer (SB) consisting of DPBS 1X + 2%FBS (Gibco) and the supernatant was removed. The cell pellet was resuspended in staining solution (50 ml for 0.5-2 Million cells) containing the conjugated antibodies (summarised in Tables 6 and 8) in DPBS 1X+2% FBS and the samples were incubated in the dark for 30-45 min at 4°C. Cells were then washed with SB, resuspended in 300-600 ml of SB (depending on the cell number) and transferred to a clean FACS tube. Single cell sorting was achieved through standard cell sorting methodologies using the Influx™ instrument (BD Biosciences). For the sorting of single cells for monoclonal population generation, single cells displaying the phenotype of interest were deposited per well into 96-well plates, containing pre-warmed 200 ml of RPMI 1640 medium with Glutamax-I +20% FBS+1% Antibiotic Antimycotic solution and the cells were grown in the incubator at 37°C, 5% CO2. Two weeks after sorting, 50 ml of RPMI 1640 medium with Glutamax-I +10% FBS was added to each well. Monoclonal cell populations were used after 3 weeks.Single cell sorting of eAPC-pIn the eAPC-p (eAPC-HLA) expression of the analyte HLA (GOI) is detected through cell surface HLA staining. Depending on the availability of antibodies, a pan-HLA (i.e., HLA-ABC) or an allele specific antibody (i.e., HLA-A*11:01) can be used (Table 2).Table 2. Standard antibodies for eAPC-p staining for monoclonal sortingHLA ClassAntibodyCat numberProviderAntibody amount (mg)Total stainingVolume (ml)IAnti-HLA-ABCAlexa-APC-Cy7311425BioLegend0.650Staining buffer (SB) = DPBS1X+2%FBSFrom eAPC-p, eAPC-pa (eAPC-HLA-analyte antigenic molecule (aAM)) populations can be derived using discrete (a single ORF delivered into an eAPC-p) or pool (mix of several ORF delivered into an eAPC-p population) processes. Cell populations are stained with the antibody panel shown below (Table 3).Table 3. Standard eAPC-pa staining for single cell sortingAntibodyCat numberProviderFor up to 3M cellsAntibody amountTotal stainingVolumeAnti-SBP-Alexa-647sc-101595AF647SantaCruzBiotech0.6 mg50mlAnti-c-Myc-Alexa-488sc-40 AF488SantaCruzBiotech0.6 mgStaining buffer (SB) = DPBS1X+2%FBSIndividual eAPC-pa were selected, and single cell sorted (monoclones) based on loss of signal of the pre-existing gene cassette (c-Myc and red fluorescent proten (RFP) (c-Myc / RFP')) and gain of signal of the selection marker of integration Streptavidin-Binding Peptide SBP (SBP+).Phenotypic screening of monoclonal cell linesA sample of 50,000 cells of the outgrown monoclonal population were harvested, centrifuged at 200 x g for 5 min. The cell pellet was washed once with cold staining buffer (SB) consisting of DPBS 1X + 2%FBS (Gibco), centrifuged at 200 x g for 5 min, and the supernatant removed. Cell pellets were resuspended in appropriate volume of staining solution (25 ml for 30-100,000 cells) containing the conjugated antibodies in DPBS 1X+2% FBS and incubated in the dark for 30-45 min at 4°C. Cells were washed with cold SB and resuspended in 15 ml of SB and analysed by flow cytometry using the iQue Cell Analyzer (Sartorious).eAPC-pThe individual eAPC-p monoclone populations were screened for the expression of the target HLA. Monoclones were stained with a anti-HLA conjugated antibody and analysed by flow cytometry. Depending on the aAPX (HLA) to be analysed and the instrument used, a panel of antibodies conjugated to different fluorochromes targeting different epitopes on the GOI (i.e., HLA Class I) is used (Table 4).Table 4. Antibodies for phenotypic characterisation of eAPC-p monoclone population. Staining buffer (SB) = DPBS 1X+2%FBSHLA ClassAntibodyCat numberProviderAntibody amount (mg)Total stainingVolume (ml)IAnti-HumanHLA-ABC PE-Cy7561349BDBiosciences0.125Anti-HumanHLA-ABC PE-Cy5555554BDBiosciences0.02525anti-HumanHLA-ABC V450561346BDBiosciences0.00125anti-HumanHLA-C PE566372BDBiosciences0.125anti-HumanHLA-A2 PE-Cy7561347BDBiosciences0.0525anti-HumanHLA-A2 BV786741008BDBiosciences0.00125Anti-c-Myc-Alexa-488sc-40 AF488SantaCruzBiotech0.6 ug25anti-c-Myc-Alexa-405sc-40 AF405SantaCruzBiotech0.125anti-SBP tag-Alexa-488sc-101595AF488SantaCruzBiotech0.125Monoclonal cell lines with an HLA+ fluoresce signal compared to the HLAnu" eAPC cell line control demonstrate integration of the GOI and thus expression of their analyte aAPX (i.e., HLA-A*11:01), and are therefore validated as eAPC-p cell lines.5eAPC-paThe phenotypic characterisation of the eAPC-pa cells is based on the loss of fluorescence of the selection marker(s) in the receiver cassette (c-Myc / RFP'), and gain of the selection marker(s) of integration of the donor cassette (SBP+) determined by antibody staining.10 Eligible monoclones must retain their HLA allele expression. The screening is performed by flow cytometry as described above. The following antibodies targeting different HLA alleles or analyte antigenic molecules, or antibodies conjugated to different fluorochromes can be used (Table 5).15 Table 5. Antibody staining panel for phenotypic characterisation of eAPC-paAntibodyCat numberProviderFor up to 100 000 cellsAntibody amount (mg)Total stainingVolume (ml)anti-SBP tag-Alexa-488sc-101595AF488SantaCruzBiotech0.125Anti-c-Myc-Alexa-405sc-40 AF405SantaCruzBiotech0.125Anti-Human HLA-ABC PE-Cy5561349BD Biosciences0.125Staining buffer (SB) = DPBS 1X+2%FBSeAPC-pa monoclone populations that show a strong fluorescent signal from the donor cassette, and a loss of fluorescent signal from the receiving cassette, compared to controls, demonstrate expression of analyte aAM selection marker and therefore inferredaAM expression. Co-expression of aAPX (i.e., HLA) and the aAM selection marker validates eAPC-pa lines.Plots of c-Myc vs RFP showing loss of c-Myc / RFP signal in monoclonal population(s) in comparison to the parental eAPC-p, and plots of SBP vs HLA showing gain of the SBP cassette (while retaining the HLA signal), indicating a successful integration event.To confirm the identity of the aAM-ORF encoded in eAPC-pa monoclones, such cell lines were subjected to genetic characterisation by sequencing the Barcode encoded within the 3’ UTRofthe aAM-ORF.Genotypic analysis of monoclonal cell linesGenomic DNA was extracted using the QIAamp® DNA Mini kit (cat num 51306, Qiagen), Quick-DNA 96 Plus kit (cat number D4070 D4071, Zymo Research) according to the manufacturer’s instructions, and PCR was conducted using primers that target adjacent and internal regions of the HLA ORF or aAM-ORF, thereby selectively amplifying successful integration couple events. Comparison was made to an unmodified parental line, wherein the HLA or aAM-ORF is lacking.PCR reactions were done using either purified genomic DNA (gDNA) or crude cell lysates. For crude cell lysates, 70,000-150,000 ARH-77 derived cells were harvested, pelleted and washed with of 1X DPBS. Cell pellets were resuspended in 20ml of low EDTA TE buffer, the cells were lysed by heating for 10min at 98°C, lysates are centrifuged at >800 x g for 5min and the PCR reaction master mix was prepared according to Table 6.Table 6. PCR reagentsReagentPer reaction (ml)Cat NumberProvider5X Phusion HF buffer6F-549LThermo FisherScientificdNTPs0.310083252Thermo FisherScientificPhusion Hot Star II DNA polymerase (2U / ml)0.3F-549LThermo FisherScientificForward primer (100mM stock)0.15-Reverse primer (100mM stock)0.15-H2O21.1 (22.1)*129114,129117QiagenCell sample2 (1)*--*Volumes to add when using purified gDNA.PCR products were run on a 1 % or 2% Agarose gel beside a 50 bp or 1 kb ladder, in 1X TAE buffer, at 120 V for 25-30 min. DNAwas stained with 10.000 dilution of SYBR safe 5 DNA gel stain (cat num S33102, Invitrogen Life Technologies) and gel image captured using the Fusion SL UV-camera (Vilber).HLA amplificationTo validate the HLA expression, PCR amplicons were generated with two set of primers 10 that primed on the AAVS1 genomic sequence distal to the region encoded by the homologous arms (Table 7) and using the PCR conditions described in Table 8..Table 1. PCR and sequencing primers for HLA Class I Barcode PCRRegionPrimerSequenceExpected Product size :Sequencing PrimerBarcodeForwardCATCATCACCATCACCACTGAC196 bpCACCACTGACTATAGTCAReverseGAATCCTGACTCCTCGACTAG15 Table 8. PCR cycler program for HLA Class IStepTemperatureDurationNumber of cycles1. Pre-heating98°CHold12. Initial Denaturation98°C30 sec13. Denaturation98°C10 sec14. Annealing64°C20 sec5. Extension72°C20 sec6. Go to step 3--34x (total 35 cycles)7. Final extension72°C5 min18. Cooling12°CHold1aAM-ORF amplificationTo validate integration of the aAM-ORF in the engineered monoclones, PCR amplification 20 of the aAM-ORF region utilising primers targeting the ORF-Full length Barcode or theORF-Minigene UGI was applied (Table 9).The ORF-Minigenes can carry different proteasome degradation signals (none (native) orUb-UFD), which will dictate the set of primer to use (Table 9). The PCR amplification conditions for the FL ORF are summarised in Table 10 and for the MGs in Table 11.Table 9. PCR and sequencing primers for ORF-Full length Barcode, and ORF-Minigene5 BarcodeRegionORFTagPrimerSequenceProduct size(bp)Sequencing PrimerBarcodeFull lengthN / AFwdATCTGGACGGCTTCGACTT165GGCTTCGACTTCTGTAGCN / ARevATCCGTATGGTGACAAGACGBarcodeMinigeneNoneFwdCATTTCAGGTGTCGTGACTG450GGAGCTACAGAAGTCGAAGCRevATCCGTATGGTGACAAGACGUbUFDFwdTCGTCAAGACTCTGACTGGT400GTAAGACCATCACCCTGRevGGAGCTACAGAAGTCGAAGTable 10. PCR cycler conditions for ORF-full length (FL) Barcode amplificationStepTemperatureDurationNumber of cycles1. Pre-heating98°CHold12. Initial Denaturation98°C30 sec13. Denaturation98°C10 sec14. Annealing64°C20 sec5. Extension72°C20 sec6. Go to step 3--34x (total 35 cycles)7. Final extension72°C5 min18. Cooling12°CHold110 Table 11. PCR cycler conditions for ORF-Minigene UGI amplificationStepTemperatureDurationNumber of cycles1. Pre-heating98°CHold12. Initial Denaturation98°C30 sec13. Denaturation98 C10 sec14. Annealing64°C20 sec5. Extension72°C40 sec6. Go to step 3--34x (total 35 cycles)7. Final extension72°C5 min18. Cooling12°CHold1Sequencing of the aAM-ORF and HLA amplicons is performed by a third party (Eurofins Genomics). Raw ,ab1 files are downloaded and analysed using the Geneious Prime analysis software (2022.1.1, Java Version 11.0.14.1 + 1 (64 bit)). Sequence reads are annotated and inspected for parameters such as the Sequence %HQ, UGI Mean PHRED, UGI ambiguities and UGI mutations.Engineering eTPC-t cells presenting a full-length functional TCRa£ using bidirectional DNA delivery vectors.Electroporation ofJurkat, Clone E6-1For each reaction, 5x106 cells were electroporated in 500 ml CTS Opti-MEM I Reduced Serum Medium (Thermo Fisher Scientific) using the Gene Pulser Xcell™ (Bio-Rad) with the following setting: Square Wave 265V, pulse length 15 ms and 2 pulses with 1s interval. For integration of the bidirectional donor vectors encoding the TRA and TRB ORFs cells were electroporated with 10ug of the vector encoding the Flp recombinase enzyme (CMVpro-Flp-sv40pA-V2) and 55 mg of the integrating vectors (i.e., TOR encoding vectors). After electroporation, cells were incubated and further expanded in culture medium RPMI 1640 with Glutamax-I (Life Technologies) + 10% FBS (37°C, 5% CO2) for 7 days prior to the T cell enrichment.Magnetic Cell Sorting of eTPC-tIsolation of cells expressing the desired TOR was achieved by following a single round of Miltenyi TCR- Indirect-positive selection and using the MultiMACS Cell24 Separator Plus (Miltenyi Biotec) for simultaneous multisample separation. Engineered T cells were labeled with phycoerythrin (PE)-conjugated anti-TCRaP antibody (Thermo Fisher Scientific, Cat.Number: 12-9986-42, Working Dilution: 1 / 10) and incubated for 10 min. Cells were washed twice with pre-cooled stain buffer (Dulbecco's phosphate-buffered saline (DPBS) with 2% Foetal bovine serum (FBS)) and resuspended in stain buffer with anti-PE MicroBeads (Miltenyi Biotec, Cat.No:130-048-801, Working Dilution:1 / 4) according to the manufacturer’s instructions and incubated for 15min. All incubations were performed at 4 °C and protected from light. To quantify the integration rate of the bidirectional TCR donorconstruct pre-ennched cells, flow through (negative fraction) and positive fraction were analyzed by flow cytometry using the IQue Screener Plus. Engineered T cells (eTPC-t) were cultured and out-grown for 7-10 days and were subsequently subjected to an additional phenotypic analysis prior to cryopreservation.Phenotypic analysis by Flow cytometryFor phenotypic analysis cell polyclones were assessed for TCR7CD3+ expression and the loss of the pre-existing selection markers (BFP7SBP'). The anti-TCRaP antibody conjugated with PE (Thermo Fisher Scientific, Cat.No: 12-9955-41, 12-9955-42, Working Dilution: 1 / 25), the anti-CD3 antibody conjugated with BV650 (BD Biosciences, Cat.Number: 564003, 563999, Working Dilution: 1 / 50), and the anti-SBP antibody conjugated with AF488 (Santa Cruz Biotech, Cat.No: sc-101595 AF488, Working Dilution: 1 / 50) comprised the antibody panel used for the analysis. Cells were incubated at 4°C, for 20 min, washed twice with pre-cooled stain buffer DPBS containing 2% Foetal bovine serum (FBS) and subsequently resuspended in stain buffer to be analyzed using the iQue Screener Plus instrument. Pure populations of engineered T cells (eTPC-t) were cryopreserved, and cell aliquots were obtained for the mycoplasma test and gDNA sequencing to verify the integration of TRA / TRB at the right genomic locus.Genetic characterization by genomic DNA sequencingPrimers used to assess integration of the TRA-ORF, annealed to the TRA-C segment (Reverse primer SEQ ID NO: 163) and the EF1a promoter (Forward primer SEQ ID NO: 162) that is a pre- existing part of the genomic receiving sites. Primers used to assess integration of the TRB-ORF, annealed to the TRB-C segment (Reverse primer SEQ ID NO: 165) and the EF1a promoter (Forward primer SEQ ID NO: 162) that is a pre- existing part of the genomic receiving sites. PCR products were run on a 1 % Agarose gel in 1XTAE buffer, using the PowerPac Basic (Bio-Rad), stained with 10,000 dilution of SYBR Safe and analyzed with Fusion SL (Vilber Lourmat).Amplicon sequencing primers, (SEQ ID NO: 164) and (SEQ ID NO: 166 ) were used to amplify TRA-C and TRB-C segments to genotypically confirm the TRA / TRB integrated ORFs.Table 12. PCR reaction for amplification of TRA or TRB.PCR mixpl per reaction5xPhusion HF bufferdNTPs (20mM)0.25Phusion HSII0.25Fwd 100uM0.15Rev 100mM0.15H2018.2Cell sample / DNA1Table 13. PCR cycling reactions for amplification of TRA or TRB.PCR conditions common for TRA / TRBInitialDenaturation98°C30sec1 cycleDenaturation98°C10sec35 cyclesAnnealing69°C20secExtension72°C15secFinal Extension72°C5min1 cycleHold12°CholdEngineering of luciferase expressing eAPC-pa lines using RMCE eAPC target cell lines expressing HLA-A*11:01 and KRAS G12V we generated using RMCE as described in earlier section. RMCE was further used to introduce Firefly luciferase into the eAPC line expressing HLA-A*11:01.Engineering of luciferase expressing eAPC-pa lines using directed endonuclease A polycistronic construct expressing EF-1 alpha promotor-driven Firefly Luciferase and green flourescent protein (GFP) was used as homology-directed repair (HDR) template to introduce these markers into eAPC lines expressing HLA-A*11:01 and KRAS by directed endonuclease-mediated knock-in into the CCR5 locus. Firefly Luciferase and green flourescent protein (GFP) was separated by a P2A cleavage site in the HDR construct. For nucleofection, 2 million cells were prepared in 20 pl Lonza SF buffer. Pre-incubated RNP and DNA mixture was added to cells and and mixed gently. This mixture was then transferred into 16-well Nucleocuvette Strips (Lonza Bioscience) and pulsed with the code EN-138. For every 2 million cells, 40pmol RNP and 2ug plasmid DNA were used. After nucleofection, pre-warmed RPMI with 10% FBS was gently added to the cuvette and the cuvette was placed in a 37°C tissue culture incubator for 15 min for cell recovery.Monoclones of the engineered lines were generated by flourescence activated cell sorting (FACS) using GFP as the selection marker.Engineering of HLA-A*11:01 and Luciferase expressing cancer cell linesVSV-G pseudotyped third-generation lentivirus purchased from Vectorbuilder was used to introduce HLA-A*11:01 ORF into commonly used cancer cell lines expressing theG12V mutant KRAS or wild type KRAS. The lentiviral vector additionally contained Firefly Luciferase and GFP ORFs with the three ORFs separated by T2A and P2A self-cleavage sites and expression of all driven by the EF-1 alpha promoter.50,000 cells per transduction were seeded the day before transduction. 1,000,000-5,000,000 p24 transduction units of virus-like particles (VLPs) were added per transduction followed by LentiBoost (Sirion Biotech) at a 100 fold dilution. Cells were incubated for 10 min at RT and spinoculated at 30 min and 800g at 32°C. Following spinoculation cells were placed in a tissue culture incubator. On the next day media was exchanged. Seven days after transduction, purity of cell lines was measured and the cells were sorted to monoclones or polyclones with a purity of >90% using FACS and GFP expression.Table 14. Summary of mammalian cell lines used through out the specificationUnmodified cell lineSourceSpecificationCOR-L23ECACC92031919SW620ATCCCCL-227IGR-1DSMZACC 236NCI-H441ATCCHTB-174QGP-1JCRBJCRB0183HEK293DSMZACC305ARH-77DSMZACC512Jurkat clone E6.1Merck88042803-1VLPrimary CellsCollection of healthy donor peripheral blood and leukapheresis products were undertaken with written consent, granted by the Swedish Ethical Review Authority. Peripheral blood mononuclear cells and primary human CD8+ T cells were isolated from apheresis productfrom healthy donors using CliniMACS CD8 reagent according to the manufacturer’s instructions (Cat. Number 170-076-703, Miltenyi Biotec).CD8* T cell activation and nucleofectionCryopreserved CD8+ T cells were recovered for 24 hours in RPMI-1640 medium with 10% FBS before activation. For activation, CD8+ T cells were plated at an initial concentration of 1 million cells / mL in AIM V (Cat. Number 11534536, Thermo Fisher Scientific) medium in presence of 5% serum replacement (SR) (Cat. Number A2596102, Thermo Fisher Scientific) and 100U / ml IL-2 (Cat. Number 130-097-748, Miltenyi Biotec). T Cell TransAct (Cat. Number 130-111-160, Miltenyi Biotec) was added to the culture at a 1:100 dilution. After 72 hour stimulation, activated CD8+ T cells were centrifuged and gently resuspended in P3 buffer with supplement, as part of the P3 Primary Cell 4D-Nucleofector™ X Kit (Cat. Number V4XP-3032, Lonza Bioscience) at 2 million cells per 20 pl. 30 pmol ribonucleoprotein (RNP) and 2 mg plasmid deoxynucleic acid (DNA) were pre-incubated and added into the suspension. This mixture was then transferred into 4D-Nucleofector cuvette (Cat. Number V4XP-3032, Lonza Bioscience) and pulsed with code EH115. After nucleofection, pre-warmed AIM V medium with 5% SR and 100U / ml IL-2 was gently added to the cuvette and the cuvette was placed in a 37°C tissue culture incubator for 15 min to allow for cell recovery. After recovery, the cells were transferred to prewarmed AIM V medium with 5%SR, 100U / ml IL-2 and 2 mM HDR enhancer. After overnight incubation, nucleofected cells were collected by centrifugation and replated in fresh AIM V medium with 5%SR, 100U / ml IL-2, without HDR enhancer to allow expansion. 7 days after nucleofection, CD34+ cells were enriched using CD34 MicroBead Kit according to the manufacturer’s instructions (Cat. Number 130-046-702, Miltenyi Biotec).Identification of G12V KRAS peptides via mass spectrometryMetal affinity chromatographyARH-77 cells were cultured in RPMI supplemented with 10% FBS at 37X1 and 5% CO2. Harvested cells were washed once with ice-cold PBS and lysed in ice-cold lysis buffer (150 mM Sodium chloride (NaCI), 1x PBS, 1% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS), 5 mM Imidazole, 0,2 mM iodoacetamide, 5% glycerol, and 1x Halt protease inhibitor cocktail (Thermo Scientific)), vortexed and incubated at 4 °C for 20 minutes. Cleared lysate was mixed with HisPurTM nickel-nitriloacetic acid (Ni-NTA) Resin (Thermo Scientific) and rotated for 2 hours at 4°C. After removal of the lysate unbound fraction, the resin was washed twice with high salt buffer (250 mM NaCI, 1x PBS, 25 mM Imidazole) and twice with low salt buffer (50 mM NaCI, 1x PBS). Washed beads were harvested in low salt wash buffer and transferred to spin columns (ThermoScientific). The bound fraction was eluted in 15% Acetonitrile and 0,2% TFA and ultrafiltered over 3kD Ultra Centrifugal Filter (Amicon). The peptide fraction was reduced and alkylated in a one-step reaction with 10 mM Tris(2-carboxyethyl)phosphine hydrochloride (TCEP), 50 mM chloro-acetamide and in 100mM Triethylammonium bicarbonate buffer (TEAB) shacking for 30 minutes at 37°C. The sample was then immediately re-acidified in 5% FA and subjected to solid phase extraction on Hypersep Retain-CX columns (Thermo). The sorbent was activated with methanol (MeOH) and equilibrated with 0.2% TFA prior to sample loading. The column was later washed with MeOH and then water prior to elution of the absorbed peptide fraction in elution buffer (MeOH, 5% NH4OH). Samples were transferred to HPLC-glass vials, vacuum-dried and stored at -20 °C prior to LC-MS / MS analysis.Mass spectrometryPeptides were re-suspended in 10 mL Solvent (10% formic acid (FA), Milli-Q) prior LC-MS / MS analysis. Each sample was analyzed on a timsTOF Pro2 (Bruker, United States) connected to a nanoElute system (Bruker, United States), injecting 2 mL from each sample vial. The nanoElute system was equipped with an UHPLC analytical column (Aurora Ultimate nanoflow with CSI fitting; 25 cm x 75 mm ID, 1.7 mm C18; lonOpticks) heated to 50 °C, and connected to a CaptiveSpray (Bruker, United States) ion source. Mobile phase buffers consisted of Solvent A (2% ACN, 0.1% FA, Milli-Q) and Solvent B (ACN, 0.1% FA). The peptides were eluted during a 55 min gradient with a flow rate set to 0.250 mL / min. The gradient started at 2% of solvent B, raised to 4% within 2 min, to 18% within 33 min, to 26% within 7 min, to 36% within 3 min, to 95% within 1 min, and maintained at 95% for 9 minutes. The nano spray voltage was set to 1.5 kV, with dry gas flow set to 3 L / min and 180 °C.The mass spectrometer acquisition was configured to operate in a data dependent acquisition (DDA) mode, using trapped ion mobility spectrometry (TIMS) with the scan mode set to Parallel Accumulation-Serial Fragmentation (PASEF), high sensitivity detection and positive mode. The precursor scan range was set between m / z 100 and 1700. The TIMS 1 / K0 values ranged from 0.7 and 1.42, with the ramp and accumulation times of 166 ms, and a duty cycle of 100%. The PASEF precursor region polygon left boundary was set at m / z 180 for low 1 / K0 and m / z 1300 at max 1 / K0, and the right boundary at m / z 1700 for both high and low 1 / K0 (0.7 and 1.42). The quadrupole energy was set to 5.0 eV and low mass m / z 200. The collision cell energy was set to 10 eV and collision RF to 1500.0 Vpp.Data analysisThe MS acquisition data files were processed using PEAKS Online X (Bioinformatics Solutions Inc., Canada) using database search, De Novo sequencing, post-translational modifications (PTM) search, and SPIDER algorithms. The library search was preformed against a composite FASTAfile including standard Human proteome library sequences and short sequences corresponding to SNP and indel events known to be present in ARH-77 and supplemented with the KRAS mutations included in the experiment; a FASTA file with a list of common LC-MS / MS contaminants was included in the search. The precursor and fragment mass error tolerances were set to 15 ppm and 0.05 Da, respectively, and the peptide lengths ranged between 7 and 25 amino acids. The De Novo search parameters were set to be the same as the library search with the Average Local Confidence (ALC) set to 50%. The PTM search was set to detect all built-in modifications, and with De Novo ALC set to 15%. The SPIDER algorithm was employed to find mutations and sequence variants. The peptide false discovery rate (FDR) was set to 1% and the proteins -1 OLogP 3 20 and proteins unique peptides 31. The results from PEAKS Online X search were further analyzed using Bruker-provided and proprietary software (Python scripts) implementing the clustering methods of Andreatta et al (2017) so as to confirm concordance to expected pHLA repertoire characteristics to assess the quality of the immunopeptides identified.TCR DiscoveryNaive CD8+ T cell enrichmentCryopreserved PBMCs from healthy HLA-A*11:01 donors were thawed and rested overnight at 10 Million cells / mL in RPMI1640 with 2mM L-glutamine and 10%FBS. The next day, PBMCs were counted using the NucleoCounter NC-200 (ChemoMetec) and enriched using the EasySep™ Mouse Naive CD8+ T Cell Isolation Kit (StemCell) following the manufacturer’s instructions. Purity of the CD8 naive T cells was validated by flow cytometry using surface antibody staining against CD45R0, CD27, CD95, CD8 and CD4 and analysis on the cell analyzer BD LSRFortessa.Selective expansion of target-specific TCRsEnriched naive CD8 T cells were co-cultured with engineered antigen presenting cells (eAPCs) constitutively expressing the HLA-A*11:01 at a ratio of 20:1 (CD8+T cells: eAPC). In a round bottom 96 wells plate, 5000 naive CD8+ T cells were co-cultured with 250 eAPCs and 1mM KRAS G12V-10-mer peptide in 100mL of OpTmizer CTS supplemented with 2mM GlutaMax and 10% human serum for 7 days. 1 day and 7 day after the seeding, 50mL of interleukin 2 (IL-2) at 100 U / mL and 25 U / mL respectively was added to support expansion of specifically activated T cells by the KRAS G12V-10-mer peptide.Harvesting and sorting of KRAS G12V specific T cells14 days after expansion, cells were harvested and counted using the NucleoCounter NC-200. Cells were stained with A*11:01 G12V KRAS MHC tetramer conjugated with phycoerythrin (Cat Number WD04069 PE 50, Immudex) and A*11:01 WT KRAS MHC conjugated with APC (allophycocyanin) tetramer (Cat Number WD05135 AP 50, Immudex) for 30min at room temperature (RT). A*11:01 G12V MHC tetramer-stained CD8+ T cells were magnetically enriched using anti-phycoerythrin (PE) Microbeads (Miltenyi) following the manufacturer’s instructions. The enriched fraction was stained for extracellular markers against cMyc, SBP and CD8 to distinguish eAPC from CD8+ T cells and CD8+ A*11:01 G12V KRAS MHC-PE+ and A*11:01 WT KRAS MHC- cells were single cell sorted using FACS sorting.TCR selectionThe identified unique TCRs from each human donor were extracted and counted. The absolute count and frequency of one TCR pair relative to the total number of pairs identified per donor was determined. A total count of more than 3 observations was considered to be an expanded clonotype.Peptide Pulse assayeTPC-t and eAPC cells harvestingAn aliquot of actively growing cultures of eTPC-t cells and eAPC cells (0.4-1.0 x 106 cells / mL) was taken for cell counting using CountBright Absolute Counting Beads (Thermofisher) read on an iQue Screener Plus (Sartorius). The desired number of cells were harvested, washed once with complete media and resuspended at a concentration of 0.7M / mL in complete media (RPMI 1640 with L-glutamin and 10%FBS).Contacting eTPC-t and eAPC in an eTPCieAPC system with exogenous antigenic moleculesCo-cultured assay were performed in round bottoms 96 wells plate at a 1:2 eTPC to eAPC ratio. 100uL of eAPC (70,000 cells) were seeded together with 50uL of eTPC-t (35,000) and 50uL of peptide was added. Peptide concentration used ranged from 0 to 10 mM final. Cells were co-cultured for 18h at 37C before functional reading by flow cytometry.Plasmid productionVector library assembly and cloningThe construction of vectors described in the examples comprises a variety of methods well known to those skilled in the art, and specific reaction compositions are outlined indetail in WO2019 / 016175. The following key materials in table 15 were used in the described procedures:Table 15:ProductSupplierSupplier NumberAcc651New England BioLabsR0599LBbsl HFNew England BioLabsR3539LDH5alpha competent cellsThermo Fisher Scientific18265017DNA clean and concentrator kitZymo ResearchD4030EcoR1New England BioLabsR3101SNotlNew England BioLabsR3189LQIAamp DNA Mini kitQiagen51306QIAquick Gel Extraction kitQiagen28704Qiagen Plasmid Plus Midi kitQiagen12945T4 ligaseNew England BioLabsM0202LT4 ligase buffer 10xNew England BioLabsB0202SXbalNew England BioLabsR0145SXholNew England BioLabsR0146SOligonucleotide duplex encoding CDR3 (odeCDR3) assemblyodeCDR3 were routinely assembled by annealing partially complementary single stranded oligonucleotides. A detailed description of reaction composition and conditions is provided in WO2019 / 016175. The following key materials in table 16 were used in the described10 procedures:Table 16ProductSupplierSupplier NumberT4 ligase buffer 10 xNew England BioLabsB0202ST4 PNKNew England BioLabsM0201LTOR reconstitutionOperation of a TORES2 to reconstitute full-length TCR ORFs is described in detail in 15 WO2019 / 016175. The following key materials in table 17 were used in the describedprocedures: Table 17:ProductSupplierSupplier NumberBsal-HFNew England BioLabsR3535LrCutSmart buffer 10 xNew England BioLabsB6004SDH5alpha competent cellsThermo Fisher Scientific18265017Notl-HFNew England BioLabsR3189LQIAamp DNA Mini kitQiagen51306T4 LigaseNew England BioLabsM0202LT4 Ligase buffer 10 xNew England BioLabsB0202SFluorescence activated cell sorting (FACS)Single HLA-multimer positive CD8+ T cells were sorted by FACS for amplification and sequencing of TCR chains. This was achieved through standard cell sorting methodologies using a BDInflux instrument. Briefly, cells were stained with HLA-multimer reagent on ice for 10 mins, then with CD3 and CD8 antibodies as markers of CD8+ T cells. Cells with CD3+CD8+Multimer+ signal were sorted to PCR plate pre-loaded with 5 pL of nuclease-free water. Specimens were snap-frozen until subsequent processing. The following key materials in table 18 were used in the described procedures:Table 18:ProductSupplierSupplier NumberA*11:01 G12V KRAS MHC tetramer (PE)ImmudexWD05135Anti-CD8 (clone RPA-T8) (BV510)BD563256Anti-CD3 (clone SK7) (APC-H7)BD560176Sequencing of TCR alpha and beta chains from single T cellsSingly FACS-sorted T cells were subjected to a two-step amplification process that entails a V-region specific primer collection for each TRA and TRB, followed by paired nested PCR reactions that create TRA and TRB amplicons for sequence analysis as described in WO2019 / 016175. This procedure is described previously (Han et. al. 2014). The following materials in table 19 were used in the described procedures:Table 19ProductSupplierSupplier Number2x Reaction MixThermo Scientific125740355X Phusion HF BufferThermo Fisher ScientificF-549SdNTPsThermo Fisher Scientific10297018Nuclease free waterQiagen129114Phusion Hot Start II DNAPolymeraseThermo Fisher ScientificF-549SSuperScript® III One- Step RT-PCR System with Platinum® Taq High Fidelity DNA PolymeraseThermo Scientific12574035Responder assay (eAPC:eTPC co-culture assays)This procedure was used to evaluate and validate the specificity and sensitivity of a TCR for an antigen presented on a defined HLA background, evaluate cross-reactivity, and / or define an alloreactivity profile for specific TCRs.Cell line preparationSelected analyte eAPC-pa and eTPC-t were thawed at least 4 days before their planned responder assay setup to allow cell recovery and growth. Both the eAPC-pa and eTPC-t cells were maintained independently in log-phase with cell concentrations between the 0.2-1 Million / ml in Roswell Park Memorial Institute (RPMI) 1640 medium (Gibco) supplemented with 10%FBS (Gibco).Assay set up and Cell StainingeAPC-pa and eTPC-t cells were separately counted using iQue flow cytometer (Sartorius) and plated in 2:1 ratio (70,000 eAPC-pa and 35,000 eTPC-t cells per well) in 200 pl final volume in a 96 well round-bottom plates and incubated overnight (18 hours) at 37 °C, 5% CO2, 90 % RH. Cell analysis was conducted through cell surface marker staining and flow cytometry analysis using the iQue instrument (Sartorious) using the following antibody panel (Table 20). The antibodies were added directly into the cell suspension in the 96-well round-bottom assay plate. After overnight incubation, 25 pl of the antibody mix was directly added to the culture plates, and cells were mixed using the microplate shaker atroom temperature for 5 sec and incubated at 2-8 C for 40-60 mm. Following the incubation, cells were centrifuged for 4 min at 400 x g and the supernatants were aspirated. The cell pellets were resuspended in 20 pl of 1,5X CellFix (4% Paraformaldehyde) solution and mixed at room temperature using microplate shaker 5 sec. Cells were incubated at 2-8 °C for 15 min before acquisition on the iQue cytometer.Table 20. The antibody staining panel for the eTPC-t. Antibody mix prepared in Staining Buffer consisting of 2% FBS (Gibco) in DPBS (Thermo Fisher Scientific)AntibodyCatalogue numberSupplierBD Horizon™ BV786Mouse anti-HumanCD80564159BD BiosciencesBD Pharmigen™ Alexa Fluor 488 Mouse Anti-HumanCD8557696BD BiosciencesBD OptiBuild™BV510 Anti-HumanCD3740202BD BiosciencesQuality Control Measures eAPC-paThe eAPC-pa were subjected to two quality control procedures: a) genotyping confirmation by direct Sanger sequencing and b) intracellular Flag staining. Genotyping was described in the cell engineering section.Intracellular FLAG stainingTo confirm ORF minigene expression, proteasomal degradation was inhibited with addition of MG-132 (Cat number 474787, Merck), according to manufacturer’s instructions and followed by intracellular FLAG staining. Following proteosome inhibition, eAPC-pa were stained with 25pl of Death Cell Marker (DCM) Aqua BV-510 dye (Zombie AquaTM Fixable Viability Kit, Cat num. 423102, BioLegend) diluted 1:100 with DPBS and incubated in dark while shaking for 20 mins at RT. Cells were washed with 250pI Stain buffer (DPBS +2%FBS), centrifuged at 400g for 4 minutes, and supernatant removed. Intracellular Flag staining was performed using the Cytofix / Cytoperm Fixation / Permeabilization solution kit (Cat num. 554714, BD Biosciences) according to manufacturer’s instructions. For cellularpermeabihzation, cell pellets were resuspended in 10OpI Cytofix / Cytoperm solution and incubated for 20 minsat4°C. Washed twice with 250pl PermWash Buffer (diluted 1:10 with water) at 400g for 3 minutes. Supernatant was removed and cells were stained with anti-DYKDDDDK-PE (FLAG) antibody (Cat num 130-128-816, Miltenyi) for 30-60 minutes at 4°C in the dark. Following the incubation, the cells were washed twice with 250pl PermWash Buffer at 400g for 3 minutes. Cell pellets were resuspended in 20pl of Stain Buffer (DPBS +2%FBS) or 1% PFA and incubated for 10-15 min at RT and data was acquired on the IQue instrument.eTPC-t genotypingThe eTPC-t were subjected to quality control by genotyping confirmation using Sanger sequencing to confirm integration of the desired TCR chains. Described in detail in the Cell engineering section.Cross-reactivity assayMutagenesis epitope libraries for fingerprintingMutagenesis epitope libraries for the G12V 10-mer peptide and the G12V 9-mer peptides were created by substituting all possible naturally occurring single amino acids at each position within the G12V mutated KRAS 9-mer (WGAVGVGK) and 10-mer (WVGAVGVGK) peptides, Table 21 and Table 22, respectively.Table 21. Mutagenesis epitope library for the 10-mer G12V KRAS peptide.Antigen mutation positionMutation aaAntigen mutationAntigen mutation positionMutation aaAntigen mutation1AV1A6AG6A1CV1C6CG6C1DV1D6DG6D1EV1E6EG6E1FV1F6FG6F1GV1G6HG6H1HV1H6IG6I1IV1I6KG6K1KV1K6LG6L1LV1L6MG6M1MV1M6NG6N1NV1N6PG6P1PV1P6QG6Q1QV1Q6RG6R1RV1R6SG6S1SV1S6TG6T1TV1T6VG6V1WV1W6WG6W1YV1Y6YG6Y2AV2A7AG7A2CV2C7CG7C2DV2D7DG7D2EV2E7EG7E2FV2F7FG7F2GV2G7HG7H2HV2H7IG7I2IV2I7KG7K2KV2K7LG7L2LV2L7MG7M2MV2M7NG7N2NV2N7PG7P2PV2P7QG7Q2QV2Q7RG7R2RV2R7SG7S2SV2S7TG7T2TV2T7VG7V2WV2W7WG7W2YV2Y7YG7Y3AV3A8AV8A3CV3C8CV8C3DV3D8DV8D3EV3E8EV8E3FV3F8FV8F3GV3G8GV8G3HV3H8HV8H3IV3I8IV8I3KV3K8KV8K3LV3L8LV8L3MV3M8MV8M3NV3N8NV8N3PV3P8PV8P3QV3Q8QV8Q3RV3R8RV8R3SV3S8SV8S3TV3T8TV8T3WV3W8WV8W3YV3Y8YV8Y4AG4A9AG9A4CG4C9CG9C4DG4D9DG9D4EG4E9EG9E4FG4F9FG9F4HG4H9HG9H41G4I9IG9I4KG4K9KG9K4LG4L9LG9L4MG4M9MG9M4NG4N9NG9N4PG4P9PG9P4QG4Q9QG9Q4RG4R9RG9R4SG4S9SG9S4TG4T9TG9T4VG4V9VG9V4WG4W9WG9W4YG4Y9YG9Y5CA5C10AK10A5DA5D10CK10C5EA5E10DK10D5FA5F10EK10E5GA5G10FK10F5HA5H10GK10G51A5I10HK10H5KA5K10IK10I5LA5L10LK10L5MA5M10MK10M5NA5N10NK10N5PA5P10PK10P5QA5Q10QK10Q5RA5R10RK10R5SA5S10SK10S5TA5T10TK10T5VA5V10VK10V5WA5W10WK10W5YA5Y10YK10YTable 22. Mutagenesis epitope library for the 9-mer G12V KRAS peptide.Antigen mutation positionMutation aaAntigen mutationAntigen mutation positionMutation aaAntigen mutation1AV1A6AG6A1CV1C6CG6C1DV1D6DG6D1EV1E6EG6E1FV1F6FG6F1GV1G6HG6H1HV1H6IG6I1IV1I6KG6K1KV1K6LG6L1LV1L6MG6M1MV1M6NG6N1NV1N6PG6P1PV1P6QG6Q1QV1Q6RG6R1RV1R6SG6S1SV1S6TG6T1TV1T6VG6V1WV1W6WG6W1YV1Y6YG6Y2AV2A7AV7A2CV2C7CV7C2DV2D7DV7D2EV2E7EV7E2FV2F7FV7F2GV2G7GV7G2HV2H7HV7H21V2I71V7I2KV2K7KV7K2LV2L7LV7L2MV2M7MV7M2NV2N7NV7N2PV2P7PV7P2QV2Q7QV7Q2RV2R7RV7R2SV2S7SV7S2TV2T7TV7T2WV2W7WV7W2YV2Y7YV7Y3AG3A8AG8A3CG3C8CG8C3DG3D8DG8D3EG3E8EG8E3FG3F8FG8F3HG3H8HG8H31G3I81G8I3KG3K8KG8K3LG3L8LG8L3MG3M8MG8M3NG3N8NG8N3PG3P8PG8P3QG3Q8QG8Q3RG3R8RG8R3SG3S8SG8S3TG3T8TG8T3VG3V8VG8V3WG3W8WG8W3YG3Y8YG8Y4CA4C9AK9A4DA4D9CK9C4EA4E9DK9D4FA4F9EK9E4GA4G9FK9F4HA4H9GK9G41A4I9HK9H4KA4K91K9I4LA4L9LK9L4MA4M9MK9M4NA4N9NK9N4PA4P9PK9P4QA4Q9QK9Q4RA4R9RK9R4SA4S9SK9S4TA4T9TK9T4VA4V9VK9V4WA4W9WK9W4YA4Y9YK9Y5AG5A5CG5C5DG5D5EG5E5FG5F5HG5H51G5I5KG5K5LG5L5MG5M5NG5N5PG5P5QG5Q5RG5R5SG5S5TG5T5WG5W5YG5YThe mutated peptides were then used as aAM-ORFs to prepare eAPC-pa cells as described in the cell engineering section.Responder assay was then performed with the TCR candidates as described in the responder assay section.Derivation of Finger print score and identification of cross-reactive candidatesA matrix describing the response data, as percentage of maximal signal (position x amino acid), is converted into a PSSM (position-specific score matrix), using a fixed value multiplier. The PSSM matrix is then systematically aligned to all possible peptides in the human proteome (UniProt), thus identifying all epitope-length peptides where the linear series of residues are all positively scored by the PSSM, irrespective of the intensity of the scoring values per se, and which routinely comprises the base list of potential crossreactivity candidates.To provide a mechanism for relative ranking, the PSSM is converted to a logodds score matrix, applying a PSI-BLAST style pseudo-count (Altschul et al 2009), the positive values of which are used to derive a relative scoring metric for each candidate (referred to as flat score). Candidates are also scored for similarity to the HLA-A*11:01 using a pseudocount-corrected log-odds matrix derived from bulk immunopeptidomics data of eluted peptides from that HLA. The epitope sequence is additionally aligned and scored to all possible peptides within the human proteome using BLASTP “short” E and p-value scores with a BLOSUM62 matrix, so as to identify any additional candidates that may be closely structurally related. The above algorithms are implemented as custom python scripts.Cross-reactivity eAPC-pa Library constructionThe fingerprint score was then screened against the whole human proteome to find matches to these tolerated positions and therefore predict potential cross-reactive hits. According to the fingerprint score, a number of cross-reactive hits were predicted and used to generate the cross-reactivity eAPC-pa library. ORFs of the identified cross-reactive hits were engineered into eAPC-p (HLA-A*11:01 monoallelic cells) by RMCE as described in the cell engineering section. The resulting eAPC-pa cells were then used in the responder assays with the eTPC-t expressing the TCRs.eAPC-p HLA Monoallelic library constructionA library of 86 monoallelic HLA-expressing eAPCs covering the most common HLA haplotypes was generated. The HLAs used to construct the library are summarised in Table 23. The eAPC-p cells were generated by RMCE as described in the cell engineering section.Table 23. A list of HLA haplotypes used in the alloreactivity assay. The HLA sequences were obtained from EBI (https: / / www.ebi.ac.uk / ipd / imgt / hla / ) and the EBI accession numbers are listed under HLA name.HLA-A subtype allelesHLA-B subtype allelesHLA-C subtype allelesHLA-E subtype allelesHLA-A*01:01HLA00001HLA-B*07:02HLA00132HLA-C*01:02HLA00401HLA-E*01:01HLA00934HLA-A*01:02HLA00002HLA-B*07:05HLA00137HLA-C*02:02HLA00404HLA-E*01:03HLA00936HLA-A*01:03HLA00003HLA-B*08:01HLA00146HLA-C*03:03HLA00411HLA-A*02:01HLA00005HLA-B* 13:01HLA00152HLA-C*03:04HLA00413HLA-A*02:02HLA00007HLA-B* 13:02HLA00153HLA-C*04:01HLA00420HLA-A*02:03HLA00008HLA-B*14:01HLA00157HLA-C*05:01HLA00427HLA-A*02:04HLA00009HLA-B*14:02HLA00158HLA-C*06:02HLA00430HLA-A*02:05HLA00010HLA-B* 15:01HLA00162HLA-C*07:01HLA00433HLA-A*02:06HLA00011HLA-B* 15:02HLA00165HLA-C*07:02HLA00434HLA-A*02:07HLA00012HLA-B*15:03HLA00166HLA-C*08:01HLA00445HLA-A*03:01HLA00037HLA-B* 18:01HLA00213HLA-C*08:02HLA00446HLA-A* 11:01HLA00043HLA-B*27:05HLA00225HLA-C*12:02HLA00453HLA-A* 11:02HLA00044HLA-B*35:01HLA00237HLA-C*12:03HLA00455HLA-A* 11:03HLA00045HLA-B*35:02HLA00238HLA-C*14:02HLA00462HLA-A* 11:04HLA00046HLA-B*35:03HLA00239HLA-C* 15:02HLA00467HLA-A* 11:05HLA00047HLA-B*35:05HLA00241HLA-C*16:01HLA00475HLA-A*11:09HLA01310HLA-B*35:08HLA00244HLA-A*23:01HLA00048HLA-B*35:12HLA00249HLA-A*24:02HLA00050HLA-B*37:01HLA00265HLA-A*24:03HLA00053HLA-B*38:01HLA00267HLA-A*24:04HLA00054HLA-B*40:01HLA00291HLA-A*24:07HLA00057HLA-B*40:02HLA00293HLA-A*24:10HLA00060HLA-B*44:02HLA00318HLA-A*24:17HLA00067HLA-B*44:03HLA00319HLA-A*25:01HLA00071HLA-B*49:01HLA00340HLA-A*26:01HLA00073HLA-B*50:01HLA00341HLA-A*29:02HLA00086HLA-B*51:01HLA00344HLA-A*30:01HLA00089HLA-B*51:02HLA00346HLA-A*30:02HLA00090HLA-B*52:01HLA00362HLA-A*31:01HLA00097HLA-B*53:01HLA00364HLA-A*32:01HLA00101HLA-B*54:01HLA00367HLA-A*33:01HLA00104HLA-B*55:01HLA00368HLA-A*33:03HLA00106HLA-B*57:01HLA00381HLA-A*34:02HLA00109HLA-B*58:01HLA00386HLA-A*66:01HLA00112HLA-A*66:02HLA00113HLA-A*68:01HLA00115HLA-A*68:02HLA00117HLA-A*80:01HLA00130Cytotoxic assaysTCR-T cells (effector cells) were generated by directed endonuclease-mediated knock-in of the TCRs (TCR-Ttcr'1, TCR-Ttcr'2, TCR-Ttcr'6, TCR-TTCR'9and TCR-Ttcr'10) into the endogenous TRAC locus and subsequently enriched for successfully edited cells, as described in material and methods, using CD34 microbead kit (Miltenyi Biotec, according to manufacturer’s instructions). Target cells were used in cytotoxity assays with varied effector-to-target (E:T) ratio which involve monoallelic eAPCs constitutively expressing cognate HLA-A*11.01 in combination with antigen KRAS G12V FL, as well as relevant control cell lines expressing HLA-A*11:01 KRAS G12V MG and HLA-A*11:01 (off-target control); or common cancer cell lines natively expressing KRAS G12V or KRAS wt, retrovirally transduced to express HLA-A*11:01. All target cells recombinantly express Firefly Luciferase. Target cells were plated at 10,000 cells (eAPC) or 20,000 cells (cancer lines) per well in a 96-well plate. Adherent cancer cells were left to adhere and TCR-T cells were 2-fold serially diluted to obtain E:T ratios from 1:1 to 1:64. For assessing EDso values of TCR-1, TCR-2, TCR-6, TCR-9 and TCR-10, target cells expressing HLA-A*11:01 were pulsed with varying concentrations of KRAS G12V (Peptides & Elephants) in the range of 0.1 pM-1 pM. Following washing, peptide-pulsed target cells or no peptide control target cells were co-cultured with TCR-T cells at an E:T ratio of 1:4. All test conditions were prepared in duplicates. After 24h of co-culture, target cell killing was assessed via luciferase activity of remaining viable cells in co-cultures compared to target only control wells and calculated as: % killing = 100 - ((RLU test condition) / (RLU target only)*100); RLU = relative luminescence units.CORL23 lung cancer mouse modelAll animal procedures were performed in accordance with the approved Research Institutes of Sweden (RISE) protocol. Female NSG mice (NOD SCID gamma, NOD.Cg-Prkdcscidll2rgtm1 Wjl / SzJ) were purchased from Charles River Laboratories, Germany.The mice were housed in micro-isolator cages under sterile conditions at the RISE facilities at temperature 20-26°C, humidity 40-70% and 12 hour light / 12 hour dark cycle.The NSG (NOD SCID gamma, NOD.Cg-Prkdcscidll2rgtm1Wjl / SzJ) mouse strain is genetically engineered to be severely immunodeficient and is an industry standard for xenograft studies as it enables engraftment and treatment using human cells without rejection (Ito et al 2002; Maletzki et al 2020). Experiments were carried out with n=10 mice per group.Mice were monitored weekly using Bioluminescence imaging (BLI) to measure tumour burden and continuously for well-being to measure overall survival.CORL-L23_A*11 cells were resuspended in Dulbecco's Phosphate-Buffered Saline (DPBS) and 100 pl containing 0.5 x 106 cells was injected for engraftment.Primary CD8+ T cells were prepared in Dulbecco's Phosphate-Buffered Saline (DPBS) as described in the Primary CD8+ T cell isolation, activation and nucleofection section, above. One day before treatment, cryopreserved TCR-T cells TCRtcr'1 and TCRNY'ES0 were thawed and cultured overnight. On the day of treatment TCR-T cells were resuspended in Dulbecco’s Phosphate buffered saline (DPBS) and 100 pl containing 10 x 106 cells injected into the tail vein for engraftment.ReagentsHuman recombinant IL-2 (Miltenyi Biotec) was prepared according to manufacturer’s instructions in Phosphate Buffered Saline (PBS) + 0.1 % human serum albumin to a final concentration of 1.5 x 106 International Unit (IU) / ml.VivoGlo Luciferin (Promega) was prepared according to manufacturer’s instructions in DPBS to a final concentration of 15 mg / ml and injected intraperitoneally prior to tumour imaging.Bioluminescence Imaging Data analysisBioluminescence images (BLI) were analysed using Kuant v2.4 image software (Vilber). BLI intensities were quantified as the background subtracted photon intensity (photons per second per steradian, ph / s / sr) in a consistently sized region of interest drawn around the lungs of each animal. When more than image per group and time-point was available, intensities were averaged. Kaplan-Meyer survival curves were generated to summarize survival across the groups.Incucyte longitudinal live imaging based killing assayThe day prior to co-culture, TCR T cells were thawed and cultured as described above. Additionally, 20 000 GFP expressing target cells in 100 pl cell line culture media were added 5 per well of a poly-D Lysine coated 96wp and left to adhere while imaged every 1 -2h for 22-24h with a 20x objective. Quantification of the GFP+ target cell proliferation at 24h was used to calculate required TCR-T numbers to be added for E:T of 1:16, 1:4 and 1:1 in 100 pl. AnnexinV red staining reagent (Sartorius) was added to the co-culture at a 1:800 dilution. Imaging was continued every 1 -2h for a total of 5 days. Target cells were masked based on 10 phase and intensity in the green channel, while dead and dying cells were masked basedon phase and intensity in the red channel. Quantification was performed as object count per well or a fold-change from the first scan. At each scan 4-9 fields are separately imaged and averaged per assay well.15 Data analysisQuantified Incucyte data was generated using Incucyte software 2022A Rev1 and 2022VB Rev2. Data was graphed using Graphpad Prism version 10.Examples20 The TCR discovery platform described in Figure 1, begins with the identification of HLA-restricted peptides derived from a target of interest (Step 1), which is then used in the TCR discovery (Step 2). Next, is the TCR and Antigen validation step (Step 3) where the platform’s main focus is on delivering an effective and safe (derisked) TCR (Steps 4 and 5). The following examples describe each platform process and the key biological25 discovery of each step as shown in Figure 1.Example 1. Mass Spectrometric identification of G12V mutated KRAS peptides presented by mono-allelic HLA-A*11:01 eAPCs.Herein is described the unbiased HLA-restricted peptide mapping for biologically relevant, 30 processed and presented G12V mutated KRAS peptides, using mass spectrometry (MS) (Figure 2). Antigen presenting cells (eAPC) engineered to express single HLA class I allele (HLA-A*11:01) were generated as described in WO 2018 / 083316. The HLA-A*11:01 open reading frame (ORF) also encoded a C-terminal 6xHistidine tag for capture by metal affinity chromatography as previously described (WO 2018 / 083316). The monoallelic eAPCs were 35 transfected with either a full length (FL) version of inactivated KRAS protein with G12V mutations (G12V_FL) (SEQ ID NO: 6); or a minigene (MG) with the candidate epitope +1-up to 9 amino acids of flanking sequence (G12V_MG-UFD) (SEQ ID NO: 5). Additionally,an orthogonal cell line (COR-L23), that natively expresses G12V mutated KRAS has been lentivirally transduced with affinity-tagged HLA-A*11:01, and was used in the assay.Peptides released from affinity purified HLA-A*11:01 pHLA complexes were measured by unbiased mass spectrometry on a Bruker TIMS-TOF2 instrument. Figure 2 shows the z-scores relative to mean intensity of all observations for the specific observations of 2 peptides derived from the G12V mutated KRAS - the nonamer (9-mer) and decamer (10-mer). In general, the z-score is the intensity of a specific peptide as compared to the intensity of all other peptides in the sample. This means that calculating z-scores takes the raw intensity score of the peptide and subtracts the population mean and the resulting figure is divided by the population standard deviation. Z-scores are calculated from log™ transformed data. Across all three cell lines, 2 epitopes of the G12V mutated KRAS were observable (these two KRAS peptide variants have been shown previously by Bear et al 2021). The z-scores in the G12V FL sample suggest that the G12V mutated KRAS 10-mer is better processed than the G12V mutated KRAS 9-mer peptide (which was detected but not quantified). However, both peptides were detected in the G12V_MG sample and the presence of both was also confirmed in the orthogonal cell line COR-L23.In conclusion, the analysis confirmed 2 processed and presented G12V mutated KRAS peptides restricted to HLA-A*11:01 class I allele.Example 2. Selective expansion of TCR clonotypes specific for identified G12V mutated KRAS peptides.After confirming the existence of the target peptides, the next step is to use the identified mutated KRAS G12V 10-mer and 9-mer peptides to discover TCR clonotypes that specifically bind them (Figure 1 Key platform Unit 2. TCR discovery).To discover G12V mutated KRAS -10-mer-specific TCRs, naive CD8 T cells derived from healthy donor peripheral blood mononuclear cells (PBMCs) were co-cultured with monoallelic engineered antigen presenting cells (eAPCs) constitutively expressing the HLA-A*11:01 in the presence of the 10-mer peptide for 7 days. Therefore, in this experimental set up, naive CD8 T cells expressing a TCR capable of recognizing the KRAS G12V 10-mer peptide loaded and presented by the eAPC were selectively activated. Upon activation, CD8 T cells proliferated and expansion was supported by addition of exogenous interleukin 2 (IL-2) for 7 days. Exapanded CD8 T cells were stained with Major Histocompatibility Complex (MHC) multimer (a PSMA tetramer that contains the KRAS peptide) and magnetically enriched before single cell sorting by fluorescence activated cell sorting (FACS). Alpha beta TCR pairs were sequenced and the frequency of appearance of eachTCR clonotype was counted (Figure 3 A). If a TCR clonotype was observed at least 3 times it was considered enriched.To discover G12V mutated KRAS 9-mer- specific TCRs, the same process as described above for the 10-mer was applied. Briefly naive CD8+ T cells derived from healthy donor peripheral blood mononuclear cells (PBMCs) were co-cultured with monoallelic engineered antigen presenting cells (eAPCs) constitutively expressing the HLA-A*11:01 in the presence of the 9-mer peptide for 7 days. Briefly, naive CD8+ T cells expressing a TCR capable of recognizing the KRAS G12V 9-mer peptide loaded and presented by the eAPC were selectively activated. Upon activation CD8+ T cells proliferated and expansion was supported by addition of exogenous interleukin 2 (IL-2) for 7 days. Exapanded CD8+ T cells were stained with MHC multimer (a Prostate Specific Membrane Antigen (PSMA) derived tetramer that contains the KRAS peptide) and magnetically enriched before single cell sorting by fluorescence activated cell sorting (FACS). Alpha beta TCR pairs were sequenced and the frequency of appearance of each TCR clonotype was counted (Figure 3 B). If a TCR clonotype was counted at least 3 times it was considered enriched.In conclusion, we have successfully expanded and enriched TCR clonotypes that have the capability of recognizing the G12V mutated KRAS 10-mer and 9-mer peptides presented by HLA-A*11:01.Example 3. Validation of sensitivity between the identified G12V mutated KRAS-specific TCRs and HLA-A*11:01-presented G12V mutated KRAS peptidesFollowing the discovery of the peptides derived from the mutated KRAS and the TCRs specific for these peptides, the TCR sensitivity was determined (Figure 1, Step 3).To functionally evaluate the sensitivity of the identified G12V mutated KRAS 10-mer and 9-mer-specific TCRs, cell-cell contact assays with peptide-pulsed eAPCs contacted with TCR-expressing eTPCs (eAPC-p - eTPC-t) were applied as described briefly here. Firstly, the TCRs were expressed into engineered TCR presenting cells (eTPCs) containing a synthetic reporter element that responds to TCRsp engagement as described in WO 2018 / 083317. Briefly, the eTPCs have been engineered to contain a Response element that comprises of a Driver-Activator component and an Amplifier-Report component, wherein both units utilize synthetic promoters. The Driver is a synthetic promoter that is responsive to the native TCR signalling pathways, encoding three sets of tandem transcription factor binding sites for NFAT-AP1-NFkB (3xNF-AP-NB). Upon transcriptional activation, the Driver induces expression of the Activator protein, a synthetic designed transcription factor derived byfusion of the Herpes VP16 activation domain, the GAL4 DNA binding domain and two nuclear localization signals at the N- and C-terminals (NV16G4N), to which the cognate DNA recognition sequence is present 6 times in tandem in the Amplifier promoter. Both the Driver and Amplifier promoters utilize the core promoter sequence (B recognition element (BRE), TATA Box, Initiator (INR) and transcriptional start site) from HCMV IE1 promoter, immediately 3’ of the respective transcription factor binding sites. The Amplifier upon transcriptional activation drives expression of the reporter, red fluorescent protein (RFP). To functionally evaluate the sensitivity of the enriched G12V mKRAS 10-mer or 9-mer specific TCRs, the responder eTPC-ts expressing the G12V mutated KRAS 10-mer or 9-mer -specific TCRs were co-cultured with the monoallelic eAPCs presenting the HLA-A*11:01 that were either unpulsed or pulsed with a concentration gradient of either the G12V mutated KRAS 10-mer peptide, the G12V mutated KRAS 9-mer peptide or the corresponding wild type (WT) peptides. Following the peptide pulsed cell-cell contact assays, the cells were stained with CD3 antibodies and the samples were analysed for CD3 expression and RFP signal using flow cytometry. CD3 downregulation reflects the internalisation of the CD3 / TCR complex following its interaction with its target and is usually associated to the strength of the interaction (avidity). The more sensitive a TCR is the more downregulation in the CD3 should be observed. It is initially a safety mechanism that the T cells have to avoid overactivation and the risk of damaging healthy cells. Stimulation of the TCR / CD3 complex results in RFP expression and CD3 downregulation by the eTPC-t, which is proportional to the strength of activation. The decrease in CD3 in combination with RFP is therefore used as a signal of TCR engagement and activation.As an example, the flow cytometric profile of three representative 10-mer-responsive TCRs is shown in Figure 4 A-C and described below. Figure 4A is a representative of a 10-mer-specific TCR (on Target TCR) that is unpulsed with G12V mutated KRAS 10-mer peptide (left panel) or pulsed with G12V mutated KRAS 10-mer peptide (right panel). The unpulsed eAPC HLA-A*11:01 cells stained high with the CD3 antibody and exhibited low RFP expression. Pulsing of the eAPC HLA-A*11:01 with the G12V mutated KRAS 10-mer peptide, led to increased number of cells with the RFP+CD3|OW signature, thus confirming TCR activation. Figure 4B is a representative of a TCR that reacts with the HLA allele presented on the eAPCs, HLA-A*11:01, regardless of whether the target antigen is present (HLA-reactive). The RFP / CD3 profiles did not change when the cells were pulsed with the G12V mutated KRAS 10-mer, but remained RFP+CD3|OW. Figure 4C is a representative of a TCR that is unresponsive to the mutated G12V 10-mer epitope, the cells have RFP7CD3hl0h signature in both unpulsed (left panel) and pulsed cells (right panel).The flow cytometric data obtained from the peptide pulse assays for all the 10-mer- and 9-mer-responsive TCRs was used to construct sigmoidal curves from which the half maximal effective concentration (EC50) values were obtained. The data from the peptide pulse assays is represented in two ways - Figure 4 which shows that many of the 10-mer- and 9-mer-responsive TCRs identified in the TCR discovery step are sensitive to the G12V mutated KRAS 10-mer or the 9-mer peptides. This is shown by plotting the TCRs against the EC50 - increased sensitivity is shown with EC50 values moving towards the right. The EC50 for TCR-1 and TCR-2 were respectively, 1.26 nM (95% Cl 0.985 to 1.66) and 9.83 nM (95% Cl 8.07 to 11.99). The EC50 of TCR-6 was 16.89 nM (95% Cl 11.23 to 24.65) and the EC50 values of TCR-9 and TCR-10 were respectively, 2.14 nM (95% Cl 1.73 to 2.64) and 5.69 nM (95% Cl 4.87 to 6.60). Many of the identified TCRs showed high sensitivity. Secondly, Figure 5 focuses on the TCRs that showed specificity and the obtained data is presented to demonstrate the sensitivity of the identified TCRs to other peptides (for example sensitivity of the 10-mer-specific TCRs to the 9-mer peptide and vice versa as well as to the wild type KRAS G12 peptide (data presented Figure 5). In Figure 5 the 10-mer TCR, TCR-1, showed high sensitivity when incubated with eAPC HLA-A*11:01 cells pulsed with the G12V mutated KRAS 10-mer peptide (EC50 1.26 nM (95% Cl 0.985 to 1.66)), while the same TCR also showed poor sensitivity when incubated with eAPC HLA-A*11:01 cells pulsed with the G12V mutated KRAS 9-mer peptide (EC50 421 nM (95% Cl 349 to 511)). TCR-1 did not bind the WT G12 KRAS peptide (Figure 5A). The 10-mer TCR, TCR-2, also showed high sensitivity when incubated with eAPC HLA-A*11:01 cells pulsed with the G12V mutated KRAS 10-mer peptide (EC50 9.83 nM (95% Cl 8.07 to 11.99)) but did not bind when incubated with eAPC HLA-A*11:01 cells pulsed with the G12V mutated KRAS 9-mer peptide or the WT G12 KRAS peptide (Figure 5B).The 9-mer TCR, TCR-6, showed high sensitivity when incubated with eAPC HLA-A*11:01 cells pulsed with the G12V mutated KRAS 9-mer peptide, EC50 16.89 (95% Cl 11.23 to 24.65) and detectable but lower sensitivity when incubated with eAPC HLA-A*11:01 cells pulsed with the G12V mutated KRAS 10-mer peptide, EC50 113nM (95% Cl 99.58 to 128.5) and no interaction with the WT G12 KRAS peptide was observed (Figure 5C). TCR-9 showed high sensitivity when incubated with eAPC HLA-A*11:01 cells pulsed with the G12V mutated KRAS 9-mer peptide, EC50 2.14 nM (95% Cl 1.72 to 2.64) and detectable but lower sensitivity when incubated with eAPC HLA-A*11:01 cells pulsed with the G12V mutated KRAS 10-mer peptide, EC50 48.12 nM (95% Cl 41.35 to 55.98) and nosubstantial interaction with the WT G12 KRAS peptide was observed EC50 1506 nM (95% Cl 1302 to 1741) (Figure 5D). TCR-10 showed high sensitivity when incubated with eAPC HLA-A*11:01 cells pulsed with the G12V mutated KRAS 9-mer peptide, EC50 5.69 nM (95% Cl 4.87 to 6.60) and detectable but lower sensitivity when incubated with eAPC HLA-A*11:01cells pulsed with the G12V mutated KRAS 10-mer peptide, EC50 171 nM (95% Cl 157.7 to 185.5) and no interaction with the WT G12 KRAS peptide was observed (Figure 5E). A reference TCR (SEQ ID NO: 5164) showed sensitivity towards eAPC HLA-A*11:01 cells pulsed with the G12V mutated KRAS 10-mer peptide (EC50 2.1 nM (95% Cl 1.840 to 2.397) (Full circle), while the same TCR failed to bind the eAPC HLA-A*11:01 cells pulsed with the G12V mutated KRAS 9-mer peptide (Full triangle) or the WT G12 KRAS peptide (Full square) (Figure 5F).Next, to further validate the interaction between the G12V mutated KRAS 10-mer- and 9-mer-responsive TCRs and the mutated KRAS peptides, an assay was performed to look for a response when the target peptide is endogenously expressed and presented by the antigen presenting cells, Figures 6. Therefore, monoallelic HLA-A*11:01 eAPCs or the monoallelic HLA-A*11:01 eAPC line constitutively expressing the G12V mutated KRAS peptide either as a minigene (MG) (SEQ ID NO: 5) or as a full-length peptide (FL) (SEQ ID NO: 6) were co-cultured with responder eTPC-ts expressing the G12V mutated KRAS 10-mer-responsive TCRs (Figure 6A) or the G12V mutated KRAS 9-mer-responsive TCRs (Figure 6B). The response of eTPC-t responder cells was measured by RFP signaling in combination with CD3 downregulation (RFP+CD3|OW).A partial response of the responder cells expressing the G12V mutated KRAS 10-mer-responsive TCRs after incubation with the eAPC HLA-A*11:01 expressing the (SEQ ID6) was observed compared to the eAPC HLA-A*11:01 expressing the SEQ ID 5 where we see a large gradient in the response (Figure 6A). This is expected as the use of the MG creates a more sensitive system because of the shorter sequence. Also higher intensity detection of the peptides in the MS data is observed (Figure 2). Only a subset responded to the eAPC-HLA-A*11:01 loaded with SEQ ID NO: 6 in RFP+CD3|OW measurements, compared to the cells loaded with the SEQ ID NO: 5. Similarly, a partial response of the responder cells expressing the G12V mutated KRAS 9-mer-responsive TCRs after incubation with the eAPC HLA-A*11:01 expressing the (SEQ ID NO: 6) was observed compared to the eAPC HLA-A*11:01 expressing the SEQ ID NO: 5 (Figure 6B). However importantly, the TCRs identified in the peptide pulse sensitivity assays were also detected in this experiment and are marked retrospectively.In conclusion, several G12V mutated KRAS sensitive 10-mer- and 9-mer-responsive TCRs were identified. Furthermore, the TCR - antigen functional validation step within the platform demonstrated that the selected TCRs mediate functional activation by peptidepulse of mutated KRAS G12V in the context of HLA-A 11:01 but did not mediate functional activation by the WT KRAS peptide.Example 4: The G12V mutated KRAS specific TCRs mediate potent T cell killing of cells presenting the G12V mutated KRAS peptide in the HLA-A*11:01 contextAs part of the TCR de-risking process, the cytotoxic potency of the G12V mutated KRAS 10-mer- and 9-mer-specific TCRs was analysed by using primary T cells transduced with the TCRs (TCR-Ttcr'1, TCR-Ttcr'2, TCR-Ttcr'6, TCR-Ttcr'9 and TCR-Ttcr'10), co-cultured with luciferase-expressing eAPCs and the ONE-Glo Luciferase Assay System (Promega) according manufacturer's instructions. The cytotoxic potency of the primary T cells transduced with the TCR-1 was also assessed on a panel of cancer cell lines expressing the KRAS G12V mutation within the HLA:A*11:01 contextTCR-T cells (effector cells) were generated by directed endonuclease-mediated knock-in of the TCRs (TCR-Ttcr'1, TCR-Ttcr'2, TCR-Ttcr'6, TCR-TTCR'9and TCR-Ttcr'10) into the endogenous TRAC locus and subsequently enriched for successfully edited cells, as described in material and methods, using CD34 microbead kit (Miltenyi Biotec, according to manufacturer’s instructions). Monoallelic eAPCs (Target cells, ARH-77) constitutively expressing HLA-A*11.01 in combination with endogenously expressing G12V mutated KRAS full length (FL) peptide, as well as relevant control cell lines expressing HLA-A*11:01 G12V mutated KRAS minigene (MG) peptide and HLA-A*11:01 only (off-target control), were used in cytotoxity assays with variation in effector-to-target (E:T) ratio. For variation in E:T ratio, target cells were plated at 10,000 per well in a 96-well plate and TCR-T cells were 2-fold serially diluted to obtain E:T ratios of 1:1 to 1:64. For assessing EC50 values of TCR-1, TCR-2, TCR-6, TCR-9 and TCR-10, target cells expressing HLA-A*11:01 were pulsed with varying concentrations of G12V mutated KRAS 7-16 peptide (Peptides &Elephants) in the range of 0.1pM-1pM. Upon thorough washing, peptide-pulsed target cells or no peptide control target cells were co-cultured with TCR-T cells at an E:T ratio of 1:4. All test conditions were prepared in duplicates. After 24h of co-culture, target cell killing was assessed via luciferase activity of remaining viable cells in cocultures compared to target only control wells and calculated as: % killing = 100 - ((RLU test condition) / (RLU target only)*100); RLU = relative luminescence units.Rapid apoptotic death of the target cells was induced by TCR-T cells expressing the TCR-1 against the target cells expressing the KRAS FL (SEQ ID NO: 6), KRAS MG-UFD (SEQ ID NO: 5) (Figure 7A). Weaker cytotoxic activity of the TCR-Ttcr'1 towards target cells expressing KRAS MG-native construct (SEQ ID NO: 179) (Figure 7 A, right panel). Additionally, absence of killing of off-target eAPC expressing HLA-A*11:01 confirms theabsence of overt off-target reactivity.TCR-T cells expressing the TCR-2 (TCR-Ttcr‘2) also showed similar toxicity towards cells expressing the KRAS MG-native construct (SEQ ID NO: 179) or KRAS FL (SEQ ID NO: 6) (Figure 7B). No significant off-target lysis of cells expressing only the HLA-A*11:01 was observed. TCR-T cells expressing the 9-mer specific TCRs (TCR-Ttcr'6, TCR-TTCR'9and TCR-Ttcr'10), also showed similar toxicity towards target cells expressing the KRAS MG-UFD (SEQ ID NO: 5) or KRAS FL (SEQ ID NO: 6) (Figure 7D and E). No significant off-target lysis of cells expressing only the HLA-A*11:01 was observed.The cytotoxic killing potential of the effector TCR-Ttcr'1 cells on a panel of cancer cell lines (Figure 7 F-H). Using immortalized cell lines from public domain collections, a set of model lines that are known to natively express KRAS G12V and have a gradient of HLA-A*11:01 surface density was generated. The cell lines expressing KRAS G12V or KRASwt as negative controls, were transduced to express HLA-A*11:01 as well as Firefly luciferase and nuclear localizing green fluorescent protein (GFP) to support luciferase and real-time imaging based killing assays, respectively. The cell lines have HLA-A*11:01 surface median flourescent intensities (MFI)s from 39 503 (COR-L23_A11) to 491 (QGP-1_A11) covering an almost 100-fold range as measured by flow cytometry (Table 24). KRAS expression levels were measured using digital droplet polymerase chain reaction (ddPCR) and with the exception of COR-L23_A11 are largely consistent across the cell lines.Table 24. Characteristics of cancer lines used in cytotoxicity assaysCOR-123_A11NCI-H44LA11SW6?0_AHQGP-1 AllIGR 1 AllKRAS MatG12VG12VG12VG12Vwild typeKRAS expression*225583HLA-A11 density4139 50311 5939 540'491'18 151aKRAS expression relative to the housekeeping gene TATA-box binding protein (TBP) bHLA-A*11 surface density is the median fluorescence intensity (MFI) established by antibody staining and flow cytometry.cSW620 and QGP-1 are also positive for HLA-A*24:02, which is cross-recognized by the antiHLA-A* antibody and used to establish the HLA-A*11 MFI therefore possibly overestimated.F) Luciferase activity-based cell-cell killing assays. Firefly luciferase enzymatically converts in an ATP-dependent reaction chromogenic luciferin to oxyluciferin emitting luminescence that can be sensitively and efficiently measured using a plate-based spectrophotometer. Firefly luciferase when ectopically expressed in cells is highlysensitive and specifically measures cell viability as its protein levels and enzymatic activity rapidly declines in non-viable cells and when exposed to most cell culture media (Coombe et al, 1998). Cytotoxicity assays were performed by luciferase activity readout after a 24h co-culture of TCR-T and target cancer cell lines at varying T:E (16:1,4:1 and 1:1) ratios compared to cancer cell line expressing KRASwt. The target cell killing was assessed via luciferase activity of remaining viable cells in co-cultures compared to target only control wells and calculated as: % killing = 100 - ((RLU test condition) / (RLU target only)*100); RLU = relative luminescence units. Very strong killing of all cancer lines across varying KRAS expression levels covering almost 100-fold decrease in HLA-A*11 surface levels was observed. Killing was near-complete atT:E of 1:1 but was also notably strong atT:E of 4:1 with signs of killing observed even at T:E ratios of 16:1, without any indication of killing of the IGR-1_A11 control line expressing KRASwt or IGR-1_A11 only cell line. The results confirmed that the cytotoxic activity of the TCR-Ttcfm cells is potent enough to deliver strong killing of cell lines derived from cancers that natively express KRAS G12V. G) Incucyte longitudinal live imaging based killing assay was used to gain additional insight into the cytotoxic killing capacity of TCR-Ttcr'1 cells during prolonged co-culture. The Incucyte platform delivers images from TCR-Ttcfm: target cell co-cultures at set intervals over extended culture periods and is commonly used for real-time quantification of target cell number and death (Lanigan et al, 2020). Expression of nuclear localized GFP by viable target cells was used to measure loss of the target cells through quantification of green objects as well as dead and dying cells following staining with AnnexinV (red objects). The longitudinal assay provides insides into sustained target cell killing and progressive target cell loss at low E:T ratios. The established set of cancer cell lines was measured at E:T ratios of 1:1, 1:4 and 1:16 with TCR-Ttcr-1. Target cell loss was quantified as the fold-change of GFP+ positive objects from the first imaging. Effector TCR-Ttcr'1 cells were added 24 hours after seeding of the target cancer cells (dashed line). Change in the GFP expression was the strongest at E:T 1:1 resulting in complete killing already at 24 hours after effector cell addition across all cancer cell lines. Evident effect was observed at the other E:T ratios (1:4 and 1:16). Cultures without the addition of the effector cells showed continued growth. IGR-1_A11 cells that do not express mutated KRAS G12V showed continued growth even in the presence of the TCR-Ttcr'1 cells. H) To gain additional insight into the mechanism behind the observed target cell killing, apoptotic dead and dying cells were quantified through analysis of the AnnexinV staining and compared to the GFP+ target cell count at 1:16 E:T ratio generated at 2, 48 and 96 hours after addition of the TCR-Ttcr'1 cells. The analysis clearly shows that the loss of GFP+ target cells is accompanied by a strong increase in AnnexinV positive objects. This demonstrates that target cell loss is accompanied by cell death and a majority of cells die through apoptosis, as expected for cytotoxic T-cell activity (Cassioli et al, 2022).In conclusion, potent and selective toxicity of primary T cells expressing TCR-1 against cells presenting the G12V mutated KRAS peptides, in HLA-A*11:01 was observed. While target cells expressing the wild type KRAS or the wild type KRAS presented in HLA-A*11:01 were not killed by the TCR-Ttcr'1 demonstrating no overt off-target reactivities.Example 5. Cross-reactive and allo-reactive profiling of G12V mutated KRAS TCRs.The TCRs that passed the functional evaluation sensitivity tests were next triaged into assays that determined their safety profile and ultimately end up with de-risked TCRs (Figure 1, Step 5). The first step in the safety assessment, the G12V mutated KRAS 10-mer and 9-mer TCRs undergo profiling for fingerprinting (Figure 8). The present example shows the fingerprinting of G12V mutated KRAS 10-mer and 9-mer TCRs using positional scanning peptide matrix. Two peptide libraries, containing all possible naturally occurring single amino acids at each position within the G12V mutated KRAS 9-mer (WGAVGVGK) and 10-mer (WVGAVGVGK) peptides, were created (the Epitope Mutagenesis Library ). Each library peptide was then engineered into eAPC to generate a library of monoallelic HLA-A*11:01 eAPCs stably expressing the mutated version of the KRAS epitope. The eAPC cells were then co-cultured for 18 hours with TCR-Ts expressing TCRs (either TCR-1, TCR-2, TCR-6, TCR-9 or TCR-10). Activation of the responder cells was measured by RFP signal in combination with CD3 downregulation, using flow cytometry. The results were then plotted as a fingerprint profile, wherein the ”y-axis” represents the amino acid substitutionsand the ”x-axis” the position where it each substitution has been introduced. The darker the colour, the higher the response due to that particular amino acid substitution in the epitope sequence. In this example, fingerprint profiles of the 5 are presented (Figure 8 A-E), included is also a fingerprint profile of a failed TCR, TCR-5 (Figure 8D). The fingerprint profiles demonstrate that the TCRs are unique in their ability to recognize the target peptide and reveal where tolerances are in that TCR-target peptide engagement. Based on these tolerances, a computer algorithm was generated and used to obtain a fingerprint score. The fingerprint score is then screened against the whole human proteome to find matches to these tolerated positions and therefore predict potential cross-reactive hits (Figure 9 A and C). According to the fingerprint score, a number of cross-reactive hits were predicted for TCR-1 but no cross-reactive hits were predicted for TCR-2 (Figure 9A). Two less sensitive TCRs, TCR-3 and TCR-4, were included as a comparison in the prediction assay and both showed predicted cross-reactive hits. The sequences from the predicted cross-reactive hits were then used to create minigene (MG) constructs that were introduced into the monoallelic HLA-A*11:01 eAPCs. Subsequently, the cells were co-cultured with the eTPC-t responder cells expressing the TCRs, TCR-1 and TCR-2 or the TCR-3 and TCR-4. To assess the crossreactivity potential of the TCRs, the activation of the eTPC-t responder cells was measured by flow cytometry following the co-culture. A threshold of 4% was applied as a cut off for cross-reactivity and anything above this threshold was considered unsafe for clinical use. Even though TCR-1 showed a number of predicted cross-reactive hits, the cross-reactivity assay has confirmed high specificity and no cross-reactive hits for either of the 10-mer responsive TCRs. TCR-3 and TCR-4 have shown some cross-reactivity based on the predicted hits (Figure 9B).Both, prediction of cross-reactive hits based on the Fingerprint score as well as the crossreactivity assay were performed also for the 9-mer-responsive TCRs, TCR-6, TCR-9 and TCR-10. A number of cross-reactive hits were predicted for TCR-9 and 1 hit was predicted for TCR-10 (Figure 9C), however following the cross-reactivity cell-cell contact assay all three 9-mer specific TCRs were confirmed to be derisked (safe) and non-cross-reactive (Figure 9D).As part of the safety profile, allo-reactivity and para-reactivity were determined for the remaining TCRs (Figure 10). Here, the responder eTPC-ts expressing either the 10-mer-or the 9-mer-responsive TCRs were co-cultured for 18 hours with a library of monoallelic HLA-expressing eAPCs covering the most common HLA haplotypes. The response was measured by flow cytometry by detection of RFP expression and reduction in CD3 signal (RFP+CD3|OW). TCR-1, showed no allo-reactivity. After pulsing the HLA eAPC library with the G12V mutated KRAS peptide, peptide-specific activation (para-reactivity) via several members of the HLA-A*11 supergroup was observed and to some extent activation through the HLA-A*30:01. TCR-2 was slightly allo-reactive with HLA-A*68:02. Parareactivity was observed following peptide pulse assay with the G12V mutated KRAS with fewer members of the HLA-A*11 supergroup, HLA-A*30.01 and to some extent HLA-A*A68:01. Regarding the allo-reactivity of the 9-mer-specific TCRs (Figure 10 B-C), TCR-6 was weakly allo-reactive with HLA-B*54:01 and para-reactive with members of the HLA-A11 supergroup and to some extent with HLA-B*54:01. TCR-9 was allo-reactive with HLA-B*35:01, HLA-B*35:02, HLA-B*35:03, HLA-B*35:12, HLA-B*57:01 and HLA-B*58:01.Para-reactivity was observed following peptide pulse assay with the G12V mutated KRAS with fewer members of the HLA-A*11 supergroup, HLA-B*35:01, HLA-B*35:02, HLA-B*35:03, HLA-B*35:05 and HLA-B*35:12 and HLA-B*52:01, HLA-B*53:01, HLA-B*57:01, HLA-B*58:01. TCR-10 was not allo-reactive and para-reactive with members of the HLA-A11 supergroup. The allo-reactivity and para-reactivity results are summarized in Table 25 below.Table 25.TCR-IDRecognition(Alloreactivity) "off-HLA"Specific recognition (Parareactivity) on-target -off-H LA"TCR-1NDAAM1:01, AM 1:02, AM1:03, AM1:04, AM1:05,AM 1:09; A*30:01TCR-2A*68:02AM 1:01, AM 1:02, AM 1:05, AM 1:09, A*30:01,A*68:02TCR-6B*54:01AM1:01, AM 1:02, AM1:04, AM1:05, AM1:09;B*54:01TCR-9B*35:01, B*35:02, B*35:03,B*35:12, B*57:01, B*58:01AM1:01, AM 1:02, AM1:05, A*11:09; B*35:01, B*35:02, B*35:03, B*35:05, B*35:12, B*52:01, B*53:01, B*57:01, B*58:01TCR-10NDAAM 1:01, AM 1:02, AM 1:05, AM 1:09ANotdetectedIn conclusion, we have identified and validated G12V mutated KRAS 10-mer- and 9-mer-specific TCRs, with no identified cross-reactive hits and a defined set of potential allo-reactive HLA alleles. With the knowledge gained from the HLA allo-reactivity assays it is possible to proactively mitigate clinical risks and further tailor the use of the validated TCRs during clinical trials depending on the HLA profile of each patient.Example 6. Integration of TCR-1 into primary T cells leads to eradication of KRAS G12V positive tumour cells in an in vivo efficacy modelAn in vivo mouse study was conducted to confirm efficacy of TCR-1 transduced T-cells (TCR-Ttcfm) against KRAS G12V positive tumour cells. Human lung cancer cells (COR-L23) positive for human G12V KRAS mutation were retrovirally transduced to express HLA-A*11:01 and firefly luciferase (CORL-L23_A.11). All cells were prepared as described in Materials and Methods. The CORL-L23 A.11 cells were injected intravenously into the tail vein and engraftment was confirmed 3 days later using Bioluminisence imaging (BLI) and mice were allocated into treatment groups to ensure equal distribution of tumour burden in the lungs across the treatment groups (n=10 mice per group). Upon confirmed engraftment, mice were treated with either 10 million TCR-Ttcr-1 or a control TCR (TCR-TNY'ESO)to control for unspecific activity of the donor CD8+ T cells. The control TCR-T cells were generated through the introduction of an irrelevant TCR recognizing an epitope from New York Esophageal squamous cell carcinoma 1 (NY-ESO 1) presented on HLA-A*02:01 into T cells from the same donor. Both TCR-T treatedgroups were compared to an untreated group. Use of the luciferase expressing CORL-L23_A.11 cells enables non-invasive measurements of the tumour burden using in vivo bioluminescence imaging (BLI). Expected treatment efficacy would manifest in rapid and sustained reduction of tumour burden as well as an increase in overall survival (Bear et al. 2021, Wang et al 2016). Tumour burden was monitored for 9 weeks using BLI and mice were sacrificed when showing signs of suffering. Mice treated with TCR-Ttcr'1 displayed complete tumour eradication already at day 7 after treatment confirming the high potency of the TCR-Ttcr'1 cells. Analysis of the tumour burden for nine weeks after treatment revealed sustained tumour eradication with no signs of tumour recurrence. In contrast, untreated and TCR-TNY'ES0 treated groups, showed a markedly increased tumour burden with time and a high mortality rate, while no adverse effects were observed as a result of the TCR-T treatment.In conclusion, we have demonstrated that TCR-T cells expressing the TCR-1 effectively exert their cytotoxic activity in vivo, resulting in sustained and specific tumour clearance of a cancer model natively expressing the KRAS G12V mutation. Tumour clearance was sustained for nine weeks after treatment, while the control groups experienced progressive increase in tumour burden and mortality.Example 7. Diversification and selection of TRA and TRB CDR3 regions of TCR-1. The diversification and selection of TCR ORFs is desirable to engineer TCR’s chain pairs with altered sensitivities, affinities and / or specificities. The TCR ORF Reconstitution and Engineering system 2 (TORES2) (described in WO2019016175) was developed for rapid generation of collections of TCR chains that are systematically altered from the original target sequence. To identify variants with comparable RFP+CD3|OW responses to the TCR-1, the CDR3 regions of TCR-1 were diversified as described in this example.CDR3 nucleotide sequences from T cell receptor alpha (TRA) chain and T cell receptor beta (TRB) chain of a parental TCR (TCR-1) were used as base sequences to generate the diversified combinatorial TRA or TRB libraries. A combination of two degenerate codons containing mixed nucleotide bases (as shown in Table 26) was substituted into the sequences encoding the CDR3 from TRA or TRB of parental TCR-1, so that the sequences were translated into an amino acid sequence that may contain one to two amino acids distinct from the parental TCR-1 CDR3 amino acid sequence. Due to high conservation of cysteine (C) and phenylalanine (F) at the beginning and end of the CDR3 respectively, the degenerate codons containing mixed bases can only be introduced in the positions between the first (C+1 - the first amino acid after the cysteine) and last codon(F-1- the first amino acid before the phenylalanine) of CDR3. The positions selected for diversification are inside the CDR3 range C+1 and F-1 and this diverisifcation generates a combinatorial library with repeats.5 In the current example, the generation of combinatorial library of TRA or TRB CDR3 regionsutilized the degenerate codons NAS, WKK, NCC and SKG. These codons use standard mixed bases designated using the International Union of Biochemistry (IUB) code and the expected translated amino acids are described in Table 26. Thus, each oligo is produced with one or two codon mix bases in the positions discussed, so that all10 possible codon triplets are provided for each mix base and all positions between C+1 and F-1 are represented by all possible codons. Table 24 shows all 24 available codons that are represented by the degenerate codons NAS; WKK, NCC, and SKG:Table 26: Standard mixed bases designated using the International Union of Biochemistry 15 (IUB) code and the expected translated amino acids used for the diversification of TRA and TRB CDR3 sequencesCodon Mix basesCodon■j|™NASGACDNASGAGENASCACHNASAAGKNASAACNNASCAGQNASTAGStopNASTACYNCCGCCANCCCCCPNCCTCCSNCCACCTSKGGGGGSKGCTGLSKGCGGRSKGGTGVWKKTGTCWKKTTTFWKKATT1WKKTTGLWKKATGMWKKAGGRWKKAGTSWKKTGGWTotal codons24In the CDR3 TRA and CDR3 TRB of parental TCR-1 the amino acids between C+3 (the third amino acid after the cysteine) and F-2 (the second amino acid before the phenylalanine) were diversified and resulted in diversification of 9 and 10 amino acid residues with an expected number of 20,568 and 25,086 nucleotide variants, respectively.Apart from the introduction of degenerate codons with mixed bases into the sequences encoding CDR3, the general design of the oligonucleotide duplex encoding CDR3 (odeCDR3) for TRA and TRB follows previously described specifications (WO2019016175). The odeCDR3 is designed to be flanked by two single stranded 4-nucleotide DNA overhangs, overhang on the 5’ end (t1-5’) and a overhang on the 3’ end ($1-3’). The overhangs are designed to permit directed ligase dependent cloning to the 3’ end of the TCR variable (V) segment encoded in the entry vector (Overhang $1-5’) and the 5’ end of the TCR joining (J) (Overhang $2-3’) fragment during reconstitution, as described in Materials and Methods). The complementary forward and reverse strand of oligonucleotides encoding CDR3 are designed and ordered as separated oligonucleotide pools.Production of combinatorial TCR plasmid libraries combined with TCR ORF Reconstitution and Engineering SystemThe assembly of oligonucleotide duplex encoding CDR3 (odeCDR3) and consecutive TCR reconstitution using TORES2 follows previously described specifications (described in WO2019016175). Briefly, the forward and reverse oligonucleotide pools encoding CDR3 of TRA or TRB were combined in a single tube in addition to T4 polynucleotide kinase and respective buffer containing ATP. By incubating this reaction at 37 °C for 30 min the forward and reverse sequences anneal and 5’ position of each oligonucleotide is phosphorylated to allow future ligation. This product was used for cyclic restriction enzyme digestion and ligation cloning to generate the plasmids containing a library of diversified CDR3 at TRA or TRB of TCR-1.The reconstitution of the combinatorial TCR libraries starts by producing a pool of plasmids containing a single TCR chain (TRA or TRB) and diversified odeCDR3. For such, the diversified odeCDR3 pool were combined in a single reaction with donor vector containing joining (J) gene segments equal to the parental TCR-1 and an entry vector containing variable and constant (V-C) gene segments equal to the parental TCR-1. In this reaction, a type IIS restriction enzyme (Bsal) was added to cleave the entry and donor vectors by recognizing the sequence 5'-GGTCTC(N1 ) / (N5)-3' and generate 4 nucleotide overhangs. The compatibility of the overhangs allows the assembly of odeCDR3 and J-fragment in the donor in the order V-odeCDR3-J-C that were ligated by adding T4 DNA ligase. For such the reaction mix was incubated for 4 min at 37 °C and 5 min at 16 °C that repeats for 30 cycles. After the 30 cycles, the T4 DNA ligase was deactivated at 80 °C and a negative selection performed by adding restriction enzyme Not I that cleaves byproducts by recognizing the sequence 5-GCGGCCGC. This product generates library of plasmids containing diversified TRA or TRB chain and is used for transformation of electrocompetent E. coli.The diversified single chains (TRA or TRB) were electroporated into Electrocompetent E. co / / (NEB® 10-beta, cat: C3019, New England Biolabs) using MicroPulser Electroporator (Bio-rad). The transformed cells were resuspended in stable outgrowth medium (NEB) and incubated for 1h at 37 °C under rotation and absence of antibiotics. Once finalized the recovery phase, the cells were transferred to lysogeny broth (LB) containing 100 pg / mL carbenicillin and incubated for 4h at 37 °C under rotation. To increase the yield of plasmid, the cells were washed in LB and transferred to a new flask containing twice the concentration of carbenicillin (200 pg / mL) and incubated overnight at 25 °C under rotation. The cells were kept in culture for an additional day or until optical density at 600 nm (OD600) above 2.0 was reached when measured using cell density meter and then harvested for plasmid extraction using the Plasmid Maxi Kit (cat: 12963, QIAGEN) following the manufacturer instructions. The extracted plasmids were quantified and validated through genotyping via sanger sequencing and diagnostic digest using set of restriction enzymes.Using the single chain-encoding plasmids described above, plasmids containing full TCR chain pair sequence were produced wherein one of the chains (TRA or TRB) contained none, one, or two mutations in the CDR3 region, and the complementing chain (TRA or TRB) is identical to the parental TCR-1 sequence. Plasmids that have a diversified CDR3 in the alpha chain (Alpha library) were produced by combining in a single reaction the TRA (TCR entry vector) containing variants at CDR3, the TRB (TCR donor vector) with asequence from the parental TCR and a bi-directional terminator vector. Plasmids that have a diversified CDR3 in the beta chain (Beta library) were produced by combining in a single reaction the TRA (TCR entry vector) with sequence from the parental TCR, the TRB (TCR donor vector) containing variants at CDR3 and a bi-directional terminator vector. In these reactions, a type IIS restriction enzyme (Esp3l) was added to cleave the entry and donor vectors by recognizing the sequence 5'-CGTCTC(N1) / (N5)-3'and generate 4 nucleotide overhangs. The compatibility of the overhangs allows the assembly of TRB and bi-directional terminator vector in the donor vector that were ligated by adding T4 DNA ligase, the reaction mix was incubated for 4 min at 37 °C and 5 min at 16 °C that repeats for 30 cycles. After the 30 cycles, the T4 DNA ligase was deactivated at 80 °C and a negative selection performed by adding restriction enzymes Sall, Mlul and Notl which cleave plasmids that do not contain the full TCR sequence by recognizing the restriction enzyme site sequences 5-GTCGAC, 5'-ACGCGT and 5-GCGGCCGC, respectively. This product generates a library of plasmids each containing a TCR chain pairs in which one of the TRA or TRB chains is diversified,and therefore each individual plasmid represents a single TCR variant. This plasmid product is used for transformation of electrocompetent E. coli following the protocol described above, and plasmids extraction using Plasmid Maxi Kit (QIAGEN).To validate the final plasmid products, a small sample of the plasmids are submitted to sanger sequence where the nucleotide sequence of TCR is confirmed. Aditionally, a small sample of the plasmids were digested using a pool of restriction enzymes and the digestion profile visualized in agarose gel under UV light.Production of diversified TCR cell libraries (dTCL)The cell libraries were generated through the delivery and integration of diversified TCR plasmid libraries into Jurkat cell line ETR-21 containing the RFP responder unit. The cell production follows previously described specifications (WO 2018 083317). Briefly, the plasmid pool was combined with 5 million Jurkat cells and a vector containing the recombinase flippase. Cells were then electroporated using the Gene Pulser Xcell System (Bio-rad). The transient expression of flippase enzyme in the transfected cells allows for the integration of sequences encoding TCR chain pairs at FRT-F3 sites. Integration can be detected by absence of BFP or GFP marker (i.e., receiver site selection marker) expression and presence of surface expression of CD3 and TCR. The transfected cells were cultured in RPMI 1640 supplied with 10% fetal bovine serum and expanded for 7 days. The integration efficiency was evaluated using flow cytometry using anti-human CD3 and anti-human TCR antibodies. The cell lines with successful integration of TCR were enriched using magnetic cell separation (MACS) wherein cells expressing CD3 (CD3+) or TCR (TCR+) were enriched using positive selection. The expansion andenrichment process were repeated until each pool of cells (cell library) reached a purity (TCR+BFP‘ or TCR+GFP") above 80%. The final output of the workflow is a diversified polyclonal pool of TCR presenting cells (eTPC-t) with a collection of diversified TCR chains (TRA or TRB), in which, each individual cell expresses a single TCR variant. For each parental TCR, two libraries are generated containing mutations on alpha and beta chain and are used for further characterization through cellular assays.Screening responder assay and sorting of responder variantsTo evaluate whether specific mutations in the CDR3 of the TRA or TRB chain are beneficial for specific and sensitive recognition of mutated G12V KRAS 10 mer peptide, each polyclonal pool of eTPC-t were co-cultured with monoallelic engineered antigen presenting cells (eAPC) eAPC HLA-A*11:01 presenting the peptide(s) in an assay corresponding to the responder assay. The pool of eTPC-ts was incubated with eAPCs at a ratio of 1:2 (final cell confluency 0.5 million cells / mL). To ensure that each TCR variant is represented more than fifty times in the assay, this assay was set-up in large vessel (cell culture flask T-75). This co-culture was incubated overnight to allow the interaction of each eTPC-t cell with eAPCs resulting in an increase of intracellular RFP fluorescence in case of successful TCR activation. On the following day, this co-culture was stained with anti-CD3, anti-CD8 and anti-CD80 antibodies to allow the distinction between eAPCs, unaffected eTPC-t and eTPC-t with downregulated CD3. The responding variants were identified by expression of RFP and downregulation of CD3. Therefore, the responding TCR population was gated (RFP+CD3|OW) and isolated using bulk sorting strategy using a BDInflux instrument (Figure 12). The responding variants were bulk sorted and frozen as cell pellets until subsequent processing.Library Preparation & Next Generation Sequencing (NGS)Genomic DNA was extracted from the diversified TCR cell library (original libraries before a responder assay) and respective bulk sorted population (responder variants after a responder assay) using quick-DNA plus kit (cat:. D4070 / D4074 / D4068, Zymo research) following the manufacturer instructions. After DNA quantification, the diversified TCR cell library and respective bulk sorted population were subjected to an amplification process targeting solely the sequences encoding the diversified chains. For such, forward and reverse primers binding theC-region and V-region of TRA or TRB were used, respectively. An amplification product size of 150 to 200 bp was expected. The Phusion plus DNA polymerase (Cat. F630, Thermo Fisher Scientific) was used for this amplification following the protocol provided by the manufacturer. The Polymerase Chain Reaction (PCR) products were purified using DNA clean & concentrator kit (Zymo research) according to specification from manufacturer. After purification, the PCR products were quantified usingQubit and nanodrop, and the presence of expected band (PCR product size) visualized via product loading at agarose gel. The products were submitted for amplicon sequencing using Illumina through an external service provider (Eurofins genomics). In this system, 5M paired reads are measured per sample.Table 27 - List of primers used for library preparation of KRAS G12V libraries - Parental TCR-1 - and combinatorial libraries alpha TRA and beta TRBTCRIDConditionForward sequenceReverse sequenceSEQIDNO: 167SEQ ID NO: 168Whole libraryTATCATGCAGAGTCTCTCAGCTCAACTTCACCATCACAGCCGGTACACGTCACAAGTCRFP+CD3SEQ ID NO: 170R-1Low eAPCSEQ ID NO: 169CAACTTCACCATCACAGCCTRAKRAS WTATCTGCGTACAGTCTCTCAGCTTCACAAGCDMGGGTACACGR3RFP+CD3SEQ ID NO: 172libraLow eAPCSEQ ID NO: 171CAACTTCACCATCACAGCCryG12VATGCTTCCTAAGTCTCTCAGCTTCACAAGKRASGGTACACGMGSEQ ID NO: 173SEQ ID NO: 174Whole libraryGCTGACCTGAATGGCTCAAACATCTGAGCTGAATGTGAACGCAGCGACCCCTTGTCRFP+CD3SEQ ID NO: 176R-1Low eAPCSEQ ID NO: 175TCTGAGCTGAATGTGAACGTRBKRAS WTCGACGTAGTCATGGCTCAAACACCTTGCDMGCAGCGACCR3RFP+CD3SEQ ID NO: 178libraLow eAPCSEQ ID NO: 177TCTGAGCTGAATGTGAACGryG12VAGTCTCGGCAATGGCTCAAACACCTTGKRASCAGCGACCMG10 Variant IdentificationThe amplicon sequencing data was obtained as merged paired reads in FASTQ format and the CDR3 nucleotide sequences were analyzed. From each FASTQ, unique CDR3nucleotide sequences were extracted and associated with number of counts that corresponds to the number of times this particular CDR3 sequence was observed in a specific sample. The lists were generated for each diversified TCR cell library and respective bulk sorted cells. For normalization of data, the calculation of frequency per5 condition was applied (equation 1). The variants that successfully recognized the G12V KRAS presented in HLA-A*11:01 were enriched and therefore were expected to have higher frequency compared to a reference library (diversified TCR cell library before responder assay). To represent this enrichment, the frequency of a CDR3 variant in a sorted gate was correlated with frequency in starting reference library (equation 2).10 Variants that have enrichment value above 1 successfully recognized the G12V KRAS and were therefore enriched. Identified TCR-1 G12V KRAS recognizing variants are listed in Tables 28 (TRA CDR3) and 29 (TRB CDR3).15 Table 28. TRA diversified CDR3SEQIDNO:SEQIDNO:SEQIDNO:SEQIDNO:184CALALTGGGNKLTF621CALIGTGGGNRLTF1058CALILTGGGSKHTF1495CALINTGGGNALTF185CALCLTGGGNKLTF622CALIGTGGGNVLTF1059CALILTGGGSKMTF1496CALINTGGGNCLTF186CALDLTGGGNKLTF623CALIGTGGGNWLTF1060CALILTGGGSKSTF1497CALINTGGGNGLTF187CALELTGGGNKLTF624CALIGTGGGQKLTF1061CALILTGGGSKVTF1498CALINTGGGNHLTF188CALGLTGGGNKLTF625CALIGTGMGNKLTF1062CALILTGGGSMLTF1499CALINTGGGNKFTF189CALIATGGGNKLTF626CALIGTMGGNKLTF1063CALILTGGGSQLTF1500CALINTGGGNKITF190CALICTGGGNKLTF627CALIGTPGGNKLTF1064CALILTGGGSRLTF1501CALINTGGGNKKTF191CALIFTGGGNKLTF628CALIGTQGGNKLTF1065CALILTGGGVKMTF1502CALINTGGGNKQTF192CALIHTGGGNKLTF629CALIGTVGGNKLTF1066CALILTGGGVKPTF1503CALINTGGGNMLTF193CALIITGGGNKLTF630CALIHAGGGNKLTF1067CALILTGGGVKTTF1504CALINTGGGNPLTF194CALILMGGGNKLTF631CALIHDGGGNKLTF1068CALILTGGGWKWTF1505CALINTGGGNRLTF195CALILTGGFNKLTF632CALIHGGGGNKLTF1069CALILTGGGWWLTF1506CALINTGGGNSLTF196CALILTGGGGKLTF633CALIHIGGGNKLTF1070CALILTGGHNKMTF1507CALINTGGGNVLTF197CALILTGGGHKLTF634CALIHTAGGNKLTF1071CALILTGGHNSLTF1508CALINTGGGNWLTF198CALILTGGGNALTF635CALIHTDGGNKLTF1072CALILTGGIMKLTF1509CALINTKGGNKLTF199CALILTGGGNDLTF636CALIHTGGGCKLTF1073CALILTGGINRLTF1510CALINTNGGNKLTF200CALILTGGGNELTF637CALIHTGGGKKLTF1074CALILTGGKNELTF1511CALINTQGGNKLTF201CALILTGGGNFLTF638CALIHTGGGNGLTF1075CALILTGGKNILTF1512CALINTRGGNKLTF202CALILTGGGNKITF639CALIHTGGGNKITF1076CALILTGGKNKMTF1513CALINTSGGNKLTF203CALILTGGGNKNTF640CALIHTGGGNKMTF1077CALILTGGKNQLTF1514CALINTTGGNKLTF204CALILTGGGNKYTF641CALIHTGGGNKRTF1078CALILTGGKNSLTF1515CALINTVGGNKLTF205CALILTGGGNLLTF642CALIHTGGGNKVTF1079CALILTGGKNVLTF1516CALINTYGGNKLTF206CALILTGGGNMLTF643CALIHTGGGNNLTF1080CALILTGGLNALTF1517CALIPTAGGNKLTF207CALILTGGGNQLTF644CALIHTGGGNRLTF1081CALILTGGLNILTF1518CALIPTCGGNKLTF208CALILTGGGNRLTF645CALIHTGGGNTLTF1082CALILTGGLNQLTF1519CALIPTDGGNKLTF209CALILTGGGNTLTF646CALIHTGGQNKLTF1083CALILTGGLWKLTF1520CALIPTGGGNALTF210CALILTGGGNWLTF647CALIHTGGRNKLTF1084CALILTGGMIKLTF1521CALIPTGGGNKGTF211CALILTGGGNYLTF648CALIHTGMGNKLTF1085CALILTGGMNALTF1522CALIPTGGGNKMTF212CALILTGGGPKLTF649CALIHTGNGNKLTF1086CALILTGGMNQLTF1523CALIPTGGGNQLTF213CALILTGGGQKLTF650CALIHTIGGNKLTF1087CALILTGGMNSLTF1524CALIPTGGGNRLTF214CALILTGGGSKLTF651CALIHTKGGNKLTF1088CALILTGGNNALTF1525CALIPTGGGNSLTF215CALILTGGKNKLTF652CALIHTSGGNKLTF1089CALILTGGNNRLTF1526CALIPTGGGNTLTF216CALILTGGMNKLTF653CALIHTVGGNKLTF1090CALILTGGPNELTF1527CALIPTGNGNKLTF217CALILTGGQNKLTF654CALIHTYGGNKLTF1091CALILTGGQNELTF1528CALIPTKGGNKLTF218CALILTGGRNKLTF655CALIIIGGGNKLTF1092CALILTGGQNKETF1529CALIPTMGGNKLTF219CALILTGGYNKLTF656CALIIMGGGNKLTF1093CALILTGGRNMLTF1530CALIPTPGGNKLTF220CALILTHGGNKLTF657CALIITGGGNKATF1094CALILTGGRNWLTF1531CALIPTQGGNKLTF221CALILTKGGNKLTF658CALIITGGGNKITF1095CALILTGGSNCLTF1532CALIPTRGGNKLTF222CALILTLGGNKLTF659CALIITGGGNKQTF1096CALILTGGSNELTF1533CALIPTTGGNKLTF223CALILTMGGNKLTF660CALIITGGGNMLTF1097CALILTGGSNGLTF1534CALIQMGGGNKLTF224CALILTPGGNKLTF661CALIITHGGNKLTF1098CALILTGGSNHLTF1535CALIQTCGGNKLTF225CALILTQGGNKLTF662CALIITNGGNKLTF1099CALILTGGSNKCTF1536CALIQTGGGNALTF226CALILTSGGNKLTF663CALIITPGGNKLTF1100CALILTGGSNKHTF1537CALIQTGGGNCLTF227CALILTYGGNKLTF664CALIITQGGNKLTF1101CALILTGGSNKSTF1538CALIQTGGGNELTF228CALIMTGGGNKLTF665CALIITRGGNKLTF1102CALILTGGSNLLTF1539CALIQTGGGNILTF229CALIPTGGGNKLTF666CALIITTGGNKLTF1103CALILTGGSNNLTF1540CALIQTGGGNKFTF230CALISTGGGNKLTF667CALIITVGGNKLTF1104CALILTGGSNPLTF1541CALIQTGGGNKSTF231CALITTGGGNKLTF668CALIKIGGGNKLTF1105CALILTGGSNRLTF1542CALIQTGGGNKYTF232CALIWTGGGNKLTF669CALIKMGGGNKLTF1106CALILTGGSNVLTF1543CALIQTGGGNPLTF233CALLLTGGGNKLTF670CALIKTAGGNKLTF1107CALILTGGSQKLTF1544CALIQTGGGNRLTF234CALQLTGGGNKLTF671CALIKTCGGNKLTF1108CALILTGGTNCLTF1545CALIQTGGGNTLTF235CALRLTGGGNKLTF672CALIKTEGGNKLTF1109CALILTGGTNKATF1546CALIQTGGGNWLTF236CALTLTGGGNKLTF673CALIKTGFGNKLTF1110CALILTGGTNKGTF1547CALIQTHGGNKLTF237CALVLTGGGNKLTF674CALIKTGGGHKLTF1111CALILTGGTNKMTF1548CALIQTLGGNKLTF238CALDITGGGNKLTF675CALIKTGGGNKDTF1112CALILTGGTNKSTF1549CALIQTRGGNKLTF239CALGITGGGNKLTF676CALIKTGGGNKITF1113CALILTGGTNQLTF1550CALIQTSGGNKLTF240CALIDLGGGNKLTF677CALIKTGGGNLLTF1114CALILTGGTNRLTF1551CALIQTVGGNKLTF241CALIELGGGNKLTF678CALIKTGGGNMLTF1115CALILTGGTNSLTF1552CALIRGGGGNKLTF242CALIFLGGGNKLTF679CALIKTGGGRKLTF1116CALILTGGTNWLTF1553CALIRIGGGNKLTF243CALIGLGGGNKLTF680CALIKTHGGNKLTF1117CALILTGGVNGLTF1554CALIRTCGGNKLTF244CALIHLGGGNKLTF681CALIKTKGGNKLTF1118CALILTGGVNKPTF1555CALIRTEGGNKLTF245CALIILGGGNKLTF682CALIKTQGGNKLTF1119CALILTGGVNRLTF1556CALIRTGGGCKLTF246CALILATGGNKLTF683CALIKTSGGNKLTF1120CALILTGGVNSLTF1557CALIRTGGGDKLTF247CALILGAGGNKLTF684CALIKTTGGNKLTF1121CALILTGGVVKLTF1558CALIRTGGGNKATF248CALILGDGGNKLTF685CALILACGGNKLTF1122CALILTGGWCKLTF1559CALIRTGGGNKFTF249CALILGEGGNKLTF686CALILAEGGNKLTF1123CALILTGGWNALTF1560CALIRTGGGNKITF250CALILGGQGNKLTF687CALILAGGGNKHTF1124CALILTGGWNDLTF1561CALIRTGGGNKMTF251CALILGHGGNKLTF688CALILAGGGNKMTF1125CALILTGGWNELTF1562CALIRTGGGNKRTF252CALILGMGGNKLTF689CALILAGGGNKNTF1126CALILTGGWNMLTF1563CALIRTGGGNKSTF253CALILGTGGNKLTF690CALILAGGGNKPTF1127CALILTGGWNQLTF1564CALIRTGGGNKVTF254CALILITGGNKLTF691CALILAGGGNPLTF1128CALILTGGYNGLTF1565CALIRTGGGNLLTF255CALILLTGGNKLTF692CALILAGGGNRLTF1129CALILTGGYNKGTF1566CALIRTGGGNMLTF256CALILNTGGNKLTF693CALILAGGGYKLTF1130CALILTGGYNKVTF1567CALIRTNGGNKLTF257CALILPTGGNKLTF694CALILAGQGNKLTF1131CALILTGGYNMLTF1568CALIRTRGGNKLTF258CALILQTGGNKLTF695CALILAGTGNKLTF1132CALILTGHGNKPTF1569CALIRTVGGNKLTF259CALILTEGGGKLTF696CALILAGYGNKLTF1133CALILTGIGNKMTF1570CALIRTYGGNKLTF260CALILTGFGGKLTF697CALILAHGGNKLTF1134CALILTGIGNKYTF1571CALISMGGGNKLTF261CALILTGGGCNLTF698CALILANGGNKLTF1135CALILTGIHNKLTF1572CALISTCGGNKLTF262CALILTGGGGNLTF699CALILASGGNKLTF1136CALILTGLGNKATF1573CALISTFGGNKLTF263CALILTGGGNAKTF700CALILAYGGNKLTF1137CALILTGLGNKDTF1574CALISTGGGNELTF264CALILTGGGNLATF701CALILCEGGNKLTF1138CALILTGLGNKSTF1575CALISTGGGNGLTF265CALILTGGGNLITF702CALILCGGGLKLTF1139CALILTGMGNKATF1576CALISTGGGNKATF266CALILTGGGNLMTF703CALILCGGGNKHTF1140CALILTGMGNKITF1577CALISTGGGNKCTF267CALILTGGGNLNTF704CALILCGGGNRLTF1141CALILTGMGSKLTF1578CALISTGGGNKDTF268CALILTGGGNLRTF705CALILCGGGVKLTF1142CALILTGMGVKLTF1579CALISTGGGNKHTF269CALILTGGGNSKTF706CALILCGGHNKLTF1143CALILTGNGAKLTF1580CALISTGGGNKMTF270CALILTGGGNVKTF707CALILCGGNNKLTF1144CALILTGNGNKATF1581CALISTGGGNKPTF271CALILTGGGNWKTF708CALILCNGGNKLTF1145CALILTGQGNKGTF1582CALISTGGGNLLTF272CALILTGGHGKLTF709CALILCPGGNKLTF1146CALILTGQGNKITF1583CALISTGGGNMLTF273CALILTGGNAKLTF710CALILDAGGNKLTF1147CALILTGQGNKMTF1584CALISTGGGNRLTF274CALILTGGNGKLTF711CALILDCGGNKLTF1148CALILTGQGNKPTF1585CALISTGGGNSLTF275CALILTGGNSKLTF712CALILDGNGNKLTF1149CALILTGRLNKLTF1586CALISTGGGNTLTF276CALILTGGQGKLTF713CALILDIGGNKLTF1150CALILTGRMNKLTF1587CALISTHGGNKLTF277CALILTIGGGKLTF714CALILDNGGNKLTF1151CALILTGSGNKGTF1588CALISTKGGNKLTF278CALILTNGGGKLTF715CALILDRGGNKLTF1152CALILTGSGNKMTF1589CALISTLGGNKLTF279CALILTQGGGKLTF716CALILEGGGNKMTF1153CALILTGSGNKQTF1590CALISTMGGNKLTF280CALILTRGGGKLTF717CALILEIGGNKLTF1154CALILTGSGNPLTF1591CALISTRGGNKLTF281CALILTTGGGKLTF718CALILEVGGNKLTF1155CALILTGSGWKLTF1592CALISTSGGNKLTF282CALILTWGGGKLTF719CALILFAGGNKLTF1156CALILTGSMNKLTF1593CALISTVGGNKLTF283CALIMLGGGNKLTF720CALILFGGDNKLTF1157CALILTGTGNALTF1594CALISTYGGNKLTF284CALIPLGGGNKLTF721CALILFRGGNKLTF1158CALILTGTGNKATF1595CALISVGGGNKLTF285CALIRLGGGNKLTF722CALILFSGGNKLTF1159CALILTGTGNKMTF1596CALITTGGGAKLTF286CALITDGGGNKLTF723CALILGGGGNKHTF1160CALILTGTGNKQTF1597CALITTGGGNCLTF287CALITLGGGNKLTF724CALILGGGGNKNTF1161CALILTGTYNKLTF1598CALITTGGGNGLTF288CALIWLGGGNKLTF725CALILGGGGNKPTF1162CALILTGVGNKDTF1599CALITTGGGNILTF289CALIYLGGGNKLTF726CALILGGGGNMLTF1163CALILTGWGNKATF1600CALITTGGGNKATF290CALLPTGGGNKLTF727CALILGGGGNQLTF1164CALILTGWGNKITF1601CALITTGGGNKCTF291CALQITGGGNKLTF728CALILHDGGNKLTF1165CALILTGWGNKMTF1602CALITTGGGNKGTF292CALVITGGGNKLTF729CALILIAGGNKLTF1166CALILTGWGNPLTF1603CALITTGGGNKHTF293CALAGTGGGNKLTF730CALILIDGGNKLTF1167CALILTGWGNQLTF1604CALITTGGGNKNTF294CALAHTGGGNKLTF731CALILIEGGNKLTF1168CALILTGWVNKLTF1605CALITTGGGNKQTF295CALALAGGGNKLTF732CALILIGGGAKLTF1169CALILTGYGNKATF1606CALITTGGGNKVTF296CALALEGGGNKLTF733CALILIGGGNALTF1170CALILTGYGTKLTF1607CALITTGGGNRLTF297CALALIGGGNKLTF734CALILIGGGNKATF1171CALILTGYTNKLTF1608CALITTGGGNTLTF298CALALLGGGNKLTF735CALILIGGGNKITF1172CALILTHGDNKLTF1609CALITTIGGNKLTF299CALALNGGGNKLTF736CALILIGGGNKNTF1173CALILTHGFNKLTF1610CALITTLGGNKLTF300CALALSGGGNKLTF737CALILIGGGNKSTF1174CALILTHGGDKLTF1611CALITTMGGNKLTF301CALALTCGGNKLTF738CALILIGGGNPLTF1175CALILTHGGIKLTF1612CALITTQGGNKLTF302CALALTGGGAKLTF739CALILIGGGNSLTF1176CALILTHGGNCLTF1613CALITTTGGNKLTF303CALALTGGGCKLTF740CALILIGGGNTLTF1177CALILTHGGNDLTF1614CALITTWGGNKLTF304CALALTGGGNALTF741CALILIGGGNVLTF1178CALILTHGGNGLTF1615CALIVTAGGNKLTF305CALALTGGGNFLTF742CALILIGGGSKLTF1179CALILTHGGNKMTF1616CALIVTEGGNKLTF306CALALTGGGNILTF743CALILIGGSNKLTF1180CALILTHGGNKPTF1617CALIVTFGGNKLTF307CALALTGGGNKCTF744CALILIPGGNKLTF1181CALILTHGGNNLTF1618CALIVTGGGNKATF308CALALTGGGNKDTF745CALILIQGGNKLTF1182CALILTHGGNPLTF1619CALIVTGGGNKGTF309CALALTGGGNKETF746CALILIRGGNKLTF1183CALILTHGGNRLTF1620CALIVTGGGNKITF310CALALTGGGNKHTF747CALILISGGNKLTF1184CALILTHGGNSLTF1621CALIVTGGGNKNTF311CALALTGGGNKMTF748CALILKGGGHKLTF1185CALILTHGGNTLTF1622CALIVTGGGNKPTF312CALALTGGGNKVTF749CALILKGGGNKMTF1186CALILTHGGNVLTF1623CALIVTGGGNPLTF313CALALTGGGNKYTF750CALILLAGGNKLTF1187CALILTHGGNYLTF1624CALIVTIGGNKLTF314CALALTGGGNLLTF751CALILLDGGNKLTF1188CALILTHGGQKLTF1625CALIVTLGGNKLTF315CALALTGGGNMLTF752CALILLGGFNKLTF1189CALILTHGGSKLTF1626CALIVTPGGNKLTF316CALALTGGGNNLTF753CALILLGGGCKLTF1190CALILTHGINKLTF1627CALIVTQGGNKLTF317CALALTGGGNRLTF754CALILLGGGGKLTF1191CALILTHGKNKLTF1628CALIVTSGGNKLTF318CALALTGGGNTLTF755CALILLGGGNALTF1192CALILTHGLNKLTF1629CALIVTTGGNKLTF319CALALTGGGNWLTF756CALILLGGGNCLTF1193CALILTHGMNKLTF1630CALIVTVGGNKLTF320CALALTGGGQKLTF757CALILLGGGNDLTF1194CALILTHGQNKLTF1631CALIWGGGGNKLTF321CALALTGNGNKLTF758CALILLGGGNELTF1195CALILTHGSNKLTF1632CALIWSGGGNKLTF322CALALTGYGNKLTF759CALILLGGGNGLTF1196CALILTHGTNKLTF1633CALIWTGGGNALTF323CALALTLGGNKLTF760CALILLGGGNHLTF1197CALILTHLGNKLTF1634CALIWTGGGNKATF324CALALTNGGNKLTF761CALILLGGGNILTF1198CALILTHVGNKLTF1635CALIWTGGGNLLTF325CALALTPGGNKLTF762CALILLGGGNKATF1199CALILTIGGNALTF1636CALIWTGGGNPLTF326CALALTRGGNKLTF763CALILLGGGNKPTF1200CALILTIGGNKHTF1637CALIWTGGGNQLTF327CALALTVGGNKLTF764CALILLGGGNKSTF1201CALILTIGGNRLTF1638CALIWTGGGNSLTF328CALALTYGGNKLTF765CALILLGGGNKWTF1202CALILTIGGNYLTF1639CALIWTHGGNKLTF329CALALVGGGNKLTF766CALILLGGGNPLTF1203CALILTIGGQKLTF1640CALIWTKGGNKLTF330CALAMTGGGNKLTF767CALILLGGGNWLTF1204CALILTIGGVKLTF1641CALIWTRGGNKLTF331CALAPTGGGNKLTF768CALILLGGGSKLTF1205CALILTIGGYKLTF1642CALIWTSGGNKLTF332CALARTGGGNKLTF769CALILLGGHNKLTF1206CALILTIGHNKLTF1643CALIWTVGGNKLTF333CALATTGGGNKLTF770CALILLGGMNKLTF1207CALILTIGKNKLTF1644CALIYTAGGNKLTF334CALCDTGGGNKLTF771CALILLGGPNKLTF1208CALILTIHGNKLTF1645CALIYTGGGAKLTF335CALCHTGGGNKLTF772CALILLGGQNKLTF1209CALILTKGDNKLTF1646CALIYTGGGNKCTF336CALCKTGGGNKLTF773CALILLGGSNKLTF1210CALILTKGENKLTF1647CALIYTGGGNKITF337CALCLAGGGNKLTF774CALILLGYGNKLTF1211CALILTKGGAKLTF1648CALIYTGGGNKPTF338CALCLGGGGNKLTF775CALILLHGGNKLTF1212CALILTKGGNDLTF1649CALIYTGGGNLLTF339CALCLLGGGNKLTF776CALILLQGGNKLTF1213CALILTKGGNHLTF1650CALIYTGGGNMLTF340CALCLPGGGNKLTF777CALILMAGGNKLTF1214CALILTKGGNKFTF1651CALIYTGGKNKLTF341CALCLSGGGNKLTF778CALILMEGGNKLTF1215CALILTKGGNKHTF1652CALIYTHGGNKLTF342CALCLTAGGNKLTF779CALILMGGGDKLTF1216CALILTKGGNKITF1653CALIYTLGGNKLTF343CALCLTGGANKLTF780CALILMGGGNCLTF1217CALILTKGGNKPTF1654CALIYTNGGNKLTF344CALCLTGGCNKLTF781CALILMGGGNHLTF1218CALILTKGGNKQTF1655CALIYTSGGNKLTF345CALCLTGGENKLTF782CALILMGGGNILTF1219CALILTKGGNKVTF1656CALIYTWGGNKLTF346CALCLTGGGGKLTF783CALILMGGGNKCTF1220CALILTKGGNKYTF1657CALKLTGGGNKGTF347CALCLTGGGNGLTF784CALILMGGGNKVTF1221CALILTKGGNRLTF1658CALKLTGGGNKITF348CALCLTGGGNHLTF785CALILMGGGNSLTF1222CALILTKGGPKLTF1659CALKLTGGGNKMTF349CALCLTGGGNILTF786CALILMGGMNKLTF1223CALILTKGGQKLTF1660CALKLTGGGNMLTF350CALCLTGGGNKCTF787CALILMGLGNKLTF1224CALILTLGENKLTF1661CALKLTGGGRKLTF351CALCLTGGGNKFTF788CALILMQGGNKLTF1225CALILTLGGNDLTF1662CALKLTGGGWKLTF352CALCLTGGGNKGTF789CALILMSGGNKLTF1226CALILTLGGNKITF1663CALKLTSGGNKLTF353CALCLTGGGNKMTF790CALILNAGGNKLTF1227CALILTLGGNPLTF1664CALLLLGGGNKLTF354CALCLTGGGNKPTF791CALILNGGGNKATF1228CALILTLGGNQLTF1665CALLLMGGGNKLTF355CALCLTGGGNKSTF792CALILNNGGNKLTF1229CALILTLGGNVLTF1666CALLLTDGGNKLTF356CALCLTGGGNLLTF793CALILNRGGNKLTF1230CALILTLGGNYLTF1667CALLLTEGGNKLTF357CALCLTGGGNPLTF794CALILNWGGNKLTF1231CALILTLGGSKLTF1668CALLLTFGGNKLTF358CALCLTGGGNRLTF795CALILPDGGNKLTF1232CALILTLGGTKLTF1669CALLLTGGGCKLTF359CALCLTGGGNSLTF796CALILPEGGNKLTF1233CALILTLGPNKLTF1670CALLLTGGGNALTF360CALCLTGGGNTLTF797CALILPGGGNKMTF1234CALILTLGTNKLTF1671CALLLTGGGNCLTF361CALCLTGGGNYLTF798CALILPGGGNKPTF1235CALILTMAGNKLTF1672CALLLTGGGNELTF362CALCLTGGGSKLTF799CALILPHGGNKLTF1236CALILTMGDNKLTF1673CALLLTGGGNHLTF363CALCLTGGINKLTF800CALILPIGGNKLTF1237CALILTMGGNFLTF1674CALLLTGGGNKATF364CALCLTGGKNKLTF801CALILPKGGNKLTF1238CALILTMGGNILTF1675CALLLTGGGNKGTF365CALCLTGGMNKLTF802CALILPRGGNKLTF1239CALILTMGGNKMTF1676CALLLTGGGNKHTF366CALCLTGGQNKLTF803CALILPWGGNKLTF1240CALILTMGGNKPTF1677CALLLTGGGNKKTF367CALCLTGGSNKLTF804CALILQCGGNKLTF1241CALILTMGGNKVTF1678CALLLTGGGNKMTF368CALCLTGLGNKLTF805CALILQDGGNKLTF1242CALILTMGGNQLTF1679CALLLTGGGNKPTF369CALCLTGQGNKLTF806CALILQEGGNKLTF1243CALILTMGGNSLTF1680CALLLTGGGNPLTF370CALCLTIGGNKLTF807CALILQGGGNKATF1244CALILTMGGNYLTF1681CALLLTGGGNTLTF371CALCLTLGGNKLTF808CALILQGGRNKLTF1245CALILTMGGQKLTF1682CALLLTGGQNKLTF372CALCLTPGGNKLTF809CALILQHGGNKLTF1246CALILTMGGYKLTF1683CALLLTGGRNKLTF373CALCLTRGGNKLTF810CALILQWGGNKLTF1247CALILTMGPNKLTF1684CALLLTHGGNKLTF374CALCLTTGGNKLTF811CALILSCGGNKLTF1248CALILTMGRNKLTF1685CALLLTIGGNKLTF375CALCMTGGGNKLTF812CALILSGGGNKGTF1249CALILTNGANKLTF1686CALLLTNGGNKLTF376CALCNTGGGNKLTF813CALILSGGINKLTF1250CALILTNGCNKLTF1687CALLLTVGGNKLTF377CALCPTGGGNKLTF814CALILSNGGNKLTF1251CALILTNGGNALTF1688CALLLTWGGNKLTF378CALCQTGGGNKLTF815CALILSRGGNKLTF1252CALILTNGGNHLTF1689CALLLVGGGNKLTF379CALDDTGGGNKLTF816CALILSSGGNKLTF1253CALILTNGGNKATF1690CALMFTGGGNKLTF380CALDGTGGGNKLTF817CALILSWGGNKLTF1254CALILTNGGNKHTF1691CALMGTGGGNKLTF381CALDLGGGGNKLTF818CALILTAGCNKLTF1255CALILTNGGNKMTF1692CALMHTGGGNKLTF382CALDLTAGGNKLTF819CALILTAGGEKLTF1256CALILTNGGNKVTF1693CALMKTGGGNKLTF383CALDLTGGGAKLTF820CALILTAGGNALTF1257CALILTNGGNKYTF1694CALMLIGGGNKLTF384CALDLTGGGNALTF821CALILTAGGNDLTF1258CALILTNGGNMLTF1695CALMLLGGGNKLTF385CALDLTGGGNFLTF822CALILTAGGNKATF1259CALILTNGGNNLTF1696CALMLTCGGNKLTF386CALDLTGGGNKATF823CALILTAGGNKVTF1260CALILTNGGNPLTF1697CALMLTGAGNKLTF387CALDLTGGGNLLTF824CALILTAGGNKWTF1261CALILTNGGNQLTF1698CALMLTGGCNKLTF388CALDLTGGGNMLTF825CALILTAGGNKYTF1262CALILTNGGNRLTF1699CALMLTGGFNKLTF389CALDLTGGGNPLTF826CALILTAGGNLLTF1263CALILTNGGNSLTF1700CALMLTGGGNCLTF390CALDLTGGGNQLTF827CALILTAGGNQLTF1264CALILTNGGNTLTF1701CALMLTGGGNELTF391CALDLTGGGNRLTF828CALILTAGGNVLTF1265CALILTNGGNWLTF1702CALMLTGGGNFLTF392CALDLTGGGNYLTF829CALILTAGGNYLTF1266CALILTNGGSKLTF1703CALMLTGGGNILTF393CALDLTGGGQKLTF830CALILTAGGSKLTF1267CALILTNGHNKLTF1704CALMLTGGGNKATF394CALDLTGGGSKLTF831CALILTAGHNKLTF1268CALILTNGINKLTF1705CALMLTGGGNKMTF395CALDLTGGPNKLTF832CALILTAG INKLTF1269CALILTNGLNKLTF1706CALMLTGGGNKVTF396CALDLTGGSNKLTF833CALILTAGNNKLTF1270CALILTNGPNKLTF1707CALMLTGGGNPLTF397CALDLTGMGNKLTF834CALILTAGTNKLTF1271CALILTNGQNKLTF1708CALMLTGGGNSLTF398CALDLTGQGNKLTF835CALILTANGNKLTF1272CALILTNGSNKLTF1709CALMLTGGGNVLTF399CALDLTGTGNKLTF836CALILTAVGNKLTF1273CALILTNGVNKLTF1710CALMLTGGGSKLTF400CALDLTGVGNKLTF837CALILTCGENKLTF1274CALILTNGYNKLTF1711CALMLTGGLNKLTF401CALDLTMGGNKLTF838CALILTCGGNFLTF1275CALILTNQGNKLTF1712CALMLTGGQNKLTF402CALDLTPGGNKLTF839CALILTCGGNKITF1276CALILTPAGNKLTF1713CALMLTGGRNKLTF403CALDLTQGGNKLTF840CALILTCGGNMLTF1277CALILTPGGDKLTF1714CALMLTGGTNKLTF404CALDPTGGGNKLTF841CALILTCGGNPLTF1278CALILTPGGNCLTF1715CALMLTGGYNKLTF405CALDQTGGGNKLTF842CALILTCGGNSLTF1279CALILTPGGNKRTF1716CALMLTIGGNKLTF406CALDTTGGGNKLTF843CALILTCGINKLTF1280CALILTPGGNMLTF1717CALMLTKGGNKLTF407CALDVTGGGNKLTF844CALILTCGNNKLTF1281CALILTPGGNPLTF1718CALMLTLGGNKLTF408CALEATGGGNKLTF845CALILTCGSNKLTF1282CALILTPGGQKLTF1719CALMLTNGGNKLTF409CALECTGGGNKLTF846CALILTCGTNKLTF1283CALILTPGGSKLTF1720CALMLTPGGNKLTF410CALEGTGGGNKLTF847CALILTDGANKLTF1284CALILTQGANKLTF1721CALMLTRGGNKLTF411CALEKTGGGNKLTF848CALILTDGDNKLTF1285CALILTQGGAKLTF1722CALMLTSGGNKLTF412CALELIGGGNKLTF849CALILTDGGAKLTF1286CALILTQGGDKLTF1723CALMLTYGGNKLTF413CALELSGGGNKLTF850CALILTDGGCKLTF1287CALILTQGGLKLTF1724CALMNTGGGNKLTF414CALELTAGGNKLTF851CALILTDGGHKLTF1288CALILTQGGMKLTF1725CALMVTGGGNKLTF415CALELTEGGNKLTF852CALILTDGGNCLTF1289CALILTQGGNALTF1726CALMWTGGGNKLTF416CALELTGGGAKLTF853CALILTDGGNDLTF1290CALILTQGGNDLTF1727CALMYTGGGNKLTF417CALELTGGGGKLTF854CALILTDGGNFLTF1291CALILTQGGNHLTF1728CALNLGGGGNKLTF418CALELTGGGLKLTF855CALILTDGGNILTF1292CALILTQGGNILTF1729CALNLLGGGNKLTF419CALELTGGGNELTF856CALILTDGGNKHTF1293CALILTQGGNKDTF1730CALNLMGGGNKLTF420CALELTGGGNGLTF857CALILTDGGNKVTF1294CALILTQGGNKETF1731CALNLTIGGNKLTF421CALELTGGGNHLTF858CALILTDGGNKWTF1295CALILTQGGNKMTF1732CALNPTGGGNKLTF422CALELTGGGNILTF859CALILTDGGNLLTF1296CALILTQGGNKQTF1733CALPGTGGGNKLTF423CALELTGGGNKHTF860CALILTDGGNMLTF1297CALILTQGGNKSTF1734CALPLAGGGNKLTF424CALELTGGGNKITF861CALILTDGGNRLTF1298CALILTQGGNKVTF1735CALPLTAGGNKLTF425CALELTGGGNKVTF862CALILTDGGNVLTF1299CALILTQGGNLLTF1736CALPLTGGGPKLTF426CALELTGGGNMLTF863CALILTDGGNYLTF1300CALILTQGGNNLTF1737CALPLTPGGNKLTF427CALELTGGGNQLTF864CALILTDGINKLTF1301CALILTQGGNRLTF1738CALQDTGGGNKLTF428CALELTGGGNSLTF865CALILTDGLNKLTF1302CALILTQGGNSLTF1739CALQFTGGGNKLTF429CALELTGGGNTLTF866CALILTDGPNKLTF1303CALILTQGGNTLTF1740CALQGTGGGNKLTF430CALELTGGGNYLTF867CALILTDGSNKLTF1304CALILTQGGNYLTF1741CALQHTGGGNKLTF431CALELTGGGQKLTF868CALILTDGTNKLTF1305CALILTQGGSKLTF1742CALQLCGGGNKLTF432CALELTGGHNKLTF869CALILTDNGNKLTF1306CALILTQGLNKLTF1743CALQLIGGGNKLTF433CALELTGGINKLTF870CALILTDQGNKLTF1307CALILTQGSNKLTF1744CALQLLGGGNKLTF434CALELTGGKNKLTF871CALILTDRGNKLTF1308CALILTQHGNKLTF1745CALQLQGGGNKLTF435CALELTGGSNKLTF872CALILTEAGNKLTF1309CALILTRGCNKLTF1746CALQLTDGGNKLTF436CALELTGGWNKLTF873CALILTEGANKLTF1310CALILTRGDNKLTF1747CALQLTEGGNKLTF437CALELTGSGNKLTF874CALILTEGGAKLTF1311CALILTRGGAKLTF1748CALQLTFGGNKLTF438CALELTGYGNKLTF875CALILTEGGNGLTF1312CALILTRGGIKLTF1749CALQLTGGANKLTF439CALELTHGGNKLTF876CALILTEGGNKFTF1313CALILTRGGNCLTF1750CALQLTGGFNKLTF440CALELTIGGNKLTF877CALILTEGGNKMTF1314CALILTRGGNELTF1751CALQLTGGGCKLTF441CALELTWGGNKLTF878CALILTEGGNKQTF1315CALILTRGGNFLTF1752CALQLTGGGNCLTF442CALELVGGGNKLTF879CALILTEGGNQLTF1316CALILTRGGNGLTF1753CALQLTGGGNELTF443CALEPTGGGNKLTF880CALILTEGGNRLTF1317CALILTRGGNKFTF1754CALQLTGGGNHLTF444CALEQTGGGNKLTF881CALILTEGGNVLTF1318CALILTRGGNKGTF1755CALQLTGGGNILTF445CALERTGGGNKLTF882CALILTEGGNWLTF1319CALILTRGGNKITF1756CALQLTGGGNKNTF446CALESTGGGNKLTF883CALILTEGGNYLTF1320CALILTRGGNKPTF1757CALQLTGGGNKVTF447CALETTGGGNKLTF884CALILTEGGQKLTF1321CALILTRGGNKWTF1758CALQLTGGGNPLTF448CALEWTGGGNKLTF885CALILTEGGSKLTF1322CALILTRGGNKYTF1759CALQLTGGGNQLTF449CALEYTGGGNKLTF886CALILTEGKNKLTF1323CALILTRGGNMLTF1760CALQLTGGGNSLTF450CALFLTDGGNKLTF887CALILTEGNNKLTF1324CALILTRGGNNLTF1761CALQLTGGGNTLTF451CALFLTGGGGKLTF888CALILTEGTNKLTF1325CALILTRGGNPLTF1762CALQLTGGGNVLTF452CALFLTGGGKKLTF889CALILTEGYNKLTF1326CALILTRGGNRLTF1763CALQLTGGGNYLTF453CALFLTGGGNKDTF890CALILTENGNKLTF1327CALILTRGGNVLTF1764CALQLTGGPNKLTF454CALFLTGGGNKGTF891CALILTFDGNKLTF1328CALILTRGGNWLTF1765CALQLTGNGNKLTF455CALFLTIGGNKLTF892CALILTFGGAKLTF1329CALILTRGGNYLTF1766CALQLTGTGNKLTF456CALFLTWGGNKLTF893CALILTFGGNFLTF1330CALILTRGGQKLTF1767CALQLTIGGNKLTF457CALGATGGGNKLTF894CALILTFGGNKATF1331CALILTRGGSKLTF1768CALQLTNGGNKLTF458CALGCTGGGNKLTF895CALILTFGGNKQTF1332CALILTRGHNKLTF1769CALQLTPGGNKLTF459CALGDTGGGNKLTF896CALILTFGGNSLTF1333CALILTRGKNKLTF1770CALQLTSGGNKLTF460CALGFTGGGNKLTF897CALILTFGGNTLTF1334CALILTRGLNKLTF1771CALQLTWGGNKLTF461CALGHTGGGNKLTF898CALILTFGGNVLTF1335CALILTRGPNKLTF1772CALQLVGGGNKLTF462CALGKTGGGNKLTF899CALILTFGGYKLTF1336CALILTRGQNKLTF1773CALQMTGGGNKLTF463CALGLEGGGNKLTF900CALILTFHGNKLTF1337CALILTRGRNKLTF1774CALQNTGGGNKLTF464CALGLGGGGNKLTF901CALILTFQGNKLTF1338CALILTRGWNKLTF1775CALRLIGGGNKLTF465CALGLIGGGNKLTF902CALILTGAGNKATF1339CALILTRNGNKLTF1776CALRLLGGGNKLTF466CALGLNGGGNKLTF903CALILTGAGNKGTF1340CALILTRSGNKLTF1777CALRLTGGCNKLTF467CALGLPGGGNKLTF904CALILTGAGNKMTF1341CALILTSAGNKLTF1778CALRLTGGGAKLTF468CALGLQGGGNKLTF905CALILTGAGNKSTF1342CALILTSGANKLTF1779CALRLTGGGGKLTF469CALGLSGGGNKLTF906CALILTGAGNKVTF1343CALILTSGGAKLTF1780CALRLTGGGNALTF470CALGLTEGGNKLTF907CALILTGAGNQLTF1344CALILTSGGNALTF1781CALRLTGGGNELTF471CALGLTFGGNKLTF908CALILTGCGCKLTF1345CALILTSGGNELTF1782CALRLTGGGNGLTF472CALGLTGCGNKLTF909CALILTGCGNKITF1346CALILTSGGNFLTF1783CALRLTGGGNKMTF473CALGLTGGANKLTF910CALILTGCGNKPTF1347CALILTSGGNGLTF1784CALRLTGGGNKQTF474CALGLTGGGAKLTF911CALILTGDINKLTF1348CALILTSGGNHLTF1785CALRLTGGGNKSTF475CALGLTGGGDKLTF912CALILTGEGNKITF1349CALILTSGGNILTF1786CALRLTGGGNPLTF476CALGLTGGGIKLTF913CALILTGEGNKNTF1350CALILTSGGNKATF1787CALRLTGGGNRLTF477CALGLTGGGLKLTF914CALILTGEGNKPTF1351CALILTSGGNKFTF1788CALRLTGGSNKLTF478CALGLTGGGMKLTF915CALILTGFGEKLTF1352CALILTSGGNKMTF1789CALRLTNGGNKLTF479CALGLTGGGNCLTF916CALILTGFGNKKTF1353CALILTSGGNKQTF1790CALRLTPGGNKLTF480CALGLTGGGNHLTF917CALILTGFGNKPTF1354CALILTSGGNKVTF1791CALRLTQGGNKLTF481CALGLTGGGNKETF918CALILTGGANALTF1355CALILTSGGNKYTF1792CALRLTRGGNKLTF482CALGLTGGGNKFTF919CALILTGGANHLTF1356CALILTSGGNMLTF1793CALRLTSGGNKLTF483CALGLTGGGNKITF920CALILTGGANKNTF1357CALILTSGGNNLTF1794CALSATGGGNKLTF484CALGLTGGGNKKTF921CALILTGGCNELTF1358CALILTSGGNQLTF1795CALSDTGGGNKLTF485CALGLTGGGNKMTF922CALILTGGDNCLTF1359CALILTSGGNYLTF1796CALSKTGGGNKLTF486CALGLTGGGNKPTF923CALILTGGDNKCTF1360CALILTSGGQKLTF1797CALSLGGGGNKLTF487CALGLTGGGNKQTF924CALILTGGDNKNTF1361CALILTSGHNKLTF1798CALSLLGGGNKLTF488CALGLTGGGNKYTF925CALILTGGDNQLTF1362CALILTSGMNKLTF1799CALSLMGGGNKLTF489CALGLTGGGNLLTF926CALILTGGENNLTF1363CALILTSGQNKLTF1800CALSLTCGGNKLTF490CALGLTGGGNNLTF927CALILTGGFNALTF1364CALILTSGTNKLTF1801CALSLTDGGNKLTF491CALGLTGGGNQLTF928CALILTGGFNGLTF1365CALILTSGVNKLTF1802CALSLTEGGNKLTF492CALGLTGGGNTLTF929CALILTGGFNKATF1366CALILTSHGNKLTF1803CALSLTGAGNKLTF493CALGLTGGGNVLTF930CALILTGGFNKFTF1367CALILTSIGNKLTF1804CALSLTGGANKLTF494CALGLTGGGNWLTF931CALILTGGFNKKTF1368CALILTSMGNKLTF1805CALSLTGGGAKLTF495CALGLTGGGNYLTF932CALILTGGFNKQTF1369CALILTSNGNKLTF1806CALSLTGGGDKLTF496CALGLTGGGSKLTF933CALILTGGGAKATF1370CALILTSQGNKLTF1807CALSLTGGGIKLTF497CALGLTGGGTKLTF934CALILTGGGAKHTF1371CALILTSRGNKLTF1808CALSLTGGGMKLTF498CALGLTGGMNKLTF935CALILTGGGAKMTF1372CALILTSSGNKLTF1809CALSLTGGGNALTF499CALGLTGGRNKLTF936CALILTGGGAKQTF1373CALILTSVGNKLTF1810CALSLTGGGNDLTF500CALGLTGGTNKLTF937CALILTGGGAKYTF1374CALILTTGANKLTF1811CALSLTGGGNFLTF501CALGLTGGVNKLTF938CALILTGGGARLTF1375CALILTTGGCKLTF1812CALSLTGGGNHLTF502CALGLTGGYNKLTF939CALILTGGGASLTF1376CALILTTGGNCLTF1813CALSLTGGGNKATF503CALGLTGIGNKLTF940CALILTGGGCKGTF1377CALILTTGGNELTF1814CALSLTGGGNKETF504CALGLTGLGNKLTF941CALILTGGGCKRTF1378CALILTTGGNFLTF1815CALSLTGGGNKFTF505CALGLTGRGNKLTF942CALILTGGGCKVTF1379CALILTTGGNHLTF1816CALSLTGGGNKGTF506CALGLTGSGNKLTF943CALILTGGGCKWTF1380CALILTTGGNKHTF1817CALSLTGGGNKHTF507CALGLTIGGNKLTF944CALILTGGGCSLTF1381CALILTTGGNKITF1818CALSLTGGGNKMTF508CALGLTLGGNKLTF945CALILTGGGDKATF1382CALILTTGGNKMTF1819CALSLTGGGNKNTF509CALGLTPGGNKLTF946CALILTGGGDKSTF1383CALILTTGGNLLTF1820CALSLTGGGNKQTF510CALGLTSGGNKLTF947CALILTGGGDMLTF1384CALILTTGGNMLTF1821CALSLTGGGNKVTF511CALGLTTGGNKLTF948CALILTGGGEGLTF1385CALILTTGGNRLTF1822CALSLTGGGNMLTF512CALGLTVGGNKLTF949CALILTGGGEKKTF1386CALILTTGGNTLTF1823CALSLTGGGNQLTF513CALGLTWGGNKLTF950CALILTGGGEKYTF1387CALILTTGGSKLTF1824CALSLTGGGNSLTF514CALGLTYGGNKLTF951CALILTGGGFKPTF1388CALILTTGHNKLTF1825CALSLTGGGNWLTF515CALGLVGGGNKLTF952CALILTGGGFKRTF1389CALILTTGNNKLTF1826CALSLTGGGNYLTF516CALGNTGGGNKLTF953CALILTGGGFKSTF1390CALILTTGPNKLTF1827CALSLTGGGQKLTF517CALGPTGGGNKLTF954CALILTGGGGALTF1391CALILTTSGNKLTF1828CALSLTGGGSKLTF518CALGQTGGGNKLTF955CALILTGGGGDLTF1392CALILTVGANKLTF1829CALSLTGGGVKLTF519CALGRTGGGNKLTF956CALILTGGGGELTF1393CALILTVGGEKLTF1830CALSLTGMGNKLTF520CALGSTGGGNKLTF957CALILTGGGGKITF1394CALILTVGGHKLTF1831CALSLTGYGNKLTF521CALGVTGGGNKLTF958CALILTGGGGKKTF1395CALILTVGGIKLTF1832CALSLTHGGNKLTF522CALGWTGGGNKLTF959CALILTGGGGKPTF1396CALILTVGGNFLTF1833CALSLTIGGNKLTF523CALGYTGGGNKLTF960CALILTGGGGKVTF1397CALILTVGGNGLTF1834CALSLTNGGNKLTF524CALHLTAGGNKLTF961CALILTGGGGKWTF1398CALILTVGGNKGTF1835CALSLTPGGNKLTF525CALHLTDGGNKLTF962CALILTGGGGKYTF1399CALILTVGGNKITF1836CALSLTQGGNKLTF526CALHLTGGGNGLTF963CALILTGGGGSLTF1400CALILTVGGNKMTF1837CALSLTRGGNKLTF527CALHLTGGGNKPTF964CALILTGGGGVLTF1401CALILTVGGNKSTF1838CALSLTTGGNKLTF528CALHLTGGQNKLTF965CALILTGGGGWLTF1402CALILTVGGNKVTF1839CALSLTVGGNKLTF529CALHLTQGGNKLTF966CALILTGGGHKATF1403CALILTVGGNPLTF1840CALSLTYGGNKLTF530CALHLTRGGNKLTF967CALILTGGGHKDTF1404CALILTVGGNTLTF1841CALSQTGGGNKLTF531CALHLTTGGNKLTF968CALILTGGGHKETF1405CALILTVGGNVLTF1842CALSRTGGGNKLTF532CALHYTGGGNKLTF969CALILTGGGHKVTF1406CALILTVGGNYLTF1843CALTDTGGGNKLTF533CALIAIGGGNKLTF970CALILTGGGHKWTF1407CALILTVGGSKLTF1844CALTFTGGGNKLTF534CALIATCGGNKLTF971CALILTGGGHQLTF1408CALILTVGSNKLTF1845CALTGTGGGNKLTF535CALIATEGGNKLTF972CALILTGGGIKMTF1409CALILTVGTNKLTF1846CALTHTGGGNKLTF536CALIATGGGHKLTF973CALILTGGGIKWTF1410CALILTVGYNKLTF1847CALTLEGGGNKLTF537CALIATGGGNELTF974CALILTGGGLKPTF1411CALILTVHGNKLTF1848CALTLHGGGNKLTF538CALIATGGGNKATF975CALILTGGGMILTF1412CALILTVQGNKLTF1849CALTLLGGGNKLTF539CALIATGGGNKFTF976CALILTGGGMKATF1413CALILTWEGNKLTF1850CALTLTEGGNKLTF540CALIATGGGNKHTF977CALILTGGGMKCTF1414CALILTWGDNKLTF1851CALTLTFGGNKLTF541CALIATGGGNKRTF978CALILTGGGNAATF1415CALILTWGGCKLTF1852CALTLTGGANKLTF542CALIATGGGNKSTF979CALILTGGGNAFTF1416CALILTWGGNDLTF1853CALTLTGGGNCLTF543CALIATGGGNLLTF980CALILTGGGNAMTF1417CALILTWGGNQLTF1854CALTLTGGGNHLTF544CALIATGGGNRLTF981CALILTGGGNAPTF1418CALILTWGGNRLTF1855CALTLTGGGNKATF545CALIATGGGNTLTF982CALILTGGGNCATF1419CALILTWGGNVLTF1856CALTLTGGGNKFTF546CALIATIGGNKLTF983CALILTGGGNCNTF1420CALILTWGGSKLTF1857CALTLTGGGNKGTF547CALIATYGGNKLTF984CALILTGGGNCPTF1421CALILTWGVNKLTF1858CALTLTGGGNKHTF548CALICTGGGNELTF985CALILTGGGNCVTF1422CALILTWNGNKLTF1859CALTLTGGGNKPTF549CALICTGGGNKATF986CALILTGGGNDITF1423CALILTWQGNKLTF1860CALTLTGGGNKQTF550CALICTGGGNKQTF987CALILTGGGNDMTF1424CALILTWRGNKLTF1861CALTLTGGGNKSTF551CALICTGGGNMLTF988CALILTGGGNDVTF1425CALILTWWGNKLTF1862CALTLTGGGNMLTF552CALICTGGGNTLTF989CALILTGGGNEFTF1426CALILTYEGNKLTF1863CALTLTGGGNNLTF553CALICTGYGNKLTF990CALILTGGGNEHTF1427CALILTYGANKLTF1864CALTLTGGGNSLTF554CALICTIGGNKLTF991CALILTGGGNEITF1428CALILTYGGLKLTF1865CALTLTGGGQKLTF555CALICTKGGNKLTF992CALILTGGGNEMTF1429CALILTYGGNCLTF1866CALTLTGGGSKLTF556CALICTMGGNKLTF993CALILTGGGNEVTF1430CALILTYGGNFLTF1867CALTLTGGGVKLTF557CALICTNGGNKLTF994CALILTGGGNEYTF1431CALILTYGGNKATF1868CALTLTGGPNKLTF558CALICTRGGNKLTF995CALILTGGGNFMTF1432CALILTYGGNKGTF1869CALTLTGGQNKLTF559CALICTTGGNKLTF996CALILTGGGNFNTF1433CALILTYGGNKMTF1870CALTLTGNGNKLTF560CALICTVGGNKLTF997CALILTGGGNGVTF1434CALILTYGGNKNTF1871CALTLTIGGNKLTF561CALICTYGGNKLTF998CALILTGGGNHFTF1435CALILTYGGNNLTF1872CALTLTLGGNKLTF562CALIDGGGGNKLTF999CALILTGGGNHITF1436CALILTYGGNQLTF1873CALTLTMGGNKLTF563CALIDIGGGNKLTF1000CALILTGGGNIATF1437CALILTYGGNSLTF1874CALTLTNGGNKLTF564CALIDSGGGNKLTF1001CALILTGGGNIITF1438CALILTYGGQKLTF1875CALTLTQGGNKLTF565CALIDTEGGNKLTF1002CALILTGGGNIPTF1439CALILTYGGSKLTF1876CALTLTRGGNKLTF566CALIDTGGANKLTF1003CALILTGGGNIQTF1440CALILTYGSNKLTF1877CALTLTSGGNKLTF567CALIDTGGGNALTF1004CALILTGGGNIRTF1441CALILTYGWNKLTF1878CALTLTTGGNKLTF568CALIDTGGGNKGTF1005CALILTGGGNIVTF1442CALILTYHGNKLTF1879CALTLTYGGNKLTF569CALIDTGGGNKHTF1006CALILTGGGNMFTF1443CALILTYNGNKLTF1880CALTMTGGGNKLTF570CALIDTGGGNKMTF1007CALILTGGGNMMTF1444CALILTYSGNKLTF1881CALTNTGGGNKLTF571CALIDTGGGNQLTF1008CALILTGGGNMTTF1445CALILTYWGNKLTF1882CALTRTGGGNKLTF572CALIDTKGGNKLTF1009CALILTGGGNMWTF1446CALILVEGGNKLTF1883CALTSTGGGNKLTF573CALIDTLGGNKLTF1010CALILTGGGNMYTF1447CALILVGGGAKLTF1884CALTVTGGGNKLTF574CALIDTMGGNKLTF1011CALILTGGGNNATF1448CALILVGGGGKLTF1885CALVCTGGGNKLTF575CALIDTNGGNKLTF1012CALILTGGGNNCTF1449CALILVGGGNALTF1886CALVDTGGGNKLTF576CALIDTSGGNKLTF1013CALILTGGGNNGTF1450CALILVGGGNILTF1887CALVGTGGGNKLTF577CALIDTWGGNKLTF1014CALILTGGGNNITF1451CALILVGGGNKATF1888CALVLAGGGNKLTF578CALIDTYGGNKLTF1015CALILTGGGNNMTF1452CALILVGGGNKNTF1889CALVLDGGGNKLTF579CALIEGGGGNKLTF1016CALILTGGGNNNTF1453CALILVGGGNKPTF1890CALVLIGGGNKLTF580CALIEMGGGNKLTF1017CALILTGGGNNVTF1454CALILVGGGNKVTF1891CALVLLGGGNKLTF581CALIEPGGGNKLTF1018CALILTGGGNPATF1455CALILVGGGNMLTF1892CALVLSGGGNKLTF582CALIEVGGGNKLTF1019CALILTGGGNPFTF1456CALILVGGGNPLTF1893CALVLTGGGIKLTF583CALIFPGGGNKLTF1020CALILTGGGNPITF1457CALILVGGGNQLTF1894CALVLTGGGNHLTF584CALIFTDGGNKLTF1021CALILTGGGNPQTF1458CALILVGGGNSLTF1895CALVLTGGGNILTF585CALIFTEGGNKLTF1022CALILTGGGNPVTF1459CALILVGGGRKLTF1896CALVLTGGGNKGTF586CALIFTFGGNKLTF1023CALILTGGGNPYTF1460CALILVGGMNKLTF1897CALVLTGGGNKKTF587CALIFTGGGNALTF1024CALILTGGGNQETF1461CALILVGPGNKLTF1898CALVLTGGGNKYTF588CALIFTGGGNKFTF1025CALILTGGGNQFTF1462CALILVPGGNKLTF1899CALVLTGGGNLLTF589CALIFTGGGNKITF1026CALILTGGGNQMTF1463CALILVQGGNKLTF1900CALVLTGGGNQLTF590CALIFTGGGNKMTF1027CALILTGGGNQNTF1464CALILVRGGNKLTF1901CALVLTGGGNSLTF591CALIFTGGGNKPTF1028CALILTGGGNQPTF1465CALILVSGGNKLTF1902CALVLTGGGNWLTF592CALIFTGGGNKVTF1029CALILTGGGNQYTF1466CALILWGGGNKHTF1903CALVLTGGGNYLTF593CALIFTGGGNKWTF1030CALILTGGGNRMTF1467CALILYDGGNKLTF1904CALVLTGGGTKLTF594CALIFTGGVNKLTF1031CALILTGGGNRPTF1468CALILYGGGEKLTF1905CALVLTGGLNKLTF595CALIFTHGGNKLTF1032CALILTGGGNRQTF1469CALILYGGGNKCTF1906CALVLTGGQNKLTF596CALIFTIGGNKLTF1033CALILTGGGNRVTF1470CALILYGGGNKQTF1907CALVLTGGRNKLTF597CALIFTLGGNKLTF1034CALILTGGGNRYTF1471CALILYKGGNKLTF1908CALVLTGGSNKLTF598CALIFTMGGNKLTF1035CALILTGGGNSMTF1472CALILYNGGNKLTF1909CALVLTGNGNKLTF599CALIFTRGGNKLTF1036CALILTGGGNSQTF1473CALILYQGGNKLTF1910CALVLTGPGNKLTF600CALIFTSGGNKLTF1037CALILTGGGNSVTF1474CALILYYGGNKLTF1911CALVLTGQGNKLTF601CALIFTTGGNKLTF1038CALILTGGGNTFTF1475CALIMTGGGCKLTF1912CALVLTGTGNKLTF602CALIGEGGGNKLTF1039CALILTGGGNTMTF1476CALIMTGGGNHLTF1913CALVLTGVGNKLTF603CALIGGGGGNKLTF1040CALILTGGGNTQTF1477CALIMTGGGNKPTF1914CALVLTHGGNKLTF604CALIGTAGGNKLTF1041CALILTGGGNVATF1478CALIMTGGGNLLTF1915CALVLTKGGNKLTF605CALIGTDGGNKLTF1042CALILTGGGNVCTF1479CALIMTGGGNMLTF1916CALVLTLGGNKLTF606CALIGTEGGNKLTF1043CALILTGGGNVDTF1480CALIMTGGGNQLTF1917CALVLTPGGNKLTF607CALIGTFGGNKLTF1044CALILTGGGNVITF1481CALIMTGGGNRLTF1918CALVLTVGGNKLTF608CALIGTGGGCKLT...

Claims

CLAIMS1. A T-cell receptor (TCR), which is isolated and / or expressed in an engineered cell, specifically recognizing a G12V mutated human rat sarcoma (RAS) peptide, wherein the peptide is a mutated human Kirsten RAS (KRAS) peptide, a mutated human Harvey RAS (HRAS) peptide, or a human neuroblastoma RAS (NRAS) peptide, wherein the peptide consists of VWGAVGVGK (SEQ ID NO: 1) and / or VVGAVGVGK (SEQ ID NO:2) presented in a HLA-A*11 complex, and wherein the TCR comprises a paired TCR alpha- and TCR beta-chain, wherein the TCR alpha chain variable domain comprises SC1alpha-CDR1alpha-SC2alpha-CDR2alpha-SC3alpha-CDR3alpha-SC4alpha-SC5alpha, and the TCR beta chain variable domain comprises SC1beta-CDR1beta-SC2 beta-CDR2 beta-SC3beta-CDR3beta-SC4beta-SC5beta, wherein SC is a scaffold region and CDR is a complementarity determining region.

2. The TCR according to claim 1, wherein the TCR, when expressed in an engineered cell, is capable of specifically recognising SEQ ID NO: 1 and SEQ ID NO: 2 when presented in a HLA-A*11 complex.

3. The TCR according to claim 1 or 2, wherein the TCR, when expressed in an engineered cell, has a higher sensitivity toward SEQ ID NO: 1 and SEQ ID NO: 2 when presented in a HLA-A*11 complex than does a known TCR.

4. The TCR according to claim 3, wherein the sensitivity is at least 1.05 fold higher than that of a known TCR.

5. The TCR according to claim 1 to 4, wherein the TCR, when expressed in an engineered cell, does not cause specific cytotoxic activity towards cells not expressing a G12V mutated RAS peptide6. TCR according to any of claims 1 to 5, wherein the TCR, when expressed in an engineered cell, does not cause specific cytotoxic activity towards cells expressing the wild type human RAS peptide, such as VWGAGGVGK (SEQ ID NO: 3) and / or VVGAGGVGK (SEQ ID NO: 4).

7. The TCR according to any of the preceding claims, wherein the TCR, when expressed in an engineered cell, does not specifically recognize the G12V mutated human RAS peptide, wherein the peptide consists of VWGAVGVGK (SEQ ID NO: 1) and / or VVGAVGVGK (SEQ ID NO: 2) presented in an allelic variant of the human leukocyte antigen (HLA) molecule other than an allelic variant of the human leukocyte antigen (HLA) molecule selected from the group consisting of HLA-A*11, HLA-A*30:01, HLA-A*68:02, HLA-B*54:01, HLA-B*35:01, HLA-B*35:02, HLA-B*35:03, HLA-B*35:05, HLA-B*35:12, HLA-B*52:01, HLA-B*53:01, HLA-B*57:01 and HLA-B*58:01 serotype.

8. The TCR according to any of the preceding claims wherein the TCR, when expressed5 in an engineered cell, does not specifically recognise other allelic variants of the human leukocyte antigen (HLA) molecule other than an allelic variant of the human leukocyte antigen (HLA) molecule selected from the group consisting of HLA-A*68:02, HLA-B*54:01, HLA-B*35:01, HLA-B*35:02, HLA-B*35:03, HLA-B*35:12, HLA-B*57:01 and HLA-B*58:01 serotype.

109. The TCR according to any of the preceding claims, wherein the TCR, when expressed in an engineered cell, does not specifically recognize the G12V mutated human RAS peptide, wherein the peptide consists of VWGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO: 2) presented in an allelic variant of the human leukocyte15 antigen (HLA) molecule other than the HLA-A*11 serotype.

10. The TCR according to any of the preceding claims, which does not specifically recognize a G12V mutated human RAS peptide, wherein the peptide consists of VWGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO: 2) presented in a20 HLA-A*11:03 complex.

11. The TCR according to any of the preceding claims, which does not specifically recognize a G12V mutated human RAS peptide, wherein the peptide consists of VWGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO: 2) presented in a 25 HLA-A*11:03 and HLA-A*11:04 complex.

12. The TCR according to any of the preceding claims, wherein the TCR, when expressed in an engineered cell, has at the most 4% cross-reactivity towards any somatically expressed HLA-presented peptide other than a G12V mutated human rat sarcoma30 (RAS) peptide, which consists of WVGAVGVGK (SEQ ID NO: 1) and / or WGAVGVGK (SEQ ID NO: 2) and which is presented in a HLA-A*11 complex in a cross-reactivity assay.

13. The TCR according to any of the preceding claims comprising:35 a. a TCR alpha chain CDR3 sequence with at least 75% identity to a TCR alphachain CDR3 sequence selected from the group consisting of SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 98, SEQ ID NO: 141 and SEQ ID NO: 143andb. a TCR beta chain CDR3 sequence with at least 75% identity to a TCR beta chain CDR3 sequence selected from the group consisting of SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 99, SEQ ID NO: 142, and SEQ ID NO: 144.5 14. The TCR according to any of the preceding claims comprising:a) a TCR alpha chain CDR3 sequence with a TCR alpha chain CDR3 sequence selected from the group consisting of SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 98 , SEQ ID NO: 141 and SEQ ID NO: 14310andb) a TCR beta chain CDR3 sequence with a TCR beta chain CDR3 sequence selected from the group consisting of SEQ ID SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 99, SEQ ID NO: 142 and SEQ ID NO: 144.1515. The TCR according to any one of the preceding claims, wherein the TCR comprises a paired TCR alpha- and TCR beta-chain comprising a complete assembly ofcombinations of the following sequences:SEQSEQSEQSEQSEQSEQSEQID NOID NOID NOID NOID NOID NOID NOSCIalpha1820281261281820CDRIalpha6062701351376062SC2alpha3234421291313234CDR2alpha7476841381407476SC3alpha4648561321344648CDR3alpha8890981411438890SC4alpha791512312579SC5alpha104104104104104104104SCIbeta192129127301921CDRIbeta616371136726163SC2beta333543130443335CDR2beta757785139867577SC3beta474957133584749CDR3beta8991991421448991SC4beta8101612412810SC5beta1051051061061065162516220or sequences having at least 90% such as at least 95%, at least 97% or at least 99%, or 100% identity to said respective sequences.5 16. The TCR according to any of the preceding claims, wherein the TCR comprises apaired TCR alpha- and TCR beta-chain comprising the following combination ofsequences:TCR#SC1CDR1SC2CDR2SC3CDR3SC4SC5TCR-1SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQalphaNO: 18NO: 60NO: 32IDIDIDIDIDNO:NO:NO:NO:NO:7446887104TCR-2SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQalphaNO: 20NO: 62NO: 34IDIDIDIDIDNO:NO:NO:NO:NO:7648909104TCR-6SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQalphaNO: 28NO: 70NO: 42IDIDIDIDIDNO:NO:NO:NO:NO:84569815104TCR-9SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQalphaNO: 126NO: 135NO:IDIDIDIDID129NO:NO:NO:NO:NO:138132141123104TCR-SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQ10NO: 128NO: 137NO:IDIDIDIDIDalpha131NO:NO:NO:NO:NO:140134143125104TCR-1SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQbetaNO: 19NO: 61NO: 33IDIDIDIDIDNO:NO:NO:NO:NO:7547898105TCR-1SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQbetaNO: 19NO: 61NO: 33IDIDIDIDIDNO:NO:NO:NO:NO:75478985162TCR-2SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQbetaNO: 21NO: 63NO: 35IDIDIDIDIDNO:NO:NO:NO:NO:77499110105TCR-2SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQbetaNO: 21NO: 63NO: 35IDIDIDIDIDNO:NO:NO:NO:NO:774991105162TCR-6SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQbetaNO: 29NO: 71NO: 43IDIDIDIDIDNO:NO:NO:NO:NO:85579916106TCR-9SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEbetaNO: 127NO: 136NO:IDIDIDIDID130NO:NO:NO:NO:NO:139133142124106TCR-SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQ10NO: 30NO: 72NO: 44IDIDIDIDIDbetaNO:NO:NO:NO:NO:86 58 144 12 106or sequences having at least 90% such as at least 95%, at least 97% or at least 99%, or 100% identity to said respective sequences.5 17. The TCR according to any of the preceding claims, wherein the alpha and beta chainCDRs have the following sequences:CDRIalphaCDR2CDR3CDR1CDR2CDR3alphaalphabetabetabetaSEQ ID NO:SEQ IDSEQ IDSEQ IDSEQ IDSEQ ID60NO: 74NO: 88NO: 61NO: 75NO: 89SEQ ID NO:SEQ IDSEQ IDSEQ IDSEQ IDSEQ ID62NO: 76NO: 90NO: 63NO: 77NO: 91SEQ ID NO:SEQ IDSEQ IDSEQ IDSEQ IDSEQ ID70NO: 84NO: 98NO: 71NO: 85NO: 99SEQ ID NO:SEQ IDSEQ IDSEQ IDSEQ IDSEQ ID135NO: 138NO: 141NO: 136NO: 139NO: 142SEQ ID NO:SEQ IDSEQ IDSEQ IDSEQ IDSEQ ID137NO: 140NO: 143NO: 72NO: 86NO: 14418. The TCR according to any of the preceding claims, wherein the alpha and beta chain CDR3s have the following sequences:CDR3 alphaCDR3 betaSEQ ID NO: 88SEQ ID NO: 89SEQ ID NO: 90SEQ ID NO: 91SEQ ID NO: 98SEQ ID NO: 99SEQ ID NO: 141SEQ ID NO: 142SEQ ID NO: 143SEQ ID NO: 14419. The TCR according to any of the preceding claims wherein the TCR comprises a5 paired TCR alpha- and TCR beta-chain wherein the alpha chain comprises as CDR3 SEQ ID NO: 88 and the beta chain comprises as CDR3 SEQ ID NO: 89.

20. The TCR according to claim 19 wherein the alpha chain further comprises as CDR1 SEQ ID NO: 60 and as CDR2 SEQ ID NO: 74, and wheren the beta chain further10 comprises as CDR1 SEQ ID NO: 61 and as CDR2 SEQ ID NO: 75.

21. The TCR according to claim 20 wherein the TCR alpha- and beta chain comprises the following combination of sequences:TCR#SC1CDR1SC2CDR2SC3CDR3SC4SC5TCR-1SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQalphaNO: 18NO: 60NO: 32IDIDIDIDIDNO:NO:NO:NO:NO:7446887104TCR-1SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQbetaNO: 19NO: 61NO: 33IDIDIDIDIDNO:NO:NO:NO:NO:754789810522. The TCR according to claim 20 wherein the TCR alpha- and beta chain comprises the15 following combination of sequences:TCR#SC1CDR1SC2CDR2SC3CDR3SC4SC5TCR-1SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQalphaNO: 18NO: 60NO: 32IDIDIDIDIDNO:NO:NO:NO:NO:7446887104TCR-1 SEQ IDSEQ IDSEQ IDSEQSEQSEQSEQSEQbeta NO: 19NO: 61NO: 33IDIDIDIDIDNO:NO:NO:NO:NO:7547898516223. An engineered cell expressing a TCR as defined in any one of claims 1-22, wherein the engineered cell is selected from the group consisting of an immune cell derived from, a peripheral blood mononuclear cell (PBMC), a cord blood cell, a hematopoietic progenitor cell, an induced pluripotent stem cell, and a primary immune cell collected from any bodily tissue.

24. A nucleic acid encoding a TCR comprising a paired TCR alpha- and TCR beta-chain as defined in any one of claims 1-122.

25. A vector comprising a nucleic acid encoding a TCR comprising a paired TCR alpha-and TCR beta-chain as defined in any one of the claims 1-22.

26. A vector according to claim 25, wherein the vector is a vector selected from the group consisting of an expression vector, a coding vector, non-viral or a viral vector, wherein said vector has the ability to carry said nucleic acid sequence into a suitable host cell where synthesis of the encoded polypeptide takes place.

27. A pharmaceutical composition comprising a soluble protein consisting of all or a functional part of one or more TCR(s) as defined in any of claims 1-22, or one or more engineered cell(s) according to claim 23 or one or more vector(s) according to claims 25 or 26.

28. The TCR according to any of claims 1-18, an engineered cell according to claim 19, a vector according to claims 21 or 22 or a pharmaceutical composition according to claim 18 for use in the treatment of a cancer in a patient carrying HLA-A*11, comprising administering to said patient said TCR, engineered cell, vector and / or a pharmaceutical composition comprising said TCR, wherein said cancer is a solid or haematological malignancy expressing the peptide of SEQ ID NO: 1 and / or SEQ ID NO: 2, and wherein said TCR, engineered cell, vector and / or a pharmaceutical composition comprising said TCR is infused systemically into said patient or injectedor pumped directly into a solid tumour, into a blood vessel that feeds a tumour or into the volume surrounding a solid tumour in said patient.

Citation Information

Patent Citations

  • MIS cross-connector

    WO2017083316A1

  • An engineered multi-component system for identification and characterisation of t-cell receptors and t-cell antigens

    WO2018083316A1

  • An engineered multi-component system for identification and characterisation of t-cell receptors, t-cell antigens and their functional interaction

    WO2018083317A1

  • A two-component vector library system for rapid assembly and diversification of full-length t-cell receptor open reading frames

    WO2019016175A1